干细胞之家www.stemcell8.cn ←点击进入 干细胞之家www.stemcell8.cn ←点击进入
The Facts On File DICTIONARY of BIOTECHNOLOGY and GENETIC ENGINEERING Third Edition 干细胞之家www.stemcell8.cn ←点击进入 干细胞之家www.stemcell8.cn ←点击进入
The Facts On File DICTIONARY of BIOTECHNOLOGY and GENETIC ENGINEERING
Third Edition
Mark L. Steinberg, Ph.D. Sharon D. Cosloy, Ph.D. 干细胞之家www.stemcell8.cn ←点击进入
The Facts On File Dictionary of Biotechnology and Genetic Engineering Third Edition
Copyright © 2006, 2001, 1994 by Mark L. Steinberg, Ph.D., and Sharon Cosloy, Ph.D.
Illustrations © 2006 by Infobase Publishing
All rights reserved. No part of this book may be reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage or retrieval systems, without permission in writing from the publisher. For information contact:
Facts On File, Inc. An imprint of Infobase Publishing 132 West 31st Street New York NY 10001
Library of Congress Cataloging-in-Publication Data
Steinberg, Mark (Mark L.) The Facts on File dictionary of biotechnology and genetic engineering/ Mark L. Steinberg and Sharon D. Cosloy—Third ed. p. cm. — (The Facts On File science library) Includes index. ISBN 0-8160-6351-6 (alk.paper) 1. Biotechnology—Dictionaries. 2. Genetic engineering—Dictionaries. I. Cosloy, Sharon D. II. Title. III. Series.
TP248.16.S84 2000 660.6′03—dc21 00-035463
Facts On File books are available at special discounts when purchased in bulk quanti- ties for businesses, associations, institutions, or sales promotions. Please call our Spe- cial Sales Department in New York at (212) 967-8800 or (800) 322-8755.
You can fi nd Facts On File on the World Wide Web at http://www.factsonfi le.com
Text and cover design by Cathy Rincon
Printed in the United States of America
MP FOF 10 9 8 7 6 5 4 3 2
This book is printed on acid-free paper. 干细胞之家www.stemcell8.cn ←点击进入
This edition is dedicated to the memory of Dr. Sharon Cosloy by her children, Michael and Rebecca, and her husband, Edward. Sharon was a loving mother, a devoted wife, a dedicated mentor, and an accomplished professor and researcher.
And above all, she was a kind and gentle woman with a bright spirit that still lives on today through the people who were fortunate enough to be touched in life by her.
From MLS: To Sharon, in memoriam, a good friend and valued colleague. You are greatly missed. 干细胞之家www.stemcell8.cn ←点击进入 干细胞之家www.stemcell8.cn ←点击进入
CONTENTS
Preface ix
Acknowledgments xi
Entries A to Z 1
Appendixes 261 Acronyms (and Other Abbreviations) 262 The Chemical Elements 267 Periodic Table 268 The Genetic Code 269 Purine and Pyrimidine Bases Found 270 in Nucleic Acids Side Chains (R Groups) for 271 Individual Amino Acids Bioinformatics Web Sites 272 Enzymes Used in Gene Cloning 274 干细胞之家www.stemcell8.cn ←点击进入
PREFACE
The last decades of the 20th century produced a dramatic revolution in the fi eld of biology in which, for the fi rst time, the ability to modify the genetic makeup of higher organisms in the laboratory rather than by the random forces of natural selection was realized. This new era was born out of criti- cal discoveries in the mid-1970s that led to the appearance of new fi elds of molecular genetics variously known as gene cloning, genetic engineering, and biotechnology. The central theme of genetic engineering is the introduction of genetic material altered in a laboratory into an organism different from that from which it was originally derived. The introduction of genes from higher organisms into microorganisms made it possible to isolate, amplify, study and ultimately engineer individual genes for a variety of specialized purposes. These techniques have also allowed scientists to look closely at the structure, function, and regulation of genes and their proteins.
Genetic engineering has given rise to technologies that were unthinkable barely two decades ago: recombinant antibodies to fi ght cancer, the isolation of genes responsible for genetic diseases, the synthesis of unlimited quantities of therapeutic agents, human hormones and critical blood factors in bacterial “factories,” the creation of genetically engineered plants and animals, and the decoding of the human genome—only a few examples of technologies that have been realized even at the time of the fi rst printing of this dictionary. Much of the research in biotechnology and genetic engineering has moved from the academic world into the industrial setting. As a consequence, many new and potential applications are in the hands of private enterprises where, fueled by more substantial funding and motivated by the forces of the market- place, the development of new products has reached an explosive pace. This has also meant that even as the rapidly increasing pace of progress taxes the ability to keep up with new developments, there is an ever-increasing need to understand the legal and ethical issues that inevitably accompany any new technology. However, in contrast to other new technologies, the products of genetic engineering deal directly with fundamental biological processes and are, by their very nature, certain to have an immediate and profound impact on all areas of human health.
The purpose of this dictionary is to provide readers with access to the basic vocabulary of modern biotechnology and genetic engineering so that those with even an elementary knowledge of basic biology and biochemistry will be able to follow the fl ood of fast-breaking developments in biotechnology and genetic engineering that constantly appears in the media.
At the time of the fi rst printing of The Facts On File Dictionary of Biotech- nology and Genetic Engineering, molecular cloning of genes had only recently matured. Even then, rapidly accumulating data from large-scale sequence analyses and the development of new techniques for amplifi cation of DNA at the microscale level were already yielding information that allowed for the 干细胞之家www.stemcell8.cn ←点击进入
Preface
determination of gene function, including the molecular nature of defects underlying numerous genetic diseases. A revised edition of the dictionary added terminology of the developing biomedical fi elds of molecular medicine, DNA technology, gene therapy, and genomics. In recent years, new areas of research have elucidated signaling pathways that are now known to regulate essential biochemical pathways, including cell growth, metabolism, and dif- ferentiation. Many modern pharmaceuticals are agents that target critical signaling pathways involved in disease processes. Among these are drugs for the treatment of high blood pressure, allergies, sexual dysfunction, anti- infl ammatory and anti-viral agents, various cancer chemotherapies, and many others. In a parallel track, the completion of the Human Genome Project in 2003, together with the computer technologies for data mining and relational analyses, created the new area of computational biology known as bioinfor- matics. The application of bioinformatic methods to burgeoning nucleotide and protein databases has yielded new insights into many genetic diseases and has helped elucidate the relationships between genes and the biochemical pathways that the gene products regulate. Bioinformatics is currently provid- ing new approaches to drug design based on predictive computer models to tailor drugs to act on specifi c molecular targets. The dictionary was updated to account for these as well as other new developments in this rapidly chang- ing fi eld.
The new “third edition” of the dictionary focuses on the new terminology in the evolving areas of genomics, bioinformatics, cell signaling, and molecular medicine. In addition, there are a number of biochemical terms pertaining to recent advances in medicines for the treatment of viral diseases, mental ill- ness, cholesterol metabolism, plant engineering, and stem cell research.
Since this book addresses an audience from diverse backgrounds and covers a broad fi eld, we attempted to include both basic as well as more technical ter- minology in a number of areas including plant and animal biology in order to meet the needs of as many readers as possible. There has also been an attempt to make the dictionary self-contained in the sense that, in cases where techni- cal terms appear in defi nitions, these terms will be defi ned elsewhere in the book. It is anticipated that the dictionary will be of benefi t to a wide-ranging audience, including high school and college students, lawyers, physicians, sci- entists, or others with a particular need to keep abreast of the rapidly develop- ing areas of biotechnology and genetic engineering.
x 干细胞之家www.stemcell8.cn ←点击进入
ACKNOWLEDGMENTS
The authors gratefully acknowledge the support of the RCMI research facilities, where they carry out their research at the City College of New York.
The authors also thank Mr. Frank K. Darmstadt, executive editor, and the production department for their support and insight in the creation of this new edition of the dictionary. 干细胞之家www.stemcell8.cn ←点击进入 干细胞之家www.stemcell8.cn ←点击进入
A
ABC transporter The largest class of as universal donors. In addition, the ABO transmembrane proteins. ABC trans- system can be used in paternity suits to porter is an acronym for ATP (adenosine rule out the possibility that a particular triphosphate) binding cassette, a region male is the father of the child in question. of the protein that is conserved in the transporter in a wide variety of differ- abscisic acid A plant hormone, lipid ent organisms and is responsible for the in nature, synthesized in wilting leaves. binding of ATP. In bacteria these pro- It counteracts the effects of most other teins use energy from ATP to transport a plant hormones by inhibiting cell growth wide variety of small molecules including and division, seed germination, and bud- sugars, vitamins, amino acids and ions ding. It induces dormancy. across the cell membrane. In eukaryotes, ABC transporters generally move mol- absorbance Often referred to as opti- ecules either outside the cell or into an cal density. Absorbance is a unit of organelle such as the endoplasmic retic- measure of the amount of light that is ulum or mitochondrion. Alterations in absorbed by a solution or by a suspen- the ABC transporter genes, particularly sion of bacterial cells. The absorbance is duplications, are the basis of resistance a logarithimic function of the percent of to chemotherapeutic drugs that many transmission of a particular wavelength tumors develop. Inhibitors of the ABC of light through a liquid and is measured transporters involved in drug resistance is by a spectrophotometer or a colorim- being developed as a strategy to deal with eter. Absorbance values are used to plot drug resistance in cancer. growth of suspensions of bacteria and to determine the concentration and purity ABO blood group A system of anti- of molecules such as nucleic acids or pro- gens expressed at the surface of human teins in solutions. red blood cells. Human blood types rep- resented in this group are A, B, AB, or absorption 1. virology The entry of a O, depending on which antigen(s), in virus or viral genome into a host cell after the form of oligosaccharides, are present the virus has absorbed to the cell surface. at the surface of the erythrocyte mem- (See adsorption.) branes. The blood serum of Type A indi- 2. photometry When light is neither viduals contains anti-B antibodies, those refl ected nor transmitted, it is said to be with Type B produce anti-A antibodies, absorbed. Some biological systems can and those with Type AB produce both. make use of light energy because they Type O individuals produce neither. have pigments that absorb light at spe- This system is one of 14 different blood cifi c wavelengths. These pigments are group systems consisting of 100 differ- able to harness light energy to drive bio- ent antigens. This system is of medical chemical reactions in vivo. An example importance because the recipient of a can be found in plant pigments, such as blood transfusion must receive blood that chlorophyll, that are used to trap light is compatible with his or her own type. energy and drive the process of photo- Type AB individuals are known as uni- synthesis where plants manufacture versal acceptors, and Type O individuals nutrients.
1 干细胞之家www.stemcell8.cn ←点击进入
absorption spectroscopy
absorption spectroscopy The use of one time, the production of these com- a spectrophotometer to determine the mercially important chemicals relied on ability of solutes to absorb light through bacterial fermentation, but this has since a range of specifi ed wavelengths. Every been replaced by chemical synthesis. compound has a unique absorption spec- trum. An absorption spectrum, which is acetylcholine A chemical neurotrans- defi ned as a plot of the light absorbed ver- mitter that is expelled into the synaptic sus the wavelength, can be derived from a cleft, or space between two nerve cells. solution (see absorbance). Absorption This neurotransmitter permits the trans- spectra are used to identify compounds, mission of an electrical nerve impulse or determine concentrations, and plot reac- action potential from one nerve cell to tion rates. another by diffusing across the cleft and then binding to a cell-membrane receptor. abzymes Catalytic antibodies that cleave proteins or carbohydrates at specifi c acetylcholinesterase An enzyme pres- residues. They are analogous to restric- ent in the synaptic cleft, or space between tion enzymes that cleave DNA at specifi c two nerve cells, that hydrolyzes or sequences. Catalytic antibodies have the destroys the unbound neurotransmitter potential to be used as therapeutic agents, acetylcholine once it has diffused through attacking specifi c viral or bacterial surface the cleft. This is required to restore the structures, and as catalysts in reactions in synaptic cleft to a state that is ready to which no enzyme has been found. receive the next nerve impulse. See ace- tylcholine. acentric fragment A fragment of a chromosome that does not contain a cen- acid blobs Certain sequences of amino tromere. Because of the absence of a centro- acids on a protein that bind to a tran- mere, acentric fragments do not segregate scriptional regulatory protein and, in so at mitosis and eventually disappear. doing, serve to activate transcription.
Acetobacter A genus of Gram- acid growth hypothesis The hypoth- negative fl agella-endowed bacteria that esis that elongation of plant cells caused are acid-tolerant aerobic rods. They are by the plant hormones known as auxins also known as the acetic-acid bacteria involves a mechanism for creating an acid due to their ability to oxidize ethanol to environment (lowered pH) in the spe- acetic acid. They are found on fruits and cifi c region of the cell where growth is to vegetables and can be isolated from alco- occur. The acidifi cation of a plant cell in holic beverages. They are used commer- a localized region helps account for cer- cially in the production of vinegar, but tain tropic behaviors seen in plants, for because of their ability to produce acetic example, phototropism. acid, they are nuisance organisms in the brewing industry. acidic activation domain In certain types of eukaryotic transcription fac- Acetobacter aceti An organism used tors (for example, the GAL4 transcrip- in the commercial production of vinegar. tion factor in yeast or the herpes simplex When introduced into wine or cider con- virus VP16 protein), a region containing taining 10 percent–12 percent alcohol, it a number of contiguous acidic amino acid will convert to acetic acid. See Aceto- residues that appears to be required for bacter. the recruitment of other additional fac- tors needed to regulate the transcription acetone-butanol fermentation The process for different genes. anaerobic fermentation of glucose by Clostridium acetobutylicum to form acidic amino acids The two amino acetone and butanol as end products. At acids that are negatively charged at pH
2 干细胞之家www.stemcell8.cn ←点击进入
actin
7.0 are aspartic and glutamic acids. Also transmitted through casual contact with referred to as aspartate or glutamate. infected individuals. Both of these amino acids contain in their R or variable groups a second carboxyl acridine orange One of a group of group that is ionized under physiological chemical mutagens known as acridines, conditions. including profl avin and acrifl avine. The size of the acridines is the same as that acidophile A classifi cation of microor- of a purine-pyrimidine base pair. For ganisms that describes the ability or the this reason, they can insert or intercalate necessity of certain species to exist in an into the helix between two adjacent base acidic environment. These acid-loving pairs. When DNA that contains an inter- organisms can exist at a pH range of 0– calated acridine is replicated, an addi- 5.4, well below the optimum of neutral- tional base pair may be added or a base ity for most bacteria. Facultative acido- pair may be deleted, disrupting the codon philes can tolerate a range of pH from reading frame in the newly synthesized low to neutral and include most fungi strand. Such a mutation is called a frame- and yeasts. However, obligate acido- shift mutation. philes including members of the genera Thiobacillus and Sulfolobus require low acrosome (process, reaction, vesicle) pH for growth. A neutral pH is toxic to A vesicle- or membrane-bound compart- these species. ment covering the sperm head that con- tains lytic enzymes. The major enzyme acivicin An antibiotic that acts as an found in the mammalian sperm acro- inhibitor of the enzyme gamma-glutamyl some is hyaluronidase, which promotes transpeptidase (GGT), which is necessary the digestion of the tough outer coat of for the breakdown and transport of glu- the egg and allows penetration of the tathione across the cell membrane. As a sperm. glutamine analog, acivicin is also used as an anticancer drug because of its ability acrylamide A substance that can poly- to block glutamine metabolism. merize and form a slab gel when poured into a mold in its molten state. It is used as acquired immunodefi ciency syndrome semisolid support medium and is immersed (AIDS) An infectious disease in humans in a conductive buffer through which a caused by the human immunodefi ciency current is passed. When solutions con- virus (HIV). The virus attacks the host’s taining heterogeneous mixtures of nucleic immune system leaving him/her suscep- acid fragments or mixtures of proteins are tible to many other diseases, including placed into slots in the gel and subjected certain rare forms of cancer and oppor- to the electrical current, the nucleic acid tunistic microbial infections that would or protein mixtures may be separated into otherwise be destroyed in an uninfected distinct collections of homogeneous mole- individual. Most often, AIDS patients die cules located in different regions of the gel, from these secondary infections that run based on their size or molecular weight. rampant through the body because of the See electrophoresis. loss of ability to immunologically sup- press them. The HIV virus is transmit- ACTH See adrenocorticotropic ted through the exchange of body fl uids hormone. during sexual contact with an infected individual, the sharing of needles among actin One of the two major proteins intravenous drug users, transfusion of responsible for muscle contraction. Actin contaminated blood products (no longer a and myosin are found in smooth and stri- threat due to the ability to screen donated ated muscle. Actin monomers together blood), and from mother to newborn dur- with two other proteins, troponin and ing delivery. It has not been shown to be tropomysin, can polymerize to form long,
3 干细胞之家www.stemcell8.cn ←点击进入
Actinomyces
thin fi laments that, together with myosin activation energy The energy required fi laments, can shorten in the presence of for a chemical reaction to proceed. In bio- ATP (adenosine triphosphate). Actin also logical systems, enzymes lower the activa- plays a role in the shape and structure of tion energy, allowing chemical reactions cells. to occur faster under physiological condi- tions. Actinomyces A genus of anaerobic Gram-positive rods that are often found active site The region of an enzyme in the mouth and throat. They occasion- that contains a special binding site for ally display a branched fi lamentous mor- substrate(s). This site is uniquely shaped phology. Many, such as A. israelii, are for the exclusive binding of the particu- human pathogens. lar substrate molecule(s) and is the site for the catalytic activity of the enzyme. actinomycin D An antibiotic produced The three-dimensional folding of the by Streptomyces parvullus that inhibits enzyme brings distal amino acids in the RNA transcription in both prokaryotes polypeptide into close proximity, thus and eukaryotes. It blocks the action of forming the active site at the surface of RNA Polymerase I, which synthesizes the protein. ribosomal RNA, and forms complexes with DNA by intercatating between G- active transport The transport, by C pairs, preventing the movement of cells or cellular compartments, of ions DNA- and RNA-synthesizing enzymes. and metabolites through cell membranes Although toxic, it is sometimes used in against a concentration gradient. This conjunction with other drugs as a che- type of transport requires cellular energy motherapeutic agent, due to its antitumor in the form of ATP (adenosine triphos- properties phate) hydrolysis. One example found in all animal cells is the active transport of action potential Also called a nerve Na+ out of cells and the active transport impulse; sequential wave of depolariza- of K+ into cells. This system is known as tion and repolarization across the mem- the sodium-potassium pump. The energy brane of a nerve cell (neuron) in response is provided by a specifi c ATPase located to a stimulus. Depolarization is a rever- in the plasma membrane. This active sal in the distribution of charge between transport system is responsible for the the inside and the outside of the neuron generation and maintenance of the elec- membrane. trical potential or voltage gradient across the cell membrane. activated sludge process A secondary sewage-treatment process where biologi- acycloguanosine (acyclovir) An anti- cal processing of the sewage by microbial viral antibiotic used to treat herpes virus activity is the main method of treatment. infections. Acycloguanosine is a deriva- In this step, sewage that has been pre- tive of the normal nucleoside, guano- viously treated in settling tanks is aer- sine, in which the sugar, ribose, has been ated in large tanks to encourage growth replaced by an ether chain. Acycloguano- of micro organisms that oxidize dissolved sine is an inhibitor of viral DNA synthe- organics to carbon dioxide and water. sis. See hsv. Bacteria, yeasts, molds, and protozoans are used. This process proves effective in Acyclovir See acycloguanosine. reducing intestinal pathogens in sewage while encouraging growth of nonpatho- acyl carrier protein (ACP) A small gens. After activated sludge has been pro- protein involved in the synthesis of fatty duced, additional processing is required, acids. First isolated from E. coli bacteria including anaerobic digestion, fi ltering, by Roy Vagelos, it was found to be a 77 and chlorination. amino acid polypeptide chain, capable of
4 干细胞之家www.stemcell8.cn ←点击进入
adenosine triphosphate
binding six other enzymes required for adenosine A nucleoside containing fatty acid synthesis. the pentose sugar ribose and the purine base adenine. When a phosphate group adaptation 1. sensory A progressive is attached to the 5′ carbon in the ribose, decrease in the number of impulses that the nucleoside becomes a nucleotide, a pass over a sensory neuron even when basic building block of nucleic acids. there is continuous or repetitive sensory stimulation to the sense organ involved. adenosine deaminase defi ciency (ADA) Sensory adaptation provides an organ- A genetic condition in which the lack of ism with a way to deal with the constant the enzyme adenosine deaminase results bombardment of the sense organs with in the disease severe combined immuno- useless information in the environment defi ciency (SCID). This rare disease leaves and the ability to screen for the appropri- individuals with no functioning immune ate stimuli to which to respond. system and results in death at a very early 2. evolution A genetic change in a popu- age. This was one of the fi rst diseases to lation of organisms that arises as a result be treated with enzyme replacement ther- of random chance, involving structures apy and then gene replacement therapy. or behaviors that will enable that group and its offspring to be better suited to adenosine diphosphate (ADP) A their environment. product of the hydrolysis or enzymatic cleavage of the terminal phosphate adaptive enzymes Enzymes that are group of adenosine triphosphate (ATP). produced by microbes only when their The other product produced during this substrates are present. When not needed, reaction is inorganic phosphate. ATP is they are not produced. This is in contrast cleaved to provide energy for cells to do to constitutive enzymes, which are always work. produced. adenosine monophosphate (AMP) adaptor molecules A term used to A product of the hydrolysis or enzymatic describe transfer RNA due to its role during cleavage of the terminal two phosphate translation of mRNA. Several properties of group of adenosine triphosphate (ATP). the tRNA molecule enable it to act as an The other product produced during this adaptor molecule. The highly specifi c nature reaction is inorganic pyrophosphate (PPi). of tRNA-amino acid binding, the comple- In this reaction, energy is produced both mentary base pairing of the tRNA anticodon from the release of pyrophosphate from with a specifi c codon in the message, and ATP and from the subsequent cleavage of its ability to carry its designated amino acid the pyrophosphate to form two molecules to the mRNA template in the ribosome are of phosphoric acid. all factors that allow the information in the message to be translated into a polypeptide. adenosine triphosphate (ATP) The single most important energy source adenine One of the four major bases in biological systems; the energy cur- found in nucleic acids. Adenine and gua- rency of the cell. All cells do work that nine are purines; cytosine, thymine, and requires energy. Work can be mechani- uracil are pyrimidines. These nitrogenous cal, biosynthetic, active transport of mol- bases are a component of the basic build- ecules into and out of cells and cellular ing blocks of nucleic acids called nucleo- compartments (see active transport), tides. Within the DNA double helix, ade- and all require the hydrolysis of ATP or nine forms a double hydrogen bond with the breaking of phophate bonds in the thymine. energy-rich ATP molecule. ATP is made up of adenine, which is linked to the 5′- adenoma A benign tumor of glandular carbon sugar ribose. In addition, there tissue. are three phosphate groups linked to the
5 干细胞之家www.stemcell8.cn ←点击进入
adenovirus
ribose in a linear arrangement. The two ADH1 A yeast-transcription termination terminal phosphate groups possess high- signal that is incorporated into yeast expres- energy bonds that, when cleaved, provide sion vectors so that cloned yeast genes energy for the cell. will form properly terminated mRNA to ensure high amounts of protein expressed. adenovirus This is a DNA-containing In many cases, mRNA that is not prop- virus whose outer protein coat is in the erly terminated is unstable, thus resulting shape of an icosahedron. There are more in decreased amounts of protein expressed than 40 different types of adenoviruses, from the cloned insert. some of which are among the many viruses that are responsible for the com- adjuvent A substance that increases the mon cold. potency of an immunogen or enhances the ability of a weak antigen to induce an adenylate cyclase An enzyme that cat- antibody response. alyzes the synthesis of cyclic AMP from ATP. See adenosine monophosphate; A-DNA One of the several forms that adenosine triphosphate; and cyclic a double helix can assume under different AMP. conditions in vivo or in vitro. The molec- ular characteristics of this helix type dif- adherens junctions Junctional com- fer from the more common B form that is plexes that occur at (and anchor) the ter- believed to be predominant under physio- mini of actin (see actin) cytoskeletal (see logical conditions. The A form is stable in cytoskeleton) elements. Adherens junc- a less humid milieu and is both the form tions bear a similarity to desmosomes of a DNA-RNA hybrid helix and the con- (see desmosome) and hemidesmosomes formation assumed by regions of double- (see hemidesmosome) in that adherens stranded RNA. A-DNA is a right-handed junctional complexes on neighboring cells helix; however, it is more compact than directly oppose one another. the B form. Other forms of DNA include C-DNA and Z-DNA. adhering junction A type of cell-cell junction that is a highly specialized region adoptive immunity The transfer of of the cell’s surfaces. It is also called a immunity to allografts to an animal that desmosome. Adherent junctions are com- was previously tolerant of such allografts. monly found in tissues that are subjected This is done by injection of lympho- to mechanical stress such as the skin. cytes from an animal that is immune to They provide very tight contact between allografts into the tolerant animal. adjacent cells and enable groups of cells to function as a unit in tissues. ADP See adenosine diphosphate.
adhesion plaque One of specialized adrenergic Pertaining to the general regions of the plasma membrane that class of neurons that utilizes catechol- are involved in the adherence of cells to amines (adrenaline, dopamine, and nor- solid surfaces. Bundles of actin microfi la- adrenaline) as a neurotransmitter. See ments called stress fi bers attach to the neurotransmitter. plasma membrane in adhesion plaques. The protein vinculin is localized in adhe- adrenergic receptors Membrane recep- sion plaques and serves to anchor these tors for adrenaline (epinephrine). Binding microfi laments in place. When cells are of the adrenergic ligands to their recep- transformed into a cancerous state, the tors upregulates various cellular pro- adhesion plaques become disordered and cesses by activating G-proteins coupled cells lose their ability to adhere properly to the receptor(s), which in turn activates (loss of anchorage dependence), contrib- the enzyme, adenylyl cyclase, which cata- uting to metastasis. lyzes the formation of cAMP. There are
6 干细胞之家www.stemcell8.cn ←点击进入
adult polycystic kidney disease
adrenergic in turn stimulates the adrenal cortex to adrenaline receptor adenylyl secrete glucocorticoids. One way that (epinephrine) cyclase glucocorticoids aid the body in deal- ing with the physical consequences of stress is by promoting a metabolic pro- cess known as gluconeogenesis, which -GDP involves the synthesis of glucose from various noncarbohydrate metabolites in G protein GTP the cell.
GDP adrenoleukodystrophy (X-linked ALD) A group of disorders caused by the inability to break down very long chain saturated fatty acids (VLCFA) that, as a consequence, accumulate in the adre-
-GTP nal cortex and brain, which leads to the breakdown of the myelin sheath of nerve cells. The X-linked form (X-ALD), in which there is an abnormal gene on the X-chromosome, is the most common form. Symptoms include vision loss, sei- zures, diffi culty swallowing, deafness, and dementia.
GTP- adsorption A step in the replication of bacterial viruses where the virus attaches to a specifi c receptor located on the ATP outer surface of the cell. The receptor is
cAMP complementary to the attachment site on the virus. The specifi city of a virus for Adrenergic receptor a particular host or a small number of hosts can be explained by the fact that the virus can only adsorb to species of four types of adrenergic receptors: α1, α2, bacterial cells that make the appropri- β1, and β2. In skeletal muscle and liver, ate receptors. Following adsorption, the adrenergic receptors stimulate glycogen phage genome penetrates the cell where it breakdown (glycogenolysis) to produce is replicated, transcribed, and translated glucose for energy. On smooth muscle and viral components self-assemble into cells, alpha receptors cause muscle con- new viral particles. This is followed by traction while beta receptors on cardiac cell lysis, or the bursting open of the cell, muscle cells act to cause more rapid and the release of the newly synthesized contraction. virions, which can range in number from 50 to 200, depending on the virus. adrenocorticotrophic hormone (ACTH) A hormone, secreted by the anterior lobe adult polycystic kidney disease of the pituitary gland, that controls the (APKD) A genetic kidney disease that production and secretion of adrenal cor- is transmitted in an autosomal dominant tex hormones. It is called a tropic hor- pattern of inheritance. The disease is mone because it regulates the activity of characterized by the formation of large other hormones. It, in turn, is regulated cysts in the kidneys resulting in gradual by a factor that is produced by the hypo- loss of kidney tissue that can lead to renal thalamus. Under conditions of stress, the failure. The disease is caused mainly by anterior pituitary secretes ACTH that mutations in the genes PKD1 (polycys-
7 干细胞之家www.stemcell8.cn ←点击进入
aeration
tin 1; gene map locus 16p13.3-p13.12) afferent Refers to the direction in and PKD2 (polycystin 2; gene map locus which a nerve impulse is moving toward 4q21-q23). Polycystin 1 codes for a pro- the central nervous system. Afferent tein that interacts with polycystin 2, a neurons are those nerve cells that carry protein that is involved in cell cycle regu- impulses from sensory organs, such lation and intracellular calcium transport. as skin and tongue, toward the central About 85 percent of APKD cases show an nervous system (i.e., the brain and the abnormality in polycystin 1, while 5–15 spinal cord). This is opposed to efferent percent of the cases involve polycystin 2. neurons, which carry impulses from the central nervous system to effector organs aeration The process whereby small such as muscle. bubbles of air or oxygen are introduced to liquid cultures of bacteria with agita- affi nity partitioning A modifi cation tion or stirring to ensure that the cells are of the aqueous two-phase separation receiving a continuous and adequate sup- technique of using polymers and salts ply of molecular oxygen. Aeration tech- to purify proteins. Affi nity partitioning niques are applied to growth of microbes employs polymers with ligands attached in industrial fermentors that have large to them, thus making them specifi c for volume capacities, as well as to ordinary the proteins to be isolated. fl asks that are grown on a gyrating plat- form in an incubator or waterbath. affi nity tailing Addition of specifi c residues to the end of a protein so that aerobe A microorganism that requires the protein can be easily identifi ed or iso- free oxygen for growth. During the pro- lated. This is accomplished by cloning the cess of respiration, oxygen is the fi nal gene for a protein into an expression vec- electron acceptor in the electron transport tor having a “tail” sequence at the 3′ end chain in these organisms. There are sev- of the insert, thus allowing a fusion of eral different categories of aerobes. Obli- the cloned gene with the tail sequence. gate aerobes die in the absence of oxygen. A common tail is six histidine residues Microaerophiles thrive in the presence of that bind to a column of a nickel-charged low amounts of oxygen, and facultative resin. Another molecule that is used to anaerobes normally use oxygen but can tail a protein is thioredoxin: This allows switch to an anaerobic metabolism when the protein to be purifi ed on an agarose- oxygen is depleted. Aerobes are more effi - based support with phenylarsine oxide cient at producing energy than organisms (PAO) covalently bound to it or identifi ed that do not use oxygen. with an antithioredoxin antibody.
aerosol A mist or a cloud of water afl atoxin A highly toxic chemical in a droplets suspended in air that can carry class of compounds called mycotoxins, airborne pathogens and provide a vehicle which is produced by molds. Afl atoxin for transmission. Aerosols may be formed is produced by Aspergillus fl avus, which in the environment in numerous ways, grows on grains and has been found to such as coughing, sneezing, splashing of contaminate many foodstuffs, including falling raindrops, and spray from break- beans, cereals, and peanuts. Afl atoxin ing waves. has been shown to be one of the most potent liver carcinogens in existence. aerotolerant Aerotolerant anaerobes are microorganisms that do not use oxy- African sleeping sickness A disease gen during metabolism but, unlike obli- also known as African trypanosomiasis gate anaerobes, can survive in its pres- that affects humans and other mammals in ence (see anaerobe). Members of the central Africa. It is spread by the tsetse fl y, genus Lactobacillus represent examples which is found in this region of the world. of aerotolerant microorganisms. The fl y is host to the parasitic protozoans,
8 干细胞之家www.stemcell8.cn ←点击进入
AIDS
the trypanosomes (T. brucei gambiense molecules in solutions of nucleic acids or and T. brucei rhodesiense), which are the solutions of proteins according to their causative agents. After being bitten by the size. In this way, molecular weights can fl y, the trypanosome enters the victim’s be determined or certain specifi c species bloodstream. Without treatment, the dis- of molecules can be isolated and purifi ed. ease is nearly always fatal because the try- Ranges of sizes of fragments that can be panosome enters the central nervous sys- separated are determined in part by the tem and coma ensues. The trypanosomes percentage of agarose in the gel. The gels have the ability to evade the host’s immune are immersed in a chamber containing a system because they can repeatedly change buffer that can conduct a current across their coat proteins, against which the host the gel. First, the samples are loaded into makes antibodies. This pathogen is the slots in the top of the gel, then a dye is subject of intense study due to its devastat- added, and fi nally the current is turned ing effects on humans and livestock and to on. the unusual characteristics of its molecular biology. agglutination The clumping of cells to one another caused by the binding of agar A complex polysaccharide made by molecules (the agglutinin) to the cell sur- the red marine alga Gelidium. It is used to face so that one or more cells are linked thicken or solidify bacterial culture media to one another by an agglutinin bridge. as well as certain foods. It was fi rst applied See hemagglutination. for the use of culturing microorganisms by the wife of Walter Hesse, a German Agrobacterium A genus of Gram- microbiologist in the late 1800s. The negative aerobic bacteria that live in soil properties of agar make it well suited for and cause crown gall disease in broad- use in the culturing of microorganisms. leafed plants. This disease is seen as the Very few microorganisms can degrade or growth of tumors on the trunks and digest it, so it remains solidifi ed in their sometimes the roots of infected plants. presence. It remains solid at high enough The pathogenicity of the organisms is temperatures (close to 100°C) to be able due to the presence of a bacterial plas- to incubate most microbes. When in mid called the Ti plasmid that can be a molten state, it will solidify when the transferred to the plants cells from the temperature drops below 42°C, but it can bacteria. The plasmid contains genes be kept in a liquid state for long periods that direct the plant cells to make nutri- of time if incubated at 50°C and above. ents that are useful for the bacteria and It can be poured into tubes, fl asks, petri gene products that interfere with normal plates, and any other support and placed plant cell growth and division. Microbial in any position to solidify, such as slanted geneticists and molecular biologists are or straight to shape the surface to either intensely studying A. tumefaciens with maximize or minimize oxygen availablity the hopes of being able to use this organ- and surface area. Most solid media are ism to transfer useful genes into crop 1.5 percent agar. plants. This can be accomplished by using the Ti plasmid as a vehicle to transfer agarose A cross-linked polysaccharide genes such as those involved in nitrogen that is isolated from red algae and used fi xation into crop plants after the plasmid as a support medium in a number of mol- has been genetically engineered to elimi- ecule separation and/or quantifi cation nate its pathogenicity. techniques, including gel electrophoresis (see below), electroimmunodiffusion, and Agrobacterium tumefaciens See immunoelectrophoresis. Agrobacterium.
agarose gel electrophoresis A proce- AIDS See acquired immunodefi - dure that uses agarose gels to separate ciency syndrome.
9 干细胞之家www.stemcell8.cn ←点击进入
Akt
Akt A component of signaling path- coaguable, water-soluble globular protein ways that involve phosphorylated phos- found in egg white, blood plasma (50 per- phatidylinositol (PIPi). These pathways cent of protein content of human plasma), are activated by a variety of growth and and various other animal and vegetable survival factors that bind to cell mem- tissues. Bovine serum albumin is often brane receptors, which then produce used in reaction mixtures and storage PIPi, which, in turn, activates Akt. Once tubes to stabilize enzymes. activated, Akt can either, 1) inhibit apop- tosis or, 2) promote cell survival by acti- alcohol An organic compound that vating the transcription factor, NF-kb. contains one or more hydroxyl groups Akt, which is a serine/threonine kinase, (–OH). Also the common name for etha- is the cellular homologue of the retrovi- nol. Other alcohols include methanol and rus oncogene, v-Akt. propanol.
Alagille syndrome A rare inherited alcohol dehydrogenase An enzyme liver disease in which there is a buildup of that is responsible for the last step in bile in the liver due to a lack or defi ciency alcoholic fermentation by yeast, which of bile ducts. This disease is seen in infants produces the alcohol in alcoholic bever- and young children and is characterized ages. This enzyme converts acetaldehyde by jaundice, stunted growth, and deformi- to ethanol. ties of the face and other internal organs. alcohol fuel An energy source that is alanine One of the 20 amino acids that produced by a process known as biocon- are incorporated into polypeptides. Ala- version, where organic waste material can nine has an aliphatic uncharged R group be converted into fuel by microorganisms. at pH 7.0 that consists of a methyl (CH3) One example is gasohol (90 percent gaso- group as its side chain. Of all the amino line and 10 percent ethanol), which is an acids with aliphatic side groups, it is the alternative fuel for automobiles. Another least hydrophobic. is methane, which is an alternative to fos- sil fuels and natural gas. Methane is a alarmones Unusual dinucleotides con- by-product of the anaerobic treatment of taining multiple phosphate groups that sewage. are produced by bacteria under condi- tions of stress, such as exposure to oxida- aldose A group of monosaccharides tive agents (for example, hydrogen per- that contain an aldehyde group (–CHO). oxide) and which act in a hormonelike fashion to regulate bacterial metabolism aldosterone A hormone secreted by the under such conditions. adrenal cortex. Aldosterone is classifi ed as a mineralocorticoid, and it acts mainly on the kidneys to control the water and electrolyte balance in the body. This enzyme ensures the retention of sodium ions and water by causing their reabsorp- tion into the blood before urine excre- tion. It also causes the excretion of potas- sium ions in the urine.
diadenosine 5′,5′-P1,P4-tetra algae Algae are photosynthetic eukary- An alarmone otic organisms. Some are classifi ed as Pro- tista and others as plants according to their morphology, which is varied. Some exist as albumin The most abundant human single-celled organisms, and some are mul- blood-plasma protein. It is a heat- ticellular. Usually, algae are aquatic, occu-
10 干细胞之家www.stemcell8.cn ←点击进入
allele-specifi c oligonucleotides
pying both marine and freshwater environ- is 9.0; and the soil bacterium Agrobacte- ments. The dinofl agellates and the diatoms rium, whose optimum pH is 12. are free fl oating, and the red and brown algae require a solid substrate to which alkaptonuria The fi rst human genetic they attach. They are further classifi ed by disease identifi ed when it was found to their photosynthetic pigments, thus the follow the laws of Mendelian inheri- names brown, red, green, and blue-green tance. Also known as “dark urine dis- algae. Many are of industrial importance ease,” it was studied by Garrod and, in providing thickeners for foods and bacte- 1902, was recognized to be inherited as rial culture media. See agar. a recessive trait. Later, the biochemical nature of the disease was also uncovered. alignment Placement of sequences of The disease is characterized by a depos- unknown genes or proteins side by side its of dark pigment in connective tissue to analyze the similarities or differences and in the urine after exposure to air. between them. These alignments are Later stages of the disease result in severe done on computers, utilizing databases in forms of arthritis and possibly death due which sequences are stored. to blockages in the arteries and valves of the heart. One in a million people is alkali Any basic (high pH) solution or born with this disease; it results from a compound. Alkaline conditions denature defi ciency in the enzyme homogentisic DNA and have been employed in meth- acid deoxygenase, which results in the ods to isolate plasmid DNA from chro- accumulation of homogentisic acid in the mosomal DNA. Certain alkali treatments urine. have been used in the isolation of bacte- rial proteins. Of course, the success of alkylating agent A type of muta- this method depends upon the alkali sta- gen that adds alkyl groups such as the bility of the protein to be isolated. methyl group (–CH3) and the ethyl group (–CH2CH3) to bases in DNA. alkaline phosphatase An enzyme used One such mutagen is ethylmethane sul- in DNA cloning procedures to remove fonate (EMS), which can alkylate either the terminal phosphates from the single- thymine or guanine residues and cause stranded tail of vector molecules that are them to mispair during DNA replication. cleaved with a restriction enzyme, thus This causes transition type mutations in preventing recircularization of the vec- DNA. tor and enhancing the recovery of vectors with inserts. allele One of several alternative forms of the same gene. A single gene can have alkaloids A class of 3,000 compounds as few as one or as many as 100 different containing nitrogen that are produced by alleles. Alleles are differences in the base plants but that exert potent physiologi- sequence of a single gene among individu- cal effects on animals. They are synthe- als in a population or on the two homol- sized from aromatic amino acid precur- ogous chromosomes in one individual. sors such as tyrosine, tryptophan, and They are the cause of genetic variation or phenylalanine. Some examples are mor- different expressions of a trait in a popu- phine, cocaine, nicotine, codeine, and lation of organisms. colchicine. allele-specifi c oligonucleotides A alkalophiles (alkalinophiles) These probe designed to detect single base- are microorganisms that fl ourish in basic pair changes in a gene. Under very spe- environments (base loving). Alkalino- cifi c conditions, a nucleotide sequence of philes exists at a pH range of about 7–12. about 20 base pairs will hybridize to its They include Vibrio cholerae, the causi- complementary sequence, but not to one tive agent of cholera, whose optimum pH with a one base-pair change.
11 干细胞之家www.stemcell8.cn ←点击进入
allograft immunity
allograft immunity The state of the alpha-actinin A protein that binds immune system in which grafted tissue to the actin fi ber in an adhesion plaque, originating from a genetically dissimilar where it is localized. animal provokes attack by the immune system of the host animal (i.e., graft alpha-amanitin A potent toxin derived rejection). from the Amanita mushroom, also known as death cap or destroying angel. It has allolactose A derivative of lactose and been used to distinquish the three nuclear the true inducer of the lactose operon in RNA polymerases of eucaryotes, Poly- bacteria. Inside the cell, lactose is con- merase I is insensitive to alpha-amanitin, verted to allolactose, which in turn acti- but RNA polymerase II is highly sensi- vates the three structural genes involved tive, and RNA polymerase III is sensitive in the utilization of lactose as a carbon but at higher concentrations of the toxin. source. When lactose is present in the medium, the genes required for its break- alpha-blockers A class of drugs that down are active; when it is not present, are used to treat high blood pressure they are shut off. See lac operon. as well as urinary problems related to enlarged prostate (benign prostatic allopolyploid A hybrid organism, usu- hyperplasia; BPH) by acting as antago- ally a plant, that has been bred from two nists of alpha adrenergic receptors on closely related species and contains one smooth muscle. In blood vessels, this or more extra full sets of chromosomes. inhibits contraction of the muscle, which For example, if the parents each have two causes vasodilation, thus lowering blood sets of chromosomes, the allopolyploid pressure. In prostate tissue, relaxation of offspring, instead of having the normal smooth muscle allows increased urinary two sets, may have four. The hybrid con- fl ow. Cardura, Terazosin, and Doxazosin tains genetic information that is different are examples of alpha-blockers. from either parent. alpha-fetoprotein An embryonic pro- allopurinol A derivative of the purine tein that is believed to function as the base hypoxanthine used to treat gout. As embryonic counterpart of albumin and an inhibitor of the enzyme xanthine oxi- with which it shows great similarity in dase, allopurinol acts by preventing the amino acid sequence and structure. accumulation of uric acid. See uric acid. The presence of alpha-fetoprotein in adult serum is a diagnostic indicator for all-or-nothing phenomenon This phrase some types of tumors such as teratomas refers to the condition in which a nerve and liver cancers (hepatomas). Alpha- cell must receive its threshold level fetoprotein is also present in the sera of of stimulation to respond and start an pregnant women. Abnormal levels of action potential. A nerve will either fi re alpha-fetoprotein during pregnancy may an impulse or not fi re at all if the stimulus be indicative of certain fetal disorders. is below threshold. There is no such thing as a weak response to a weak stimulus. alpha-helix Refers to one type of three- See action potential. dimensional conformation that a protein assumes in the cell. An alpha-helix is sta- allosteric enzymes Enzymes that have bilized by the formation of many hydro- many subunits and many active sites. gen bonds between nearby amino acids They display substrate-induced conforma- in the protein. Hydrogen bonds form tional changes and have different roles or between every three amino acid residues. functions in their different conformations. This provides the regularity to the struc- They play an important role in the regula- ture of the helix. Another conformation tion of metabolic pathways and the regula- of proteins is the beta pleated sheet. See tion of gene expression. beta-pleated sheet.
12 干细胞之家www.stemcell8.cn ←点击进入
amide
Alu elements A family of related DNA ecules that allow these mutated tRNAs to sequences that are widely and randomly recognize the amber mutation UAG (see dispersed through mammalian genomes. amber mutation). Ordinarily, a UAG They are about 300 base pairs in length codon in a message signals the termina- and are classifi ed as moderately repetitive tion of translation, but a tRNA with an DNA sequences. There are about 600,000 amber-suppressor mutation has an anti- copies of these sequences in the human codon that is complementary (CUA) to genome. At the ends of these sequences is the termination codon. It can therefore a cleavage site for the restriction enzyme insert the amino acid that it is carrying at Alu. Their purpose, if any, in the genome that site in the growing polypeptide chain is not known. and avert chain termination.
Alzheimer’s disease (AD) A progres- ambient The physical conditions in an sive disease of the brain characterized by organism’s surrounding environment. memory loss and cognitive dysfunction Micro organisms that live in the human that was fi rst described in 1907 by Dr. gut, for example, have an ambient tem- Alois Alzheimer. Alzheimer’s disease is perature of 37°C. Organisms that exist in caused by the deposition of beta amyloid dust particles in a room have an ambient protein, which forms plaques and causes temperature of about 23°C, or room tem- the death of nerve cells in critical areas of perature. Ambient conditions also can the brain. While the vast majority of AD include atmospheric pressure, humidity, cases are seen in later life, a small num- oxygen levels, and other physical param- ber (<3 percent) of cases show a pattern eters that surround an organism. of inheritance, and these tend to manifest much earlier (early onset Alzheimer’s). Ames test A method for screening The inherited form of AD has been traced potential mutagens and carcinogens. to dominant mutations in at least three This test was developed by Bruce Ames genes: Amyloid Precursor Protein (APP) in the early 1970s and cut down drasti- located on chromosome 21, presenilin 1 cally on the time and expense that is located on chromosome 14, and preseni- involved in animal testing. The Ames lin 2 located on chromosome 1. test requires the use of bacteria to deter- mine the possible mutagenic potential of amber codon The codon UAG, which a chemical. It relies on the principle that is one of the three codons that does not the chemical structure and properties code for an amino acid but represents a of DNA are universal. In addition, the stop signal. mechanisms for toxicity in a bacterium mimic those of a mammal if the appro- amber mutation A type of genetic priate liver enzymes are provided to mutation in a class called nonsense muta- process the chemical in the same way a tions. An amber mutation arises when a mammal would. A chemical that causes three-base-pair sequence in DNA (codon) mutations in bacteria would likely do the such as UUG, coding for a specifi c amino same in a mammal, and because 90 per- acid, mutates to a UAG codon that does cent of all known carcinogens are muta- not code for any amino acid. UAG is a gens, a chemical found to be a mutagen termination codon because it causes the in the Ames test would be a suspected termination of protein synthesis. Any carcinogen. mutation that results in a UAG termina- tion codon is called an amber mutation. amide The product of the reaction There are also mutations called opal and between an amine compound and car- ochre that are also nonsense mutations. boxylic acid. peptide bonds are the bonds that link amino acids together in amber suppressor Mutations in the proteins and are a type of amide bond anticodon of several different tRNA mol- between two amino acids. The amino
13 干细胞之家www.stemcell8.cn ←点击进入
amine
group of one amino acid is linked to the acids that are incorporated into proteins carboxyl group of the next amino acid. is the substrate of one of the enzymes. In addition, each enzyme recognizes the amine Compounds that contain an appropriate tRNA(s) to charge. amino group (NH2). Amino acids are amines. See amino acid and amino aminoglycoside antibiotics A group group. of antibiotics that act to kill a broad range of bacteria by interfering with protein amino acid The building blocks of synthesis at the bacterial ribosome. They proteins. Amino acids contain a free are produced naturally by members of carboxyl group (COOH), a free amino the soil-dwelling genus Streptomyces and group (NH2), a hydrogen atom, and include streptomycin and kanamycin. a variable side group (R) attached to a single carbon. (One exception to this is amino group The –NH2 group in proline, whose amino group is involved a molecule. The presence of an amino in a cyclic structure.) The physical and group is the defi ning characteristic of the chemical properties vary among the R group of organic compounds known as groups. However, there are several clas- amines. sifi cations that put certain R groups in the same category because they share aminolevulinic acid (ALA) The fi rst similar properties. These are the acidic, committed intermediate in the synthe- basic, aliphatic, aromatic, and hydroxyl- sis of heme (see heme) and chlorophylls. containing or sulfur-containing amino Cells that either overproduce ALA or are side groups. There are 20 different amino fed large amounts of ALA overproduce acids that are found in proteins. porphyrins, or intermediates in the heme biosynthetic pathway. Porphyrins produce aminoacyl-tRNA A tRNA that is car- toxic compounds to the cell when they react rying its specifi ed amino acid; also called with oxygen. Thus ALA is being tested as a charged tRNA. The specifi city of charg- a weed killer and as a photodynamic agent ing of tRNA molecules is carried out by in the treatment of skin lesions. 20 different enzymes called aminoacyl tRNA synthetases. Each of the 20 amino 6-aminopenicillic acid A chemical structure that is found in the different natural and semisynthetic penicillins. This common nucleus of the penicillins contains the beta-lactam ring structure. In addition to the common core, 6- aminopenicillic acid, all penicillins contain a variable side group that distinguishes them from one another.
2-aminopurine A purine derivative that is a potent mutagenic agent because it be- comes incorporated into DNA in place of adenine. As a result, it induces mistakes in DNA during DNA replication.
amino side groups See amino acid.
amino sugars These are derivatives of simple sugars that have been modifi ed to form amines because of the addition of Aminoacyl-tRNA an NH2 group in place of the hydroxyl
14 干细胞之家www.stemcell8.cn ←点击进入
amplifi cation
group normally found at carbon 2. Two ter of the micelle away from water. Fatty commonly found amino sugars are D-glu- acids are amphipathic. Amphipathic mol- cosamine, which is a major component of ecules are responsible for the properties chitin (the outer hard covering of insects), of biological membranes. and D-galactosamine, which is found in cartilage. amphiphysin A protein found in nerve terminals, particularly at the synapse amino terminal Also called the N- where it is believed to be involved in the terminus; one of the ends of a polypeptide recruitment of dynamin at sites of endo- chain. This end of the polypeptide con- cytosis during the process of synaptic sists of an unreacted amino group. The transmission. Amphiphysin autoantibod- other end is called the carboxyl terminus, ies are found in patients with Stiffman or C-terminus. syndrome (SMS). Amphiphysin autoan- tibodies are also associated with breast ammonium sulfate precipitation cancer and small cell lung carcinoma. “Salting out” of proteins in solution. A fi rst step in the purifi cation of proteins amphoteric The description of a sub- from cell extracts; ammonium sulfate, stance that has both acidic and basic which promotes hydrophobic interac- groups and has properties of both acids tions, is the most common salt used to and bases. fractionate proteins according to their solubility in the salt solution. ampicillin A semisynthetic form of the antibiotic penicillin; an antimicro- amniocentesis A procedure for test- bial agent that kills bacteria by inhibiting ing the karyotype of a fetus in utero. the formation of bacterial cell walls. The Cells from the amniotic fl uid surround- addition of an amino group to penicillin ing the fetus are taken from the mother makes ampicillin effective against gram and cultured in the lab. Karyotype anal- negative organisms, thus widening the ysis of the cells will determine the sex of antibiotics spectrum of activity. the fetus, including any gross deformi- ties of the chromosomes or a chromo- amplifi able selection Exploitation of a some number that signals certain genetic natural phenomenon in which some diseases. transformed cell lines undergo local repeated DNA replication to produce AMP See adenosine monophosphate. many copies of genes at those locations. A commonly used system is the use of amphibolic A metabolic pathway, methotrexate to amplify the region one that is catalytic and anabolic, that around the dihydrofolate reductase can both degrade metabolites as well as (DHFR) gene. synthesize them. These pathways allow breakdown products of one pathway to amplifi cation Repeated replication of be used as substrates in the synthesis of a plasmids or sequences. Plasmid amplifi - compound in another pathway. cation is a process that is used to increase the replication of plasmids over that of amphipathic compound A compound chromosomes so that the plasmid isola- that contains both polar and nonpolar tion from whole cells is facilitated. The groups. Polar groups are soluble in water process involves growing cells with (hydrophilic), and nonpolar groups are amplifi able plasmids in the antibiotic not (hydrophobic). In water or aqueous chloramphenicol that stops chromosomal environments, amphipathic compounds DNA replication but does not affect plas- form micelles, or small vesicles with polar mid DNA replication. Specifi c sequences regions in contact with water and nonpo- of DNA can be amplifi ed using the tech- lar regions regions sequestered in the cen- nique of PCR (polymerase chain reaction).
15 干细胞之家www.stemcell8.cn ←点击进入
amplifi cation refractory mutation system
amplifi cation refractory mutation sys- and/ or function to another compound or tem (ARMS) A PCR (polymerase chain biomolecule. reaction) technique that is used to differ- entially amplify specifi c alleles of a gene. anaphase A stage during mitosis or cell Primers (oligonucleotides) for the PCR are division where chromosomes split at the constructed so that the 3′ base contains centromere and the resulting chromatids the specifi c base change of the allele. Only move to opposite ends of the cell. During DNA targets that hybridize (see hybrid- meiosis, or reduction division, there are ization) to the primer will be amplifi ed, two anaphase stages. During anaphase I, and all other alleles with mismatch base homologous pairs of chromosomes sepa- pairs and that do not pair with the 3′ base rate from each other with their centro- of the primer will not be amplifi ed. meres intact and move to opposite ends of the cell. Anaphase II, during the second amyloid protein The protein form- meiotic division, resembles the anaphase ing the core of the characteristic plaques stage in mitosis, as described above. seen in Alzheimer’s disease. The pro- tein is composed of 39–43 amino acids anaphylotoxin A substance released and exhibits a tendency to form insoluble by the body as part of an immunological precipitates in solution. The formation of response to the presence of a foreign anti- plaques is believed to refl ect the tendency gen. Anaphylotoxins stimulate the release to aggregate out of the cell fl uid, causing of histamines, which cause infl ammation interruption of neural transmission. in tissues.
amylose A starch made up of a long, androgens A group of male sex hor- unbranched chain of glucose. A polymer mones that are responsible for the devel- of monosaccharides is called a polysac- opment and the maintainence of mascu- charide. Amylose is the principle storage line features and organs. Testosterone is starch of plants. an androgen.
anabolic A type of metabolic pathway aneuploid An unbalanced set of chro- in which complex molecules are synthe- mosomes that results from either the loss sized from smaller precursors, usually in or the gain of chromosomes. An individ- a series of steps; the type of metabolism ual with the normal complement of two that builds molecules as opposed to cata- copies of each chromosome (diploid) is bolic metabolism, which is degradative. disomic. Trisomy is the condition of hav- Energy is usually required for anabolic ing one extra chromosome, and mono- metabolism. An example would be the somy is a loss of one chromosome. synthesis of polypeptides from amino acids or the synthesis of nucleic acids Angelman syndrome (AS) A neuro- from nucleotides. See catabolism. logical condition fi rst described by Dr. Harry Angelman in 1965 that is char- anaerobe A microorganism that does acterized by small head size, severe not or cannot use oxygen during respi- learning diffi culties, fi ne tremors, jerky ration. Obligate anaerobes such as the limb movements, and epileptic seizures. genus Clostridium will die in the pres- Cytogenetically, the disease is associated ence of oxygen. Others such as E. coli are with a deletion of chromosome 15 and is classifi ed as facultative anaerobes because now known to involve a cluster of genes they will use oxygen when present but involved in the regulation of ubiquitin at can switch to anaerobic respiration in its gene map locus 15q11-13. absence. angiogenesis The process by which analog A compound that has impor- new capillaries are formed from endothe- tant biochemical similarities in structure lial B cells. Angiogenesis is stimulated by
16 干细胞之家www.stemcell8.cn ←点击进入
antigen
a signal in the form of a growth factor(s) antibiotic resistance Microorganisms may and is comprised of at least four compo- have a natural resistance or develop resis- nents: (1) the production of proteases that tance to an antibiotic so that the drug is not allows endothelial cells to invade the sur- effective in inhibiting growth or killing. rounding tissue, (2) directed movement of endothelial cells toward the source of antibiotic-resistance genes Genes that the stimulating growth factors, (3) prolif- confer antibiotic resistance to a microor- eration, and (4) formation of tubules (i.e., ganism. Examples are genes that encode capillaries). enzymes that destroy the antibiotic; genes that code for the target of the antibiotic angiopoietins A group of secreted fac- but that become mutated so that the tar- tors (Ang-1, Ang-2, Ang-3, Ang-4) that, get no longer responds to the drug; or together with VEGF, regulates endothe- genes that encode proteins that prevent lial cell survival and capillary formation the antibiotic from being taken up by the through the receptor tyrosine kinase, Tie- mircroorganism. 2, on the endothelial cell surfaces. The angiopoietins are found in the mamma- antibodies Proteins that circulate in the lian metanephros, the precursor of the bloodstream and bind to foreign invading kidney, and they are implicated in dereg- substances (antigens, e.g., bacteria, tox- ulated vessel growth in Wilms’ kidney ins, certain viruses) with a great deal of tumors and in blood vessel remodeling specifi city. Antibodies are the mediators kidney tissue following toxic injury. of the immune response to soluble anti- gens. Immunoglobulins. angstrom (Å) A unit of measurement usually used for wavelengths or cellular antibody-producing cell An activated structures. B lymphocyte or plasma cell secretes anti- 1 = 10–10 meters, or 10–6 millimeters, bodies. Each plasma cell secretes an anti- or 10–4 (0.0001) micrometers, body with specifi city for one antigen. or 0.1 nanometers. anticoagulant A chemical substance anion A negatively charged ion. that prevents the coagulation of blood.
anneal Complementary single strands anticodon A three-nucleotide base- of DNA or DNA and RNA that form pair sequence that is antiparallel and hydrogen bonds between complementary complementary to a codon. The antico- base pairs to form double-stranded DNA don is found on a tRNA and interacts or DNA-RNA hybrids. with a specifi c codon on the mRNA so that an amino acid will be placed in antennapedia complex A genetic locus the correct position according to the in the homeotic box that is defi ned by mRNA during translation or protein mutations that cause developmental synthesis. defects in the thoracic and head segments of the fruit fl y, Drosophila melanogaster. antidiuretic A chemical substance that See homeobox. counteracts a diuretic.
antibiotic A substance usually made antifungicide A substance or drug that by a microorganism that inhibits the kills fungi. growth or kills another microorganism, for example, penicillin. There are many antigen A substance that will stimulate synthetic or manufactured antibiotics the production of specifi c neutralizing that are derivatives of naturally occurring antibodies in an immune response. Any antibiotics and are available for medici- chemical substance, usually a protein, nal or research purposes. that will interact with an antibody.
17 干细胞之家www.stemcell8.cn ←点击进入
antigenic determinant
antigenic determinant A small portion ple, sulfa drugs that block the synthesis of the antigen that determines the specifi - of the vitamin folic acid. cally of the antigen-antibody reaction. antimorphic allele A mutant allele antigenic variation A sequential change that has an antagonistic reaction to the in the structure of an antigen of microor- normal, wild type of allele. A person who ganisms and viruses so that antigens on has both an antimorphic allele and wild these pathogens will not be recognized by type of allele for a particular gene will antibodies already produced in the host. have less of that gene product than an The disease-relapsing fever, which is char- individual who has a deletion for that acterized by cyclic infections by the same gene and the wild type of allele. bacterium, is due to the ability of the bac- terium to change its antigenic makeup and antimutator A gene that decreases the thus avoid immunity built up by the host. spontaneous mutation rate of an organ- A more subtle type of antigenic variation ism. These genes are usually involved in is seen in the antigenic shift (major anti- some DNA repair or metabolism process. genic change) and antigenic drift (minor antigenic change) seen in the infl uenza anti-oncogene A tumor suppressor virus that result in loss of immunity by gene, or a gene whose absense is needed populations and infl uenza pandemics and for an oncogenic event. Loss or inactiva- epidemics every number of years. tion of a tumor suppressor gene by either mutation or deletion is believed to be an antigen-processing/-presenting cell important event in the development of a Any of a heterogeneous group of cells tumor. that bind foreign antigens to their sur- face and then interact with helper T antiparallel Refers to the structure of cells, a process that is required for DNA. The two strands of complementary T-cell activation. Antigen-presenting cells DNA are antiparallel, that is, the 5′ end include dendritic cells in lymphoid tissue, of one stand is paired with the 3′ end of Langerhans cells found in skin, and some the other and vice versa. macrophages. antiparasite A substance or chemical antihelminthic agent A substance or that inhibits or kills parasites. drug that inhibits the growth or kills hel- minth parasites. antiport The transport of two sub- stances across the cell membrane that are antihistamine A substance or drug coupled but in opposite directions. that blocks the effects of histamines in the infl ammatory process; a drug that antisense RNA A strand of RNA that relieves allergy symptoms. is complementary to that of a messenger RNA. An antisense RNA would bind to anti-idiotype antibodies An anti- the messenger and prevent synthesis of body made in response to a unique the protein encoded by the message. Anti- antigen-combining site of an antibody. sense RNA is being explored as a pos- The resulting antibody may have a struc- sible therapeutic agent for viral infections tural similarity to the original antigen and to prevent certain cancer genes from and may stimulate antibodies against it, being expressed into proteins. thus serving as a vaccine. antisense strand Of the two DNA antimetabolite A chemical that inhib- strands in a double-stranded DNA mol- its the growth of microorganisms because ecule, the antisense strand is the one that it blocks the synthesis of some metabolite is not used as the template for RNA syn- needed by the microorganism, for exam- thesis.
18 干细胞之家www.stemcell8.cn ←点击进入
apyrimidinic site
antiseptic Any chemical that is com- in a variety of ways, the main pathway monly used to kill microorganisms to is initiated by the binding of a ligand to prevent infection. the Fas receptor or by binding of tumor necrosis factor (TNF) to its receptor. antitermination factor A protein that Activation of the receptors sets off a cas- prevents the termination of transcription. cade by which proteases called caspases It is involved in certain mechanisms of are activated, ultimately resulting in deg- gene expression control. radation of DNA by DNase, proteolysis, and cell death. apaf-1 A cytoplasmic protein that initi- ates the process of apoptosis by cleaving, aptamer An oligonucleotide of and thereby activating, caspase 9. Acti- DNA or RNA or a peptide that binds to vation of caspase 9 causes subsequent and inactivates proteins. Often, libraries activation of other caspases in a reaction of sequences are used to inhibit the pro- chain that ultimately commits the cell to tein, and the sequences that are success- undergo apoptosis. Cleavage of caspase ful are amplifi ed and identifi ed. Aptam- 9 requires the formation of a complex ers can be used to study the active site of between apaf-1, cytochrome c, and dATP the protein or they can be developed into to form an oligomeric structure called an therapeutics. apoptosome. apurinic site A site on the DNA in APC syndrome Familial adenomatous which a purine is missing but the phos- polyposis coli; a genetic disease character- phodiester sugar backbone is still intact. ized by the development of benign polyps in the colon, a condition that frequently apyrimidinic site A site on the DNA in precedes the development of malignant which a pyrimidine is missing but the phos- colon cancer. The genetic locus of APC phodiester sugar backbone is still intact. has been shown to reside on human chro- mosome 5. Research aimed at mapping and then cloning the causative gene(s) via chromosome walking is currently under Fas ligand way. See genetic disease. TNF
APH Aminoglycoside 3′ phosphotrans- Fas
ferase; a bacterial gene that codes for TNF-R1 an enzyme that confers resistance to the FADD TRADD antibiotic neomycin. The APH gene is commonly used as a selectable marker in caspase 8 transfection experiments in that cells that do not contain the gene can be eliminated from a population by exposure to neomy- mitochondrion cin. See negative selection. cytochrome c
apoenzyme The protein moiety or part effector caspases of an enzyme without its cofactor; nor- mally inactive.
apoptosis Programmed cell death, or a degradation of regulated set of reactions that results in DNA and protein cell death. Apoptosis regulates the bal- ance between cell growth and multipli- cell death cation and eliminates unnecessary cells. Although apoptosis can be brought about Apoptosis
19 干细胞之家www.stemcell8.cn ←点击进入
aqueous
aqueous Pertaining to water; for exam- human immunodefi ciency virus (HIV) ple, the aqueous phase after separation infection, including general malaise, with an organic solvent would be the night sweats, dementia, wasting, and water phase. opportunistic diseases associated with immunodefi ciency such as Kaposi’s aqueous two-phase separation A sarcoma (a rare form of skin cancer), method to partition proteins during puri- pneumonia (generally caused by Pneu- fi cation using solutions of polyethylene mocystis carinii), and retinitis (caused glycol and dextran or polyethylene glycol by cytomegalovirus). and certain salts such as a phosphate. Archaebacteria A group of bacte- arabinosyladenine (AraA) An antivi- ria including those that produce meth- ral anitibiotic that is used to treat viral ane from carbon dioxide and hydro- encephalitis. AraA is a derivative of the gen (methanogens) and those that live normal purine nucleoside, adenosine, in high-salt environments (halophiles) in which the sugar, ribose, has been that appear to be very different from replaced with one of its optical isomers, and more primitive than other living arabinose. bacteria. It is believed that Archaebac- teria have evolved separately from the arabinosylcytosine (AraC) An anti- true bacteria (Eubacteria) and from the biotic that acts by blocking DNA syn- eukaryotes and that they constitute a thesis. AraC is a derivative of the nor- third group of organisms. mal pyrimidine nucleoside, cytosine, in which the sugar, ribose, has been arginine An amino acid with the side replaced with one of its optical isomers, chain: arabinose. – (CH2)3 –NH–C=NH \ arachidonic acid A 20-carbon fatty NH2 acid with four double bonds. It serves as a precursor for the synthesis of prosta- argininemia A disease caused by a glandins. defi ciency of the enzyme arginase that catalyzes the last step of the urea cycle in ARC AIDS-related complex, or a which arginine is hydrolyzed to urea and series of symptoms related to an active ornithine. The syndrome is characterized by hyperammonemia, encephalopathy, and respiratory alkalosis. The disease gene is an autosomal recessive, at gene map locus 6q23.
ARMS See amplifi cation refrac- tory mutation system.
aromatic An organic compound that contains a benzene-derived ring.
ARS element Autonomously replicat- ing sequences (ARS) found on yeast plas- mids that are initiation sites for plasmid replication. Plasmids that lack such sites will not replicate.
Arthus reaction An infl ammatory Arabinosylcytosine response caused by the production or
20 干细胞之家www.stemcell8.cn ←点击进入
atomic-force microscopy
depositing of antigen-antibody complexes are used in a number of industrial in tissues. fermentations.
artifact The appearance of a structure assay A test. In an enzyme assay, an in microscopy or an experimental result enzyme is tested for activity under spe- that is not real but is due to experimental cifi c conditions. procedures used. ataxia telangiectasia (AT) A rare Ascomycetes A class of fungi that is human disease associated with a defect distinguished by a structure, the ascus. in the DNA repair system. It is a fatal dis- ease that is characterized by a damaged ascorbic acid Vitamin C. Lack of immune system, premature aging and a this vitamin in the diet results in the predisposition to some cancers. Individu- disease scurvy. Ascorbic acid is a reduc- als who have only one copy of the gene ing agent that keeps the enzyme pro- ATM do not have the disease but are very lyl hydrolase in active form. Collagen sensitive to X-rays or chemicals, which synthesized in the absence of ascorbic cause DNA damage, and these individuals acid is insuffi ciently hydroxylated, can are prone to developing cancer. The gene not form fi bers properly, and causes involved in AT (called ATM) is one of a the skin lesions that are associated class of genes called tumor suppressors. with scurvy. AT content The fraction of the total ascus A saclike structure that pro- nucleotides in a DNA molecule that are duces ascospores, or the sexual spores of either adenine or thymine nucleotides; the ascomycetes. generally given as a percentage.
aseptic Without germs; sterile. AT/GC ratio The ratio of adenine plus thymine base pairs to guanine plus cyto- asexual reproduction Reproduction sine base pairs in a molecule of DNA. in the absence of any sexual process, or the reproduction of a unicellular organ- ATM A tumor suppressor gene that is ism by cell division, where a single parent activated by DNA strand breaks. Acti- is the sole contributer of genetic informa- vated ATM in turn activates the chk2 tion to its offspring. kinase, which results in cell cycle arrest in G2. ATM is an acronym for ataxia tel- asparagine An amino acid with the angiectasia mutated because both copies side chain: of this gene are mutated in patients with –(CH2)–C=O this disease. Mutations in the ATM gene \ result in hypersensitivity to radiation and NH2 a tendency to accumulate mutations in other genes, which can lead to cancer, aspartame An artifi cial sweetener that particularly breast cancer, leukemia, uses the amino acid phenylalanie as a and lymphoma. Also, mutations in ATM precursor. can cause cells to die, particularly in the cerebellum, which results in the prob- aspartic acid An amino acid with the lems with limb movement seen in ataxia side chain: telangiectasia. The ATM gene is located –(CH2)– C=O on the long (q) arm of chromosome 11 at \ position 22.3 (gene map locus 11q22.3). OH atomic-force microscopy (AFM) A Aspergillus A genus of fungi that are device for visualizing objects with a max- important economically because they imum resolution of about 10 pm, about
21 干细胞之家www.stemcell8.cn ←点击进入
ATP
the size of small molecules. Unlike tra- autogenous control Control of gene ditional microscopes, the AFM does not expression by the gene’s product or pro- contain a lens but utilizes a probe that tein encoded by the gene. measures the attractive or repulsive forces between the probe tip and the molecu- autoimmune The inability to distinquish lar structure being visualized as the tip self from nonself, or a state where the body is moved along the surface of the speci- produces antibodies to its own cells. men. The movement of the probe tip gives rise to an electrical signal, which is trans- autolysin An enzyme that causes cellu- lated into an image by computer. Unlike lar self-destruction of the same cells that electron microscopes, AFMs can image synthesize it. samples either in air or in liquids. autolysis The self-degradation of a cell ATP See adenosine triphosphate. by release of hydrolytic enzymes of the lysosome. In the case of bacteria, autoly- ATPase Any of a class of enzymes that sis is brought about by self-destruction of acts to remove one or more phosphate the cell wall by a specifi c enzyme. groups from ATP to produce ADP or AMP and inorganic phosphate by hydro- autonomic nervous system The part lysis. The release of phosphate is accom- of the nervous system that regulates panied by the release of energy that is involuntary responses. used to power various cellular functions. autonomously replicating sequences atrial natruiretic factor (ANF) A (ARS) Special nucleotide sequences in hormone produced by the right atrium of the DNA of chromosomes that serve as the heart that stimulates sodium excre- sites where DNA replication begins. tion by the kidneys and is involved in the regulation of blood pressure. ANF autoradiography A technique that is believed to play a key role in cardio- involves using a radioactively labeled vascular homeostasis by acting on recep- compound to localize a reaction in a cell tors that stimulate the formaton of cyclic or to study a process and using photo- GMP (cGMP). ANF is currently the tar- graphic fi lm to visualize the location of get of research on new antihypertensive the label. and diuretic drugs.
attenuation 1. A decrease in virulence autosomal dominant A mutant allele of a pathogen. found on one of the autosomes that will 2. A mechanism of gene regulation in always produce a specifi c trait or disease. bacteria in which availability of certain Therefore the chance of passing the gene amino acids will control the expression of or the disease to progeny in a pregnancy genes for their own synthesis by causing is 50 percent. premature termination of transcription of the genes involved in the synthesis. autosome A chromosome that is not a sex chromosome. att site A site on the Escherichia coli bacterial chromosome that interacts with autotroph An organism that can make the bacteriophage lambda genome and at its own nutrients and organic carbon which the bacteriophage genome integrates compounds from inorganic carbon in the into the bacterial genome resulting in lysog- form of carbon dioxide. enization of the bacterium. See lysogenic. auxin A plant hormone that regulates autoclave An apparatus that uses steam cell reproduction and cell elongation in under pressure to sterilize materials. certain tissues.
22 干细胞之家www.stemcell8.cn ←点击进入
Azotobacter
auxotroph A bacterial mutant that can axis polarity The orientation of the no longer make some required nutrient. body in space, depending upon three axes: the anterior/posterior body axis, Avastin An anticancer drug that acts by the dorsal/ventral axis, and the medial/ blocking the formation of new blood ves- lateral axis. During the development sels that feed tumors. Avastin is a recom- of the embryo, genes that control axis binant antibody to vascular endothelial polarity are the axis formation genes growth factor (VEGF), which has been that establish embryonic body axis and engineered by the insertion of certain the axis polarity genes that control ante- human sequences to avoid rejection by rior/posterior and dorsal/ventral body the patient’s immune system. Avastin acts orientation. by blocking VEGF, a protein that plays a key role in tumor angiogenesis. Avastin is axon Extention of a nerve cell that con- used in combination with 5-Fluorouracil ducts impulses away from the cell body. chemotherapy to treat patients with pri- mary metastatic cancer of the colon or axoneme The structural core of a cilia rectum but is currently being tested for or eucaryotic fl agellum that is made up of treatment of other types of cancer includ- nine outer doublets of microtubules and ing renal cell, breast, and non-small cell an inner pair of microtubules. lung cancers. 3′-azido-3′-deoxythymidine (azido- axenic culture Pure culture or the thymidine [AZT]) An antiviral anti- growth of one organism. biotic used to treat HIV infection (the AIDS virus). AZT is a derivative of the axin A membrane-bound intermediate normal deoxyribonucleoside thymidine in the Wnt signaling pathway that acti- in which an azide group is attached to vates the transcription of D-type cyclins. the deoxyribose sugar at the 3′ position. Axin interacts with the adenomatosis AZT is an inhibitor of the virus reverse polyposis coli (apc) protein, beta-catenin, transcriptase enzyme that blocks viral and glycogen synthase kinase 3b in spe- replication at the point where viral RNA cifi c ways that ultimately regulate the is copied into DNA. entry of beta-catenin into the nucleus. The axin protein contains three domains: Azotobacter A genus of free-living a regulation of G-protein signaling (RGS) microorganisms that are capable of domain, a disheveled domain, and an biological nitrogen fixation, or the abil- axin (DIX) domain. Mutations in axin ity to use nitrogen of the atmosphere are associated with liver and ovarian for synthesis of nitrogen-containing cancers. compounds.
23 干细胞之家www.stemcell8.cn ←点击进入
AB
BAC Bacterial artifi cial chromosome; mutant phenotype is changed back to a laboratory-constructed plasmid that is the wild type. capable of replicating in bacteria, usually E. coli, with a very large insert of up to bacteria A group of single celled pro- 300 kb of foreign DNA. caryotic organisms that divide by binary fi ssion, are haploid or contain one copy of Bacillus A genus of free-living rod- a chromosome, do not possess organelles shaped bacteria that produce extremely such as mitochondria and chloroplasts, resistant spores, that ensures the organism’s and do not have a membrane-bound survival under harsh environmental condi- nucleus. tions. Some species produce antibiotics. bacterial transformation A genetic Bacillus Calmette-Guérin (BCG) A transfer process where cell-free, isolated nonvirulent form of Mycobacterium DNA is taken up by a recipient cell and bovis, an organism that causes tubercu- incorporated into its genome. losis in cows. It was isolated by Calmette and Guérin of the Pasteur Institute and bacterial virus A bacteriophage, or a has been used since 1928 as a vaccine, virus that uses a bacterium as its host to primarily in Europe and Japan, against reproduce. tuberculosis. bacteriocidal Describing a chemical or bacitracin An antibiotic that is effec- drug that can kill bacteria. tive against Gram-positive bacteria. It inhibits cell-wall synthesis. bacteriophage A bacterial virus that utilizes the bacterial host replicative backbone 1. The spinal column of a systems for its own replication, after vertebrate organism. which the host cell is usually destroyed— 2. A structural feature of a molecule that releasing progeny bacteriophage. Many arises from its primary structure. Pro- bacteriophage particles consist of an tein backbones arise from the linking of icosohedral-shaped head that carries the amino acids through the peptide bond bacteriophage DNA genome. The bac- between the carboxyl group of one amino teriophage attaches to its bacterial host acid and the amino group of the other. by means of a cylindrical tail that then Nucleic acid backbones are formed from serves as a conduit to inject the DNA into the joining of nucleotides through sugar- the host through a hollow core. phosphate linkages. bacteriophage, transducing A phage back cross A genetic cross between a that acts as a vector in a gene transfer heterozygote and one of the its parental process by injecting donor bacterial DNA homozygotes. into a recipient on viral infection.
back mutation A mutation that bacteriophage lambda A DNA- reverts a previous mutation, so the containing bacterial virus that infects
24 干细胞之家www.stemcell8.cn ←点击进入
BamHIverso
ble of transporting protons across the bacterial membrane, thereby creating a light-dependent electrochemical proton gradient.
bacteriostatic A chemical or drug that inhibits the growth of bacteria but does not kill them.
bacteroid A group of anaerobic, Gram- negative, small-rod bacteria.
baculovirus An insect cell virus that is used as a cloning vector. Proteins made from cloned DNA in baculovirus are gly- cosylated, a process that does not occur Bacteriophage when cloning in bacteria.
Escherichia coli and has a complex set of baffl es Structures on the bottom of regulatory mechanisms governing whether some culture fl asks that increase aeration the virus will reproduce itself and lyse its when growing a culture of organisms in a host or lysogenize its host by integration of shaking water bath or incubator. its genome into its host’s genome. Deriva- tives of lambda are used as cloning vectors baker’s yeast Saccharomyces cerevi- to introduce foreign DNA into E. coli. siae, a common yeast, or unicellular bud- ding eukaryotic organism, that ferments bacteriophage mu A DNA virus that sugars and produces carbon dioxide, is capable of transposition, or inserting which is used to leaven bread. its DNA randomly into the genome of its host. This virus is used in the process of Balbiani rings A very large puff indi- insertional mutagenesis. cating transcriptional activity that is seen at a site on the polytene chromosome of bacteriophage X174 A single-stranded the certain larval insects. DNA virus that has been used to study the process of DNA replication. Baltimore, David (b. 1938) A molec- ular biologist and virologist who won bacteriophage Q A single-stranded the Nobel Prize in physiology or medi- RNA bacteriophage. cine in 1975 for the discovery that ret- roviruses, a group of viruses that have bacteriophage T4 A large DNA virus. an RNA genome produce an enzyme, reverse transcriptase. He was found- bacteriophage T7 A DNA virus with ing director of the Whitehead Institute a very strong promoter that responds to for Biomedical Research at MIT and held specifi c T7 RNA polymerase. A number that position from 1982 to 1990. He of cloning vectors have been constructed headed the National Institutes of Health so that foreign DNA is situated next to AIDS Vaccine Research Committee in a T7 promoter, so that expression of the 1996. gene can be regulated and amplifi ed by addition of T7 RNA polymerase. BamHI A restriction enzyme that rec- ognizes a specifi c six-base pair sequence bacteriorhodopsin A transmembrane (GGATCC) and cuts in a staggered man- protein of the “purple membrane” of ner, thus creating single-stranded over- Halobacterium halobium that is capa- hangs (sticky ends) at the cut sites.
25 干细胞之家www.stemcell8.cn ←点击进入
rectoBam islands
Bam islands Repeated sequences of fi xed length in a nontranscribed spacer region. The designation comes from the fact that these sequences were fi rst iso- lated by digestion of the spacer region with the restriction enzyme, BamHI.
barophile An organism that grows under conditions of high hydrostatic pressure but cannot grow under normal atmospheric pressure. Such organisms have been isolated from deep seas where the hydrostatic pressure exists at less than 100 atmospheres.
barotolerant An organism that can tolerate high hydrostatic pressure.
Barr body A condensed X chromo- some seen in the interphase. The genes on it are not expressed; thus the chromo- some is inactive.
basal body Centriole.
basal lamina The thin layer that underlies epithelial cells, which consists of various extracellular matrix proteins including laminin and collagen. The thin membrane surrounding the ovarian fol- licle is also referred to as a basal lamina.
base 1. A substance that decreases the concentration of H+ ions in solution, or an alkaline substance. 2. A purine or pyrimidine found in nucleic acids. Base pair
base analog A purine or pyrimidine base substitution A type of mutation base other than the ones normally found in which one base or base pair is different in nucleic acids. in the mutant than in the wild type.
base pair (bp) Complementary rela- basket centrifuges Instruments that tionships between purine and pyrimi- operate at very low centrifi cal forces dine molecules that allow adenine to and act as centrifi cal fi lters, collect- form two hydrogen bonds with thymine ing large particulate matter. These or uracil and guanosine to form three are useful to collect proteins that have hydrogen bonds with cytosine. Base been absorbed to materials such as ion pairing enables nucleic acids to recog- exchange supports in the batch adsorp- nize each other and plays an important tion method. role in reactions involving nucleic acids such as DNA replication, transcription, basophile An organism that lives in and translation. alkaline environments.
26 干细胞之家www.stemcell8.cn ←点击进入
Beadle, Georgeverso W.
batch centrifuges Those centrifuges in terms of the length of the transcripts that can accommodate solutions varying with the larger transcript giving rise to from less than 10 ml to liters at a wide the apoptosis repressor form and the range of centrifi cal forces. smaller transcript coding for the apopto- sis promoting form. The same gene char- batch culture Growth of microorgan- acterized in chicken is known as bcl-x, isms in a closed system under proscribed and that described in humans is known conditions of medium, temperature, and as bax. aeration. bcr A region on human chromosome 22 B cells See B lymphocytes. known as the breakpoint cluster region, at which chromosome breakage and bcl2 An anti-apoptotic factor found in translocation occurs in cases of chronic the mitochondrial outer membrane that myelogenous leukemia (CML) and acute acts to block the release of cytochrome c lymphoblastic leukemia (ALL). In these from the mitochondrion. The inhibition of cancers, there is a reciprocal transloca- cytochrome c blocks the activation of cas- tion between chromosomes 22 and 9 that pase 9 by apaf-1. Bcl2 was originally dis- results in the formation of a hybrid chro- covered as an oncogene activated by chro- mosome (the Philadelphia Chromosome) mosomal translocations in lymphomas. in which the abl oncogene is fused to a gene in the bcr region. The bcr-abl fusion bcl-x/bax A bcl2-related gene that product contains an activated form of abl can either mimic the function of bcl2 that results in transformation of the cell as a repressor of apoptosis or, in an to a cancerous state. alternatively spliced form, act to pro- mote apoptosis. The alternative splicing Beadle, George W. (1903–1991) A products of the gene are characterized geneticist who, in collaboration with
1B 1A 2 3 4 5 6 7 8910 11 chromosome 9 c-abl
chromosome 22 bcr
translocation
bcr/abl fusion
Breakpoint cluster region (bcr)
27 干细胞之家www.stemcell8.cn ←点击进入
rectobectoplasm
Edward Tatum, showed that genes control recombinant DNA. He became head of the enzyme production. Beadle and Tatum NIH Scientifi c Advisory Committee for shared the 1958 Nobel Prize in physiol- the Human Genome Project in 1991. ogy or medicine with J. Lederberg. beta-adrenergic receptor kinase bectoplasm An archaic term for the (βARK) An enzyme responsible for outer portion of the cytoplasm of a cell. the desensitization of the beta-adren- ergic receptor as a result of continued Beer-Lambert law The equation that stimulation by the receptor agonist (e.g. states that the molar concentration of a epinephrine). βARK causes inactiva- substance is proportional to how much tion of the receptor by phosphorylating light of a certain wavelength is absorbed serine residues on the cytosolic portion by a solution of the substance: of the receptor. Inactivation of the beta- A = ECL adrenergic receptor is due to elevated Where levels of βARK in cardiac muscle that A = the absorbance at a given wave- occurs rapidly after a heart attack. The length βARK gene is located on chromosome E = the molar extinction coeffi cient 11, centromeric to 11q13 (gene map locus C = the molar concentration of the solu- 11q13). tion L = the length of the light path beta-arrestin (βarr) A protein that binds to the cytosolic portion of the beta- Bence-Jones protein Part of an anti- adrenergic receptor following phosphory- body molecule (the light chain) that is lation of the receptor by βARK. Binding found in the urine of individuals who of βarr effectively blocks the binding of have the disease multiple myeloma, a the G-coupled receptor kinase, thereby tumor of the bone marrow. These frag- inactivating all subsequent steps in the ments were instrumental in determining cascade of reactions that releases glucose the structure of the antibody. from glycogen in muscle and liver.
benign Referring to a tumor that does beta-barrel A type of structure not proliferate and does not invade sur- assumed by some transmembrane proteins rounding tissues. in which the polypeptide(s) are arranged in a such a way as to give the appearance Benzer, Seymour (b. 1921) A geneti- of a barrel. In a beta-barrel, 20 or more cist who studied, and then employed, the transmembrane polypeptide segments are process of recombination in bacterio- aligned in a regular manner to form to a phages to create the fi rst fi ne structure cylinder that acts as a channel to trans- maps of genes. He is credited with estab- port solutes across the cell membrane. lishing the relationship between genetic Porins, which form channels in bacterial units (genes) and proteins as formulated and mitochondrial membranes, are one in the “one gene–one protein” hypoth- of the best-known examples of beta- esis. barrel structures.
Berg, Paul (b. 1926) A biochemist beta-blockers A class of drugs used who gained fame for his work with recom- to treat high blood pressure (hyperten- binant DNA. He was a member of the sion), congestive heart failure, abnormal National Academy of Sciences who helped heart rhythm (arrhythmia), and angina. formulate National Institutes of Health Beta-blockers act by blocking beta- policy on recombinant DNA in the mid- adrenergic receptors mostly on cardiac 1970s. Berg was awarded the Nobel Prize muscle tissue. Beta-blockers, particularly in chemistry in 1980, along with Walter those specifi c for beta1 receptors, are Gilbert and Frederick Sanger, for work on selective for cardiac tissue. Some exam-
28 干细胞之家www.stemcell8.cn ←点击进入
bioreactorsverso
ples of beta-blockers are atenolol, meto- down organic matter in water. A measure prolol, and propranolol. of the organic pollutant load.
beta-carotene A pigment that harvests biochemistry The chemistry of biolog- light energy and transfers this energy to ical systems and processes. other photosensitive pigments, such as chlorophylls, in a photosystem. This pig- bioconversions The use of microbes ment gives a red or orange color to car- to catalyze the production of economi- rots, tomatoes, and other plants. cally valuable products. The process of fermentation is a bioconversion or a bio- beta-galactosidase An enzyme that transformation. catalyzes the hydrolysis of the disaccha- ride lactose to the monosaccharides glu- biodegradation The fi eld of study cose and galactose. The gene encoding this devoted to methods for removal of enzyme in E. coli is part of the lac operon. environmental pollutants using the degradative properties of microorgan- beta-lactam ring A basic structure of isms. Much of the work in this fi eld penicillins and their synthetic derivatives. centers on the creation of genetically engineered microorganisms designed beta-pleated sheet Rigid, extended to degrade organic compounds that are sheetlike secondary structure of proteins generated in industrial waste or that that is held together by hydrogen bonds. capture toxic metals present in toxic waste dump sites. bFGF Basic fibroblast growth factor; one of a family of growth factors that bioenergetics The fi eld covering ther- induces angiogenesis and acts as a che- modynamic principles that are applied to moattractant for fi broblasts and other biological systems. cell types. It binds to heparan sulfate in the extracellular matrix. biogel A matrix made out of a variety of materials such as dextran, polyacryl- BglII A restriction enzyme that recog- amide, agarose, and cellulose used in nizes a specifi c six base-pair sequence chromatography to purify proteins. See (AGATCT) and cuts the DNA in a stag- chromatographic techniques. gered manner, creating single-stranded overhangs at the cut site. bioinformatics Computational molec- bicoid genes A group of genes that ular biology and genetics. The use of com- code for proteins that play a determining puters to store and analyze data, usually role in the development of the head and nucleotide sequence data that can be ana- the thorax in the embryo of the fruit fl y, lyzed for control regions of genes, amino Drosophila melanogaster. acid sequence data that can be used to fi nd functional domains of proteins, and bidirectional replication Replication both kinds of data used to fi nd sequence of a DNA molecule by two replication similarities to other genes or parts of forks moving in opposite directions from genes. Such gene sequence comparisons a single initiation point. are being used to understand evolution of genes and organisms. binary fi ssion Division of one cell into two after replication of the DNA. biomass The total mass of living mat- ter present on Earth. biochemical oxygen demand (BOD) A measure of the amount of oxygen con- bioreactors Equipment designed to sumed in biological processes that breaks maximize product formation in a bio-
29 干细胞之家www.stemcell8.cn ←点击进入
rectobiosynthesis
catalyzed reaction. Such equipment uses the fruit fl y, Drosophila melanogaster. See biocatalysts that are immobilized on a homeobox. support and controls the contact between the catalyst and its substrate. bivalent A synapsed pair of homolo- gous chromosomes found in prophase I biosynthesis The synthesis of mol- and metaphase I of meiosis; also known ecules in biological systems. These syn- as a tetrad. theses are carried out in small discrete steps, each step catalyzed by an enzyme, BLAST Basic local alignment search and are energy requiring, usually involv- tool; a set of similarity search programs ing ATP or GTP as energy sources. designed to look at all of the available protein or nucleic acid sequence data- biotin A vitamin prosthetic group that bases. Access BLAST through the home carries activated carbon dioxide and that page of the National Center for Biotech- is bound to the enzyme pyruvate decar- nology Information (http://www.ncbi. boxylase. This is an important enzyme nih.gov). because it replenishes one of the interme- diates of the Krebs cycle. blasticidin An antibiotic that inhibits protein synthesis in both prokaryotes and biotin labeling (biotinylation) A non- eukaryotes. A gene that confers resistance radioactive labeling system in which bio- to blasticidin (BSD) has been incorpo- tin is covalently linked to a nucleic acid. rated into some plasmid vectors so that the antibiotic can be used to select stable biotransformations See bioconver- cell lines that carry the vector. sions. blastoderm A stage in the develop- biphasic growth curve The growth ment of insect embryos in which a layer curve of a microorganism that is char- of nuclei or cells around the embryo sur- acterized by two exponential growth round an internal mass of yolk. phases separated by a stationary phase. Such a growth curve is produced by blastula The stage in animal develop- culturing the organisms on two carbon ment in which a ball of cells is formed sources, in which one carbon source is from the cleavage of cells of the zygote. in a limiting concentration and must be used up before the second carbon source blood agar A culture medium in which can be utilized. animal blood, usually rabbit or horse, is added to provide nutrients or to be used bispecifi c antibodies Antibodies in diagnostically for hemolysins (enzymes which the two binding sites recognize dif- that lyse red blood cells) secreted by cer- ferent antigens. Such antibodies can have tain strains of bacteria. one binding site recognize the antigen of a tumor cell, and the other antigen rec- blood groups See ABO blood ognize the antigen of a cytotoxic (T cell) group. lymphocyte, thus effecting the killing of the tumor cell by the cytotoxic T cell. Bloom syndrome (telangiectatic ery- Biospecifi c antibodies can be produced thema) A rare autosomal recessive dis- chemically, or biologically by fusion of ease characterized by spider veins (telan- two monoclonal antibodies, producing giectases), sensitivity to light, impairment hybridomas or cells. of growth and the immune system, and a predisposition to cancer. Bloom’s syn- bithorax A genetic locus in the homeotic drome is caused by a mutation in a gene box defi ned by mutations that cause devel- called BLM, at gene map locus 15q26.1. opmental defects in the thorax region of The BLM protein is a DNA helicase.
30 干细胞之家www.stemcell8.cn ←点击进入
branched-chain alpha-ketoacid dehydrogenase
blot A nylon or nitrocellulose mem- homology, about 20 so-called growth/ brane onto to which nucleic acids or differentiation factors (GDFs) have been proteins are transferred for the purpose classifi ed as BMPs. BMPs are being tested of hybridization or interaction with anti- as a means of inducing bone growth at bodies. See northern blot and South- sites of extensive injury or after surgical ern blot hybridization. procedures involving bone removal.
blotting, capillary diffusion A pro- Bovine somatotrophin (BST) A cedure that transfers nucleic acid from a growth hormone that has been manufac- gel to a nylon or nitrocellulose membrane tured in large quantities through recom- by capillary diffusion, that is, movement binant DNA techniques used to enhance of water through the gel and through the the production of milk. This is a very membrane that results in depositing and controversial product because of the pub- trapping the nucleic acid on the mem- lic’s concern over the long-term effects brane as the water moves. of recombinant DNA on the quality and safety of food. blotting, electrophoretic A variant of capillary-diffusion-blotting procedure Boyer, Herbert (b. 1936) A biochem- but using an electrical fi eld to facilitate ist whose discovery of restriction enzymes the transfer of the nucleic acid to the and their application in creating recombi- membrane. nant DNAs initiated the fi eld of genetic engineering. He and Stanley Cohen cre- blunt-end DNA Both strands of DNA ated the fi rst recombinant DNAs that at one end are even; that is, there are could be grown in bacteria. In 1976 he no single-stranded overhangs. This term and Robert Swanson founded Genentech is often used in reference to restriction (for genetic engineering technology), the enzymes that cut the DNA at the same fi rst biotechnology company. In 1985 position on both strands, as opposed to Genentech was the fi rst biotech company enzymes that make staggered cuts. to produce a biopharmaceutical product, human growth hormone. blunt-end ligation A cloning tech- nique in which both the vector and the branched-chain alpha-ketoacid dehy- insert to be spliced into the vector have drogenase (BCKDH) An enzyme that, blunt ends that must be joined together by if inactivated by mutation in any of the the enzyme ligase. Such a ligation is more subunit genes (E1a, E1b, E2, E3), leads to diffi cult to achieve than one in which the a condition know as Maple Syrup Urine vector and the insert have complementary Disease (MSUD). BCKDH is necessary single-stranded overhangs that fi rst form for the metabolism of the three branched- hydrogen bonds before the ligation step. chain amino acids: leucine, valine, and isoleucine. Enzyme defi ciency results in blunt ends See blunt-end DNA. spillover of these amino acids and their corresponding alpha-ketoacids into the B lymphocytes The antibody-producing blood and urine, giving the urine a char- cell of the humoral immune response. acteristic color and odor from which the When stimulated with antibody, these name of the condition is derived. MSUD cells divide and differentiate into plasma was fi rst described in 1954 and leads to cells that secrete antibodies. mental and physical disabilities and can be fatal if untreated. The genes for the BMP Bone morphogenetic proteins; different subunits are located on differ- a family of proteins that can induce the ent chromosomes: E1a at gene map locus formation of new bone (osteogenesis). The 19q13.1, E1b at gene map locus 6p21-22, gene sequences of the BMPs place them in E2 at gene map locus 1p21-31, and E3 at the TGF-b superfamily. Based on sequence gene map locus 7q31-32.
31 干细胞之家www.stemcell8.cn ←点击进入
branch migration
branch migration A proposed step system, and therefore the disease is char- in the process of DNA recombination, acterized by many types of systemic and or DNA crossing over, in which there is pulmonary infections. Infections begin at movement of the crossover point of the about six months of age when the mater- recombinant intermediate. nal antibodies begin to decline. In the absence of B-cell maturation, the organs BRCA1/BRCA2 The fi rst breast can- where B-cell maturation normally takes cer genes identifi ed. Both genes are place (the spleen, tonsils, adenoids, Peyer tumor-suppressor genes. Mutations in patches, and peripheral lymph nodes) these genes are believed to be responsi- are often reduced in size or completely ble for about half of the inherited forms absent. The BTK gene is found on the X of breast cancer. Individuals inherit one chromosome at gene map locus Xq21.3. copy of the mutated gene because if an embryo possesses two copies of the buffer A substance in liquid that tends mutant gene, it does not survive. to resist changes in pH, by absorbing either hydrogen or hydroxyl ions. breakage and reunion Physical break- age of DNA molecules and rejoining of Burkitt’s lymphoma A tumor that parts of two different molecules, result- is relatively common in East Africa and ing in recombination or crossing over. New Guinea but rare in other parts of the world. The Epstein-Barr virus (EBV), 5-Bromouracil (5-BU) A chemical the etiological agent of infectious mono- that causes mutations in DNA because it nucleosis, is associated with this disease, resembles thymine, a natural constituent but it is not currently known whether the of DNA. When incorporated into DNA in relationship of the virus to the disease is place of thymine in its enol-shifted form, casual or causal. it can readily pair with guanine. In its presence, an A-T base pair is replaced by a bursa of Fabricius A lymphoid organ G-C base pair after two rounds of replica- of the chicken that is responsible for the tion. This is called a transition mutation. maturation of B lymphocytes. The B cells were so named because of this organ. broth A liquid culture medium for However, humans and other mammals microorganisms. do not possess a bursa, and its equiva- lent in these organisms is probably other Bruton Agammaglobulinemia An X- lymphoid tissues, such as the tonsils, the linked immunodefi ciency disease in males appendix, Peyer’s patches, and the lym- that is caused by mutations in a gene phoid follicles. that codes for an enzyme known as the Bruton tyrosine kinase (BTK). The BTK burst number The number of viral enzyme is necessary for the maturation of particles that are produced per cell after antibody-producing B cells of the immune infection.
32 干细胞之家www.stemcell8.cn ←点击进入
AC
C3 cycle The Calvin cycle or that part CAAT box A consensus nucleotide of photosynthesis where CO2 is fi xed to sequence in DNA that has homology to form a three-carbon organic compound GGT(orC)AATCT and that is found in that is subsequently converted into a six- the promoter region of many eukaryotic carbon sugar. genes and is required for effi cient tran- scription.
C4 cycle The Hatch-Slack pathway, or an accessory very effi cient pathway to fi x cadherins A family of proteins found CO2 used by plants that grow in hot dry on the cell surface that mediate cell-cell climates with low CO2 levels. adhesion and that play a central role in normal development. The cadherins are responsible for the selective cell-cell C600 A strain of E. coli that is com- adhesion that accounts for the cell sort- monly used in genetic experiments and as ing by which cells are placed at their a host for cloned plasmids. proper sites during development. The typical cadherin protein has fi ve tan- Cot value A parameter describing the dem repeated extracellular segments, a rate at which complementary strands of single membrane-spaning segment, and DNA reassociate with one another to a cytosolic domain. Cadherins function form double-stranded DNA. Cot values as a signal transduction element in the are of signifi cance historically because Wnt signaling pathway. Cell-cell bind- the theoretical relationship between C t o ing by E cadherins releases membrane- and reassociation rate underlies the prin- bound src, which acts to induce cyclin ciple of DNA probe hybridization. D through beta catenin. There is also If DNA is denatured to a single- recent evidence that altered expression stranded state and then allowed to reassociate back to its native double- of cadherins may be involved in invasion stranded form, the extent of reassocia- and metastasis of tumor cells. tion for any particular DNA sample increases (1) with DNA concentration caldesmon A calmodulin-binding pro- when allowed to renature for a given tein involved in the regulation of contrac- amount of time or (2) with time at a tion in smooth muscle. At high calcium con- given DNA concentration. centrations caldesmon binds to the Ca++- Cot is the product of the two variables: calmodulin complex. This leads to muscle Cot = (DNA concentration) × (the time contraction by allowing muscle actin to allowed for reassociation). make contact with myosin. The concentration (C) of double- stranded DNA formation as a function calmodulin A ubiquitous calcium- of Cot is: binding protein that serves as an intracel- ++ C/Co = 1/(1 + kCot) lular receptor of Ca and, in its active where k is the reaction rate constant and form, mediates an intracellular response ++ Co is the initial concentration of unpaired to Ca as a second messenger. See sig- DNA. nal transduction.
33 干细胞之家www.stemcell8.cn ←点击进入
rectocalorie
E-cadherin integrin
a b Wnt ILK Frz b -catenin b -catenin a a Dsh a a
Src actin conductin actin b -catenin axin P cytosol GSK-3b b -catenin b -catenin
Apc Apc Tcf-4
b -catenin P Tcf-4 b -catenin
[transcription] P GSK-3b proteolysis cyclin D1 cyclin D1 myc nucleus
Cadherins function as a signal transduction element in the Wnt signaling pathway
calorie A unit of energy measurement: smooth muscle. Binding of calponin to the amount of energy needed to raise the muscle myosin head groups results in a temperature of 1 gram of water by 1°C. state of relaxation.
calpains A group of calcium-dependent cAMP See cyclic AMP. proteases that act on various cytoskeletal, membrane, and certain proteins involved in cancer A class of diseases in which regulatory processes. Calpains exist in two normal cell control is lost so that certain major isoforms—calpain I and calpain II— cells in the body proliferate uncontrol- that have different calcium requirements lably, invade other tissues, and spread to for activation. Calpains has been linked to distant sites (metastases) in the body. both neurodegenerative conditions, includ- ing ischemia and Alzheimer’s disease. Cal- CAP Catabolite activator protein, or pain appears to play a role in apoptosis. catabolite repressor protein (CRP); a pro- Calpain-mediated proteolytic activation of tein that when bound to cAMP will bind apoptotic pathways leading to cell death is to the promoter region of some operons, a late-stage event brought about by exci- encoding enzymes that metabolize sug- totoxic compounds, and therefore, thera- ars in bacteria to enhance transcription. peutic strategies aimed at limiting neuronal Thus, the protein bound to cAMP acts as damage by selectively inhibiting calpains a positive regulator of transcription. See are currently under investigation. lac operon.
calponin A protein of about 34 kDa capped 5′ ends A methylated guano- involved in regulation of contraction in sine residue attached to the 5′ end of a
34 干细胞之家www.stemcell8.cn ←点击进入
cardiac muscleverso
eukaryotic mRNA. The bond is made isms, but fats and some amino acids can between the 5′ phosphate group of the also be utilized for energy production. nucleotide and the 5′ end of the RNA, so the nucleotide is referred to as inverted. carbonyl group The atoms of car- This cap may give stability to the mRNA. bon and oxygen, in which the oxygen is bonded to the carbon via two chemical capping of mRNA The posttranscrip- bonds, C = O. tional process that adds a guanosine resi- due to the 5′ end of a eukaryotic mRNA carboxyl group The atoms of carbon, and then methylates it. oxygen, and hydrogen, in which one oxy- gen is bonded to the carbon via a double capsid The protein coat of a virus. bond and the oxygen and hydrogen form a hydroxyl group (OH) and are bonded capsomere The protein subunits of the to the carbon via a single bond with the capsid. oxygen: –C=0 capsule An envelope of carbohy- | drate, or a slime layer surrounding some OH microorganisms. Capsules contribute to Carboxyl groups are found on organic the invasiveness of some bacteria because acids. they enable the organisms to evade phagocytosis. carboxyl terminus The end of a mol- ecule where a carboxyl group is found. carbohydrate A sugar or the name for Proteins that are made up of amino acids molecules that contain carbon hydrogen have a carboxyl terminus and an amino and oxygen in the ratio, CnH2nOn and terminus. that can be simple monomers, such as glucose or fructose; disaccharides; or two carboxypeptidases Enzymes that re- molecules joined together by a glycosidic move successive amino acids from pro- bond (see glycoside), such as sucrose teins starting at the carboxy terminal end (common table sugar) or lactose (milk (see above) by hydrolyzing the peptide sugar); or polymers containing as many bond between amino acids. as thousands of simple sugar molecules, such as starch, cellulose, and glycogen. carcinogen A cancer-producing agent or any chemical or physical agent that carbon dioxide cycle The fl ow of CO2 can produce a tumor in an animal or from organisms that can photosynthe- cause normal cells in culture to become size (plants and algae) and convert it into transformed. organic foodstuffs to all other organisms that consume the organic molecules and carcinogenesis The process by which give off CO2 as waste product. a normal cell transforms into a cancerous one. See transformation. carbon fi xation The process by which plants and algae (photosynthesizers) con- carcinoma A tumor derived from vert inorganic carbon, CO2, into organic epthielial cells. molecules, specifi cally carbohydrates, that are used as food for other organisms. cardiac muscle The muscle tissue of the heart, thus responsible for pumping carbon source Any organic carbon- blood through the body’s circulatory containing molecule that can be metabo- system. It is striated and looks very simi- lized to produce energy in the form of ATP lar to skeletal muscle, but both muscles in an organism. In general, carbohydrates use different carbon sources for energy serve as carbon sources for most organ- production.
35 干细胞之家www.stemcell8.cn ←点击进入
rectocarotene (beta)
carotene (beta) A specifi c carot- ate conditions are moved behind promot- enoid found in plants that assists in ers where they can be expressed. Cassettes light absorption by the chloroplasts. This can be constructed in the lab by fl anking pigment gives the red color to such veg- the gene or sequence to be made into a etables as carrots, tomatoes, and yellow cassette with restriction enzyme cutting squash. sites.
carotenoids A family of pigments that catabolic pathway A series of reac- can absorb a range of wavelengths of light tions that breaks down compounds to and funnel the energy to chloroplyll a, the simpler ones, usually with the release of major photosynthetic pigment of plants. energy that is trapped into high-energy Thus, these accessory pigments greatly molecules such as ATP. extend the range of wavelengths of light that can be used for photosynthesis. catabolism The degradation of com- plex substances to simple ones. carrier A substance involved with the transport of materials. catabolite A substance that can be bro- ken down by an organism to yield energy, carrier protein A protein embedded usually in the form of ATP. within the cell membrane that binds to a specifi c compound or group of related com- catabolite repression A process found pounds and aids in transporting it from the in certain bacteria in which there is outside of the cell through the membrane decreased synthesis of enzymes invol- lipid bilayer to the interior of the cell. ved in catabolism when a preferred alternative catabolite is present. For casamino acids A mixture of amino example, the enzymes that metabolize acids that results from the enzymatic the sugar lactose are not synthesized by breakdown of the milk protein, casein. bacteria when they are grown on the sugar glucose. cascade A series of reactions that is trig- gered off by one reaction or compound. catalase An enzyme that breaks down hydrogen peroxide, a toxic waste product casein hydrolysate The breakdown of metabolism, to water and oxygen; usu- product of the milk protein casein to ally found in the microbody or peroxi- its constituent amino acids by either some organelles. enzymes or acid hydrolyzing the peptide bonds between the amino acids. catalysis (catalytic) The acceleration of a reaction by a catalyst. caspase 3 (ced-3) A component of the apoptosis pathway that is activated catalyst A substance or physical agent by cleavage of procaspase 3 by caspase that speeds up a reaction but is not con- 9. Caspase 3 is an effector caspase that sumed during the course of the reaction. directly leads to the macro changes Catalysts in biochemical reactions are observed in apoptosis, such as membrane enzymes. Catalysts change the rate at and DNA damage and large-scale proteo- which reactions approach equilibrium but lytic degradation. Ced-3 is the same pro- do not affect the position of equilibrium. tein characterized independently in the nematode C. elegans. catalytic site The location on an enzyme where the active site or the place cassettes Genes or nucleotide sequences where substrates bind and the reaction that can be easily spliced into chromo- proceeds. The catalytic site brings reac- somes or plasmids. Some cassettes are tants of a reaction close together eliminat- naturally occurring and under appropri- ing the need for random collisions, thus
36 干细胞之家www.stemcell8.cn ←点击进入
versocdks
making it more effi cient for the reaction and HAP5 and stimulates the transcrip- to proceed. tion of various genes by recognizing and binding to a CCAAT motif in promoters. CAT assay An assay for determin- The human gene for CBF is at gene map ing whether a given DNA fragment may locus 6p21.3. contain promoter activity by ligating the fragment to the chloramphenicol acetyl CCBF transciption factor A tran- transferase (CAT) gene in an expression scription factor involved in regulation vector and observing whether the CAT of genes (e.g., Cln1 and Cln2) required enzyme is made when the vector is trans- for progression through the G1 phase of fected into animal cells. See aph. the cell cycle in yeast. The CCBF tran- scription factor binds to a specifi c DNA catenanes Macromolecular rings that sequence called the cell cycle box in the are mechanically interlinked with one promoter region(s) of the critical cell another. Catenanes have been used to cre- cycle genes. ate molecular machines (nanomachines). Catenanes are being tested as nanoscale CD3 A complex of transmembrane robotic devices that may be useful for the proteins in T cells that, in association development of slow-release drug-delivery with the T cell receptor, helps promote systems or to control chemical reactions in an interaction between the T cell and nanoscale laboratories on a chip. another cell containing an antigen on its surface. As a result of this interaction, catenation The linking together of there is a proliferation of T cell clones multiple copies of a macromolecule. that recognize the antigen. A transmembrane protein in CAT gene Chloramphenicol acetyl CD4 t cells that, like CD3, functions in the transferase gene; a bacterial gene that interaction of a T cell with an antigen- catalyzes the transfer of an acetyl group presenting cell to promote the prolifera- to chloramphenicol. The CAT gene is tion of a T-cell clone specifi c for the anti- commonly used as a reporter gene in gen. During the interaction of the T cell experiments designed to demonstrate that and the antigen-presenting cell, CD4 (and certain DNA sequences can function as CD8) activates a tyrosine kinase inside promoters. the T cell that leads to the proliferative response of the T cell. cation A positively charged ion. CD8 A T-cell transmembrane protein C-banding A technique for staining that functions in essentially the same way the highly repeated DNA sequences in the as CD4. region of the chromosome surrounding the centromere. See satellite DNA. cdc An acronym for cell division cycle.
CBF See CCAAT-binding factor. cdks (cyclin-dependent kinases) The enzymatic subunit of the complexes that CCAAT-binding factor (CBF) A tran- regulate progression of a cell through the scription factor complex that binds to the cell cycle. Cyclin-dependent kinases are CCAAT motif upstream of the promoters generally specifi c for tyrosine (tyrosine of many different genes, for example, type kinase) but are inactive unless they are 1 collagen, albumin, and beta-actin genes. complexed with a cyclin; the cyclin thus In the yeast Saccharomyces, CBF binding functions as the regulatory subunit of the induces the transcription of genes required cyclin-cdk complex. Different combina- for growth based on a nonferment- tions of cyclins and cdks control passage able carbon source. CBF consists of four through different phases of the cell cycle. known subunits: HAP2, HAP3, HAP4, In mammalian cells:
37 干细胞之家www.stemcell8.cn ←点击进入
rectocDNA
• Cyclin D-Cdk4 or 6 controls progres- • circumferential belt—a ring of actin sion through G1 phase. and myosin bundles that encircles the • Cyclin E-Cdk2 controls entry to S inner surface (cytoplasmic side) of the phase. cell membrane just at the location of adherens junctions. • Cyclin A-Cdk2 controls progression • hyaluronan (hyaluronic acid: HA) is a through S. long acidic polysaccharide found in • Cyclin A-Cdk1 controls progression the extracellular matrix all over the through G2. cell surface. The presence of HA inter- • Cyclin B-Cdk1 initiates the onset of feres with close cell-cell contacts and M phase. thus inhibits cell-cell junctions that mediate adhesion. • stress fi bers—bundles of actin and cDNA (complementary DNA) The myosin that run internally along the single-stranded complementary DNA ventral surface of cell. Stress fi bers that is copied from mRNA by the enzyme are attached at one end to adhesion reverse transcriptase. plaques, and it is believed that they function in cell movement and cell-sub- cDNA cloning A recombinant DNA strate attachment. technique in which double-standed cDNA • proteins in cell adhesion—cell surface is spliced into vectors so that the gene can proteins that mediate cell-cell adhe- be amplifi ed or expressed. sion. These proteins fall into three major classes: cadherins, selectins, cDNA library A collection of cDNA and immuno globulins. molecules spliced into vectors, made by using all the mRNA molecules in a cell cell coat A layer of carbohydrates that or organism and copying it with reverse protrude out into the extracellular space transcriptase. The library is subsequently from the cell membrane in animal cells screened with appropriate probes to and is seen in the electron microscope as pick out the clone of choice. See clone an electron dense coat on the surface of library and library. the cell.
cell The smallest membrane-bound unit cell culture A population of cells capable of replication. Cells may either grown in a medium. function independently, such as those of unicellular microorganisms, or function cell cycle A sequence of events involved cooperatively as the cells of a tissue or in the replication of the genetic material of organ. the cell and the orderly parceling of it out to two daughter cells. The cell cycle con- cell abalation The selective destruc- sists of the G1, S, and G2 phases that make tion of cells. The technique of cell aba- up the interphase and the M phase or mito- lation is used in studies of the role of sis where chromosome division occurs. differentiating cells in the development of an organism. Genes encoding cytotoxins cell-disruption techniques The re- such as diphtheria toxin are introduced lease of intracellular proteins and nucleic into the cells to be destroyed behind cell- acids from microorganisms. The tech- specifi c promoters. niques to be used depend on the sensitivity of the protein or nucleic acid to be isolated cell adhesion Any mechanical cou- to each treatment and whether the extrac- pling of one cell to another or of a cell to tion procedure is small scale or large scale: a solid support (the substrate). Cell adhe- • chemical—alkali conditions can be sion is mediated by specialized cell-cell or used to release certain proteins from cell-substrate junctions or the extracel- microorganisms in both small-scale lular matrix: and large-scale preparations.
38 干细胞之家www.stemcell8.cn ←点击进入
cell versoplate
• detergents—both ionic such as sodium extract refers to the soluble portion of the lauryl sulfate, or nonionic detergents internal cellular contents after removal of such as Triton X-100 can be used to the organelles and cell membrane debris. destroy the cell membrane and facili- tate cell lysis. cell-free protein synthesis The syn- • enzymatic—lysozyme, an enzyme pre- thesis of proteins in a test tube using a pared from hen egg whites, breaks cell-free extract to supply the necessary down the peptidoglycan cell wall of enzymes and components and dependent bacteria. on addition of amino acids and mRNA. • grinding—physical disruption of the bacterial cell wall by grinding with an cell fusion The process of fusing two abrasive material such as glass beads. different cells together, fi rst creating a This can be done either in small scale heterokaryon that contains both of the with a mortar and pestle or in large nuclei and then a fusion of the nuclei to scale using a cell disrupter apparatus. create a synkaryon. The fusion occurs • osmotic shock—release of proteins by reaction between the two cell mem- from the periplasmic space of Gram- branes, brought about by treatment with negative bacteria (see Gram stain) by Sendai virus or polyethylene glycol. resuspending the cells fi rst in a solu- tion of 20 percent sucrose and then cell line A cell culture started from resuspending them in water. a particular type that can be cultured • shearing—passage of cells through a indefi nitely in the laboratory and is thus narrow orifi ce at high pressure. Small- characterized as “immortal.” scale operations may use solid shear in which frozen cell are forced through cell lineage A complete set of ancestral the orifi ce. Large-scale preparations cells and cell divisions that makes up a use liquid shear. certain cell type during development. • sonication—disruption of cell walls by high-frequency sound waves. cell-mediated immune system See cell-mediated immunity. cell-division-cycle genes Any of approximately 50 genes that control the cell-mediated immunity A type of cell cycle in yeast. immunological response that is mediated by cytotoxic T lymphocytes or killer T cell-division-cycle mutant Cell-division- cells and is used by the body to destroy cycle temperature-sensitive mutants of cells that carry foreign antigens, such as yeast that either become blocked or show virally infected cells, tumor cells, and aberrent behavior in various parts of the nonmatching tissue grafts. cell cycle at a temperature at which the mutation can be expressed (the restrictive cell membrane The boundary that temperature). See cell cycle. limits the cell contents from its environ- ment. It is composed of a phospholipid cell fractionation The process of pre- bilayer that is associated with proteins paring a cell-free extract and dividing the either embedded in the bilayer (intrin- cell contents into fractions by centrifuga- sic or transmembrane) or external to it tion techniques. (extrinsic). The cell membrane provides a selectively permeable barrier to the cell, cell-free extract The product of treating allowing entrance by substances that are a suspension of cells with a substance(s) needed by the cell and preventing leakage that destroys the cell wall (in the case of of important substances out. bacteria and plants) and/or the cell mem- brane, thus releasing the cytoplasm and cell plate The boundary between two cell organelles. Sometimes the cell-free newly formed nuclei in a plant cell that is
39 干细胞之家www.stemcell8.cn ←点击进入
rectocell sorter
about to divide into two daughter cells; centimorgan (cm) One hundredth of these daughter cells consist of cell wall a morgan, the unit of genetic distance material and cell membrane that grows or a map unit distance, named in honor and eventually becomes contiguous with of Thomas Morgan’s contribution to the existing cell wall and cell membrane. mapping genes in Drosophila. The cen- It is also called the phragmoplast. timorgan is defi ned by recombination frequency between two genetic markers cell sorter An instrument used to sepa- expressed as a percentage. rate and analyze different classes of cells from mixed populations. The fl uorescence central dogma The concept that all activated cell sorter (FACS) separates dif- genetic information fl ows from DNA. ferent cell types in a population based on The information in the DNA is passed external antigens that bind to antibodies on to progeny cells by the process of labeled with fl uorescent dyes. DNA replication, and the information stored in DNA is fi rst transcribed into cell sorting The process of sorting RNA, which is then translated to syn- out different cell types in a heteroge- thesize proteins. neous population. See fl uourescence- activated cell sorting. central nervous system The sensory and motor cells (neurons) of the brain cell synchronization The process by and spinal cord. which all cells in a population come to be in the same phase of growth and conse- centrifugal force The force that tends quently undergo cell division simultane- to impel substances outward from a cen- ously. ter of rotation.
cell theory The theory that states that centrifuge An instrument that sepa- the cell is the basic structural unit of all rates substances from liquids by centrifu- organisms and that all cells arise from gal force and separates substances from preexisting cells. other substances based on how each moves in a centrifugal fi eld. cellulase An enzyme that hydrolyzes long polymers of cellulose to cellobiose, centriole A structure composed of which is a disaccharide of glucose units. microtubules that is found in the nucleus and is involved in the formation of the cell wall The rigid or semirigid layer spindle apparatus that aids in the orderly peripheral to the cell membrane of bacte- parceling out of duplicated chromosomes ria, algae, fungi, and plants. In plants the to daughter cells in the process of cell cell wall is composed of microfi brils of division. The centriole is also identical in cellulose embedded in a matrix. The bac- appearence to the basal body, the organ- terial cell wall, the peptidoglycan layer, elle that is embedded at the periphery of is a complex structure of chains of alter- the cell and serves as the base of the cell’s nating residues of N-acetylmuramic acid locomotive appendages, the fl agella and and N-acetyl glucosamine held together cilia. by peptide bridges. centromere The point along the chro- Center for Inherited Disease Research mosome to which duplicated sister chro- (CIDR) A center of the National Insti- matids are joined before the chromo- tutes of Health (NIH) supported by nine somes are divided into the two daughter of the NIH institutes to provide genotyp- cells. It also serves as the site of attach- ing and statistical genetics services for ment of the kinetochore, the structure on researchers identifying genes that cause which microtubules of the spindle appa- human disease. ratus attach to pull the duplicated chro-
40 干细胞之家www.stemcell8.cn ←点击进入
Charon phageverso
mosomes to opposite ends of the cell dur- brain, that consists of a pair of hollow, ing mitosis. convoluted lobes.
centromere binding factor A com- cesium chloride gradient centrifuga- plex of proteins that binds to a particular tion A method used to separate and/or DNA sequence in the centromeric region purify molecules, usually nucleic acids. of the yeast chromosome (the CEN The nucleic acids to be separated are sequence) and also to one of a microtu- mixed with an appropriate density of the bule in the spindle fi ber. In this way, the dense chemically inert salt, cesium chlo- centromere binding factor forms a physi- ride, and centrifuged at high speeds for cal connection between the chromosome hours to days. The cesium chloride estab- and the spindle apparatus during mitosis. lishes a density gradient during the cen- trifugation, and the molecules of nucleic centromeric sequences Special nucleo- acid move up or down the gradient to tide sequences in the DNA of chromosomes reach their position of bouyant density in that serve as sites where the spindle appara- the gradient. tus attaches to chromosomes during mito- sis. See yeast artifi cial chromosomes. CFTR See Cystic Fibrosis Trans- membrane Conductance Regulator. centrosome The cell center or a micro- tubule organizing center consisting of CH choline A small alcohol of the granular material surrounding two cen- 3 structure, HO–CH –CH –N(CH ) , that trioles (see centriole). 2 2 3 3 is found in membrane phospholipids and is part of the important neurotransmitter, cephalosporin-C One of a group of acetylcholine. antibiotics, the cephalosporins, that is produced by the fungus Cephalosporium and that resembles penicillin in structure channel protein A cell-membrane- and mode of action. embedded protein, part of a channel structure that allows substances of appro- cerebellum Part of the hindbrain con- priate size and charge to pass through the sisting of two hemispheres and a small membrane by diffusion. central portion. chaotrophic The ability of an agent to cerebroside A class of membrane lipids disrupt the structure of water. Such sub- derived from sphingosine similar in struc- stances weaken hydophobic interactions. ture to gangliosides but differing in that cerebrosides have only a single sugar mol- chaperones Proteins responsible for ecule. Both gangliosides and cerebrosides the proper folding of proteins once they are widely found in the cell membranes are translated (see heat-shock genes). of neural cells, where they play essential roles in neural functioning. Chargaff’s rules The discovery that in DNA the concentration of adenine always cerebrospinal fl uid (CSF) The fl uid equals the concentration of thymine and that is produced in the ventricles of the that the concentration of guanine always brain and fi lls the ventricles and the cen- equals the concentration of cytosine. tral canal of the spinal cord. It serves to cushion the brain and protect it from Charon phage A vector used for clon- blows to the skull or bruises resulting ing DNA constructed from bacteriophage from sudden movements of the head. lambda. The name Charon is taken from the ancient Greek myth of the ferryman cerebrum That part of the brain, Charon, who transported the spirits of located above and in front of the hind- the dead across the river Styx.
41 干细胞之家www.stemcell8.cn ←点击进入
rectocheckpoint
checkpoint Places in the cell cycle where some limiting nutrient to the removal of specialized processes can arrest progression spent medium and cells. through the cell cycle. Cell-cycle arrest at a checkpoint is generally caused by DNA chemotaxis The movement of an damage or other type of injury at an early organism to an attractant and away from stage, which would lead to malfunction. a repellant.
chelator An organic compound in chemotherapy The treatment of a dis- which atoms form bonds with metals, thus ease with chemicals, but the term is usu- removing free metal ions from solution. ally used to defi ne the treatment of can- cer with drugs that selectively kill faster chemiluminescence The emission of light growing tumor cells. as the result of a chemical reaction. Che- miluminescence is widely used as a means chemotroph An organism that obtains of detecting DNA and protein probes in its energy from the oxidation of chemi- various analytic techniques, particularly in cal bonds. See chemoautotroph and Southern, northern, and western blotting. chemo organotroph.
chemiosmotic theory A model pro- chiasma (chiasmata, pl.) The location posed by Peter Mitchell that couples elec- of a crossover event between two chro- tron transport to oxidative phosphoryla- matids in the tetrad structure of synapsed tion (ATP synthesis during respiration) duplicated pairs of chromosomes that or photophosphorylation (ATP synthesis occurs during prophase I of meiosis. during photosynthesis). It postulates that the energy needed to drive the synthesis chimera An animal formed from ATP is stored in a proton gradient across aggregates of genetically different groups the inner membrane of the mitochondrion of cells. Chimeras are made by combining or the thylakoid membrane of the chloro- early stage embryos that arise from fertil- plast and that this gradient forms dur- ized eggs of two different sets of parents ing electron transport. When the gradi- or by injecting cells from an early embryo ent is relieved by the transport of protons of one genotype into the blastocyst of across the membrane, the stored energy is another genotype. The term chimera is used to drive the synthesis of ATP. derived from the name of the mythologi- cal creature with the head of a lion, the chemoautotroph An organism that body of a goat, and the tail of a serpent. obtains its energy from the oxidation of chemical bonds, usually the oxidation of chimeric DNA A recombinant DNA inorganic metal ions, and can use inor- molecule, or one in which a fragment of ganic carbon (C) or carbon dioxide (CO2) DNA from a some source is spliced into a to make biological molecules. vector from another source.
chemolithotroph A synonym for chiral compound A compound, usu- chemoautotroph. ally a carbon compound, that is optically active, that is, has the ability to rotate the chemoorganotroph An organism that plane of polarized light to the left or to obtains its energy from the oxidation of the right, due to its ability to exist in one chemical bonds and requires organic car- of two mirror images. See enantiomers. bon compounds for growth. A heterotroph. chirality The nonidentity of a compound chemostat An apparatus used to main- with its mirror image. See enantiomers. tain a bacterial culture in continuous cul- ture or exponential growth. This is done chi sequence A sequence of bases on the by coordinating the rate of addition of genome of the bacterium E. coli that signals a
42 干细胞之家www.stemcell8.cn ←点击进入
chitinverso
nuclease to cut at that site for recombination cular DNA molecules, is cut by a restric- or crossing over to occur. It serves as a hot tion enzyme that cuts each circular DNA spot of recombination as it is used preferen- once. The name is derived from the fact tially as a site where recombination occurs. that the four-armed structure, as seen by electron microscopy, resembles the Greek chi structure The structure generated letter chi. when the fi gure eight–shaped molecule, which is an intermediate form in the pro- chitin The structural polysaccharide pre- cess of recombination between two cir- sent in the exoskeleton of insects, in the cell
Chi structure
43 干细胞之家www.stemcell8.cn ←点击进入
rectochk kinases
walls of fungi, and in crustacean cells com- partially digested fats and proteins in the posed of units of N-acetylglucosamine. duodenum.
chk kinases A group of critical inter- cholera toxin A toxic protein produced mediates (Chk1, Chk2, and Chk3) in an by the bacterium Vibrio cholerae that important type of checkpoint control that causes the disease cholera. Cholera toxin operates in the G2 phase of the cell cycle. acts by binding to a receptor (GM1 gangli- Chk kinases block mitosis in cells that oside) present on intestinal mucosal cells. have undergone DNA damage and other This activates adenylate cyclase, which types of injury by phosphorylating cdc25, stimulates the formation of cAMP, which, + + which then becomes inactive. Inactivation in turn, causes rapid loss of H20, Na , K , - - of cdc25 stops the dephosphorylation of Cl , and HCO3 into the small intestine. cdc2, which is normally carried out by The lost H2O and electrolytes are replaced unphosphorylated cdc25. from the blood, which causes the diarrhea, loss of electrolytes, and dehydration that chloramphenicol An antibiotic pro- are characteristic of cholera. If untreated, duced by Streptomyces venezuela that the disease ultimately progresses to shock, inhibits protein synthesis in bacteria, kidney failure, and death. The toxin con- mitochodria, and chloroplasts but not in tains fi ve binding (B) subunits, an active higher organisms. It is used to amplify (A1) subunit, and a bridging piece (A2) recombinant DNA molecules when a that links A1 to the fi ve B subunits. The plasmid vector is used to make the recom- A1 subunit is an enzyme that transfers binant. Chloramphenicol will specifi cally ADP ribose from NAD to a G protein that inhibit the host cell’s replication because more or less irreversibly maintains adenyl it is dependent on new protein synthesis cyclase in an active state. but will not inhibit certain plasmid repli- cation. Thus, in the presence of the anti- cholesterol A nonpolar lipid molecule biotic, the recombinant molecule prefer- containing four conjugated rings that is a entially replicates as many as 200 copies major component of cell membranes and per cell. which is the precursor molecule for a vari- ety of important biomolecules, including chlorophyll A light-absorbing pig- steroid hormones, vitamin D, and bile ment found in the chloroplasts of plants salts. Cholesterol is carried by lipopro- and algae that is essential as an electron teins in the blood that are responsible for donor in the process of photosynthesis. It carrying cholesterol to sites where it can is the pigment that gives the green color be metabolized. Inappropriate deposition to plants. of cholesterol in the arterial wall is a fac- tor in the formation of plaques that leads chloroplast The organelle in plant cells to atherosclerosis. and algae that is responsible for photo- synthesis. It contains the chlorophyll and cholinergic The term applied to all the proteins used to carry out the reac- neurons that utilize acetylcholine as a tions of photosynthesis. neurotransmitter.
cholecystokinin A small polypeptide cholinergic neuron Pertaining to the hormone secreted by the mucosal epithe- general class of neurons that utilizes ace- lial cells of the duodenum and also by the tylcholine as a neurotransmitter. nerve cells of the enteric nervous system that stimulates the release of digestive chondroitin sulfate A sugar acid that is enzymes stored in the pancreas and bile commonly a component of the fuzzy layer, stored in the gallbladder into the small an extracellular layer of collagen and gly- intestines. The secretion of cholecys- cosaminoglycans peripheral to the cell tokinin is stimulated by the presence of coat of some animal cells.
44 干细胞之家www.stemcell8.cn ←点击进入
chromatin remodelingverso
chromatid One of the daughter- chromatin to allow access of transcription duplicated chromosomes that is joined at factors to the promoter regions of genes. the centromere to its sister chromatid Chromatin remodeling is carried out by and is seen at the prophase and meta- protein complexes known as chromatin phases stages of mitosis and meiosis. remodeling factors (or “machines”) that temporarily remove nucleosomes from chromatin The material of the chro- the DNA in regions of DNA where the mosome, consisting of DNA associated transcription factors bind. The remodeling with histone proteins. complex in yeast is called the SWI/SNF complex, which contains an ATP-binding chromatin remodeling The process protein that provides energy for the move- of altering the DNA-protein complexes in ment of the complex along the DNA.
estradiol
vitamin D3
cholesterol
testosterone cortisol
Derivatives of cholesterol
45 干细胞之家www.stemcell8.cn ←点击进入
rectochromatographic techniques
chromatographic techniques • high-performance liquid chromatog- • affi nity chromatography—a technique raphy (HPLC)—a chromatographic for separating a substance from a method in which a high resolution of mixture based on its natural tendency separation is achieved by improve- to bind to another substance (a ligand) ments in the packing of columns and for which it is said have an affi nity. the fl ow of solvents through the col- In affi nity chromatography, a liquid umns under high pressure. Such a suspension or solution containing the method yields very sharp peaks of mixture is generally poured through a substances eluted from the column. hollow column containing the ligand • hydroxyapatite chromatography—the that is bound to some inert supporting separation of molecules based on substance. The substance to be sepa- their relative binding to a column pre- rated remains bound to the ligand in pared with calcium phosphate. Such the column while the unbound mol- a column is used to separate double- ecules in the mixture pass through the stranded DNA that will bind to it column. from single-stranded DNA, which will • column chromatography—the sepa- pass through. ration or purifi cation of substances, • ion-exchange chromatography—the se- generally proteins, based on their spe- paration of substances based upon cifi c binding to a column, prepared their charge and thus their affi nity to a by attaching a ligand to some support column prepared with a charged sup- that will specifi cally bind to the sub- port material. Substances are eluted stance and washing the bound column from the column with a solution of with a solution that will compete with ions that compete with the substances the bound substance for the column. binding to the column. • gas-liquid chromatography (GLC)—a • paper chromatography—the separation type of chromatography in which of substances based on their relative substances in a sample are evapo- solubilities in a mixture of solvents. rated into a stream of an inert gas Substances to be separated are applied such as argon, helium, or nitrogen to paper support, and the solvents and then separated at a high tempera- travel up or down the paper via capil- ture by passing the evaporated mate- lary action, dissolving and transport- rial through a column containing a ing the substances on the paper. liquid, such as silicone oil or polyeth- • reverse-phase chromatography—the se- ylene glycol, on an inert matrix mate- paration of substances based on their rial such as fi rebrick. relative hydrophobicities. The sup- • gel-exclusion chromatography—a vari- port matrix is prepared to contain ant of gel fi ltration in which sepa- large hydrophobic carbon chains that ration of substances in a mixture is will bind hydrophobic proteins more achieved by collecting the fraction of strongly and are thus eluted from the the sample containing the molecules column more slowly than hydrophilic whose size is greater than the exclu- ones. sion size of the gel beads. • thin-layer chromatography—the same • gel-fi ltration chromatography—the se- as paper chromatography, but the sup- paration of molecules, generally pro- port is a glass plate that is coated with teins, based on their sizes, as seen by a silica gel. their fl ow through a column prepared with porous beads of a carbohydrate chromatography An analytical tech- polymer that will trap smaller mole- nique used to separate molecules from cules impeding their fl ow but permit each other based on differences in their larger molecules to fl ow faster. This affi nities and/or migration on some sup- procedure is also called molecular port resulting from the fl ow of a solvent sieving. See gel fi ltration. (see specifi c types in chromatographic
46 干细胞之家www.stemcell8.cn ←点击进入
chromosome walkingverso
techniques). Chromatographic meth- • S phase — Relaxation of the chroma- ods differ with respect to the nature of tin and unwinding of the DNA helices the solid support and the type of mobile during DNA replication phase (solvent). • G2 phase — Condensation of chroma- tin begins. chromogenic label Any molecule atta- ched to a biological probe molecule that • Mitosis generates a colored compound(s) as a PROPHASE — Sister chromatids become means of visualizing the location and detectable. amount of probe bound to a particular Assembly of the mitotic spindle target. Breakdown of the nuclear envelope METAPHASE — Alignment of centro- chromomeres The beadlike structures meres on lampbrush chromosomes that are seen ANAPHASE — Disjunction of sister during meiosis when the chromosomes chromatids become extended. See lampbrush chro- mosome. TELOPHASE — Disassembly of chromo- somes chromosomal mutation A change in the sequence of base pairs of the DNA chromosome jumping See chromo- encoding a gene that results in a change some walking. on the protein. The change can be as simple as a change in one base (missense chromosome mapping The techni- mutation involving one amino acid on the ques used to assign specifi c genes loca- protein) or the addition or deletion of one tions on the chromosome, based upon base (resulting in a change in the reading crossover frequencies and linkage fre- frame, thus affecting many amino acids quencies between genes. on the protein), to more complex changes, such as the addition or deletion of many chromosome puffs The uncoiled re- bases or the transposition of part of one gions of DNA found on the giant poly- chromosome to the other. tene chromosomes of the salivary glands of certain members of the Diptera group chromosome The structure in the (e.g., fruit fl y) with the appearance of nucleus that contains the genetic informa- puffs when observed by conventional tion composed of DNA and the histone light microscopy, which have been shown proteins associated with the DNA. The to be sites where the chromosomal DNA term chromosome is also used to refer is actively in the process of transcription. to the genes-containing unit of bacteria, viruses, mitochondria, and chloroplasts, chromosome walking (jumping, although these do not resemble the chro- crawling) A procedure used to locate mosomes of higher organisms in struc- a gene by using cloned genes close to ture or histone content. the target, preparing probes from these genes, and using them to isolate mem- chromosome cycle A term fi rst bers of a genomic library that hybridize coined by Barbara McClintock in 1942 to the probe but contain other genetically to describe the cyclical series of changes linked material. If each member of the in chromosome structure that takes place library contains an insert of 10,000 base during the cell cycle. pairs (bp), a probe that can hybridize to The chromosome cycle: the fi rst 100 bp can be used to isolate a gene that is located 9,000 bp away. If • G1 phase — Chromosomes become the gene is, in fact, located more than dispersed as a result of changes in the 10,000 bp away, then the fi rst probe is way chromatin fi bers are coiled. used to isolate a clone to make a second
47 干细胞之家www.stemcell8.cn ←点击进入
rectochymotrypsin
probe, which can be used in turn to iso- ucts in a cross that does not involve a late a third probe, until the specifi c gene recombination event or crossing over) is found. This procedure is called chro- when crosses are made between genes car- mosome walking because probes are iso- rying two mutations. If two mutations are lated and then used to identify portions found on separate genes, they are said to of the chromosome that are contiguous to be in the trans confi guration; if they are each other. on the same gene, they are in the cis con- fi guration. Complementation will only chymotrypsin A digestive enzyme that occur between transmutations in different hydrolyzes peptide bonds, thus cleaving genes, not in the same gene. proteins to their component amino acids, found in the small intestine. cistron A genetic unit or gene as defi ned by the cis-trans test. cilium (cilia, pl.) Short, hairlike membrane-bounded appendage com- citric acid An organic acid containing posed of microtubules used in the loco- three carboxyl groups and an impor- motion of cells. tant intermediate in a cyclic pathway called the Krebs cycle, tricarboxylic acid A biological timing circadian clock (TCA) cycle, or citric acid cycle that is mechanism that controls a type of natu- responsible for the metabolism of glucose ral synchrony (see cell synchroniza- to water and carbon dioxide in the pres- tion) by controlling cell division. ence of oxygen. cis A term used in genetics to defi ne an c-jun N-terminal kinase (JNK1, event or gene whose action occurs on the JNK2) An enzyme that activates the same chromosome. transcription factor AP-1 (AP-1 is identical to the oncogene product jun) by cis acting Pertaining to a genetic ele- addition of phosphate groups to certain ment that exerts an effect on a target amino acids at the N-terminal end. located within the same unit. For exam- ple, a promoter element is said to be cis acting with respect to the genes it controls clathrate A semisolid structure in which because both are on the same strand. water molecules assume a cagelike structure around a “guest” molecule. In the most cis-acting gene A regulatory gene that common clathrates, the guest molecule is controls transcription of genes that lie methane (CH4). These types of clathrates near it on the same chromosome by bind- (also known as hydrates) were discovered ing protein factors needed to turn tran- by Sir Humphrey Davy in 1810. In the nat- scription on or off. See cis-trans test. ural environment, methane clathrates are formed by bacterial or thermal degradation cis face The portion of the Golgi com- of organic materials in oceans. Clathrates plex stack of vesicles that has just formed, are under consideration as a possible source also called the forming face, which is of renewable energy. oriented toward the rough endoplasmic reticulum. See Golgi apparatus. clathrin A large protein that forms a basketlike structure around vesicles that cisterna A fl attened membrane-bound transport molecules into or through cells sac, such as found in the endoplasmic or at sites (coated pits) where endocytosis reticulum. will occur.
cis-trans test A test to determine a cleavage 1. The breaking of bonds of functional genetic unit or the gene (see between units of macromolecules, such cistron) by genetic complementation as the enzymatic cleavage of amino acids (the ability to make functional gene prod- from protein.
48 干细胞之家www.stemcell8.cn ←点击进入
clustalverso
2. The furrowing that occurs in animal duced after being “instructed” to do so cells to form two daughter cells from a by contact with the antigen. parent cell after mitosis when the chro- mosomes have divided. clone (cellular) A population of cells 3. A series of cell divisions that occur that have been derived from the divisions during early animal embryogenesis. of one cell, so the population is geneti- cally identical. cleavage divisions See cleavage. clone (DNA) Recombinant DNA mol- cleavage furrows See cleavage. ecule or recombinant molecule. A gene or fragment of DNA that has been spliced clinical trials Testing of new drugs or into a vector, so that the DNA can be therapies on humans in a rigorous, con- amplifi ed many times by transferring the trolled setting. recombinant molecule into a host organ- ism (usually a bacterium or yeast) that CLN1, CLN2, CLN3 The genes that can be grown in large quantities. code for the three G1 phase cyclins— cln1, cln2 and cln3—in yeast. These clone bank A collection of recombinant cyclins function to drive the initiation of DNA molecules of the genomic material of S phase in the yeast cell cycle by forming a particular organism, prepared by frag- complexes with cdc28, the yeast homo- menting the DNA of the organism and logue of the mammalian cyclin dependent splicing each of the fragments into vector kinase, cdc2. cln3 forms a complex with molecules. Also known as a library. cdc28, which stimulates transcription of the CLN1 and CLN2 genes. This results clone library See clone bank. in accumulation of the cln1 and cln2 cyclins, which then form complexes with cloning The process of creating a cdc28. The cln1-cdc28 and cln2-cdc28 recombinant DNA molecule, isolating it complexes induce the transition from G1 and amplifying it. See gene cloning. into S phase. cloning vector The molecule of DNA clonal deletion The selective loss, that is used to house the DNA fragment early in development, of B and T cells to be cloned. Vectors are small chromo- of the immune system that produce anti- somes, either plasmid or bacteriophage, bodies or have receptors for antigens that capable of self-replication in a host cell are an integral part of the organism (self and producing many copies of itself per antigens). This process is necessary to host cell, thus amplifying the number of prevent the immune system from attack- copies of the cloned fragment. ing the cells and tissues of the organism later in life (autoimmunity). Clostridium The genus of organisms that are obligate anaerobes and produce clonal selection The theory that the spores. Members of this group produce stimulation of an immune response spe- powerful toxins and are responsible for cifi c caused by the introduction of a for- diseases such as botulism, gas gangrene, eign antigen results from proliferation of and tetanus. a single preexisting antibody-producing cell of the immune system such that a clustal A computer program for clone of cells bearing antibodies specifi c aligning multiple nucleotide or peptide for the antigen is produced. Clonal selec- sequences. Carrying out alignments on tion was originally put forth as a coun- multiple sequences simultaneously allows terhypothesis to the instructional theory the delineation of similar segments in that stated that an antibody-producing genes from different sources. This infor- cell altered the type of antibody it pro- mation can be used to group sequences
49 干细胞之家www.stemcell8.cn ←点击进入
rectocoated pit
into gene families or to defi ne regula- coenzyme Also called cofactor, a tory elements or other motifs or to study small nonprotein organic molecule asso- molecular evolution. ciated with an enzyme (apoenzyme) and is required for catalytic activity. The coated pit An invaginated site on the coenzyme plus the apoenzyme is called cell membrane that is lined with clathrin a holoenzyme. Although the apoenzyme facing the interior of the cell and con- does not change during the course of taining specifi c receptors at the exterior catalysis, the coenzyme may be chemi- where molecules interact with the recep- cally altered, but it is regenerated and tors for transport into the cell via recep- reused in subsequent reactions. A num- tor mediated endocytosis. ber of vitamins serve as components of coenzymes. For example, two common coated vesicle Small, membrane- coenzymes involved in energy metabo- bound droplets coated with a basket of lism are nicotinamide adenine dinucle- clathrin transporting molecules either otide (NAD+) and fl avin adenine dinu- from the outside of the cell via recep- cleotide (FAD). Both the nicotinamide tor mediated endocytosis, having arisen and fl avin portions of the molecules are from coated pits, or transporting newly derivatives of the B vitamins, nicotinic made proteins to be sorted to either acid and ribofl avin. organelles or secreted to the outside of the cell. coenzyme A (CoA or CoASH) A small organic molecule composed of ade- coat protein(s) The proteins that make nosine diphosphate that is linked to the up the outer layer, or coat of a virus. vitamin pantheteine phosphate, which serves as a carrier of acyl groups. CoA is coccus (cocci, pl.) The name for a type particularly important as an acyl carrier bacterial cell with a round morphology. during the oxidation of sugars for energy production. Cockayne syndrome A rare heredi- tary disease fi rst described by Edward cofactor A metal ion, such as Mg++, Alfred Cockayne that is characterized by Fe+++, or Mn+, or coenzyme that func- sensitivity to sunlight, short stature, and tions in association with enzyme proteins an aged appearance. The molecular basis and that are necessary for complete enzy- of the disease is the inability to perform matic activity. a certain type of rapid DNA repair called “transcription-coupled DNA repair” Cohen, Stanley (b. 1922) A molecular after exposure to ultraviolet light. biologist who carried out the fi rst cloning Defects in at least two genes have been experiments by splicing the gene encod- identifi ed in Cockayne syndrome: CSA ing resistance to the antibiotic tetracyclin (also called ERCC8 for Excision-Repair from one strain of bacteria (Staphylococ- Cross Complementing rodent repair defi - cus aureus) into a plasmid from another ciency), located on chromosome 5, and strain (Escherichia coli) in a test tube. The CSB (also called ERCC6), at gene map recombinant molecules were transferred locus 10q11-21. into cells of E. coli, and transformed cells with tetracyclin resistance grew into colo- code Refers to the way the genetic nies. These experiments demonstrated information is stored in the DNA. See that genes isolated from one organism, codon. spliced into a vector, and transferred into a host organism are intact and capable of coding strand The strand of DNA that producing functional proteins. However is used as a template to make mRNA. It it was the discovery of growth factors, contains the complement of the code to including epidermal growth factor, that be translated. won him the Nobel Prize in physiology
50 干细胞之家www.stemcell8.cn ←点击进入
Collins, Francisverso
and medicine, which he shared with Rita encodes genes for a colicin and immunity Levi-Montalcini in 1986. proteins that protect Col-harboring cells from the bacteriocidal effects of the coli- cohesions See condensins. cin it produces.
cohesive ends Also known as sticky colicin An antibiotic that is encoded by ends. The single-stranded extentions of certain E. coli plasmids, such as ColE1. a double-stranded DNA molecule that Colicins kill bacteria by a number of dif- show complementarity to other single- ferent mechanisms, including inhibition stranded extensions of DNA molecules. of protein synthesis, inhibition of active Such sticky ends are generated by restric- transport, and DNA degradation. tion endonucleases. coliforms A group of bacteria that coiled-coil A type of higher-order pro- includes the genera Escherichia, Kleb- tein structure in which two helices are siella, Enterobacter, and Citrobacter, wrapped around each other. Because the which are small rod-shaped facultative wrapping causes each helix to be shaped anaerobes, stain Gram negative, and fer- into another helix form, the helix “coils” ment lactose with gas production within are thought of as being a “coiled-coil” in 48 hours of growth. They are used to this confi guration. assess fecal pollution of water.
coincidental evolution (concerted colinear Having the linear array or evolution) In genes that have become sequence of one molecule correspond to duplicated, the tendency for mutations that of another. The sequence of bases occurring in one copy to appear in the found on the mRNA corresponds to the other with the result that the effects of sequence of amino acids found on the evolution appear in both copies at the protein that it encodes. This relation- same time. ship extends to the sequence of bases on the DNA for bacteria, but in higher cointegrate structure A molecule of organisms, the DNA also contains some DNA in which a transposon has medi- intervening sequences (see introns) that ated the joining of two plasmids, with must be eliminated before obtaining copies of the transposon occurring at the colinearity. joints between the two plasmids. This is the fi rst step in the transposition of colinearity The condition of being the transposon from one plasmid to co linear. See colinear. another. coliphage A bacterial virus that infects colcemid A drug that blocks microtu- and reproduces in coliforms. bule formation and thus disrupts events, such as chromosome separation during collagen A fi brous protein that is a mitosis, which depend upon microtubule major component of connective tissue function. and is found in the fuzzy layer that envel- ops animal cells. colchicine A drug that disrupts micro- tubule function as does colcemid. Collins, Francis (b. 1950) A researcher in the fi eld of genetic disease who gained ColE1 A naturally occurring plasmid fame as the head of the scientifi c team that is carried by some strains of E. coli that succeeded in cloning the gene for cys- and has been used as a basis for con- tic fi brosis through chromosome walking structing a number of cloning vectors for in 1989. He is currently director of the making recombinant DNA molecules. Human Genome Project at the National It is one of a family of plasmids that Institutes of Health.
51 干细胞之家www.stemcell8.cn ←点击进入
rectocolloid
colloid A suspension of microscopic promegapoietin. CSFs are used to treat particles ranging in size from 1 nm to conditions of low white-blood-cell counts, 1 μm that is dispersed in some medium. such as in patients receiving radiation or Hydrophilic colloids are composed of chemotherapy, patients with AIDS, and macromolecules that remain dispersed in those with white-blood-cell diseases. an aqueous solution because of the par- Commercially available CSFs are gener- ticles’ affi nity for water. Hydrophobic ally made by recombinant DNA tech- colloids are less stable and are composed niques. of insolubles particles suspended in water and remaining in a suspended state due colorimeter An instrument that quan- to repulsive forces among particles. titates amount of substance in solution by measuring the amount of light, at a given colony A group of cells that grow from wavelength, that is absorbed by the solu- a single cell on some solid medium, such tion. Colorimetry is based on Beer’s and as an agar plate. Lambert’s laws defi ning extinction coef- fi cient of a substance and the relation- colony counter An instrument used to ship of light absorbed by a substance to count the number of colonies on an agar its concentration. Colorimeters are also plate. There are two types. The manual used to measure the turbidity of solutions, type has an electronic stylus that creates which is an indication of the number of a signal that is counted when touched to particles in suspension or the number of a colony. Automatic colony counters have bacterial cells in a culture. scanners that detect density differences and can read an entire plate for the total combinatorial library A mixture of number of colonies. polymeric chains in which individual chains differ from one another by virtue colony-forming unit (CFU) A viable of the linear arrangement of the mono- cell that gives rise to a colony. mers that make up the polymer. For example, a combinatorial peptide library colony hybridization A method used would contain polypeptides that are cre- to identify colonies harboring a particu- ated from the same amino acids, but the lar gene or DNA sequence. Colonies on amino acids in different polypeptides in an agar plate are partially transferred to the library would be arranged in a unique a membrane, generally nitrocellulose or order, for example, Ala-Leu-Tyr-Ser- . . . nylon, by gently pressing the membrane v. Leu-Ser-Tyr-Ala-. . . . on top of the colonies. The membrane is treated with alkalai to denature the combining site The site on an antibody DNA in the cells, heated to fi x the DNA molecule where the antigen interacts. onto it, then washed with a labeled probe to identify those colonies that carry the commensalism A relationship between sequence. Once the colony is identifi ed on members of different species living within the membrane, it can be picked from the the same cultural environment with one original plate and cultured to study or to organism benefi ting from the relation- further isolate the gene or sequence. ship, but the other not being affected.
colony-stimulating factors (CSFs) A comparative genomics A branch of group of hormonelike substances that bioinformatics concerned with the anal- stimulates the production of various types ysis of gene structure and function by of white blood cells. Colony-stimulating comparing similarities and differences factors include: granulocyte-macrophage in DNA and protein sequences from dif- colony-stimulating factors (GM-CSF or ferent organisms. Comparative genom- sargramostim), granulocyte colony-stim- ics uses computer programs to compare ulating factors (G-CSF or fi lgrastim), and DNA and protein sequences in genetic
52 干细胞之家www.stemcell8.cn ←点击进入
complete mediumverso
databases such as the GenBank and complementary base sequence A Swiss Protein Database. These pro- sequence of bases that can form hydrogen grams align multiple sequences to look bonds with another sequence. See com- for regions of similarity. This type of plementary base pairing. analysis is used to predict the function of genes in higher organisms from the complementary DNA See cDNA. known functions of similar genes in lower organisms such as bacteria and complementation 1. The ability of yeast. Differences among similar genes one chain of polynucleotides (either DNA from different organisms can be used to or RNA) to form hydrogen bonds with create models of evolutionary relation- another chain because of a coincidence ships (molecular evolution). of adenine/thymine pairs of bases and guanine/cytosine pairs of bases on each compatibility group Defi ning a group strand. of plasmids on their ability to coexist in 2. Genetic complementation is the ability the same cell with another plasmid from of one mutant to supply a required func- a different group. tion to another mutant. See cis-trans test. competence The state of a bacterial cell 3. Also, cloning by complementation that has the ability to take up DNA from is a technique in which a mutant host the environment. Some species of bacte- cell (e.g., lacks the ability to synthesize ria develop natural competence by syn- some nutrient) is infected with a library thesizing competence factors and DNA and a clone is picked that has the abil- receptor proteins that aid in the uptake of ity to synthesize the nutrient. This clone DNA into the cell. Other species, such as is derived from a mutant cell that picked E. coli can be made competent by treat- up a recombinant molecule containing ment of cells with high concentrations of a functional gene that has the ability to CaCl2 in the cold. replace its own faulty one.
competition hybridization A tech- complementation test See cis-trans nique for determining the degree of test. similarity between two nucleic acids by measuring the degree to which the two complement-fi xation test (CF) A nucleic acids hybrize to one another in serological test for antibodies based on the presence of a third nucleic acid that the ability of complement to lyse red acts as a standard. blood cells. Serum to be tested is mixed with antigen and complement. An indica- competitive inhibition The inhibition tor system of sheep red blood cells (RBCs) of an enzyme by a substance that revers- and antibody against the sheep RBCs is ibly binds to the active site of the enzyme added. If specifi c antibody for the antigen and thus competes with the substrate for is present in the serum, it will combine the site. with the antigen and bind the comple- ment, and no complement will be avail- complement A group of serum pro- able to lyse the sheep RBCs. Thus no lysis teins that are activated by reaction with of sheep RBCs indicates the presence of antigen-antibody complexes. Once acti- antibody in the serum in a complement- vated, they aid in the killing of pathogenic fi xation test. bacteria and/or facilitate phagocytosis. complete medium A culture medium complementary base pairing The for- that supplies all the nutrients (amino mation of hydrogen bonds between ade- acids, vitamins, and bases found in nine and thymine and between guanine nucleic acids) that an organism needs for and cytosine. See complementation. growth.
53 干细胞之家www.stemcell8.cn ←点击进入
rectocomplexity
complexity A measure of the num- chromosome condensation involves an ber of different base-pair sequences on a ordered coiling of the DNA-chromatin given genome. that uses energy derived from hydrolysis of ATP. The cohesions are highly con- composite transposon A transposable served in evolution and are found in element made up of insertion sequence eukaryotes and prokaryotes. (IS) elements fl anking a central portion of DNA sequence that usually contains conditional mutation A mutation that is a gene or genes encoding antibiotic resis- expressed only under certain conditions. An tance determinants. Common composite example, is a temperature-sensitive mutation transposons are Tn5 and Tn10. that encodes a protein functional at certain permissive temperatures (e.g., 32°C), but compost A mixture of decaying not functional at higher nonpermissive tem- organic material used for fertilization or peratures (e.g., 42°C). Such mutations can rejuvenation of soil. defi ne essential genes because mutations in essential functions are lethal events, but con- concanavilin A (con A) A lectin ditional mutations allow the organisms to isolated from the jack bean (Canavalia survive at permissive temperatures. ensiformis) that binds to certain sugar residues. It is used in affi nity chroma- conformation The three-dimensional tography to purify glycoproteins and structure of a macromolecule, such as a is also used to agglutinate cells by cross- protein. linking glycoproteins found at the cell surfaces. In addition, con A induces rest- congenital Aquired during develop- ing lymphocytes to divide. ment in the uterus.
concatamer A series of the same DNA conidiophore A specialized fungal molecules linked in tandem, thus creating structure that bears the spores of conidia. a dimer, a trimer, or a multimer. conjugation A means of gene transmis- c-oncogene A normal cellular gene sion between any coliform bacterial strain that has a viral oncogene, or tumor- that carries an F factor (carried either on producing homologue. Such genes are the bacterial chromosome or extrachro- also called proto-oncogenes and can be mosomally) and another strain that lacks activated by mutation, amplifi cation, the F factor. During conjugation, neigh- or overepression to become a cancer- boring bacteria come into direct contact producing cell. with one another and transfer DNA from one (the donor) to another (the recipient) condensation The chemical reaction by means of a mating tube formed at the that results in the joining of two mol- point of contact. Because the genes from ecules with the elimination of a water the donor are always transferred in a given molecule. An example is the formation order, conjugation has been used to map of the peptide bond between two amino genes on the bacterial genome by observ- acids. ing which genes are transferred to recipi- ents following controlled interruption of condensing vacuole A membrane- the mating process. See HFR strain. bound vacuole arising from the Golgi complex and developing into a secretory conjugation, bacterial A means of granule by the progressive loss of water. gene transmission between bacteria by cell-to-cell contact or bacterial mating. condensins Families of proteins that mediate the condensation of chromo- conjugation, chemical The covalent somes during mitosis. The process of attachment of a molecular group to a
54 干细胞之家www.stemcell8.cn ←点击进入
constant regionverso
molecule for the purpose of enhancing each position when different examples or altering its function. The attachment are compared. Consensus sequences are of fl uorescent or chromogenic groups found in promoters and are responsible to antibodies or nucleic acids to create for binding RNA polymerase and other probes is an example of conjugation. proteins needed for transcription. Con- sensus sequences also signal other events, connective tissue Fibroblast cells that such as splicing of introns out of primary secrete collagen. Collagen gives cells transcripts. adhesive strength that is needed to main- tain form. Some examples of connective conservative replication A mecha- tissue are bone, cartilage, tendons, and nism of DNA replication in which each ligaments. strand of a parental molecule remains together after replication. See semicon- connexon A structure of the gap junc- servative replication. tion composed of six protein subunits around a hollow center. Two aligned con- constant region The carboxy termi- nexons of two cells provide a means of nal regions of the heavy chain or light communication between the two cells. chain of the antibody molecule, which has the same or nearly identical amino consensus sequence An order of bases acid composition as each member of the that has the most common nucleotide at same class.
Bacterial conjugation
55 干细胞之家www.stemcell8.cn ←点击进入
rectoconstitutive gene
constitutive gene Genes that are ex- dilutes the incoming material and is useful pressed continuously and are not subject in waste treatment or any other procedure to either induction or repression. Such in which any components of the incoming genes encode housekeeping functions and substrate would inhibit the enzymatic bio- are expressed in all cells at a low level. conversion process.
constitutive heterochromatin Chro- contractile ring A beltlike structure mosomal regions that remain in a perma- composed of actin microfi laments and nently condensed state during interphase found under the plasma membrane that in every cell in the organism and are functions to divide an animal cell into never genetically active in any cell, such two daughter cells after mitosis. as the centromere. controlling element Transposable ele- constitutive mutant An organism that ments of maize that were found to cause has a mutation in some regulatory gene mutations and chromosomal breakage so that the expression of the gene(s) it when they transposed into or excised out controls is constitutively expressed. See of genes. constitutive gene. Coombs reaction An immunological contact inhibition The property of test for identifying blood groups using normal animal cells in culture to stop specifi c antibodies to antigens of red blood dividing once they have formed a con- cells, red blood cells, and antiantibodies to tiguous monolayer over the surface of the overcome a natural replusion by red blood medium on which they are growing. cells, which can mask a positive test.
contamination Growth of undesirable coordinated enzyme synthesis The organisms in some culture or material. regulation by the same event or signal of the synthesis enzymes involved in the contig A term that describes the assem- same metabolic process. In bacteria this is bly of sequence data from multiple over- accomplished generally by the organiza- lapping DNA fragments into a larger seg- tion of the genes that encode the enzymes ment. The term refl ects the practical size into operons with a single regulatory ele- limitations of the sequencing techniques ment. In higher organisms, the genes are used for sequencing large stretches of usually scattered but have common regu- genomic DNAs such as those employed in latory elements that respond to the same the Human Genome Project. Because only signal. relatively short fragments can be reliably sequenced in a single run, sequence data coordinate regulation The expression representing a large DNA segment, such of multiple genes in unison, for example, as may be present in a yeast artifi cial chro- the genes of an operon. mosome (YAC), must be derived by assem- bling data from many smaller pieces. copia elements A family of transpos- able elements found in Drosophila. A continuous culture A system that typical Drosophila genome carries about maintains a cell culture at a steady 50 of these elements in widely scattered growth rate. This is achieved by use of a regions. chemostat or turbidostat. copolymer A synthetic polymer of two continuously fed stirred tank reactor deoxyribonucleotides in random order (CSTR) A bioreactor apparatus in (e.g., ACACCACCCAA), or two ribo- which fresh substrate is continuously fed nucleotides in alternating order (e.g., in and a corresponding volume of con- AUAUAUAUAU). These were used to elu- tents is removed. Such procedure quickly cidate the genetic code by using them in
56 干细胞之家www.stemcell8.cn ←点击进入
cosmidverso
an in vitro protein synthesizing system corpus luteum The temporary endo- and analyzing the amino acid composi- crine gland formed from a ruptured ovar- tion of the resulting polypeptides. ian follicle after release of an egg.
copy choice A mechanism of genetic cortical cytoplasm A region of the egg recombination in which the recombinant cytoplasm just under the cell membrane molecule is formed by selectively replicat- that undergoes rearrangements after fer- ing parts of the parental DNA molecules. tilization and has profound consequences in the development of the embryo. copy number The number of plasmid molecules per bacterial cell. Some plas- cortical reaction Release of enzymes mids are said to be relaxed in the con- from the cortical vesicles after fertiliza- trol of their replication and are defi ned tion of an animal egg that results in a as high-copy-number plasmids, e.g., more hardening of the vitrelline membrane to than 20 to 100 copies per cell. These are prevent additional sperm penetration. used as cloning vectors and result in high yields of recombinant DNA or the pro- cortical vesicles Membrane-bound str- tein encoded by the recombinant. Strin- uctures of the egg cell that release prote- gently controlled plasmids exist in cells in ases and other enzymes during the pro- low copy number, or one to a few copies cess of fertilization. per cell. These plasmids are used to clone genes that produce proteins that are toxic corticosteroid The steroid hormone, a to bacterial cells when produced in high derivative of cholesterol, that is synthe- concentrations. sized in the adrenal cortex.
cordycepin An antibiotic that acts by COS cells A derivative of CV-1 mon- blocking transcription. Cordycepin is a key cells that are infected with, but do derivative of the normal nucleoside, ade- not produce SV40 virus. COS cells nosine, in which the hydroxyl group on express the SV40 early genes (T antigens) the 3′ carbon is missing. When cordycepin needed for viral replication. COS cells becomes incorporated into newly synthe- are used as host cells in cloning experi- sized RNA in place of the normal adenine ments, when derivatives of SV40, lacking nucleoside, the RNA strand terminates. the early genes, are used as cloning vec- tors for eukaryotic DNA. The early genes core particle An octamer of histones expressed by the COS cells allows the (H2A, H2B, H3, and H4) with 146 base recombinant molecules to replicate and 3 pairs of DNA wrapped 1 /4 times around thus amplify its cloned inserts. in a nucleosome. cosmid A cloning vector constructed of corepressor The effector molecule that a plasmid origin of replication, an anti- binds to a repressor to form a complex. biotic resistance gene, and the cos sites The effector–corepressor complex func- of lambda DNA. These molecules can be tions to repress or prevent transcription packaged in vitro into a lambda phage of a bacterial operon. coat and can then be transferred into host cells by viral infection. Colonies contain- Cornybacteria A genus of small ing the cosmid are selected on medium Gram-positive straight to slightly curved supplemented with the antibiotic of the rod-shaped bacteria, frequently club resistance gene on the cosmid. Such clon- shaped, with aerobic to facultative che- ing vectors can be used to clone frag- moorganic (see chemo organotroph ) ments up to about 47 kilobases long. This metabolism. A pathogenic member of is about three times the amount of DNA this group is C. diphtheriae, the causative that can be cloned into lambda-phage- agent of diphtheria. derived vectors.
57 干细胞之家www.stemcell8.cn ←点击进入
rectocos site
cos site The 5′ 12 base-pair (bp) over- across the cell membrane. See cotrans- hang termini of bacteriophage lambda port. DNA that are base-pair complementary to each other: When a cell is infected with covalent bonds Strong chemical bonds this bacteriophage, the DNA, injected in formed between atoms in which there is a as a linear molecule, circularizes through sharing of two or more electrons. hydrogen bonding between nucleotides of the overhang termini. Lambda is covalently closed circular DNA A replicated in long tandem repeats of its circular double-stranded molecule of genome. The cos sites serve as packaging DNA, such as a plasmid, in which there markers for an endonuclease that cuts in are no nicks or breaks in the sugar phos- a staggered fashion, creating unit head- phate backbone. Usually, covalently fuls of DNA with 5′ 12 bp overhangs that closed circular (ccc) DNA exists as super- are packaged into phage coats. coiled; that is, the molecule folds in on itself due to strain in the molecule. If a cotransduction The introduction of two nick is introduced into the backbone, the linked genes into a bacterial cell by the ge- molecule relaxes and is referred to as an netic transmission process of transduction. open circle (oc). See supercoiled DNA.
cotransformation The introduction of Coxsackie viruses An antigenically two linked genes into a bacterial cell on distinct group of viruses of the entero- the same fragment of DNA by the genetic virus genus (viruses that are found in transmission process of transformation. the intestines and excreted in the feces), including some human pathogens. cotranslational transfer The insertion CpG rich islands Regions of DNA of one end of a polypeptide into the mem- believed to be regulatory elements of brane of the endoplasmic reticulum gene activity that are characterized by before synthesis of the whole polypeptide an unusually high content of cytosine is completed. See leader sequence. and guanine nucleotides arranged in the repeating sequence: CGCGCGC. . . . cotransport The simultaneous move- CpG islands are located in a segment 5′ ment across a membrane of two different to the coding region in many genes and substances in a coupled manner. The two are often sites of methylation. substances may move in the same direc- tion (symport) or in the opposite direc- C-reactive protein A protein whose tion (antiport). levels increase during systemic infl am- mation and which functions to activate Coulter counter An instrument that the complement pathway and prepares automatically counts cells by measuring foreign substances for phagocytosis. C- the changes in resistance that occur when reactive protein is a member of the pen- cells in suspension are passed through a traxin protein family, was discovered small slit. by Tillet and Frances in 1930, and was named for the fact that it reacts with the coupled reactions Two enzymatically C polysaccharide of Streptococcus pneu- controlled chemical reactions that must moniae. C-reactive protein is made in the occur simultaneously. For example, many liver, and blood levels increase within six reactions that require an input of energy hours of an acute infl ammatory stimu- to proceed are coupled to the hydrolysis lus. These protein levels in the blood are of ATP (ATP ADP + Pi), which releases 7 under investigation as a means of assess- kcal of energy. ing cardiovascular disease risk.
coupled transport The obligatory creatine phosphate A high-energy simultaneous transport of two solutes compound in muscle cells that is used to
58 干细胞之家www.stemcell8.cn ←点击进入
cruciform structures
regenerate the ATP needed for muscle cro protein A protein that interferes contraction. with the synthesis and action of the C repressor of a lambda bacteriophage and CREB Cyclic-AMP response element is necessary in the lytic response of the binding; CREB proteins are transcrip- phage after infection into a cell. tion factors that are activated by stimuli that increase cAMP levels. The binding of crossing over The physical exchange CREBs to sequences called CRE elements of genetic information between a pair of in the promoters of a number of genes reg- homologous DNA molecules. ulates their transcription. cAMP produc- tion is controlled by the binding of various crosslink A covalent bond between ligands to certain cell surface receptors strands of DNA. See cross-linking. linked to adenylyl cyclase. cAMP activates a protein kinase which, in turn, activates cross-linking A reaction in which two a protein kinase that migrates into the strands of DNA are covalently bonded nucleus and activates a CREB protein. together. Certain mutagenic agents, such CREB proteins have been shown to be as X-rays, cause cross-linking, and the involved in the process of long-term poten- DNA must be repaired if it is to replicate tiation in the neurons of lower organisms, and function properly. including snails, fruit fl ies, and rats. In humans abnormalities in the gene coding crossover fi xation An alternative for the CREB protein CBP is associated model to saltatory replication to explain with Rubenstein-Taybi syndrome. the occurrence of highly repeated sequences. In crossover fi xation, addi- Crick, Francis (1918–2004) A Brit- tional copies of a certain sequence are ish scientist who with James Watson won created on one DNA strand by unequal the Nobel Prize in physiology and med- crossing over. icine in 1962 for postulating a double- stranded helical structure for DNA, using cross-reactive antibodies Nonspe- the X-ray diffraction data of Maurice cifi c antibodies that will bind to antigens Wilkins, also a Nobel Prize winner in and give a false positive response in an 1962. The double helix accounted for the antigen-antibody test. known physical and chemical properties of DNA, but also suggested a mechanism crown gall plasmids The Ti (tumor- for its replication. inducing) plasmid of Agrobacterium tumefaciens that is responsible for the crista The infolding of the inner mem- malignant transformation of dicotyledon- brane of the mitochondrion, which in- ous plants infected with this organism. creases the surface area of the membrane Part of the plasmid DNA incorporates responsible for electron transport and production of ATP via oxidative phos- into the plant chromosome to cause the phorylation. production of a tumor. These plasmids lacking the tumor-producing genes have critical concentration The minimal been constructed as potential vectors for concentration of subunits required for recombinant DNA molecules for plant formation of a polymer. genetic engineering.
critical dissolved oxygen concentra- crown gall tumor See crown gall tion (Ccrit) The concentration of dis- plasmids. solved oxygen in a submerged culture when oxygen is the limiting substrate. The cruciform structures DNA structure air supply to a fermentor is adjusted to in which strands separate and self-anneal maintain an oxygen level above its Ccrit. through complementary base pairing
59 干细胞之家www.stemcell8.cn ←点击进入
cryogenics
is enhanced. Common cryoprotectants are dimethyl sulfoxide (DMSO), glycerol, and sucrose.
cryptic plasmid A plasmid that con- tains no genes or apparent phenotypic markers other than those needed for rep- lication and transfer.
crystallography (X-ray) A technique used to analyze the structure of mole- cules by analysis of diffraction patterns of X-rays that pass through crystal spec- imens.
CsCI centrifugation See cesium chloride gradient centrifugation.
ctDNA The DNA found in a chloro- plast.
culture A population of cells cultivated in a medium.
curing Any action that causes the loss of a plasmid or lysogenic bacteriophage from a culture of bacteria.
cutaneous Pertaining to, existing on, Cruciform structures or affecting the skin.
cuvette The container for samples for a to form cruciforms or crosslike struc- spectrophotometer, or other instruments tures. Cruciforms can arise at regions of that are used to make measurements on inverted base-pair repeats. liquid samples.
cryogenics The science of freezing, C value A value representing the total especially with reference to methods for amount of DNA, given in base pairs, in producing very low temperatures. the haploid genome of a particular spe- cies. cryopreservation The preservation of cells, organs, tissues, or other biological cyanine dyes Water-soluble fl uores- materials at very low temperatures, in cent dyes widely used as labeling mol- freezers (–80°C), over dry ice (–79°C), or ecules in a variety of probe applications, in liquid nitrogen (–196°C). At low tem- including probe hybridizations for micro- peratures, preserved biological materials arrays and analytic techniques based on remain genetically stable and metaboli- antigen-antibody reactions. Cyanine dye- cally inert. labeled molecules can be detected with sensitivities close to that for radiolabels. cryoprotectants Chemicals that reduce The most commonly used cyanine dyes the formation of ice crystals during freez- are Cyanine 3 (or 5) bihexanoic Acid; ing so that survival of cryopreserved cells Cy3 or Cy5.
60 干细胞之家www.stemcell8.cn ←点击进入
cycloserine
cyanobacteria Blue-green algae. Pro- groups to proteins, either at a serine caryotic, photosynthetic, oxygen-evolving or tyrosine residue. Phosphorylation organisms. of proteins is an important mechanism of regulation of metabolism in higher cyanogen bromide (CNBr) A chemi- organisms because the added phosphate cal that recognizes methionine residues and group either activates or inactivates the cleaves polypeptide chains at these residues. protein and thus stimulates or inhibits CNBr is used to cleave genetically engi- the metabolic reaction. neered proteins that have been constructed as a composite of cloned material and vec- cyclic GMP A molecule of guanosine tor material. CNBr is also used to cross- monophosphate in which there is a cova- link proteins to various support materials lent bond between the 3′ hydroxyl (OH) for affi nity chromatography purposes. and the 5′ phosphate group.
cyclic AMP (cAMP) A molecule of cyclin(s) The regulatory subunits of adenosine monophosphate in which there cyclin-dependent kinases (cdks); cdks is a covalent bond between the 3′ hydroxyl are activated upon binding a specifi c (OH) and the 5′ phosphate group. It is cyclin. Once activated, cdks induce cells an important molecule in controlling to transit through a certain stage of the metabolic processes in higher organisms cell cycle. Originally discovered as a (see cyclic AMP–dependent protein component of MPF (mitosis-promoting kinases). Because its intracellular concen- factor), a substance isolated from cells tration is often controlled by hormonal of embryos of the frog Xenopus laevis action and the metabolic activities it con- that were found to induce entry of cells trols is in response to the hormone, it is at any stage of the cell cycle into mitosis called a second message. cAMP also plays (M phase). a role in the control of bacterial metabo- lism by binding with the catabolite activa- An antibiotic that tor protein and regulating transcription of cyclohexamide inhibits yeasts and other fungi but does some genes. not inhibit bacteria. It is used as an agri- cultural fungicide. cyclic AMP–dependent protein kin- ases Enzymes that add phosphate cyclooxygenase enzymes Cyclooxy- genases (COXs) are mixed-function oxi- dases that catalyze the addition of oxygen atoms to carbons 9, 11, and 15 as well as form a covalent bond between carbons 8 and 12 of arachidonic acid to create pros- taglandin H2 (PGH2), the precursor of other prostaglandins. The COX enzymes are also known as prostaglandin H2 syn- thases. COXs have two isozymic forms termed COX-1 and COX-2. Aspirin acts to inhibit both COX isozymes by acety- lating a serine residue in the active site.
cycloserine An antibiotic from Strep- tomycetes that acts by blocking two steps in the biochemical pathway by which the bacterial cell wall is synthesized. Because cycloserine is structurally Cyclic AMP (cAMP) similar to the amino acid D-alanine, it
61 干细胞之家www.stemcell8.cn ←点击进入
cysteine
Regulation of cell-cycle kinetics by cyclins. The transition from the G2 phase to mitosis (M) is regulated by a complex between cyclin B and a cyclin-dependent kinase (cdk). p34cdc2 contains three phosphorylation sites at Thr 14, Tyr 15, and Thr 161; in the active form, Thr 161 is phos- phorylated, and Thr 14 and Tyr 15 are not (left inset). p34cdc2 is phosphorylated at Thr 161 dur- ing G1 and becomes additionally phosphorylated at Thr 14 and Tyr 15 on binding to cyclin B that begins to accumulate at the end of S phase. Dephosphorylation of the Thr 14 and Tyr 15 sites mediated by the phosphatase p80cdc25 occurs at the G2/M boundary, resulting in the active complex. Cyclin B is then rapidly degraded by ubiquitin just after the start of mitosis. A-type cyclins begin to accumulate during S phase and appear to function at the G2/M boundary. Net synthesis of E-type cyclins occurs in G1; E-type cyclins activate a second cdk, p33cdk2, which acts at the G1/S boundary. p33cdk2 acts to induce phosphorylation of histones and certain cel- lular proteins involved in mitosis.
competitively inhibits the incorporation between chains contributes to the overall of D-alanine into a pentapeptide that shape of the protein. is used to construct the bacterial cell wall. cystic fi brosis An inherited disease that affl icts almost one in 2,000 children cysteine An amino acid with a sulfhy- in the United States. In 1989 the gene, dryl in its side chain: whose mutant allele accounts for a major- NH2 ity of the cases, was cloned. | HS-CH2-CH-COOH Cystic Fibrosis Transmembrane Con- Disulfi de bonds between two cysteine ductance Regulator (CFTR) A pro- residues on the same polypeptide chain or tein that functions as a channel for the
62 干细胞之家www.stemcell8.cn ←点击进入
cytoplasmic inheritance
transport of chloride ions across the acteristic of epithelial cells previously cell membrane. Mutations in CFTR are identifi ed as tonofi laments by electron responsible for the diseases cystic fi brosis microscopy. The cytokeratin family con- and congenital bilateral aplasia of the vas tains a number of different proteins, and deferens. The CFTR gene is located on keratin fi laments found in different types chromosome 7q31.2. of epithelia are comprised of different keratin proteins. Expression of keratins is used clinically as a diagnostic criterion in cytidine monophosphate (CMP) The tumor diagnosis. nitogenous base cytosine attached to a ribose sugar molecule with a phosphate cytokinesis The process of dividing residue at the 5′ end of the ribose. the cytoplasm of a cell into two daughter cells following mitosis. cytidine triphosphate (CTP) The same as CMP above, but with three phosphate cytokinins Substances that promote residues. cell division and cell-and-shoot differ- entiation in plant tissue cultures. Some common cytokinins are benzylaminopu- cytochalasins A family of drugs pro- rine (BAP) and 2-isopentenyladenine. duced by certain fungi that interferes with polymerization of actin microfi la- ments and hence inhibits cell movements cytology The study of cells based on that depend on actin polymerization- microscopic observations. depolymerization reactions. cytomegalovirus (CMV) A usually cytochrome c oxidase An enzyme nonpathogenic human virus that can complex of the electron transport chain be pathogenic in immunocompromised that reduces molecular oxygen to water. hosts. Following infection, the virus per- sists in the host but the carrier is protected cytochrome P-450 (also P450) A from disease by its immune system. Both cytochrome found in the smooth endo- (T-cell immunity) and humoral (antibody) plasmic reticulum that is important in activities are believed to be involved in drug detoxifi cation, especially in the liver. the defense against such CMV-induced Cytochrome P-450 is a type of mixed- disease, and thus the organism is a good function oxidase that carries out hydrox- model to study immunological processes. ylation reactions (addition of OH groups) Many plasmid vectors have incorporated to molecules, thus aiding in solubilizing a promoter from CMV so that mamma- them so that they can be fl ushed out of lian genes cloned behind the promoter the body. will be expressed in cell culture.
cytochromes Heme-containing proteins cytoplasm The liquid colloidal sub- of the electron transport chain involved stance between the cell membrane and in cellular respiration that carry out oxi- nucleus of the cell. dation-reductions reactions, thus pass- ing electrons down the chain from iron cytoplasmic inheritance Patterns of atom of one cytochrome to iron atom of inheritance carried by genes not con- another until it is passed to the fi nal elec- tained in the chromosomal DNA; i.e., tron acceptor, molecular oxygen. the genes carried in mitochondria or chloroplasts. Since the sperm cytoplasm cytogenetics That area of study of does not contain mitochondria, pat- chromosomes and their behavior. terns of cytoplasmic inheritance involv- ing mitochondria are always maternal. cytokeratins A class of proteins that One example of cytoplasmic inheritance make up the intermediate fi laments char- in humans is LHON (Lebers Hereditary
63 干细胞之家www.stemcell8.cn ←点击进入
cytoplasmic streaming
Optic Neuropathy), which is caused by cytosine One of the nitrogenous bases defects in the electron transport Com- found in nucleic acids. Cytosine is a plex I in mitochondria. Other examples pyrimidine that forms hydrogen bonds include: MELAS syndrome (mitochon- with the purine guanine. drial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes), caused cytoskeleton A complex network of in most cases by an A to G transition in a microtubules, microfi laments, and interme- mitochondrial leu-tRNA; Kearns-Sayre diate fi laments extending throughout the syndrome (KSS), which leads to loss of cytoplasm that gives shape to a eukaryotic vision, hearing, and heart problems due cell and is involved in cellular movement. to the accumulation of defective mito- chondria; and MMC (maternally inher- ited myopathy and cardiomyopathy), cytosol The cytoplasm that contains where energy-demanding muscle cells are the organelles of a eukaryotic cell. compromised. cytotoxic T cell An activated T lym- cytoplasmic streaming The back-and- phocyte, also known as a killer T cell, forth movement of cytoplasm in some that Iyses cells that are recognized as a algae and the circular fl ow of cytoplasm combination of self and foreign, such as around a central vacuole in plant cell, virally infected cells, tumor cells, and for- also known as cyclosis. eign tissue graphs.
64 干细胞之家www.stemcell8.cn ←点击进入
AD
dalton A unit of mass used generally colon cancer. The name DCC derives for macromolecules that is equal to 1.000 from the observation that segments of on the atomic mass scale, or almost the chromosome 18 now known to contain same as the mass of a hydrogen atom. DCC are frequently deleted in colon car- The term dalton can be used interchange- cinoma tumors. DCC is expressed on ably with the term molecular weight. neural membranes, where it appears to Thus a 100,000 dalton (or 100 kilodal- serve as a receptor for the protein netrin. ton protein) can be described as having a Its tumor-suppressive activity appears to molecular weight of 100,000. stem from its ability to induce apopto- sis in tumor cells. The apoptotic activity dansyl chloride A compound that of DCC is upregulated by caspase 3 and reacts with the amino group of an amino downregulated by netrin. DCC gene map acid to produce a fl uorescent derivative locus is 18q21.3. that can be easily detected and identifi ed. It is used in procedures to identify the DDBJ See databases. amino terminal residue of peptides. ddNTPs Dideoxyribonucleotide tri phos- dark reactions A series of enzymati- phates. See Sanger sequencing. cally catalyzed reactions in which organ- isms that carry out photosynthesis syn- deaminase An enzyme that removes thesize organic compounds in the form amino groups from molecules. of sugars from inorganic carbon dioxide. These reactions use energy, in the form deamination The process by which a of ATP, and reducing power, in the form deaminase removes amino groups from of NADPH made during the light-phase molecules. Deamination of bases in DNA reactions of photosynthesis. results in mutations, and cytosine is the most susceptible base. databases Information stored in com- puters to be used in the sequence analysis death phase The fi nal phase in the of genes and proteins. The National Insti- growth curve of a population of cells in tutes of Health maintains such databases which the cells die exponentially; that is, (GenBank). EMBL is a European database for each time increment, a certain per- established in 1980 to collect and store centage of cells die. nucleotide sequence data. Its counterpart, SwissProt, translates the sequence data into decline phase See death phase. protein data. EMBL, GenBank, and the DNA database of Japan, DDBJ, collabo- degrees of freedom The number of rate to collect and exchange data on a daily independent variables in an experiment. basis, as sequence data are being deposited at a rate of one sequence per minute. defective virus A virus that is missing some essential genetic information so that DCC Deleted in colon carcinoma; a it cannot reproduce itself. Such viruses tumor-suppressor gene associated with can be propagated in a host cell only if a
65 干细胞之家www.stemcell8.cn ←点击进入
rectodefensins
helper virus that supplies the missing pro- delayed hypersensitivity An allergic teins coinfects the same host cell. reaction that takes 24 to 48 hours to appear. An example is the skin test for defensins Part of the innate host defense exposure to tuberculosis. After injection system against invading microbes. These with the allergen, a positive response small peptides, produced by many differ- (a swelling at the injection site) does not ent organisms, have a broad spectrum of appear before 48 hours. activity against bacteria, fungi, and some enveloped viruses. Defensins have been deletion mutation A change on the found in great abundance in the phago- DNA due to the elimination of one or cytic white cells of mammals and birds, more nucleotides. A deletion can alter the but they have also been found in cells of genetic information in a very profound the intestine and in skin cells. Their main way. The deletion of one base pair results mechanism of activity is to insert into the in a frameshift, where every codon is membranes of microbes and destroy them. changed following the deletion; a dele- tion of many bases results in a message defi ned medium A medium used to with fewer codons. See frameshift. grow organisms in which all the compo- nents are known. For heterotrophs, that delivery system An artifi cial system to would be a medium with a known carbon deliver a drug to a specifi c target, such source, nitrogen source, metals, and any as inclusion of a drug in a liposome or amino acids, vitamins, or other growth conjugating a drug to an antibody. See factors required by the organism. fusogenic vesicle.
degenerate code Referring to the fact demyelination The loss of the myelin that in the genetic code many amino sheath, layers of membrane surrounding acids are specifi ed by more than one segments of nerves that provide rapid codon or sequence of three bases (triplet). transmission of nerve impulses down The degeneracy of the code accounts for such nerves. Demyelination occurs in 20 different amino acids encoded by 64 some degenerative nerve diseases, such possible triplet sequences of four different as multiple sclerosis and polio, resulting bases (see nucleic acid). For example in loss of function of those demyelinated the amino acid leucine has six different nerves. codons, UUA, UUG, CUU, CUC, CUA, CUG. See wobble. denaturation Change in the three- dimensional shape or structure of a pro- degradation The process by which tein or nucleic acid by a physical or chem- substances are broken down. A degrada- ical agent, such as heat or strong acid (the tive pathway is one in which molecules denaturant), such that normal function- are enzymatically cleaved into smaller ing is altered. molecules. denaturation of DNA The splitting dehydration-condensation reaction apart of the double-stranded structure into The joining of two molecules together single strands by heating the molecule or with the elimination of a molecule of treating it with acid, alkali, salts, or urea. water. See hydrolysis. denaturation of proteins See dena- dehydrogenation The process by which turation. hydrogen ions or protons are removed from an organic molecule. Such a process dendrite A branch of a nerve cell is also called oxidation. It is carried out the receives signals and transmits them by enzymes called dehydrogenases. inward toward the nerve cell body.
66 干细胞之家www.stemcell8.cn ←点击进入
density gradientverso
Denaturation of DNA
Denhardt’s solution A commonly used solution for carrying out probe hybridiza- tions on fi lters, for example, Southern and northern blots. Denhardt’s solution con- tains polyvinylpyrrolidone (PVP), fi coll, bovine serum albumin, and a nonspe- cifi c DNA at high concentration to pre- vent nonspecifi c probe hybridization. See Southern blot hybridization.
denitrifi cation The process of reducing nitrogen compounds to a lower oxidation level, e.g., nitro (NO3) to nitrate (NO2) or nitrate to nitrite (NO).
density gradient A solution in which there is a range of densities with the sol- ute being more concentrated at the bot- tom and less concentrated at the top. These gradients can be stepwise, formed by discrete layers of different density solutions, or continuous, formed by small incremental changes in density. The gra- dients are generally made from solutions of sucrose or the heavy salts, cesium chlo- ride or cesium sulfate. Density gradient centrifugation
67 干细胞之家www.stemcell8.cn ←点击进入
rectodensity gradient centrifugation
density gradient centrifugation Tech- deoxyribonucleotide A deoxyribonu- nique used to separate macromolecules cleoside with phosphate groups attached according to their buoyant densities by to the sugar, usually at the 5′ position. either layering the macromolecules on top This is the basic building block of DNA. of a preformed gradient and subjecting the See nucleotide. gradient to centrifugation, or mixing the molecules in a solution of some support depolarization The change in electrical that will form a gradient on centrifuga- charge across a membrane. When a nerve tion. See centrifuge, cesium chloride cell receives an impulse, it becomes momen- density centrifugation, and density tarily depolarized; its interior becomes gradient. more positivily charged with respect to its exterior. Repolarization restores its interior deoxynucleoside Any of the nitroge- to a negative charge. A nerve impulse is nous bases found in nucleic acids (adenine, propagated down a nerve fi ber by waves guanine, thymine, uracil, or cytosine) of depolarization-repolarization events. See attached to deoxyribose, a fi ve- carbon action potential. sugar. See nucleoside. depurination Removal of purines deoxyribonuclease (DNase) An (guanine or cytosine) from DNA with enzyme that breaks the chemical bond the sugar-phosphate backbone remaining between the phosphate and sugar groups intact. Such a process occurs either enzy- (the backbone) of DNA molecules. These matically, as in a DNA repair process, or enzymes can be exonucleases, removing nonenzymatically, when a chemical inter- deoxynucleotides from the ends of the acts with the base and weakens its bond to its sugar residue. molecule, or endonucleases, that cleave bonds of internal nucleotides. desalting Removal of salt. This can be accomplished for preparations of macro- deoxyribonucleic acid (DNA) A molecules by dialysis or by column chro- macromolecule consisting of two com- matography. See gel fi ltration. plementary (see complementary base pairs) chains of deoxyribonucleotides. desmin A protein component of the The chains are formed by chemical intermediate fi laments found in mus- bonds between the sugar and phosphate cle cells. portions of the deoxyribonucleotides, and the two chains are held together desmoplaquin One of the protein com- by hydrogen bonds between the bases ponents of the desmosome. (A pairs with T and G pairs with C). This molecule contains the genetic infor- desmosome Regions of tight contact mation of the cell because the sequence between adjacent epithelial cells; this con- of nucleotides of the chains specify the tact gives strength to tissues and enables sequence of amino acids of proteins cells of a tissue to function together. made by the cell. There are two types of desmosomes: Belt desmosomes are bands of attachment that encircle the cell, and spot desmosomes are small local points of contact.
desmotubule A tubular structure that lies in a channel of the plasmadesmata, a means of communication between two plant cells. Such a channel is made up of the fusion of cell membranes from two adacent cells through the pores of the cell Deoxyribose wall.
68 干细胞之家www.stemcell8.cn ←点击进入
dictysomeverso
desulfurization The removal of sulfur diagnostic 1. n. A test that is used to from a molecule. determine the source of a problem. 2. The method of determining the nature detergent A molecule with a hydro- of a disease by analyzing the symptoms. phobic part and a hyrophilic portion. adj. A specifi c characteristic that allows The detergent can dissolve lipids (fats and one to determine the source of a problem oils). or the nature of a disease.
determination The irreversible com- diagnostic test A procedure that gives mittment of a cell to a particular devel- the ability to determine the nature of a opmental pathway. If a determined cell is problem. See diagnostic. transplanted, it will develop into the struc- ture it would have if it had not been trans- dialysis 1. A technique used to sepa- planted. rate molecules from each other through a semipermeable membrane that allows deuteromycetes One of the four major water and small molecules such as salts to classes of fungi, also called Fungi imper- pass through. The separation is based on fecti. The deuteromycetes are important the permeability of the molecules. Large because this group contains the majority molecules are retained by the membrane of human pathogens. and smaller ones pass through. Thus pro- teins can be desalted by dialysis. dextran A storage polysaccharide in 2. A medical procedure used to clear the yeasts and bacteria that is made up of blood of impurities after kidney failure. glucose. See desalting.
dextranase An enzyme that catalyzes dialyzable The ability to be dialyzed. the breakdown of dextran. See dialysis.
dextrin A molecule made up of several diatomaceous earth A fi nely pulver- glucose residues and one of the products ized mixture of earth composed largely resulting from alpha-amylase hydrolysis of the silicon shells of the microorgan- of starch. isms diatoms used as a fi ltering substance or as an absorbant. dextrose Another name for D-glucose, the most common sugar found in living dibasic An acid that has two hydrogen organisms. atoms that may be replaced by basic mol- ecules or metal ions to form a salt. dextrotatory isomer An isomer of a sugar that rotates polarized light to the dicentric chromosome A chromo- right. Dextrose is the dextrotatory isomer somal aberration involving breakage and of glucose. then fusion of chromosomal fragments resulting in the formation of a hybrid diacylglycerol (DAG) A molecule of chromosome with two centromeres. glycerol with two fatty acids attached to it by ester linkages. It is formed along dicotyledon Any plant characterized with inositol triphosphate (InsP3) by by fl ower parts in fours and fi ves, net- hydrolysis of a membrane lipid (phospha- veined leaves, a cambium, and an embryo tidylinositol-4,5- bisphosphate) by the with two cotyledons, or two seed leaves. enzyme phospholipase c. Both DAG and InsP3 serve as second messengers in dictysome A stack of fl attened mem- the cell. DAG activates protein kinase C, branous sacs found in plant cells located which in turn activates other enzymes. adjacent to the endoplasmic reticu- See protein kinase. lum. Its function is to mediate the
69 干细胞之家www.stemcell8.cn ←点击进入
rectodideoxynucleotide
secretion of proteins outside the cell or differentiation The process during the to target newly synthesized proteins to development of an embryo in which cells organelles such as the Iysosome. This become specialized in structure and func- organelle is called the Golgi (see Golgi tion and go on to form different tissues of apparatus) in animal cells. the adult.
dideoxynucleotide A nucleotide with differentiation antigen Any biomole- a ribose having a hydrogen atom at the cule that is detectable by an immunologic 3′ position instead of an OH group. assay only in a specifi c cell subtype in an Such a nucleotide cannot form a 3′ to organism and that may therefore be used 5 phosphodiester linkage (the linkage of ′ as a marker of that subtype. the sugar phosphate backbone of DNA) with another nucleotide. Thus, adding The free movement of mol- a dideoxy nucleotide to a growing DNA diffusion chain will terminate further synthesis of ecules from an area of greater concentra- the chain. See dideoxy sequencing. tion to an area of lower concentration.
dideoxy sequencing An enzymatic diffusion coeffi cient or constant method of sequencing DNA using dide- (kD) The measure of the ability of a oxynucleotides to stop the synthesis of solute to diffuse through a concentration DNA chains at specifi c points prema- gradient. The factors that affect the value turely, developed by Fred Sanger. DNA of the kD include the size of the particle, to be sequenced is divided into four its degree of polarity, and temperature. tubes containing DNA polymerase, the The rate of diffusion depends upon the kD four deoxynucleotides (dA,dT,dG,dC) in the following way: v = kD ([X]outside- and one of the dideoxynucleotides, [X]inside); where v is the rate of diffusion either ddA, or ddT, or ddG, or ddC. The and ([X]outside-[X]inside) represents the ratio of dideoxynucleotide to regular concentrations of solute [X] of the con- nucleotide is fi xed so that during DNA centration gradient. synthesis the DNA polymerase has the option of incorporating a regular or digitalis A cardiac drug derived from dideoxynucleotide. Because incorpo- the plant foxglove that is used to treat con- ration of a dideoxynucleotide into gestive heart failure and arrhythmias. Dig- a growing DNA chain stops further italis was discovered by the Scottish doctor synthesis of that chain, each tube will William Withering in 1785 and was found contain a series of fragments, each end- to contain a mixture of steroids including ing with the dideoxynucleotide of that digoxigenin and digitoxigenin that act to tube, for example, the tube containing slow the heart rate while increasing the ddA will have fragments that end in A. intensity of the contraction. The size of each of the fragments can be determined by gel electrophoresis, and the sequence can be read up the gel. digoxigenin A plant-derived steroid For example, if the tube containing ddA that, when covalently bound to a biologi- produces three fragments, with sizes of cal probe molecule, has been used as a four bases, seven bases, and 10 bases, hapten in some antibody-hapten-based the sequence of the DNA synthesized has probe systems. See hapten. an A residue at the fourth, seventh, and 10th position. See Sanger sequencing. dihybrid cross A cross between two individuals who are heterozygous for differential centrifugation A tech- two different genes; for example, a cross nique used to separate cells, organelles, or between pea plants that carry heterozy- molecules that differ in size or density by gous alleles for short/tall and for red/ using successively higher centrifi gal forces. white fl ower phenotypes.
70 干细胞之家www.stemcell8.cn ←点击进入
disaccharideverso
dihydrouridine An unusual pyrimi- dine base that is found only in tRNA. Dihydrouridine is derived from uri- dine by the addition of two hydrogen atoms.
dimer 1. A molecule that has two sub- units. The subunits may or may not be identical. 2. Denoting two units, for example, a dimer of nucleotides, dCdG.
dimorphism The state of having two different forms. In botony this can be seen in a plant or a species of plant that has two distinct leaf types, fl owers, or some other structure. In zoology this can Dipole be seen in two individuals of the same species exhibiting coloring, size, or other skin lesions, swollen lymph glands, sore characteristics. throat, and fever. Diphtheria toxin con- sists of two subunits, A and B. The toxin dioxin A group of heterocyclic hydro- binds to a receptor (called the HB-EGF carbons or any of a number of isomers receptor) and is taken into the cytosol in of the chlorinated teratogen, TCDD, an endosome where proteolytic cleavage which is highly toxic and is found releases the A subunit. The A subunit has as impurities in some defoliants and enzymatic activity that causes ADP-ribose herbicides. from NAD to ribosylate the eukaryotic Elongation Factor 2, which then blocks diploid Having two sets of chromo- the function of this factor in protein syn- somes so that each gene is represented thesis and ultimately causes cell death. twice in a cell or an organism. Describ- ing a cell or an organism that contains direct terminal repeats Sequences of two copies of each chromosome. See nucleotides that are duplicated on each haploid. end of a polynucleotide molecule. See long terminal repeat and terminal diplotene One of the stages of pro- redundancy. phase I during meiosis I in the formation of germ cells. During diplotene, the chias- disaccharide A molecule consisting of mata, or region where crossing over took any two sugar units. Maltose is a disac- place, can be visualized. charide consisting of two glucose mole- cules linked together by a beta-glycosidic dipole A polar molecule in which the bond. Sucrose is composed of fructose centers of positive and negative charge are separated. A molecule of water has a triangular shape and exists as a dipole. The oxygen at the head of the triangle is electronegative, and the two hydrogen tails are electropositive. See polarity.
diphtheria toxin The toxin secreted by the bacterium Corynebacterium diph- theriae, the pathogen that causes the dis- ease diphtheria, which is characterized by Disaccharide
71 干细胞之家www.stemcell8.cn ←点击进入
rectodisc electrophoresis
and glucose linked together by a beta- D loop A structure of DNA in which glycosidic bond. there is a localized denaturation of the duplex or displacement of a single disc electrophoresis Shortened term strand from the duplex resulting in for discontinuous electrophoresis, a a shape that resembles the letter D. refi nement of polyacrylamide gel electro- This structure is usually stabilized with phoresis in which the sample is electro- proteins called single-stranded binding phoresed through two polyacrylamide proteins. phases: a low percentage (stacking) gel
that sits on top of a higher percent- DMSO Dimethylsulfoxide [(CH3)2SO]; age (resolving) gel. The two-phase app- a reagent used for the cryopreservation of roach produces higher resolution between cultured animal cells. DMSO is also used closely migrating bands. See gel elec- to increase the effi ciency of transfection trophoresis. of DNA. See cryoprotectants.
disinfectant Any chemical that can kill DMT Dimethoxy trityl; a molecule bacteria and viruses. that is used as a blocking group to pre- vent unwanted reactions in automated disjunction The separation of chro- oligonucleotide synthesis. mosomes during anaphase of mitosis or meiosis. DNA, repetitive Sequences repeated many times on the genome. These dissociation constant The constant sequences vary in length from three to that relates the dissociation of two atoms, fi ve base pairs to 300 base pairs and molecules, or even large particles from are found on the genome in hundreds to one another. For the dissociation of sub- thousands of copies. Some of the repeti- stance A from substance B, where AB is a tive DNA makes up the satellite DNA, complex of A and B: a distinct band from the bulk of chro- AB → A + B mosomal DNA found after cesium chlo- Kdissociation = [A][B]/[AB] where ride density centrifugation. See Alu [A] is the molar concentration of A elements. [B] is the molar concentration of B [AB] is the molar concentration of AB DNA cloning Any procedure that gen- erates many copies of a particular DNA distillation The process of separat- sequence. The sequence can be inserted ing and purifying liquids from a mixture into a plasmid or bacteriophage, which based on each liquid’s boiling tempera- will be duplicated manyfold in a bacte- ture. The more volatile substance will boil rial cell, or the sequence can be copied at a lower temperature from the others in manyfold by polymerase chain reaction, a mixture. The vapor is then collected, or PCR. cooled, and condensed, thus extracting and refi ning it from the mixture. DNA fingerprinting A process of identifying trace evidence such as disulfi de bond A covalent bond blood, semen, saliva, and hair found between two sulfhydryl (SH) groups by at crime scenes. The most common oxidation to form an S-S linkage. Such procedure is to amplify specific re- bonds occur in proteins between cys- gions of DNA found in the evidence teine residues and stabilize the tertiary by PCR and then analyze them using structure of the protein. specific probes to Southern blots (see Southern blot hybridization) of divalent An atom or radical group hav- the amplified DNA. Because certain ing two valences or the ability to combine regions of human DNA are very vari- with two different atoms or molecules. able, comparisons between blots of
72 干细胞之家www.stemcell8.cn ←点击进入
DNA probeverso
relaxes positively supercoiled DNA by unwinding one strand of duplex DNA around the other so that each strand is wrapped around the other less than one turn per every 10 bases.
DNA linkers Short stretches of nucleotide-sequence-carrying restriction- enzyme (see restriction endonucle- ase) cutting sites that can be added by ligation to the ends of the sequence of a gene to facilitate the cloning of the gene into a vector.
DNA photolyase An enzyme that catalyzes the repair of pyrimidine dimers formed as the result of ultra- violet irradiation. The fi rst step in the repair involves the excision of the dimer that takes place only in the presence of visible light. DNA photolyase is also known as photoreactivating enzyme. See ultraviolet repair.
DNA polymerase(s) Any enzyme that can use a chain or a strand of deoxy- nucleotides as a template, a primer that Double-stranded DNA is a short fragment of deoxy nucleotides and that can synthesize a complementary DNA of suspects, victims, and evidence strand. All DNA polymerases synthesize can be used to ascertain with great DNA from the 5′ phosphorylated end to likelihood whether the trace evidence the 3′ hydroxyl end. came from a particular individual. DNA polymerase I A specifi c DNA dna genes The genes encoding the polymerase that has not only the 5′ to 3′ DNA proteins (dnaA, dnaB, dnaC) polymerizing activity but also has two that function in the initiation of DNA nucleolytic or degradative activities, a 3′ replication at the replication origin to 5′ exonuclease, an editing function, in prokaryotic genomes and plasmid and a 5′ to 3′ exonuclease. This enzyme, DNAs. with all of its activities, is used by the cell during different steps of DNA repli- DNA glycosylase An enzyme that rec- cation. It is also used during DNA repair ognizes a deaminated base and catalyzes processes. In addition, purifi ed DNA its removal from the DNA molecule, cre- polymerase I with or without its nucle- ating an apurninic or apyrimidinic site in ase activities is used in various in vitro the DNA molecule. procedures, such as preparing of labeled DNA probes and DNA sequencing via DnaG primase The enzyme responsible the dideoxy method. See Kornberg for catalyzing the formation of the short enzyme. RNA primers in Okazaki fragments. DNA probe A sequence of deoxynu- DNA gyrase An enzyme that catalyzes cleotides used to identify or isolate spe- the introduction of negative supercoils or cifi c genes or RNA transcripts that have
73 干细胞之家www.stemcell8.cn ←点击进入
rectoDNA profi ling
DNA polymerase
complementary sequences. Such probes function indicates that the plasmid con- are used in hybridization procedures tains the gene of interest. (Southern, northern, slot, and dot blots and colony or plaque hybridizations) and DNA-RNA hybrid A DNA-RNA du- are labeled with either a radioactive atom plex molecule composed of a single chain of 32P or 35S, which allows for detection of deoxyribonucleotides (DNA) and a using autoradiography, or nonradioactive chain of complementary ribonucleotides materials such as biotin or digoxigenin, (RNA). Such molecules may be created which are detected via specifi c reactions. experimentally from purifi ed DNA and See probe. RNA and are also formed when chromo- somal DNA is fragmented, heated, and DNA profi ling See DNA fi nger- mixed with RNA transcripts. printing. DNase I A DNA-degrading enzyme that catalyzes the cleavage of phosphodi- DNA repair Any process that restores ester bonds of DNA; DNase I is isolated damaged DNA. Generally, these are mul- in large quantities from pancreas. See tistep processes, requiring an enzyme endonuclease. to remove the damaged nucleotide (see DNA glycosylase and/or endonucle- DNase I hypersensitivity sites Regions ase) alone or with other nucleotides, a on the chromosome that are extremely polymerase (see DNA polymerase I) to sensitive to digestion by DNase I. These replace the removed nucleotides, and an sites are generally found near active genes enzyme to seal the sugar phosphate back- where transcription factors or other reg- bone. See excision repair. ulatory elements bind to the DNA. See hypersensitive site. DNA rescue, in positional cloning A technique for cloning genes in bacteria DNase I sensitivity Increased suscep- or yeast by transforming (see transfor- tibility to digestion by DNase I, which mation, bacterial) plasmids contain- correlates with genes that are actively ing normal genes into a host containing transcribing RNA. This shows that the a mutation that inactivates a particular chromatin of genes being expressed has function, for example, the ability to syn- an open conformation that is accessible thesize an amino acid. Addition of the to DNase I and that inactive chromatin is plasmid that leads to reactivation of the condensed.
74 干细胞之家www.stemcell8.cn ←点击进入
double versohelix
DNA sequencing A method to deter- dominance The ability of a genetic mine the order of nucleotides on a DNA trait to be phenotypically or physically fragment or molecule. Methods include expressed, whether it occurs as heterozy- use of chemicals to break the DNA chains gous or homozygous. See recessive. at specifi c bases (see Maxam-Gilbert sequencing) and enzymatic incorporation dominant control regions (DCRs) of dideoxynucleotides that result in chain An enhancer element found in the termination. See dideoxy sequencing. human beta-globin gene cluster that is being incorporated into viral vectors to docking protein (DP) A receptor pro- stimulate and regulate the expression of tein located on the membrane of the rough genes cloned into such vectors. endoplasmic reticulum (RER) that binds the signal recognition particle (SRP). This dominant negative Any mutant that protein-RNA complex bound to the initial codes for an inactive protein that, in the sequence of a protein is in the process of heterozygous state, is expressed in domi- being synthesized and is destined for secre- nant manner over the functional, or wild tion outside the cell. The docking protein type protein. anchors the partially synthesized protein to the membrane of the RER so that as dopamine A monamine neurotransmit- its synthesis is completed, it is deposited ter derived from the amino acid tyrosine. into the RER, where it will be targeted for Dopamine is involved in several clinical secretion. See rough ER. syndromes including schizophrenia and amphetamine-induced psychoses. A defi - dolichol phosphate A group of phos- ciency of dopamine is responsible for Par- phorylated long-chain hydrocarbons com- kinson’s disease. prised of cis-isoprene repeat units that acts to collect sugars for glycosylation of dosage effect The ability of a pheno- proteins being processed in the endoplas- type to be altered by an increase in the mic reticulum for export to the cell sur- amount of gene product. face. Branched sugar chains attached to dot blot A hybridization technique the phosphate moiety on dolichol phos- used to quantitate rapidly the amount of phate are transferred to proteins in the DNA or RNA in a crude preparation that lumen of the rough ER. is placed directly onto a hybridization membrane. See blot. domain A compact globular unit of protein structure. Many large proteins double crossover Two recombination have a number of domains usually con- events on the same chromosome. See nected by fl exible regions of polypeptide crossing over. chain. In the antibody molecule, there are variable domains that recognize differ- double digestion The treatment of a ent antigens, as well as constant domains preparation of DNA with two restriction that characterize each class of antibody enzymes. This technique is used to map molecule. See epitope. DNA and to isolate fragments of DNA with two distinct sticky ends to clone into a vector in a particular orientation. See restriction enzymes and cloning.
double helix Another name for a mole- P cule of DNA, consisting of two antiparallel, n (9-22) complementary strands of deoxypolynu- cleotides held together by hydrogen bonds between the complementary pairs. The DolicholDolichol phosphatephosphate molecule has a right-handed twist resulting
75 干细胞之家www.stemcell8.cn ←点击进入
rectodouble minutes
in one strand wrapped about the other to recombinant DNA technology has cloned a form a helix conformation. See dna. gene and expressed its protein product.
double minutes Small pieces of a chro- Drosophila A genus of small fl ies that mosome that contain many copies of a includes Drosophila melanogaster, the particular gene. The amplifi cation of the common fruit fl y. A well-defi ned genetic dihydrofolate reductase (DHFR) gene fol- organism, it is used as a model system lowing exposure to methotrexate may be to study and understand cell processes, manifest either in terms of the formation development, and genetics of higher of double minutes or as a homogeneously organisms. staining region of a giant chromosome. See homogeneously staining region. Drosophila heat-shock proteins Sev- eral proteins that are immediately synthe- double reciprocal plot A method for sized after the organism is subjected to a analyzing the kinetic parameters of an short treatment of heat above its lethal enzyme (Km and Vmax), by plotting 1/v limit. Some of these proteins are highly versus 1/[S], where v = rate of product for- conserved in evolution in that they are mation and [S] = substrate concentration. very similar to hsps found in bacteria and other higher organisms. Synthesis of these A technique double thymidine block proteins can also be induced by exposure used to synchronize cells in culture. A to certain toxic chemicals, alcohol, and high concentration of thymidine added to other types of stress. See heat-shock the culture will block DNA replication, proteins. so all treated cells proceed through their cell cycle and stop at the same point. See cell synchronization. drug-delivery systems See delivery systems. doubling time The same as a genera- tion time, or the time it takes for a popu- duplex Another name for double- lation of cells to double in number. stranded helical DNA. See double helix.
down-promoter mutation A mutation duplex melting The process of dena- or change in the sequence of the promoter turing double-stranded DNA by heating of a gene that results in less expression or so that the hydrogen bonds between com- transcription of that gene. See promoter. plementary bases are disrupted. See DNA denaturation. Down’s syndrome The most frequent genetic cause of mental retardation. The dyad Two units, or a pair. disease also includes variety of phenotypic abnormalities: broad skull, short stature, dyad symmetry of DNA Two regions epicauthal fold (a fold of skin around the of the DNA that have inverted, repeat- eye), stubby hands and feet. The disease is ed, or palindromic base-pair sequences. the result of an individual inheriting three Restriction-enzyme cutting sites exhibit copies (trisomy) of chromosome number 21. dyad symmetry.
downstream Denoting the region of a dystrophin One of a number of pro- gene that is located away from the gene in teins that serve to anchor the muscle the direction of the 5′ end. myofi bril to the plasma membrane. The protein derives its name from the fi nding downstream processing An industrial that a defect in the structure of dystro- term referring to the process of protein phin, or absence of the protein, is found extraction and purifi cation that occurs after in patients with muscular dystrophy.
76 干细胞之家www.stemcell8.cn ←点击进入
AE
E1A An adenovirus early gene that is under minimal nutritional conditions, E. responsible for the oncogenic properties coli is widely used as a vehicle for carry- of the virus. ing recombinant DNAs and as material for studying bacterial genetics. E2A A transcription factor that acts in a complex with a second transcrip- ecology The fi eld of study that deals tion factor, MyoD, to bring about the with the interrelationship between a developmental process that causes cells to population of organisms and the envi- become myoblasts. ronment, including physical factors and populations of organisms. early development A stage in the growth cycle of a bacteriophage that pre- EcoRI A restriction enzyme derived cedes DNA synthesis. from the bacterium E. coli that has the recognition sequence: early genes Viral genes that are the fi rst 5´-GAATTC-3´ to be expressed after the virus infects its 3´-CTTAAG-5´ host. The early genes are generally respon- sible for replication of the virus DNA and EcoRI methylase An enzyme that cat- for inducing expression of the late genes at alyzes the transfer of methyl groups from some specifi c point in the viral life cycle. the compound s-adenosylmethionine to an adenine nucleotide in the restriction E-cadherin A transmembrane pro- site of the enzyme EcoRI: tein that anchors cells to one another at EcoRI me specialized junctions (adherens junc- methylase | tions) and desmosomes where the mem- …GAATTC… – – – – – …GAATTC… → … branes of two adjacent cells make con- …CTTAAG… s-adenosyl CTTAAG… tact with one another. The extracellular methionine | domains of two opposing E-cadherins me make contact with one another on the extracellular side of the cell membrane. Edman degradation A procedure for The intracellular domains of E-cadher- determining the sequence of amino acids ins are embedded in a plaque that also in a polypeptide. The procedure is based anchors cytoskeletal fi laments. on reaction of each amino acid in the peptide chain, in order, with the Edman ecdysone A hormone that induces reagent, phenyl isothiocyate (PITC). The expression of critical genes during lar- Edman degradation is used in devices for val development in insects. Ecdysone is automated polypeptide sequencing. known to be responsible for gene tran- scription seen in chromosome puffs. EDTA Ethylene diamine tetra acetate; a chemical that binds tightly to mag- E. coli Escherichia coli, a bacterium nesium and calcium and that is used to normally found in the intestinal tract. remove even trace amounts of these met- Because of its ability to grow rapidly als effectively from a solution. EDTA is
77 干细胞之家www.stemcell8.cn ←点击进入
rectoeffector
used to control unwanted magnesium- eicosanoids A group of paracrine hor- and calcium-dependent side reactions in a mones derived from arachidonic acid biochemical mixture. through a series of enzymatic pathways, involving cyclooxygenases (COX1, COX2) effector A regulatory molecule; a and lipoxygenases. The eicosanoids de- chemical that brings about an increase or rived from COX reactions are prostaglan- a decrease in the rate of reaction in a spe- dins and thromboxane, while lipoxygenases cifi c biochemical pathway. transform arachidonic acid to the leukotri- enes and lipoxins. efferent Running in the direction away from a certain structure. For example, electroblotting A technique that uti- efferent nerve fi bers carry nerve impulses lizes an electric fi eld to transfer protein away from the brain to an effector such or nucleic acids from a gel to a blotting as a motor neuron. membrane, generally for the purpose of carrying out northern, Southern, or west- effl uent Waste fl uid such as buffer ern blot hybridizations. emerging from a chromatographic col- umn either before or after the actual electrodialysis The technique of acceler- chromatography. ating the process of dialysis by applying an electric fi eld across the dialysis membrane. EGFR Epidermal growth factor receptor; a family of transmembrane proteins whose electrodiffusion The induction of move- extracellular domains are the receptors for ment of a charged substance by an electric epidermal growth factor and whose cyto- fi eld. solic domains are receptor tyrosine kinases. The EGFR family consists of four members, electroendosmosis The diffusion of EGF-R (ErbB1), ErbB2 (Neu), ErbB3, and water into or out of a gel or membrane in ErbB4. In addition to the normal ligand the presence of an electric fi eld. Electro- (EGF), the tyrosine kinase portion of EGFR endosmosis resulting in the shrinkage or can be activated by various chemical stimuli swelling of an agarose gel is a factor that and ultraviolet radiation. The EGFR tyro- infl uences the migration of nucleic acids sine kinase activates the MAP kinase sig- during agarose gel electrophoresis. naling pathway, which in turn activates the transcription factors fos, AP-1, and Elk-1 electroimmunodiffusion A method of that stimulate gene expression related to cell quantifying antigen-antibody reactions in proliferation. Abnormal stimulation of the which antisera is incorporated into a layer EGFRs or mutations in an EGFR gene have of support medium such as agarose and been implicated in the development of can- the antigen that reacts with the antibody cers of the lung, breast, prostate, colon, and is induced to migrate through the gel ovary. electrophoretically (see electrophore- sis). Interactions of antigen and antibody egg The common term for an oocyte. produce rocket-shaped precipitin lines, the heights of which are proportional to egg coat A specialized extracellular the antigen concentration. matrix, comprised of glycoproteins, that surrounds the oocyte plasma membrane. electrolyte A charged atom or molecule In mammalian eggs, the egg coat is called in solution. the zona pellucida; in sea urchins, it is referred to as the vitelline layer. In addi- electron carrier In the biochemical tion to protecting the egg, the egg coat context, a molecule that accepts electrons sometimes functions as a selective barrier or hydrogen atoms from a specifi c donor to fertilization by sperm from different molecule and then transfers them to a spe- species. cifi c electron acceptor. FAD, NAD+, and
78 干细胞之家www.stemcell8.cn ←点击进入
electron microscopyverso
O- C O
CH3
arachidonic acid
O O- O- C O C O
O CH3 CH3 OH OH O- C prostaglandin E leukotriene A4 O O (PGE 1 ) CH3
OH
thromboxane A2
Eicosanoids
ubiquinone are examples of important biochemical electron carriers.
electronegativity The affi nity that an atom or molecule has for electrons.
electronic potential The measure of electron pressure in volts; the relative dif- ference in the concentration of electrons in two compartments, such as the inside of a cell membrane versus the outside of the membrane.
electron microscope A device that uti- lizes a beam of electrons passing through a specimen, instead of light, to visualize and magnify the features of the specimen. In an electron microscope, a powerful magnet that is used to bend the electron beam is the equivalent of the glass lens that, in a conventional microscope, is used to bend the light beam as a means of achieving magnifi cation.
electron microscopy A procedure for using the electron microscope to achieve high levels of magnifi cation. Because elec- tron microscopy must be carried out in a vacuum, biological specimens are gener- Electron microscope
79 干细胞之家www.stemcell8.cn ←点击进入
rectoelectron transport
ally fi rst coated with a thin layer of metal ELISA Enzyme linked immunosorbant that conveys the outlines of the structural assay; a sensitive technique for detec- features of interest. tion of a substance by allowing the sub- stance of interest, if present in a sample, electron transport The process of to attach to an immobilized antibody on passing electrons among electron carriers some solid substrate such as plastic. The according to a defi ned sequence. presence of the substance is visualized and quantitated using a second, labeled electron transport chain A series of antibody. large complexes located in the inner mito- chondrial membrane that uses the energy elongation factor Any of several pro- contained in electrons derived from the tein factors that are necessary to carry metabolism of fats and carbohydrates out the part of the process of translation to generate ATP. The transport chain in which amino acids are added to the consists of fi ve complexes designated by growing polypeptide chain (elongation). the roman numerals I, II, III, IV, and V. See translation. Complexes I and II accept electrons from metabolites, and these complexes transfer the electrons to complex III. Complex III elongation factors A group comprised transfers electrons to complex IV, which of at least three proteins (EF-G, EF-Ts, then reduces molecular oxygen to form EF-Tu) that are required for the elongation water. During the process, protons are of a polypeptide that is in the process of pumped out of the mitochondrion to cre- being synthesized on ribosomes (transla- ate a proton gradient. The energy stored tion). in the proton gradient is used by complex V to create ATP. eluant In column chromatography, the fl uid, such as a buffer solution, that runs electrophoresis The movement of sub- through a column and in which separated stances through a medium induced by an substances appear as they are washed electric fi eld. through the column.
electroporation A technique for intro- elution profi le In column chroma- ducing substances into cells by using a tography, a graph showing the amount pulsed electric fi eld to cause the target of material appearing in the eluant of a substance to be electrophoresed across column over time. The elution profi le is the cell membrane. generally seen as a series of peaks rep-
fraction number
Elution profi le
80 干细胞之家www.stemcell8.cn ←点击进入
emulsifiverso er
ELISA
resenting the optical density or biologi- embryo In vertebrates the organism cal activity of the eluant at various times that develops from the fertilized egg at during elution of the material that is any stage prior to birth. undergoing separation. embryology The fi eld of study devoted elution volume In column chroma- to the development of the embryo. tography, the amount of eluant that passes through a column before a par- emulsifi er A chemical, such as a deter- ticular peak in the elution profi le is gent, that is capable of breaking up a observed. mass of insoluble material into small par- ticles that then form an emulsion. The EMBL See databases. most common biochemical emulsifi ers
81 干细胞之家www.stemcell8.cn ←点击进入
rectoemulsion
produce emulsions from otherwise water- endogenous Originating from within; insoluble fatty substances. as from within a cell or a tissue.
emulsion For two unmixable liquids, a endogenous virus A virus present, colloid of one of the liquids suspended in usually in a latent form, inside a cell. the other (e.g., emulsifi ed oil and water). This term applies to various viruses that are found in an inactive state in the cells enantiomers A pair of optical iso- they infect but that may become acti- mers that are direct mirror images of one vated following exposure of the infected another. cells to various chemical and physical agents. This is true of bacteriophage encapsulation The process by which proviruses and of some forms of herpes particles become engulfed in or coated by virus. a continuous matrix. endonuclease A type of enzyme that 3′-end The terminal nucleotide at one end produces nucleic-acid-strand breaks in of a polynucleotide chain, whose 3′ carbon the interior of the nucleic acid strand. carries an unreacted hydroxyl group (–OH group). The other end is the 5′-end. endoplasm The inner part of the cell cytoplasm, that is, the portion closest to 5′-end The terminal nucleotide at one the nucleus. end of a polynucleotide chain, whose 5′ carbon carries an unreacted phosphate group. The other end is the 3′-end. endoplasmic reticulum (ER) A com- plex cytoplasm membrane network to endergonic reaction A chemical reac- which ribosomes engaged in the synthe- tion that requires the input of energy, sis of proteins destined to be exported such as heat, or mechanical agitation. outside the cell are attached. Portions of the endoplasmic reticulum containing end-fi lling Creating a blunt end from a completed proteins for export are trans- ragged-ended or staggered-ended double- ported to the Golgi apparatus to which stranded DNA through the use of a DNA they fuse. polymerase. endorphin Any of a group of short endocrinology The fi eld of study peptides that bind to receptors on neurons devoted to the function and pathology in the brain with the effect of reducing of the endocrine glands, for example, the the sensation of pain. The term is derived thyroid and pituitary glands. from endo- or endogenous morphine because endorphins are seen as naturally endocytic vesicle The membrane en- produced opiates. See methionine- closed vesicle that forms in the cyto- enkephalin. plasm of a cell during the process of endocytosis. endosome The structure formed by the fusion of several endocytic vesicles endocytosis A process in which cells in the cytoplasm following endocytosis. take up small particles or large mol- See clathrin, coated pit, and coated ecules by an invagination of the cell vesicle. membrane, which leads to the formation of a membrane-enclosed vesicle in the endospore A tough, resistant, mem- cell cytoplasm. A number of important brane-enclosed cell that is formed by effectors infl uence cell behavior includ- some Gram-positive bacteria and actino- ing the induction of gene transcription mycetes under conditions of limited food after being delivered to the cytoplasm via supply. The endospore is highly dehy- endocytosis. drated and metabolically inactive and
82 干细胞之家www.stemcell8.cn ←点击进入
enterotoxinsverso
can survive harsh environmental condi- engrailed gene One of a class of genes tions such as prolonged heat, drying, and known as segment polarity genes in Dro- exposure to toxic chemicals. sophila melanogaster (fruit fl y). The engrailed gene is a major gene responsi- endosymbiont A symbiotic organism ble for dividing the segments of the Dro- that lives inside the body of its symbiotic sophila embryo into posterior and anterior partner. halves.
endothelial cells The cell type of enhancers Certain DNA nucleotide which blood vessels are comprised. base sequences that act over distances as great as several kilobases to stimulate endothelial growth factors A class transcriptional activity of a particular of growth factors released by various tis- gene or group of genes. sues under conditions of oxygen depri- vation that stimulates angiogenesis. The enriched medium A supplemented production of angiogenic factors includ- nutrient broth for the culture of cells or ing endothelial growth factors by tumors microorganisms that require unusual accounts for the vascularization of large nutrients or unusually high levels of tumor masses that would otherwise normal nutrients. Enriched medium is become internally necrotic. For this rea- required for the culture of auxotrophic son, these factors are studied as a tar- mutants. get of cancer therapies designed to kill tumors by starvation. enteric organism A microorganism that inhabits the intestinal tract. endothermic A term used to describe a chemical reaction that requires heat in Enterobacteriacae Any of a large group order to proceed. of bacteria that inhabit the intestinal tract.
endotoxins Toxic lipopolysaccharides enterotoxins Toxins that affect the associated with the cell wall of Gram- intestine, or those that cause food poi- negative (see Gram stain) bacteria. soning. These toxins are secreted by These cell-bound toxins cause a variety the bacteria that produce them and are of physiological effects, including fever, ingested in foods contaminated with hemorrhagic shock, and diarrhea. these enterotoxigenic (toxin-producing) bacteria. Enterotoxin A is produced by end product The fi nal chemical prod- the Gram-positive (see Gram stain) uct of the series of enzymatic reactions in bacterium, Staphylococcus aureus, a particular biochemical pathway. and is most frequently associated with outbreaks of food poisoning. Recently end-product repression See feed- epidemics of food poisoning caused by back inhibition. ingestion of water, meat, or fruit con-
End-product inhibition
83 干细胞之家www.stemcell8.cn ←点击进入
rectoentomology
taminated with animal fecal matter are enzyme immobilization The chemi- due to the potent toxin produced by the cal bonding of an enzyme to some solid enterotoxigenic Escherichia coli (ETEC), matrix in a manner that preserves the strain E. coli O157:H7. enzymatic activity. The attachment of enzymes to solid matrices is an essential entomology The fi eld of study that step in the development of many enzyme- deals with insects. based biochemical assays.
entropy The variable that measures the enzyme inactivation The loss of the degree of disorder in a molecule. Changes activity of an enzyme under conditions in entropy that occur in molecules under- other than that found in the intact cell. going chemical reaction are one com- Enzyme inactivation is an important ponent of the free energy change that consideration when purifi ed enzymes are determines whether a reaction will occur employed in an environment where they under a given set of conditions. may be subject to conditions of tempera- ture, salt, pH, and so on that are not env gene(s) One of the three genes con- found in their native environment. Spon- tained in most retroviruses that codes for taneous inactivation of enzymes that the ENV glycoprotein(s). occurs for unknown reasons is also often observed in enzyme preparations, partic- ENV glycoproteins The protein prod- ularly in dilute solutions. uct of the retrovirus env gene(s) which forms a major component of the virus enzyme replacement therapy The envelope in the mature virus particle. method used to treat disease states caused by enzyme defi ciencies by direct enzyme A polypeptide or protein that injection of the missing enzyme. Enzyme acts as a catalyst for biochemical reac- replacement therapy has been used suc- tions. Enzymes do not actually cause a cessfully for treating patients with Gau- reaction to occur, but rather speed up the cher’s disease. rate at which an ongoing reaction takes place. Virtually all signifi cant biochemi- enzyme stabilization Inhibition of cal reactions in living systems are cata- enzyme inactivation. Enzyme stabiliza- lyzed by enzymes. tion is often achieved by altering the salt concentration pH or lowering the tem- enzyme derepression The induction perature of an enzyme solution. Recently, of enzyme activity by removing or inac- modifi cation of the enzyme by attach- tivating an inhibitor such as the induction ment of organic groups or altering the of a galactosidase activity by lactose. See amino acid compostion of the enzyme lac operon. polypeptide have been used to achieve enzyme stabilization. enzyme engineering Modifi cation of enzymes through recombinant DNA eosinophil One of the three subclasses techniques and site-directed muta- of leucocytes. Eosinophils are named for genesis so that they can be used for their characteristically intense staining industrial purposes. Some of these with eosin. Eosinophils are amoeboid modifi cations include increasing protein scavenger cells similar to macrophages stability, enhancing catalytic activity and are found in greatly increased num- and/or substrate specifi city, changing bers in the blood of individuals carrying optimal requirements for catalysis so parasitic infections. that the engineered enzymes will func- tion under nonphysiological conditions, ephrins A family of proteins implicated and/or become resistant to feedback in guiding axons and patterning the ner- regulation. vous system during neural development.
84 干细胞之家www.stemcell8.cn ←点击进入
Epstein-Barr versovirus
Ephrins act as ligands for receptors (des- episome Bacterial DNA that is not inte- ignated EPH-related receptors) that are grated into the bulk of the chromosomal protein-tyrosine kinases. There are two DNA and therefore replicates separately, classes of ephrins: the A-subclass (ephrin and in different copy number from, chro- A1–ephrinA5) and the B-subclass (eph- mosomal DNA. rinB1–ephrinB3). epistasis A term coined by William epidemiology The fi eld of study devoted Bateson in 1909 to describe the control of to analysis of the occurrence of disease in a certain phenotypic trait by two or more a population including the distribution, genes. A gene is considered epistatic when incidence, and factors that control the it suppresses the effect of another gene. spread of a disease. Epistatic genes are also called inhibiting genes because of their suppressive, hypo- epidermal growth factor (EGF) A static effects on other genes. Pleiotropy, small polypeptide growth factor discov- in which a single gene controls the expres- ered by Stanley Cohen as a factor that sion of more than one phenotypic trait, is caused premature eyelid opening in new- the opposite of epistasis. born mice. EGF has since been shown to be active in stimulating the growth of epi- epistatic gene A gene that suppresses thelial as well as some nonepithelial cell the effect of another, nonallelic, gene. See types. A portion of the gene that codes for allele. the EGF cell receptor has been found to be virtually identical to the Erb-B oncogene. epithelial Of or pertaining to the cell epigenetic The term applied to any fac- layers that interface between the tissue tor that infl uences cell behavior by means and the external enviornment, such as the other than via a direct effect on the cells of the skin and the lining of the gut genetic machinery, that is, the DNA. and lung airway passages.
epimerase A type of enzyme that cata- epitope The segment on a polypeptide lyzes the conversion of one epimer into its that constitutes the actual site of antibody opposite epimer. binding by a specifi c antibody molecule. The antigenic determinant. epimers Optical isomers that differ from one another at only a single carbon epitope tag A technique by which the atom. The sugars glucose and galactose function of a protein can be studied by are examples of epimers. inserting a short nucleotide segment that codes for a known epitope (an antigenic epinephrine (adrenaline) The bio- oligopeptide) into the gene for the protein chemical secreted by the adrenal glands to be studied. When the protein is made, and by the synaptic vesicles of certain it will contain the epitope. Antibodies to types of neurons. Epinephrine serves the epitope can then be used to obtain as both a hormone that stimulates the various kinds of information on the pro- breakdown of glycogen into glucose and tein, such as where it is located in the cell, a neurotransmitter. what other proteins it interacts with, if there are changes in location within the cell in response to stimuli, if there is a subunit structure, etc.
Epstein-Barr virus A member of the herpes family of DNA viruses that has been associated with Burkitt’s lymphoma Epinephrine in West Africa and New Guinea.
85 干细胞之家www.stemcell8.cn ←点击进入
rectoequatorial plate
equatorial plate The early stage of the ERCC1 is the homologue of the RAD10 formation of the membrane that divides gene in Saccharomyces cerevisiae, which two daughter cells at the end of the pro- functions in repair and recombination cess of mitosis; the metaphase plate. between chromosomes. ERCC1 levels are elevated in cancer cells that have become equilibrium centrifugation A tech- resistant to the chemotherapeutic agent, nique for separation of proteins or nucleic cisplatin. In human syndromes in which acids from a mixture by subjecting the NER is defective, such as xeroderma mixture to density gradient centrifuga- pigmentosum (XP), there is a greatly tion for a period of time suffi cient for increased incidence of skin cancer. each component of the mixture to form a band at a point equal to its density. ERK Extracellular receptor tyrosine kinase; a group of transmembrane pro- equilibrium potential The membrane teins that function as signal transducers potential at which there is no net diffu- for signals in the form of biochemicals sion of a particular type of ion across the (ligands) that bind to the ERK extracel- membrane. Equilibrium potentials are lular domains. Ligand binding activates a important determinants of nerve-impulse tyrosine kinase function of the intracellu- generation. lar domain. Phosphorylation of a tyrosine residue(s) on an intracellular protein(s) erb-A An oncogene carried by the avi- initiates a series of subsequent biochemi- an erythroblastosis virus. There are two cal changes. distinct human erb-A proto-oncogenes, erb-Aα and erb-Aβ. Both forms encode erlotinib (Tarceva) An anticancer proteins that are thyroid hormone recep- drug that acts by blocking the human tors, but they are located on different epidermal growth factor receptor (EGFR) chromosomes: erb-Aα on chromosome that inhibits the tyrosine kinase activity 17q21 and erb-Aβ on chromosome 3p24. of the receptor. Tarceva is a quinazo- linamine, with the chemical name N- erb-B An oncogene carried by the avian (3-ethynylphenyl)-6,7-bis(2-methoxye- erythroblastosis virus. The human proto- thoxy)-4-quinazolinamine. oncogene of erb-B (c-erb-B) encodes the protein for the EGF receptor of which error-prone repair Another term for as many as fi ve variant forms may exist. SOS repair. The terminology is derived These are designated erbB-1, erbB-2, etc. from the observation that repair of pyrim- The erb-B proteins are receptor tyro- idine dimer damage is often inaccurate. sine kinases that stimulate cell division See excision repair and SOS repair via the MAP kinase signaling pathway. system. erbB-2 which is also known as HER-2 or neu, has been implicated in a number erythroblast A bone-marrow stem cell of highly malignant breast cancers. The that gives rise to erythrocytes. erb-B genes are located within the region of chromosome 7p12.3-p12.1. See EGFR and heregulin. erythrocyte A red blood cell.
ERCC1 Excision repair cross comple- erythrocyte ghosts Red blood cells menting; a polypeptide that is required whose contents have been removed. for nucleotide excision repair (NER) in Erythrocyte ghosts are used as vehicles DNA that has been damaged. In the nu- to deliver drugs and other bioactive com- cleotide excision repair mechanism, single- pounds to cells. See delivery system. stranded cuts are made on either side of the damage, after which the segment of erythromycin An antibiotic that acts DNA between the two cuts is excised. by binding to bacterial ribosomes and
86 干细胞之家www.stemcell8.cn ←点击进入
Euglenaverso
inhibiting the process of translocation estrus cycle A set of changes occur- during protein sysnthesis. ring periodically in female primates that prepare the reproductive tract for preg- erythropoesis The process by which nancy and are governed by changes in erythrocytes are generated from stem the levels of the female hormones. The cells in the bone marrow. peak of the cycle (called estrus) coincides with ovulation. erythropoetin A glycoprotein, pro- duced by the kidney, that stimulates ethanol Ethyl alcohol (drinking alco- erythropoesis. hol); the alcohol produced from the fer- mentation of sugar by certain strains of Escherichia coli See E. coli. anaerobic yeast.
essential amino acid Any amino acid ethidium bromide A widely used that cannot be synthesized by an organ- fl uorescent stain for visualizing DNA ism from other components. In humans under ultraviolet light. Ethidium bro- about half of the 20 amino acids are mide is called an intercalating dye essential; in most bacteria none are. because it has a multi-ring structure that allows it to insert between the nucleotide essential gene Any gene whose mal- bases. (See fi gure on next page.) function is lethal to an organism. A num- ber of classical experiments on bacterial ethylene A simple two-carbon hydro- molecular genetics, such as fl uctuation carbon with the formula H2C=CH2. analysis, depended on the use of muta- tions in essential genes. etiology The study of the cause of a disease or pathological condition. established cell line Cells that have become immortalized during the process ets oncogene An oncogene that is car- of maintaining them in cell culture. ried by Avian leukemia virus E26 (v-ets) that causes leukemias in chickens. The establishment of cell lines The pro- product of the ets proto-oncogene (c-ets) cess by which cells in tissue culture is a nuclear protein that has been found become immortalized so that they can to have DNA binding activity and is be maintained indefi nitely. Establishment believed to play a role in the activation is believed to involve some genetic change and proliferation of T cells. that occurs spontaneously during the course of culture. Because cells derived euchromatin One of the two classes of from cancerous tissue are more readily chromatin seen in interphase cells that is established than cells from normal tissue, distinguished from the other class (het- the genetic changes involved in the process erochromatin) by being much less con- of established cell lines are also believed densed and transcriptionally active. to be related to the process by which cells become cancerous. eugenics The science of selective breed- esterase A type of enzyme that catalyzes ing to achieve a predetermined set of the breakage of ester linkages. Esterases are genetic characteristics. important in the breakdown of many lipids and in the metabolism of nucleic acids. Euglena A primitive single-celled organ- ism classifi ed as belonging to the algae in estrogen A steroid hormone, pro- the plant kingdom. Euglena exhibits the duced by the ovaries, that cause changes properties attributed to both plants and in the lining of the uterus in preparation animals, being photosynthetic in the pres- for implantation of the embryo during ence of light and a motile, food-seeking estrus. organism in the absence of light. Euglena
87 干细胞之家www.stemcell8.cn ←点击进入
rectoeukaryote
Ethidium bromide
is believed to represent or be related to plant and animal kingdoms other than ancestral organisms that gave rise to both bacteria and viruses. plants and animals. European Bioinformatics Institute eukaryote The general term for any (EBI) The European Bioinformat- higher plant or animal distinguished by ics Institute (EBI) is a molecular genet- the presence of a true nucleus that con- ics facility that forms part of the pub- tains the DNA. Bacteria and viruses are lic domain European Molecular Biology the organisms that comprise the noneu- Laboratory (EMBL) that was established karyotes (i.e., prokaryotes). in Heidelberg, Germany, in 1980. The EBI is organized into three subprograms: eukaryotic cell Any cell in which the cellular genome is contained in a mem- 1. Service program: biological databases brane-enclosed nucleus. In general, and information services. The EBI eukaryotic cells include all cells in the provides access to the EMBL Nucle-
88 干细胞之家www.stemcell8.cn ←点击进入
excision repair
otide Sequence Database, SWISS- and maintained in Heidelberg, Germany; PROT protein-sequence databases, it is the European equivalent of the Gen- the Macromolecular Structure Data- Bank DNA sequence databank. base (EBI-MSD), and the RHdb data- base of radiation-hybrid maps evolution In the biological context, the 2. Research program: tools and infor- term evolution is generally equated with mation for the study of molecular natural selection as proposed by Darwin: structure, gene comparison, metabolic the process of change in the composition pathways, three-dimensional struc- of a population resulting from the selec- ture, and database searching tion of a subpopulation that is better fi t 3. Industry program: molecular bio- than the population as a whole for sur- logical resources geared to the needs vival under a particular set of environ- of the biotechnology, chemical, and mental conditions. pharmaceutical industries excision repair The process of repair- European Molecular Biology Lab ing damaged regions of DNA that (EMBL) The EMBL has a large DNA involves the removal of the damaged sequence database containing sequence region by excision followed by recopying data compiled from international sources of the excised region by DNA polymerase
Excision repair
89 干细胞之家www.stemcell8.cn ←点击进入
exergonic
and ligation of recopied region by DNA exonuclease III An exonuclease that ligase. See ultraviolet repair. catalyzes the cleavage of single nucleo- tides one at a time from the 5′ end of exergonic A chemical reaction that double-stranded DNA that has a non- releases energy in various forms such as phosphorylated 3′ end. heat or light. exonuclease VII An exonuclease that exit domain One of the two major catalyzes the cleavage of short oligonucle- classes of binding sites on the ribosome. otides from both the 3′ and 5′ ends of The fi nished polypeptide that is the prod- single-stranded DNA. uct of the process of translation leaves the ribosome at this site. exotoxin Any of a variety of toxic sub- stances produced by a microorganism exocellular Pertaining to processes or and released to the surrounding fl uid. reactions that originate within the cell but take place outside the cell. For exam- expansins A class of plant cell wall ple, the digestion of extracellular proteins proteins required for cell growth. Under by proteolytic enzymes secreted by a cell conditions of low pH, expansins induce is an exocellular event. the breakdown of the hydrogen bonds that bind cellulose microfi brils to one another. This makes the plant cell wall less rigid, exocrine Secretion of a glandular- which, in turn, allows cell growth to produced substance via a duct or canal occur. that leads to the exterior. Exocrine glands are distinguished from endocrine explant The growth of a portion of a glands, which secrete their products into tissue outside of its normal location. the bloodstream. Sweat produced by eccrine glands or milk produced by mam- exponential growth phase The phase mary glands are examples of exocrine of growth of a population of cells or secretion. organisms during which the overall popu- lation number is seen to double at a regu- exocytosis The process in which sub- lar interval. See biphasic growth and stances contained in a specialized ves- growth phases. icle within the cytoplasm of a cell are secreted to the outside by fusion of the export The transport of substances vesicle with cell plasma membrane. The across the cell membrane from the inte- secretion of neurotransmitters in syn- rior of a cell to the exterior via special- aptic vesicles by neurons is a common ized systems. example of exocytosis. expressed sequence tags (EST) Short exon The regions of a gene in eukary- cDNA sequences used to link physical otic cells that, as opposed to the introns, maps of genomes. actually contain the coding sequences for a polypeptide. See intron and expression library A library of DNA splicing. fragments that has been created using a vector designed to express any genes that exon shuffl ing The evolutionary pro- are present in the library. See expression cess of creating new genes by duplication system and expression vector. and recombination of preexisting exons. expression-linked copy (ELC) The exonuclease A class of enzymes that particular variable surface glycoprotein catalyze the cleavage of nucleotides from gene that is being expressed at any one the end(s) of a nucleic acid. time during the developmentmental cycle
90 干细胞之家www.stemcell8.cn ←点击进入
ezrin
of the trypanosome. See variable sur- extracellular fl uid The liquid outside face glycoprotein. the cells in a tissue.
expression site The term for the extracellular matrix A complex mix- genetic location of an expression- ture of proteins (such as fi bronectin, linked copy of a variable surface glyco- laminin, collagen) that is deposited on protein. Expression sites are all located the outside of a cell and plays a crucial near the telomere of a chromosome. role in the attachments of cells to the sur- faces on which they grow. The extracel- expression system An expression vec- lular matrix is believed to play an impor- tor that contains the cloned DNA it is tant role in regulating the growth and designed to express, together with the differentiation of a cell partly because the host with which the vector is to be used. composition of the extracellular matrix is often dramatically altered in cancerous expression vector A specialized cloning tissue. vector that contains the elements needed to transcribe a cloned DNA. Expression extrinsic protein A protein present in vectors contain sequences required for a cell or tissue but which originated else- DNA replication and promoter elements where. adjacent to the cloned DNA to initiate transcription. extrusion The energy-requiring pro- cess by which cells export large particles extinction coeffi cient The constant of or organelles. proportionality relating the molar concen- tration of a substance and the absorbance ezrin A cytoskeletal element that links of its solution. See Beer-Lambert law. the transmembrane adhesion molecule, ICAM-1 (intercellular adhesion molecule extracellular Outside the cell. 1) to the actin cytoskeleton.
91 干细胞之家www.stemcell8.cn ←点击进入
AF
F(ab)2 fragment A portion of the IgG ments. The genetic form of the disease antibody molecule containing the two is an X-linked autosomal recessive. The antigen binding domains but not the Fc gene for the disease (called FGD1), of as portion. Such fragments are generally yet unknown function, has been mapped produced by treating antibodies with cer- to chromosome band Xp11.21. The dis- tain proteases that specifi cally cleave the ease was described by the Norwegian molecule near the end of the Fc segment. pediatrician D. J. Aarskog in 1970 and American C. I. Scott Jr. in 1971. F-1 generation First fi lial generation; the fi rst generation offspring of a genetic cross. f-actin (fi lamentous actin) The func- The term is generally applied to the immedi- tional actin fi lament composed of G-actin ate offspring of higher plants and mammals. subunits.
factor, blood clotting Any of a group F-2 generation Second fi lial genera- of protein factors in the blood serum that tion; the offspring of a mating between act according to a defi ned pathway to members of the F-1 generation. produce a blood clot. In blood clotting, the breakdown of platelets at the wound Fabry’s disease One of the lysosomal site is the fi rst step. Factors VII, VIII, storage genetic diseases characterized by IX, and XI become activated by tissue the lack of alpha-galactosidase. When factor and, in the presence of calcium, this enzyme is missing in the lysosome, convert factor X to activated thrombo- long-chain carbohydrates that need to be plastin. Thromboplastin then converts degraded are not. These charbohydrates prothrombin into thrombin, the clotting then accumulate in the bloodstream and enzyme. Thrombin catalyzes the conver- deposit in the capillaries and other organs, sion of soluble fi brinogen in the serum eventually leading to stroke, heat attack, into the insoluble protein fi brin. Fibers and fatality in the young adult. This is made of fi brin are the basic structure of a disease that is a promising candidate the fi nal clot and are made fi rm by fac- for enzyme replacement therapy because tor XIII, the fi brin-stabilizing factor. The cloned alpha-galactosidase can be admin- genetic disease, hemophilia, is the result istered to individuals and directed to the of a defect in the gene that codes for one lysosome, where it needs to function. of these factors (factor VIII).
facilitated diffusion The process of facultative anaerobe A microbe that passive diffusion through a membrane lives under anaerobic conditions but that via membrane channels or with the aid of can adjust its metabolism to utilize oxygen carrier proteins in the membrane. when placed in an aerobic environment.
faciogenital dysplasia (Aarskog-Scott facultative heterochromatin A highly syndrome) A disorder characterized by condensed form of heterochromatin that wide-spaced eyes (ocular hypertelorism), is believed to not be transcribed. anteverted nostrils, a malformed scro- tum, and excessive looseness of the liga- facultative microoganisms See aerobe.
92 干细胞之家www.stemcell8.cn ←点击进入
feline sarcoma versovirus
reassociates fi rst when the strands of a native DNA helix are dissociated from one another, for example, when heated and then allowed to reassociate. The fast component was shown to contain highly repeated DNA sequences.
fastidious Pertaining to microrganisms with complex nutritional requirements; requiring enriched media. See enriched FAD (fl avin adenine dinucleotide) medium. fatty acid Any of a group of long-chain carboxylic acids that are found mostly FAD, FADH2 Flavin adenine dinucle- otide; a cofactor for enzymes involved in in animal fat. The most common fatty oxidoreductions and electron transfer in acids found in animal tissues are oleic, numerous biochemical reactions, but par- palmitic, stearic, and palmitoleic acid. ticularly those involved in the oxidative metabolism of sugars for energy produc- FBJ An acronym derived from the tion. FAD is a combination of two nucle- names of the discoverers (Finkel, Biskis, otides, one of which is derived from the B and Jinkins) of the FBJ murine osteosar- coma virus. See fos. vitamin ribofl avin (vitamin B2). FADD Fas associated via death domain; Fc The portion of the immunoglobulin a component of the classical apoptosis heavy-chain molecule that does not con- pathway mediated by Fas. tain the antigen-binding region; the anti- body molecule constant region. familial hypercholesterolemia A genetic disease characterized by abnormally high fecundity The measure of fertility; for serum cholesterol levels resulting in early example, sperm count or the production onset atherosclerosis and heart attack. The of viable eggs. genetic defect results in low tissue levels of the receptor for low- density lipoproteins feedback control The general term for (LDLs). Cells lacking these receptors cannot regulation of an enzyme’s activity by one take up LDLs from the blood to digest them. of its own metabolites.
familial Mediterranean fever A gen- feedback inhibition Inhibition of en- etic disease characterized by recurrent zyme activity by a product (generally the fevers and infl ammation of the abdomi- fi nal product) of the metabolic pathway nal cavity resulting in severe abdominal of which the enzyme is part. pain. Other symptoms include arthritis, chest pains, and skin rashes. feeder layer In tissue culture, a layer of cells that produces a product that sup- Fas A transmembrane receptor protein ports the growth of another cell type in involved in the “classical” apoptosis path- co-culture. Feeder layers are used as a way. In this pathway, activation of the means of growing cells that will not grow Fas receptor (caused by binding of ligand in purely synthetic culture medium. to the extracellular portion of Fas) results in activation of caspase-8 (also known as feedforward control Stimulation of FLICE) by FADD, which is bound to the enzyme activity by a product of the meta- cytosolic domain of the Fas receptor. bolic pathway of which the enzyme is part.
fast component That portion of a feline sarcoma virus (FSV) A retrovi- preparation of eukaryotic DNA that rus that causes sarcoma tumors in cats.
93 干细胞之家www.stemcell8.cn ←点击进入
rectofermentation
fermentation The process in micro- to the recipient. F′ plasmids are F factors organisms in which the metabolism of that have picked up a region of the bacte- sugars for energy is accompanied by the rial chromosome after a faulty recombi- formation of alcohol or lactic acid. nation event in an Hfr strain.
fermentor A device for growing large FGP Fluorescent green protein; A nat- bacterial cultures. A fermentor consists urally occurring fl uorescent protein iso- of a large vessel (usually containing more lated from certain coelenterates such as than 10 liters of culture) that is mechani- the Pacifi c jellyfi sh. Because the gene for cally shaken or rapidly rotated for aera- FGP has been cloned and found to be tion of the culture. There is also a heater active when fused to other genes, it has in contact with the culture vessel that found wide application as a molecular tag maintains the culture at the proper tem- for determining the cellular location of perature, usually 37°C. various proteins to which it can be fused by various molecular genetic techniques. ferritin A protein that forms a complex with iron. Ferritin, which normally func- fgr The oncogene carried by the Garden- tions as an iron storage protein, is used as Rasheed strain of the feline sarcoma a noradioactive label for visualizing anti- virus. bodies bound to a specifi c antigen, such as in a western blot. fi brin The protein formed from fi brino- gen that polymerizes to form the fi bers fertilization The fusion of two gam- that comprise a blot clot at the site of a etes and of their respective nuclei to cre- wound. See factor, blood clotting. ate a diploid or polyploid zygote. fi brinogen The protein that is released fes Feline sarcoma; the oncogene car- by platelets at the site of a wound and ried by Snyder-Theilen strain of feline that gives rise to fi brin when thrombin is sarcoma virus (FSV). fes is believed present. See factor, blood clotting. to be a protein kinase that catalyzes the phosphorylation of tyrosine residues. fi broblast A cell type that comprises the bulk of the living cells in connective fetal calf serum (FCS) The serum tissue and in the supporting matrix (the from the blood of embryonic calves; an stroma) of skin and other epithelial tis- essential component of most tissue cul- sues. Fibroblasts are embedded in a com- ture media. The factors in FCS that pro- plex extracellular matrix, much of which mote the growth of cells in tissue culture they secrete and that is responsible for the are largely unknown but are believed to strength and fl exibility of the stroma. include growth factors and hormones. fi broblast growth factor receptor 3 Feulgen reagent A DNA-specifi c stain (FGFR3) The cell surface receptor for (fuchsin sulfi te) that, because it was found fi broblast growth factors (FGFs); a family to stain chromatin in the nucleus strongly, of polypeptide growth factors involved was cited as evidence that DNA was the in cell division, angiogenesis, and wound hereditary material in experiments car- healing. The FGF receptor is comprised ried out by Robert Feulgen in 1914. of an immunoglobulin-like extracellular domain, a transmembrane domain, and F factor A bacterial plasmid con- an intracellular tyrosine kinase domain. taining fertility genes that establish the Mutations in the FGF receptor cause donor characteristics for conjugation achondroplasia, a disease of bone devel- (see high-frequency recombination opment characterized by stunted bone strain). These genes are responsible for growth. The FGFR3 gene is located on the ability of the donor cell to establish the HD region on chromosome 4 (gene contact with and transfer its chromosome map locus 4p16.3).
94 干细胞之家www.stemcell8.cn ←点击进入
fl agellinverso
fi bronectin A ubiquitous glycoprotein fi lter sterilize A technique for render- found in blood and in virtually all tissues ing a solution sterile (i.e., free of microbes of the body that is thought to play a key the size of bacteria) by passing it through role in cell adhesion and in the control a fi ne fi lter. of cell growth and differentiation. Fibro- nectin is particularly prominent in the fi ne-structure mapping A mapping fi broblast-containing tissues where it is technique that can detect changes in complexed with collagen. nucleotide base sequence covering a few nucleotides based on very rare recombi- Fick’s law of diffusion The premise nation events between strands of DNA that a substance in solution will diffuse carrying different forms of the same gene in a direction that will tend to eliminate (alleles). any concentration gradient, that is, make the solution homogenous with respect to fi ngerprinting A general term for tech- concentration. niques that defi ne a unique identity for a given protein or nucleic acid molecule fi coll A synthetic polymer of the sugar by breaking the molecule into a pattern sucrose. Ficoll is biochemically inert and of fragments based on its amino acid or is used primarily to increase the den- nucleotide base sequence by using various sity of solutions for purposes of density proteases or restriction enzymes. Finger- gradient centrifugation and nucleic acid printing has been developed as a tool in hybridization. forensic medicine primarily in the form of DNA fi ngerprinting in which an individu- al’s unique pattern of DNA fragments is fi coll gradient A solution of fi coll visualized by Southern blot hybridization created in such a way that the con- using a probe for a gene that is known to centration of fi coll varies continu- vary widely. ously along an axis through the solu- tion. Ficoll gradients are often used to fi nger protein A protein that contains separate different cell types from one segments of regularly spaced cysteine another by sedimentation. See density amino acids that appear to be involved gradient. in binding zinc atoms. This type of struc- ture is characteristic of nucleic acid bind- fi gure eight An intermediate stage in ing proteins. the process of recombination in which two circular DNAs are covalently bound fi rst-order kinetics Any chemical reac- to one another. tion in which the rate at which the reac- tion occurs is proportional to the molar fi lamentous bacteriophage A sub- concentration of only one reactant. For class of single-stranded DNA bacterio- example, for the reaction phage in which the bacteriophage genome A --- > B + C, the rate of reaction = k[A], is encapsidated by an elongated viral coat where k is the reaction rate constant. resembling a fi lament. F1 and M13 are the most common members of this class fl agella Long, external, fl exible fi la- of bacteriophage. ments that are used to propel cells in a liquid medium. Bacterial fl agella, which fi lamin A dimeric protein that cross- differ in structure from the fl agella in links actin fi laments to produce a viscous eukaryotic cells, also serve as a chemo- aggregate with the properties of a gel. tactic organ that guides the cell to sources of food. fi lopodia Long microspikes (50 μm) that extend out of the growing tip of the fl agellin The protein that makes up the axon of a developing neuron. bacterial fl agellum.
95 干细胞之家www.stemcell8.cn ←点击进入
rectofl ash evaporator
fl ash evaporator A device for removing emitted by individual cells. Flow cytom- solvent from large volumes of a solution etry is carried out in an instrument in by evaporation to concentrate the solute. which individual cells are illuminated A fl ash evaporator consists of a heated, by a laser beam as they pass by a win- rotating glass sphere with a tube to allow dow where a sensitive photocell records the evaporating solvent to exhaust. the quantity of light emitted at a given wavelength. Because antibodies can be fl avin A compound that is derived from labeled with fl uorescent compounds, ribofl avin (vitamin B2). Important fl avin this technique has been widely used as biomolecules are FAD and FMN. See an automated procedure for quantitating coenzyme. amounts of various antigens present in a population of cells.
fl uctuation analysis A method devel- oped by Salvatore Luria and Max Del- bruck in 1943 that used statistical analy- sis of the rate of mutation occurring in bacterial cultures containing small num- bers of cells to demonstrate that muta- tions occur spontaneously.
A fl avin molecule fl uid mosaic model A model of the e u k a r yo t i c c e l l m e mb r a n e prop o s e d by S . J . Singer and G. L. Nicolson in 1972. The FLICE Fadd-like ICE; an alternative model is based on the idea of a semisolid name for caspase 8. FLICE-2 is an alter- lipid bilayer into which transmembrane native name for caspase 10. and integral membrane proteins are embedded. fl ippases A group of enzymes that cat- alyzes the movement of membrane lipids fl uorescence The property of cer- from one membrane leafl et to the other tain molecules whereby they emit light (fl ipping). Flippases are believed to serve at a specifi c wavelength (emission wave- important functions in the traffi cking of length) when illuminated by a light beam vesicles, particularly for the formation of at another specifi c wavelength (excitation secretory and endocytic vesicles. Some wavelength). fl ippases do not require an energy source, while others require energy derived from fl uorescence-activated cell sorting the hydrolysis of ATP. (FACS) A variation of fl ow cytometry in which fl uorescently labeled cells are fl occulation The rapid precipitation out physically sorted into different compart- of solution of large amounts of material. ments based on the amount of fl uores- cence emitted at a given wavelength. fl ora Plant life. fl uorescence in situ hybridization fl ow cytoenzymology A technique for (FISH) A process like autoradiog- separation and analysis of cells by fl uo- raphy, but instead of using radioactively rescence-activated cell sorting (FACS) labeled DNA, the DNA probe is tagged based on the presence of certain enzymes with a fl uorescent dye that will vividly that generate colored compounds from show up chromosomes or parts of chro- synthetic substrates. mosomes.
fl ow cytometry A technique based on fl uorescence resonance energy transfer automated measurement of fl uorescence (FRET) The direct transfer of an excited
96 干细胞之家www.stemcell8.cn ←点击进入
folate antagonistverso
photon from one fl uorescent molecule to change in substrate concentration when another located within 1-50Å from one the system is isolated, but increases only another. Since the ability to transfer the by 2 percent when the enzyme is in the photon from one molecule to the next var- intact cell, the enzyme would have a fl ux- ies as a function of the sixth power of the control coeffi cient of 2/5, or 0.4. distance, the transfer of the photon (which can be measured from the fl uorescence of FMN Flavin mononucleotide; a nucleo- the recipient molecule) is a sensitive indica- tide derived from the vitamin ribofl a- tor of the distance between the two mol- vin (vitamin B2). FMN, one of the two ecules. nucleotides that comprise FAD, also fun- ctions in the transport of electrons dur- fl uorescent-antibody techniques Tech- ing the oxidative metabolism of sugars niques for visualization of the location of for energy production. See coenzyme a certain antigen in a tissue section or and fl avin. other cell preparation that is based on the binding of an antibody with a fl uorescent Fmoc A molecule (9-fl uorenymethoxy- label to the antigen of interest. carbonyl) used to protect the free amino end of a growing peptide chain against fl uorescent label Any molecule that unwanted side reactions during the chem- fl uoresces and can be attached to another, ical synthesis of a peptide. nonfl uorescing probe molecule such as an antibody or a DNA hybridization probe. fms The oncogene carried by the McDonough strain of feline sarcoma virus. The human proto-oncogene (c-fms) fl uorimetry Quantitative measurement encodes a protein that is the membrane of fl uorescence. receptor for macrophage colony stimu- lating factor (MCSF). The chromosomal 5-fl uorodeoxyuridine The nucleotide location of the c-fms gene is 5q33.2- derivative of 5-fl uorouracil that is formed 5q33.3. in cells treated with 5-fl uorouracil. 5- fl uorodeoxyuridine and 5-fl uorouracil are focus-forming assay A test for the both used as anticancer agents. presence of DNA that contains onco- genic activity. In a focus-forming assay, 5-fl uorouracil (5-FU) An analog of test DNA is transfected into animal cells thymine used as an anticancer agent. 5- that ordinarily show contact inhibition. FU is an inhibitor of the enzyme, dihy- If the test DNA contains oncogenic activ- drofolate reductase (dHFR) and therefore ity, the recipient cells lose contact inhibi- is an inhibitor of nucleotide synthesis, tion, begin to divide, and then form areas which is particularly harmful to the rap- of dense packing (foci). The appearance idly growing cells in tumors. of foci is taken as an indication of onco- genic activity. fl ush ends Termini of a double- stranded DNA molecule that have no focus-forming units (FFU) A mea- single-stranded overhanging regions. See sure of the concentration of live virus blunt-end DNA. in a given volume of fl uid. Focus-form- ing units are determined by spreading a fl ux-control coeffi cient A measure of known amount of virus-containing fl uid the relative change in fl ux (i.e., change over a layer of cells that the virus infects in the rate of substrate conversion to and then observing the number of areas product) caused by some specifi c modula- in the cell layer that show evidence of tion of an enzyme (e.g., chemically alter- viral infection. See titer. ing its activity) when the system is in a steady state. If the activity of an enzyme folate antagonist A type of compound, increases by 5 percent in response to a for example, methotrexate, that blocks
97 干细胞之家www.stemcell8.cn ←点击进入
rectofoldback DNA
certain critical reactions in the synthe- (human), and HCM1 (Saccharomyces sis of nucleotides and that requires the B cerevisiae). Most forkhead factors are vitamin, folic acid. Folate antagonists are involved in embryonic development, widely used as chemotherapeutic agents but some factors have been shown to be for treatment of cancer because the rap- involved in other functions, including idly growing cells of malignant tumors regulation of circadian rhythm, cell-cycle are more dependent on these reactions control, and life span. than normal cells. formamide One of the most com- foldback DNA A segment of DNA that monly used chemicals for denaturing contains palindromic repeat sequences nucleic acids in hybridization techniques. that may base pair to one another during Formamide has the chemical formula: reassociation. See palindrome. CONH2.
follicle cells A layer of cells found in forming face The side of the Golgi both vertebrates and invertebrates that stack where vesicles that have budded off surround the oocyte and supply it with from the rough endoplasmic reticulum certain low molecular weight nutrients. fuse to the Golgi apparatus; the cis face of the Golgi apparatus. footprint The region on a DNA molecule to which some particular regulatory pro- forms I, II, and III, DNA The super- tein binds. The footprint can be visualized coiled, nicked circular, and linear forms, by partially digesting the protein-bound respectively, of circular episomal DNAs DNA with DNase 1 and then separating such as viral or plasmid DNAs. Forms the digested DNA fragments by electropho- II and III are not thought to be natu- resis. The region bound by the protein will rally occurring forms but are believed to not be cut by the DNase and will appear as be derived from native supercoiled DNA a blank area on the gel. (form I) by nicking of one (form II) or both strands (form III) during the process forensic science The science developed of extraction. by Edmund Locard in the early part of the 20th century to establish whether formycin B A purine derivative that is there has been a transfer of trace evidence used as an antiparasitic agent. Formycin between the criminal and crime scene or B inhibits the ability of cells to use sal- between the crime scene and the crimi- vaged nucleotides from the extracellular nal. Forensic scientists focus on trace evi- medium for nucleic acid synthesis. dence such as blood, semen, saliva, and hairs found at the crime scene. Before the forward mutations Any mutation that advent of DNA technology, trace evidence causes a change from a normal function- was analyzed by a series of blood group- ing gene to an improperly functioning, or ing tests. Now, forensic scientists rely on inactive, gene. dna fi ngerprinting. fos The viral oncogene (v-fos) carried forkhead transcription factors A by Finkel-Biskis-Jinkins (FBJ) murine family of transcription factors defi ned osteosarcoma retrovirus. The fos homo- by a common DNA binding domain of logue in human cells codes for a family of about 100 amino acids called the fork- proteins consisting of four members: Fos, head domain, fi rst described in a mutant FosB, FosL1, and FosL2. These genes for of Drosophila melanogaster. Forkhead leucine zipper transcription factors form transcription factors have been found dimers with the jun family of proteins in a wide variety of species from yeast to form the transcription factor complex to humans, including FD1-5 (D. mela- AP1. As transcription factors, the fos nogaster), HNF-3 (mammalian), HTLF proteins are implicated in cell prolifera-
98 干细胞之家www.stemcell8.cn ←点击进入
freeze-drying
tion, differentiation, and transformation. are sites where chromosomal transloca- The human c-fos gene is located on chro- tion is observed. mosome 14q21-31. fragile X syndrome The second most fosfomycin (fosfonomycin) An anti bi- frequent genetic cause of mental retarda- otic that acts by blocking an early step tion after Down’s syndrome. This dis- in the biochemical pathway by which the ease belongs to a group of diseases that bacterial cell wall is synthesized. Fosfo- result from a repeating sequence of three mycin, which is a structural analog of bases (triplet) on a chromosome, caused phosphoenol pyruvate (PEP), blocks the by DNA polymerase slippage during step at which PEP is required to create DNA replication. Fragile X is caused the pentapeptide that is used to construct by increasing the numbers of the triplet the bacterial cell wall. CGG on the X chromosome. The larger the number of repeats, the more severe fos-related antigens (FRA) A group the disease. Individuals with only a few of nuclear phosphoproteins that are simi- repeats are carriers of the disease but in lar in structure to the product of the fos general do not have the symptoms. oncogene. frame-shift mutation A type of founder effect The presence of a chro- mutation in which nucleotide bases are mosome, a portion of a chromosome, or inserted or deleted in the coding region even a particular allele in the members of gene causing the triplet codons to be of a given population that can be traced translated in the wrong reading frame. back to a single individual.
four-strand crossing over Crossing Franklin, Rosalind (1920–1958) A over between two sister chromatids that physical chemist who carried out the high- involves breaking of both DNA strands resolution X-ray diffraction studies that on both chromosomes. This differs from led to the elucidation of the double heli- the usual case that involves only one cal nature of DNA for which James Wat- DNA strand from each chromatid. See son and Francis Crick were awarded the crossing over. Nobel Prize.
F protein The Sendai virus–derived FRAP Fluorescence recovery after pho- protein that is responsible for the ability tobleaching; a technique whereby fl uores- of the virus to cause cell fusion. The F cent molecules located in a specifi c cellular protein is used in the creation of fuso- structure, for example, the nucleus or cell genic vesicles. membrane, are bleached by a microscopic light beam. The bleached area is exam- fps (fes oncogene) The oncogene car- ined at various periods of time after the ried by the Snyder-Theilen strain of feline photobleaching to determine how fast the sarcoma virus (FSV). The human homo- cellular structure regenerates the material logue of fps (c-fps) encodes a cytoplasmic in the bleached area. The FRAP technique tyrosine kinase. The feline gene causes is best known for its use in studies of cell sarcoma tumors, but the association of membrane synthesis and fl uidity. the human fps gene with cancer has not yet been clearly established. The location free energy See Gibbs free energy. of the human fps gene is chromosome 15q26.1. freeze-drying The removal of ice from a frozen cell sample to be examined by fragile sites Sites on chromosomes that the freeze-etch technique by subjecting show a higher than normal probability of the sample to a vacuum as the tempera- breakage and therefore more commonly ture is slowly raised, thereby leaving the
99 干细胞之家www.stemcell8.cn ←点击进入
freeze-etch
essential cell structural features behind. Fura 2 A dye that fl uoresces in the See lyophilization. presence of calcium. Fura-2 fl uorescence can be used to observe and quantitate the freeze-etch A technique for examin- infl ux or effl ux of calcium in the cytosol. ing cell structure by electron microscopy in which a frozen cell sample is cracked furanose A ring form of a sugar in with a knife to reveal the cell contents. which the ring is made up of four carbon After freeze-drying, the sample is then atoms and one oxygen. The term desig- shadowed and examined under the elec- nates a large group of sugars that form tron microscope. this type of ring when dissolved in water.
freeze fracture A technique for examin- fushi tarazu gene A gene in the pair- ing the structure of the cell membrane by rule locus of the fruit fl y, Drosophila electron microscopy. The procedure is essen- melanogaster. Mutants of the fushi tially the same as in freeze-etching, except tarazu (ftz) gene are missing every other that the sample is fractured along the plane segment. See pair-rule mutants and of the cell membrane, which is then exam- segments, segmentation. ined after freeze-drying and shadowing. fushi tarazu mutation A mutation Frei test A clinical test to diagnose dis- that causes a failure to produce the seven eases caused by infectious microbes based embryonic parasegments that appear on the appearance of a skin reaction when at the blastoderm stage of develop- a killed preparation of the suspect micro- ment in Drosophila melanogaster (fruit organism is injected subcutaneously. fl y). Experiments centered on this muta- tion helped identify the pair-rule class of French pressure cell A device for lys- genes. ing bacterial cells by subjecting them to hydrostatic pressure. fusidic acid An antibiotic that acts by blocking the translocation step in protein Freund’s adjuvant An emulsion con- synthesis (translation) by blocking the sisting of water, oil, and dead mycobac- release of the elongation factor (EF)-GDP teria that, when mixed with an immu- complex. nogen, enhances the immune response when the immunogen-Freund’s adjuvant fusion proteins Proteins that represent mixture is injected into an animal. the product of the artifi cial splicing of two genes. fructose An isomer of glucose found in citrus fruits. A phosphorylated form of fructose is an intermediate metabolite in fusogenic vesicles Liposomes that con- the oxidation of glucose for energy pro- tain, in the lipid bilayer, specialized fusion- duction. inducing molecules (e.g., the F protein).
ftz An acronym for fushi tarazu. futile cycle In living systems, a combi- nation of competing reactions in which fumarase The enzyme that catalyzes the products of one set of reactions are the conversion of fumarate to malate, an reconverted to the original reactants. important step in the Krebs cycle phase The term is generally applied to reactions of the metabolism of sugars. of energy metabolism such as the inter- conversion: fungi See mold. ATP->ADP fructose-6-phosphate <======> fungicide An agent that selectively kills ADP->ATP fungi. fructose-1, 6-bisphosphate
100 干细胞之家www.stemcell8.cn ←点击进入
G
G1 phase A segment of the cell cycle that converts galactose into glucose. The representing the time period during disease is characterized by organ enlarge- which there is an increase in cellular mass ment, mental retardation, and cataract between the end of mitosis and the onset formation resulting from the accumula- of DNA synthesis (S phase). tion of D-galactose and D-galactose-1- phosphate in the bloodstream. G2 phase A segment of the cell cycle representing the time period during galactosidase Any one of the class of which there is an increase in cellular mass enzymes that catalyze the cleavage of between the end of DNA synthesis (S the glycosidic linkage between galactose phase) and the onset of mitosis. and another sugar. The galactosidases are divided into α and β galactosidases GABA Gamma amino butyric acid; an depending upon the type of glycosidic inhibitory neurotransmitter derived from bond that is cleaved (i.e., α or β). See the amino acid glutamate. GABA acts to glycosidic linkage. inhibit neural transmission by opening channels that admit chloride ions into the GALT Gut-associated lymphatic tissue; neuron. The GABA receptor is the target of patches of lymphoid tissue in the small pharmacologic agents, such as Valium and intestine; Peyer’s patches. other diazepams, that act as depressants by potentiating the action of GABA. gamete The mature product of the process of meiosis, for example, egg and GAG 1. Glycosaminoglycans. Long-branched sperm, in organisms that reproduce sexu- chains of sugar molecules built from repeat- ally. ing dissacharide subunits containing amino groups. Glycosaminoglycans are present on gamma chain An immunoglobulin the surfaces of eukaryotic cells where they (Ig) chain that is found as a transmem- are believed to play a role in cell-cell and brane protein on the surface of a B cell cell-substate recognition. and is part of the B-cell antigen-receptor 2. Group-specifi c antigens. The proteins complex. encoded for by the GAG gene of a retro- virus. The GAG proteins are the compo- gamma interferon See interferon. nents of the virus capsid. gamma radiation A high-energy elec- galactose An optical isomer of the tromagnetic radiation that is produced sugar glucose. Galactose differs from during the process of nuclear decay in glucose only at the fi fth carbon and is which one subatomic particle is converted converted into glucose through the action into another; for example, the decay of of an epimerase enzyme (UDP-glucose 4- a neutron into a proton and an electron epimerase) that acts on this carbon. also releases gamma radiation.
galactosemia A genetic disease caused ganglion A collection of neurons that, by a defi ciency of the epimerase enzyme in mammals, are centers of lower brain
101 干细胞之家www.stemcell8.cn ←点击进入
gangliosides
function outside the brain proper. In GC box A sequence of nucleotides lower animals such as worms and inver- (GGGCGG) that is found in the promot- tebrates, which lack a brain, ganglia con- ers of mammalian cells and that appears stitute the centers of all brain function. to be a binding site for certain transcrip- tion factors. gangliosides A class of cell membrane lipids found almost entirely in brain neu- GC content The fraction of the total rons. Ganglioside molecules form part of nucleotides in a DNA molecule that are the brain-receptor complex for pituitary cytosine and guanine nucleotides, gener- polypeptide hormones. ally given as a percentage of the total.
GAP GTPase-activating proteins. A gel A semisolid colloidal solution. group of proteins that inactivate the ras- GTP by inducing hydrolysis of the bound gel electrophoresis A technique for GTP to produce ras-GDP. The ras-GDP separation of substances, principally complex remains inactive until the GDP nucleic acids and proteins, in a mixture is exchanged for GTP. The inactivation by using an electric fi eld to induce them of ras-GTP by GAPs is an important step to migrate through a gel. Separation of in the signal transduction pathway medi- the individual component substances in ated by ras. the original mixture is based on the size of the molecules (gel fi ltration) and/or gap genes A group of genes (hunchback, the electric charge. Agarose gels are com- Kruppel, knirps) that play a key role in the monly used for separation of mixtures development of segmentation in the embryo of nucleic acids, and polyacrylamide gels of the fruit fl y, Drosophila melanogaster. are generally used for separation of pro- Gap genes have been identifi ed on the basis teins and nucleic acids. of mutations that result in the absence of segments in the midportion of the embryo. gel fi ltration A technique for sepa- ration of a substance from others in a gap junction A specialized channel mixture by passing the mixture usually that forms between two adjacent cells at through gel beads in a column. Separa- their mutual point of contact and that tion is based on the size of the molecules connects the cells so that small molecules and depends on the size of the spaces (about 2,000 kilodaltons or less in size) between the polymeric gel molecules (i.e., can pass between them. Gap junctions are the pores). Substances whose molecules believed to be a mechanism of intercellu- are smaller in size than the pores enter lar communication involved in the con- the gel, so their movement through the gel trol of cell growth and differentiation. is slower than larger molecules that have less of a tendency to pass through the gel gap mutants Mutants of the fruit fl y, pores but, instead, pass around the gel Drosophila melanogaster, in which sev- beads. Each type of gel has a characteris- eral adjacent segments fail to appear dur- tic pore size that determines the exclusion ing the course of development. See seg- size: the maximum molecular size that ments, segmentation. can enter the gel. Molecules larger than the exclusion size are completely excluded gasohol A mixture of 90 percent gaso- from the gel. line and 10 percent ethyl alcohol. Gaso- hol is purported to be a cleaner and more gel-retardation assay A technique for energy-effi cient alternative to gasoline. It determining the presence of DNA has been proposed that ethyl alchohol for protein complexes in a given DNA frag- this purpose could be cheaply obtained ment by observing whether or not the by bacterial fermentation. rate of movement of the fragment in an
102 干细胞之家www.stemcell8.cn ←点击进入
gene cloning
Gel fi ltration
electric fi eld is slowed in the presence of a various investigators around the world, cur- particular protein. rently maintained at the National Library of Medicine. The GenBank, which is the gelsolin A protein that, in the pres- most comprehensive U.S. national database ence of calcium, liquefi es gels formed of this type, is divided into 13 sequence from actin and fi lamin. The liquefaction categories: primate, mammal, rodent, ver- is accomplished by cleavage of the actin tebrate, invertebrate, organelle, RNA, bac- fi laments and subsequent capping of the teria, plant, viral, bacteriophage, synthetic, cleaved fi lament ends. and unannotated. See databases.
gel transfer A term applied to the gen- gene A sequence of DNA nucleotides eral process of transferring substances sep- that carries the complete code required arated by gel electrophoresis from the gel to for the biosynthesis of a polypeptide. a membrane for analysis, for example, for Southern, northern, or western blot analy- gene bank A group of genes that are sis. Blotting is one type of gel transfer. coordinately controlled.
GenBank A national database of nucleic gene cloning The science of creating acid and protein sequences contributed by recombinant DNAs that can be inserted
103 干细胞之家www.stemcell8.cn ←点击进入
gene(s) codominant
into and copied by a host microorganism. gene(s) codominant Different versions The term and the power of the technique (alleles) of a particular gene, both of which derives from the ability to rapidly grow are active in the heterozygous state. and easily manipulate large populations of microorganisms carrying the recombinant gene conversion A mechanism pro- DNA from a single cell (i.e., a clone). posed to explain coincidental evolu-
Gene cloning
104 干细胞之家www.stemcell8.cn ←点击进入
genetic code
tion of duplicated genes in which a DNA For example, 16p11.2 designates sub- strand from one gene copy becomes paired band 2 of band number 11 on the p arm with the complementary DNA strand of chromosome 16. from the other gene copy; any area of base mismatch (presumably representing a gene(s) pseudogenes A variant form of mutation that occurred in one of the gene a particular gene that has become perma- copies) is then repaired by a mismatch nently inactivated over time as the result repair system. See mismatch repair. of genetic drift.
gene(s) dominant A version of a par- generation time The average time ticular gene (allele) whose expression between the appearance of parent and obscures the expression of its recessive progeny generations in a population. allelic form when both are present in the heterozygous state. gene(s) recessive A version of a par- ticular gene (allele) whose expression is gene duplication An error in the nor- obscured by the expression of its domi- mal process by which genes are copied nant allelic form when both are present and that results in a copy of a gene being in an organism (the heterozygous state). placed in the same DNA strand as the gene from which it was copied. gene splicing A term that is applied to the general area of recombinant DNA gene expression Any gene activity. but that is also applied to the process of Gene expression may include gene tran- splicing of eukaryotic RNAs. See exon, scription into mRNA, translation of intron, and splicing. mRNA into protein, or activation of a preexisting gene product (protein). gene therapy The treatment of human genetic diseases by the transfer of a wild gene families A group of genes whose type, or “good,” gene into a person whose nucleotide base sequences show a high disease is the result of a faulty gene. Such degree of sequence homology to one therapies depend on creating the appro- another. In evolution, gene families are priate vector to bring the replacement believed to arise through gene duplication. gene into the appropriate tissue. Some blood diseases, such as thalassemia and gene fl ow The tendency for gene fre- hemophilia, are amenable to such treat- quency to appear in one population as ment because wild-type genes missing in the result of interbreeding with another patients suffering from these diseases can population in which the gene is present. be inserted into stem blood cells and intro- duced into the patients by bone marrow gene frequency The relative percentage transplants. Gene therapy has been used of occurrence of a particular gene relative to treat familial hypercholesteremia, a dis- to all versions (i.e., alleles) of that gene. ease in which patients have a faulty gene for a protein that is responsible for clear- gene library See library. ing the blood of cholesterol. Because the process requires alteration of the genetic gene map locus The chromosomal loca- material of an individual and may be tion of a gene. Gene map locus is defi ned risky, such procedures require monitoring by chromosome number, p or q arm, band by local and federal oversight committees number, and sub-band number. Gene map involving scientists, ethicists, and lawyers. locus is written as: Xp (or q) y.z where: X is the chromosome number; genetic code The sequence of three p or q designates the chromosome arm; consecutive nucleotide bases in a strand y is the band number; and of DNA or RNA that specifi es an amino z is the sub-band number. acid.
105 干细胞之家www.stemcell8.cn ←点击进入
genetic disease
genetic disease A disease caused by understand functional relationships be- an alteration or mutation in a gene that tween parts of genes and to assess evolu- results in an aberrant form of the protein tionary relationships between species. See coded for by the gene. Because genetic alignment and databases. diseases are based on alterations in genes themselves, genetic diseases are trans- genotype The set of all genes, includ- missable to offspring that receive the ing the different alleles, either expressed faulty gene. Hemophilia and sickle-cell or not expressed, that is carried in the anemia are examples of genetic diseases. DNA of an organism.
genetic drift The process of changes in gentamycin An aminoglycoside antibi- structure of a gene in evolution as the otic isolated from Actinomycetes that is result of a random substitutions, loss, active against a number of Gram-positive or insertions of nucleotide bases in the cocci-type bacteria. DNA. genus A subclassifi cation of organisms genetic engineering The manipulation between family and species. The stan- of genes through the use of recombinant dard classifi cation categories in order of DNA techniques for the purpose of modi- general to increasingly detailed biologi- fying the function of a gene or genes for a cal characteristics is: kingdom, phylum, specifi c purpose. class, order, family, genus, species.
genetic information Any information germacide Any agent, chemical or that is carried in terms of the sequence of physical, that destroys microbes that nucleotide bases in DNA. cause disease.
genetic map A map of the genome of germ cell A reproductive cell or any an organism based on the relative dis- cell giving rise to a reproductive cell, such tances between genetic markers. See as an oocyte or spermatocyte. linkage map. germinal centers A region of the lymph genetics The study of the process by node that contains a mass of rapidly divid- which traits are transmitted from parent ing B cells. See B lymphocytes. to offspring; the study of inheritance. germination The growth of a plant genome All the genetic information from a spore or a seed. carried in the haploid number of chro- mosomes. germ line Embryologically, the cells that will, in the adult organism, give rise genomic DNA The DNA representing to germ cells. the entire genome. In laboratory termi- nology, the term genomic DNA is used germ-line therapy A gene therapy to describe a pure preparation of total based on the introduction of new genetic native DNA isolated from tissue or a cell material or on alteration of existing culture. genetic material in cells that give rise to either sperm or egg. In germ-line therapy, genomic library A library created in the new or altered genetic material can be a particular vector from genomic DNA passed from parent to offspring. such that the entire genome is included in the library. ghost cells A cell, usually a bacterial or red blood cell, that lacks much or most genomics Computer analysis of gene of its internal contents as the result of sequences from different organisms to lysis and resealing of the cell membrane.
106 干细胞之家www.stemcell8.cn ←点击进入
glucocorticoid
Because ghost cells can fuse with other Gleevec An anticancer pharmaceuti- cells, ghosts have been used as a means of cal made by Novartis that inhibits the abl packaging and delivering drugs to other protein-tyrosine kinase that is activated cell targets. in chronic myelogenous leukemia (CML) by formation of the Philadelphia chromo- gibberllin A group of plant hormones some. Gleevec is effective against CML that induce the plant growth and matura- and some gastrointestinal tumors (GISTs). tion in fl owering plants. glial cell A cell type that occupies the Gibbs-Donnan effect The observa- spaces in between the neurons of the tion that charged molecules on one side brain. Glial cells are divided into fi ve of a semipermeable membrane often fail major subclasses: Schwann cells, oligo- to ever become evenly distributed on dendrocytes, microglia, astrocytes, and both sides of the membrane. This effect ependymal cells. is explained on the basis of the fact that other charged substances that cannot glial fi brillary acidic protein diffuse across the membrane produce an (GFAP) A protein that assembles into a electric fi eld that infl uences the migration cytoplasmic network of intermediate fi la- of charged molecules. ments found only in glial cells.
Gibbs free energy The energy that globin A group of proteins that form is either released, or used by, a chemi- the subunits of the oxygen-carrying mol- cal reaction. The free energy absorbed or ecules hemaglobin and myoglobin. A released during a reaction (ΔG) is the dif- mutation in the globin genes is respon- ference between the energy of the prod- sible for the oxygen-transporting defect ucts and the energy of the reactants (ΔG seen in sickle cell anemia. =Gr-Gf) and is given by: ΔG = ΔH–tΔS Globotriaosylceramide A glycolipid where: molecule that accumulates in patients with ΔH is the energy released (or used) in Fabry’s disease, which is caused by a defi - chemical bond breakage (or formation) ciency of the enzyme α-galactosidase A. during the chemical reaction. ΔS is a measure of the change in entropy globular actin (G-actin) The basic (disorder) of the molecules involved in the monomeric subunit that polymerizes to reaction. form the characteristic actin fi laments in t is the temperature at which the reac- muscle. G-actin is a single polypeptide of tion occurs. 375 amino acids.
For a bimolecular reaction, A + B --> C + D glucagon A small (29 amino acids) ΔG = ΔG°´ + RT ln([C]c[D]d/[A]a[B]b) polypeptide hormone that stimulates the where ΔG°´ is the standard free energy breakdown of glycogen into glucose pri- for the reaction under standard biologi- marily in the liver. cal conditions. See standard trans- formed constants. glucoamylase An enzyme, found largely in saliva but also in the juices of the lower Gilbert, Walter (b. 1932) Walter digestive tract, that catalyzes the break- Gilbert became famous as a coinventor down of complex sugars, for example, of the Maxam-Gilbert technique of DNA starch, by cleaving the bonds between sequencing and for his research on the two adjacent glucose subunits. intron-exon structure of eukaryotic genes. He shared the Nobel Prize in chemistry in glucocorticoid One of the three classes 1980 with Paul Berg. of steroid hormones produced by the outer
107 干细胞之家www.stemcell8.cn ←点击进入
glucogenesis
layer (the cortex) of the adrenal gland. The gen peroxide produced in the reaction can glucocorticoids cortisone, corticosterone, be used to oxidize certain aromatic com- and cortisol regulate the metabolism of pounds that form colored products. glucose. They also act as anti-infl amma- tory agents and are used to limit infl am- glutamic acid An amino acid whose mation in certain chronic infl ammatory side chain is: conditions such as arthritis. –CH2–CH2–COOH The COOH group gives glutamic acid its glucogenesis (gluconeogenesis) The acidic nature. process of creating glucose from its own metabolites. This pathway is active under glutamine An amino acid whose side conditions where the rate of metabolism chain is: of glucose is reduced. –CH2–CH2–C=O \ glucose A six-carbon sugar that is the NH2 major source of energy for most of the Glutamine plays an important role as animal kingdom. Energy is generated an intermediate in the transfer of amino through the oxidation of glucose to yield groups in the biosynthesis and degrada- carbon dioxide and water. See tricar- tion of a number of other amino acids. boxylic acid cycle. glutamine-rich domains A region(s) glucose effect The blockage of the found in certain types of eukaryotic induction of the lac operon genes by the transcription factors. Glutamine-rich presence of glucose. domains are involved in interaction with other transcription factors with which Glucose Galactose Malabsorption they act in a synergistic manner to upreg- (GGM) A rare autosomal recessive dis- ulate transcription; in human cells the order resulting from a defect in the SGLT1 glutamine-rich domains interact with gene that codes for a transporter for the acidic type transcriptional activators sugars glucose and galactose. The condi- bound at a separate site. Sp1 and Oct1 tion is characterized by severe diarrhea are examples of transcription factors and dehydration in neonates and can be that contain glutamine-rich domains. A fatal unless a sugar-free diet is maintained. glutamine-rich domain in the transcrip- In GGM most mutations are found to pro- tion factor Sp1 makes contact with the duce nonfunctional truncated SGLT1 pro- dTAFII110 factor in the Drosophila teins or in misplacement of the transporter TFIID complex to bring about transcrip- so that glucose and galactose cannot be tional activation. removed from the intestinal lumen. The sugars osmotically remove water from the glutathione A molecule made up of body tissue into the intestinal space, which three amino acids linked end-to-end (a tri- causes the diarrhea. peptide: glutamate-cysteine-glycine) that acts as a reducing agent. Glutathione plays glucose isomerase The enzyme that a role in determining the proper folding catalyzes the conversion of glucose into of newly synthesized proteins through the the structural isomer fructose. cross-linking of cysteine residues.
glucose oxidase An enzyme derived GLUT transporters A group of trans- from certain molds that catalyzes the con- porters (GLUT1, GLUT2, GLUT3, version of glucose into gluconic acid with GLUT4, and GLUT5) which function to the formation of hydrogen peroxide. Glu- transport glucose and other hexoses such cose oxidase is widely used for the deter- as galactose and fructose into the cell. The mination of glucose in the urine in the GLUT transporters allow sugars to diffuse diagnosis of diabetes because the hydro- passively, down a concentration gradient,
108 干细胞之家www.stemcell8.cn ←点击进入
glycosidic linkage
into cells. They are large integral mem- cyclin D by phosphorylation. Inhibitors brane proteins in which a transport chan- of GSK3 are being investigated as thera- nel is formed from 12 membrane-spanning peutic agents for the control of diabetes regions. The appearance of GLUT trans- and to limit the degree of neurological porters on the cell surface is induced by damage in stroke patients. insulin in liver cells. glycolipid A sugar or polysaccharide glycerides (mono-, di-, tri-) A class covalently attached to a lipid. Glycolip- of lipids in which one or more fatty acids ids are important components of animal is covalently attached to a glycerol mol- cell membranes. Cerebrosides and gan- ecule. Glycerides are divided into mono- gliosides that are derivatives of the lipid glycerides (one fatty acid molecule), di- sphingosine, are important components glycerides (two fatty acid molecules), and of glycolipids in membrane receptors in triglycerides (three fatty acids). Glycerides the brain. are important as storage vehicles of fat. glycopeptide A polypeptide covalently glycerol The simplest carbohydrate linked to a sugar or polysaccharide. Gly- containing three carbon atoms with the copeptides are divided into two classes, structure: depending on whether the sugar(s) are H2C–CH–CH2 linked to the polypeptide by an oxygen | | | atom (O-linked) or a nitrogen atom (N- HO OH OH linked). See peptidoglycan. Because of its ability to absorb water, glyc- erol is used commercially as a moisturizer. glycophorin A transmembrane glyco- protein (see transmembrane proteins glycine The simplest amino acid whose and glycoproteins) found in erythro- side chain consists only of a hydrogen atom. cyte membranes. The critical function that glycophorin serves is unknown, but The cell coat; an outer glycocalyx it is believed that charged residues on the coating, rich in carbohydrates on the sur- extracellular domain of the protein may face of most eukaryotic cells. The glyco- help to prevent blood cells from sticking calyx also contains some glycolipids and to one another. Glycophorin has been proteoglycans that may form part of the shown to be a site of attachment for the extracellular matrix (ECM). infl uenza virus and the malarial parasite, Plasmodium falciparum. glycogen A complex storage polysac- charide consisting of branching chains Proteins linked to sugars of glucose molecules. Glycogen is the pri- glycoprotein mary source of glucose that is produced and/or polysaccharides that are prevalent mostly from glycogen breakdown in the on the outside surfaces of cell membranes. liver under conditions where the amount Glycoproteins are components of special- of free glucose is insuffi cient for the ized receptor molecules and the extracel- body’s needs. lular matrix (ECM) in eukaryotic cells.
glycogen synthase kinase 3 (GSK3) glycosaminoglycans See GAG. A serine/threonine protein kinase that activates the enzyme glycogen synthase glycoside A compound formed between by phosphorylation. The β isoform a sugar and some other type of molecule, of GSK3 (GSK-3β; one of the two iso- for example, a protein, lipid, or other forms) is also known as Factor A, which organic molecule. activates the phosphatase PP-1. GSK-3β is also a component of the Wnt signal- glycosidic linkage (bond) A cova- ing pathway, where it regulates levels of lent bond between the anomeric carbon
109 干细胞之家www.stemcell8.cn ←点击进入
glycosylation
of a sugar and another molecule, usually Golgi apparatus (Golgi body) In another sugar, protein, or lipid. eukaryotic cells, a series of membrane- bound vesicles arranged in a stack in glycosylation The process of adding which the polysaccharides of glycosylated polysaccharides to polypeptides that are polypeptides are progressively altered or destined to become glycoproteins. Glyco- processed prior to their being sorted or sylation takes place primarily in the inte- transported to the cell surface. rior of the endoplasmic reticulum (ER) during the synthesis of the polypeptide gonadotropic hormones (gonado- that is to be glycosylated. tropins) A group of polypeptide hor- mones made by the pituitary gland that glyoxylate cycle A pathway used by stimulate accessory cells surrounding the plants and bacteria for obtaining energy oocyte to release progesterone, which in from acetate and other two carbon com- turn causes the oocyte to mature. In ani- pounds that are metabolized into acetate mals, gonadotropins begin to appear at or acetyl groups. The glyoxylate cycle is the age of sexual maturity. analogous to the Kreb’s cycle with many of the same intermediate steps. gonadatropin The collective name for follicle-stimulating hormone (FSH) and glyoxysome An organelle in plants where lutinizing hormone (LH); small polypep- the glyoxylate cycle, a biochemical pathway tide hormones that are made in the ante- used to convert fats to sugar, is located. rior portion of the pituitary gland (ade-
rough endoplasmic reticulum
Golgi apparatus (Golgi body)
110 干细胞之家www.stemcell8.cn ←点击进入
GRB2
nohypophysis) and act to stimulate the rial cells are fi rst stained with crystal vio- reproductive organs in various ways. let and iodine and then decolorized with alcohol. Cells that retain the purple color gp120 A glycoprotein found on the of the crystal violet after the alcohol treat- surface of the HIV virus. During viral ment have thick cell walls and are Gram- infection, the attachment of gp120 to positive. Cells that lose the crystal violet CD4, a receptor on the surface of the tar- after decolorization but then take up a get lymphocyte, is a primary event. For pink counterstain, safranin, have thinner this reason, antibodies created against cell walls with an abundance of lipid in gp120 epitopes are a major focus in the the cell envelope. These cells are called development of virus-neutralizing anti- Gram-negative. The Gram-positive Gram- bodies and anti-AIDS vaccines. negative classifi cation system is particu- larly useful because, not only does it help GPR14 G protein–coupled receptor 14; to identify bacteria, but in a wide variety the membrane receptor for the neuropep- of bacteria the Gram stain shows a corre- tide hormone urotensin II, which regulates lation with sensitivity to antibiotics. cardiovascular function and is hypoten- sive in mammals. GPR14 is predominantly grana Stacks of thylakoid disks inside expressed in the heart and pancreas and the chloroplast. in low levels in portions of the brain. The gene map locus of human GPR14 gene is granulocyte macrophage-colony stim- 17q25.3. ulating factor (GM-CSF) A recombi- nant protein produced in large scale and G protein(s) A class of cell membrane- used as an adjunct to cancer chemother- bound proteins that bind GTP and/or apy since 1991. It stimulates the produc- GDP and act to alter certain metabolic tion of granulocytes to boost the immu- pathways or gene expression when a spe- nity of patients taking chemotherapy. cifi c ligand binds to a receptor on the out- side of the cell. granulocytes A class of leucocytes composed of neutrophils, eosinophils, graft v. host reaction A deleterious and basophils. Granulocytes are active in immune reaction in which lymphocytes allergic immune reactions such as allergic present in grafted tissue attacks the tis- skin lesions and arthritic infl ammation. sues of the host. gratuitous inducer A molecule that, gram A universally adopted measure of because it structurally resembles a cer- mass in the scientifi c world. A gram is tain inducer of transcription, can act to defi ned as one thousandth of the mass of induce transcription in lieu of the authen- one liter of pure water at a temperature tic inducer, for example, IPTG in lieu of where its density is greatest, that is, just lactose as a gratuitous inducer of the lac above the freezing point (0°C). operon.
gramicidins A class of polypeptide gray matter That portion of the neural antibiotics isolated from Bacillus brevis. tissue of the spinal cord that is composed Gramicidins act as ionophores in which of the nerve cell bodies in contrast to the ions are carried across the bacterial cell white matter, which is made up of the wall in the interior of the circular mol- nerve-cell axons and dendrites. In cross- ecule. section, the gray matter is seen as a but- terfl y shaped structure that runs through Gram stain A method for differentially the interior of the spinal cord. staining bacteria developed by Christian Gram in 1884. Staining depends on the GRB2 An intermediate in the RTK-ras cell-wall properties of the bacteria. Bacte- signal transduction pathway. The
111 干细胞之家www.stemcell8.cn ←点击进入
Griffi th, Frederick
GRB2 is an adaptor protein that binds the TRK phosphotyrosines via an SH2 domain and the Sos protein via an SH3 domain. Sos then induces exchange of ras-bound GDP for GTP, thereby activating the ras-GTP complex that binds to the N-terminal end of cytosolic raf, a protein whose C-terminal end has serine/threonine kinase activity. GAP is a negative regulator of ras that acts to increase the rate of hydrolysis of ras-bound GTP to GDP.
SH2 domain GRB2 binds to the phos- entering the cell are trapped in the cyto- phorylated cytoplasmic domain of an sol where they accumulate. RTK; the GRB2 SH3 domain simultane- ously binds to a protein called Sos that, growth curve A graph in which the in turn, stimulates GDP bound to ras on number of individuals in some population the inner surface of the cell membrane to of organisms, for example, cells in culture, be exchanged for GTP. animals in a herd, fi sh in a pond, and so on, is plotted as a function of time. Griffi th, Frederick (1881–1941) A bacteriologist who demonstrated that heat- growth factors A group of small, killed, pathogenic pneumococcus bacteria secreted polypeptides that bind to recep- could transform live, nonpathogenic pneu- tors on certain specifi c target cells and mococci into the pathogenic form when the stimulate cell division in those target two were mixed together. This experiment cells. Growth factors have become the gave rise to the work of Avery, MacCleod, focus of intensive research because of and McCarty that showed the transform- their ability to infl uence the physiology ing factor to be DNA. of growth and also because many of them have been found to bear a close relation- griseofulvin An antifungal agent pro- ship to oncogenes. duced by Penicillium griseofulvum. Gris- eofulvin appears to act by inhibiting the growth hormone A growth factor pro- movement of chromosomes during mito- duced by the anterior lobe of the pituitary sis by interfering with the spindle appa- gland that stimulates the growth of bone ratus. and muscle during childhood. Growth hormone was one of the fi rst bioactive group translocation A type of active factors whose genes were cloned and transport in bacteria in which compounds expressed in transgenic animals, thereby that enter the cell by passive diffusion demonstrating the feasibility of curing are immediately modifi ed, for example, genetic disease by gene therapy. by phosphorylation such that they can- not passively diffuse back across the growth media A synthetic solution of cell membrane. In this way, compounds nutrients to support the growth of cells or
112 干细胞之家www.stemcell8.cn ←点击进入
guanosine, 7-methyl
stationary by acting on the agent after it has been phase bound to glutathione via the sulfur (S) atom attached to the cysteine residue in Number of cells log phase glutathione. or (exponential phase) organisms GT-AG rule The observation that intron sequences in DNA always begin lag phase with GT as the fi rst two nucleotides and always end with AG as the last two Time nucleotides. The GT-AG rule plays a role Growth phase in the mechanism of RNA splicing by which messenger RNA (mRNA) is cre- ated from heterogeneous nuclear RNA microorganisms in culture. See defi ned (hnRNA). medium and minimal medium.
growth phases The different stages of GTP-binding protein (G protein) A growth of a culture of microorganisms membrane-bound protein that acts (usually applied to cultures of bacteria) as an intermediate between the bind- as refl ected in the shape of the growth ing of a stimulatory molecule, such as curve. There are three growth phases: a hormone to a receptor on the out- (1) a period of slow growth just after side of the cell, and the biochemical the organisms are inoculated into fresh effect that ultimately takes place inside growth medium (lag phase), (2) a period the cell. The mechanism by which G during which the population doubles at a proteins transmit the signal (i.e., the fi xed interval of time (exponential phase binding of the stimulatory molecule to or log phase), and (3) an indefi nite period its receptor) from the outside of the cell during which growth is slow or com- to the inside is not entirely understood pletely stopped as the culture becomes but is known to involve the exchange overcrowded and nutrients are displaced of a molecule of GDP for a molecule (stationary phase). of GTP by the G protein as part of the process. growth rate The change in the num- ber of organisms in a population divided guanine One of the four purine bases by the length of the time interval over normally found in DNA and RNA. See which the change in the population num- purine. ber took place. For example, a culture of cells in which there were 2,500 organ- guanine nucleotide exhange factor isms on one day and 7,000 organisms (GEF) A protein factor required in the three days later would be said to have peptide-elongation step in protein syn- shown a growth rate of (7,000–2,500)/3, thesis. Following the hydrolysis of GTP or 1,500 organisms/day. bound to elongation factor Tu (EF-Tu), GEF is involved in the regeneration of Grunstein and Hogness method The the EF-Tu complex by mediating the technique of hybridization of a DNA exchange of bound GDP for GTP. probe to whole, lysed, bacterial colonies that have been transferred by blotting guanosine A ribonucleoside consisting onto a nitrocellulose fi lter or other hybrid- of guanine and the sugar, ribose. ization membrane; colony hybridization. guanosine, 7-methyl A derivative of GST Glutathione S-transferase; a class the normal nucleoside, guanosine, that is of enzymes that aid in the detoxifi ca- found in the cap of eukaryotic mRNAs. tion of xenobiotics or toxic electrophiles See capped 5′ ends.
113 干细胞之家www.stemcell8.cn ←点击进入
rectoguanosine monophosphate
Guanosine nucleosides
guanosine monophosphate (GMP) attached to the fi fth carbon atom of the The ribonucleotide containing guanine; a ribose sugar. GTP, together with ATP, derivative of guanosine formed by phos- CTP, and UTP, is a direct precursor of phorylation of fi fth carbon of the ribose. RNA and a high-energy compound that provides energy that drives other bio- guanosine triphosphate (GTP) Gua- chemical reactions. nosine with three phosphate groups
114 干细胞之家www.stemcell8.cn ←点击进入
HA
H-2 histocompatibility The match of but in which the tissue structure is poorly tissue proteins that, in the mouse, deter- organized. These lesions are believed to mines whether a tissue graft will or will represent developmental abnormalities not be rejected by the immune system of rather than true neoplasms. the host. H-2 compatibility is determined by a large gene complex that codes for haploid The state of a cell having only cell surface glycoproteins. See major one set of alleles as opposed to the diploid histocompatibility complex. state in which a cell normally contains two copies of each allele. habituation The tendency of some neu- rons to require longer than normal refrac- haploid number Having one-half the tory phases or stimulation by stronger-than- number of chromosomes as are normally normal nerve impulses to trigger an action present in a diploid cell, thus being in the potential if action potentials have been trig- haploid state, for example, in gametes. gered in that neuron in the recent past. haploinsuffi ciency One copy of a gene hairpin loop The folding back of a is not suffi cient to assure normal function. nucleic acid strand on itself. Hairpins are created by internal base pairing between haplotype A particular set of markers, purine and pyrimidine bases along two for example, RFLPs or alleles, in a cer- separate segments of the nucleic acid. See tain region of a chromosome. The term looped domains. was originally applied only to clusters of alleles in the major histocompatibility half-register In repeated sequences complex (MHC) but is now applied to in which the repeat unit can be divided any specifi ed genetic locus. into two halves, half-register refers to a misalignment of the two chromosomal copies such that the fi rst half of a repeat HA protein Hemagglutinin protein; a unit is aligned with the second half of the glycoprotein found on the surface of the other chromosomal copy. For example, infl uenza virus that binds to sialic acid if the two halves of the repeat units are residues on the cell membranes of cells designated X and Y, then the repetitive that are infected by the virus; this bind- portion could be represented by ing initiates the process of infection. In ...XYXYXYXYXYXYXYX... a subsequent step, the HA protein medi- and in half register: ates fusion between the viral membrane ...XYXYXYXYXYXYXYX... and the membrane of an endosome that ...XYXYXYXYXYXYXY... encapsulates the virus. This observa- tion has led researchers to utilize the HA halophile A type of bacteria requiring protein as a tool to study the process of sodium chloride (NaC1) as an essential membrane fusion. nutrient. hapten A small molecule that can act hamartoma A mass comprised of the as an immunogen only when combined normal organ tissues in which it is found with a larger molecule.
115 干细胞之家www.stemcell8.cn ←点击进入
rectoHardy-Weinberg law
Hardy-Weinberg law A mathematical tion formulas are largely used to represent formulation describing how two differ- the furanose and pyranose rings of sugars ent alleles are distributed among the indi- to show the three-dimensional differences viduals in a population. For two allelic between structural, conformational, and forms of a certain gene, D and d, assum- optical isomers. ing that (1) mating between individuals is random, and, (2) if the frequency of a HB101 A substrain of the bacterium, certain allele, D, in the population is p, Escherichia coli, that is widely used as a and the frequency of the d allele form is host in which to grow recombinant vec- q, then tors because of its high effi ciency of DNA uptake and transformation. 1. The fraction of individuals homozy- gous for D (DD) will always be given HCG Human chorionic gonadotro- by p2; pin; an ovary-stimulating hormone pro- duced in the placenta after the embryo 2. The fraction of individuals heterozy- implants into the wall of the uterus. HCG gous for D (Dd) will always be given is referred to as the pregnancy hormone by 2pq; and because antibodies to HCG are used to 3. The fraction of individuals homozy- diagnose pregnancy. gous for d (dd) will always be given by q2. HDAC Histone deacetylase(s); a group of 11 enzymes (isoforms) that catalyze harvesting Collection of cells, organ- acetylation/deacetylation of histones that isms, or growth medium from an experi- are complexed with DNA in chromatin. mental population, generally for purposes Since aetylation of histones represses tran- of analysis or extraction of biochemicals. scription, HDACs are considered to have a transcriptional repressor function. Because HAT medium A type of cell-culture some of the genes whose expression is growth medium containing hypoxan- repressed by HDACs are tumor suppres- thine, aminopterin, and thymine used for sors, inhibitors of HDACs are being tested negative selection (i.e., HAT selection) of as anticancer agents. certain kinds of mutant cells that cannot utilize hypoxanthine and/or thymine to H DNA An unusual structure found make nucleic acids. in DNA segments with long stretches of polypyrimidines or polypurines in which HAT selection The procedure for there is also a palindromic repeat. In these selecting cells in HAT medium. The pro- regions DNA can fold back upon itself to cedure is based on the principle that only form a hairpin in which three of the DNA those cells that can utilize hypoxanthine strands are base paired with one another and thymine supplied from outside the to form a triple helix while the fourth cell to make their nucleic acids will sur- strand remains unpaired. The formation vive in the presence of the drug aminop- of H DNA structures is believed to play a terin or other folate antagonists, which role in the control of gene expression. prevents cells from synthesizing their own purine and pyrimidine nucleotides. heat-shock genes A set of genes found throughout the animal kingdom that are Haworth projection formula A type of suddenly and rapidly transcribed in a representation of organic ring compounds coordinated fashion when cells are sub- that shows some of the characteristics of jected to certain kinds of stress, such as the three-dimensional structure, particu- a sudden rise in temperature. Many of larly the spatial arrangement of the substit- these heat-shock genes encode chaperons, uent groups along the ring with respect to proteins that aid in the folding or unfold- one another and the ring. Haworth projec- ing of proteins.
116 干细胞之家www.stemcell8.cn ←点击进入
helix-loop-helixverso
triple helical
TAGCAGGCTTCTCTCTCTCTCTCT C ATCGTCCGAAGAGAGAGAGAGAGA GT C G TCTCTCTCTCTCTCT A G G C C AGAGAGAGAGAGAGA
AAGCGATGTGACT TTCGCTACACTGT
H DNA
heat-shock proteins (HSPs) A large of a transcriptional enhancer protein to group of proteins that are rapidly induced this sequence is the fi rst event in the acti- in response to various forms of stress vation of the heat-shock genes. such as exposure of cells to changes in temperature, sudden lack of availabil- heavy chain (immunoglobulin heavy ity of nutrients, oxygen deprivation, chain) The longer of the two peptide etc. The heat-shock proteins are also chains that make up an antibody mol- present under normal conditions, where ecule, for example, IgG. they function as “molecular chaperones” that aid in correct protein folding and in HeLa cell A line of tissue culture cells shuttling proteins between intracellular derived from a cervical cancer by Gey, compartments and to destinations out- Coffman, and Kubicek in February 1951. side the cell. HSPs are usually designated The cell-line designation is derived from according to their molecular weight—for the name of the tumor donor and was the example, HSP70 or HSP40 (70 and 40 fi rst epitheliallike cell derived from human kilodaltons)—but may have unsystem- tissue to be placed into tissue culture. atic names such as GrpE and DnaJ. HSPs are believed to play a role in eliciting the immune response by presenting frag- helicase An enzyme(s) that catalyzes ments of proteins (peptides) onto the cell the unwinding of the DNA helix during surface to help the immune system recog- DNA replication at a point just ahead of nize diseased cells. the replication fork.
heat-shock response element (HSE) helix-loop-helix A structural motif A certain nucleotide sequence in the consisting of two helices separated by an promoter of the heat-shock genes oligopeptide loop found on many eukary- (CNNGAANNTCCNNG). The binding otic regulatory proteins. DNA binding is
117 干细胞之家www.stemcell8.cn ←点击进入
rectohelix-turn-helix
effected by a short stretch of basic amino hemagglutinin/neuraminidase pro- acids just adjacent to the helix-loop-helix tein (HN protein) A protein derived motif. from the coat of the paramyxovirus, Sen- dai virus, that binds strongly to the cell helix-turn-helix A structural motif con- membranes of many types of animal cells. sisting of two short (seven to nine amino For this reason, the HN protein is used acids) helices separated by a turn found to create liposomes that are intended to on many prokaryotic DNA-binding regu- deliver agents (e.g., therapeutic agents) to latory proteins. One of the helices, called various animal cells (fusogenic vesicles). the recognition helix, interacts with DNA along the major groove. One example of a heme An organic, iron-containing, regulatory helix-turn-helix protein is the ring-shaped molecule that is the oxygen- cro protein of lambda bacteriophage. binding group in hemaglobin.
helper T cell A specialized type of T hemicellulose The name given to a cell whose function is to stimulate other mixture of long polysaccharides with a T lymphocytes (for example, cytotoxic T celluloselike structure that, together with cells) that then go on to carry out vari- pectin, forms an amorphous matrix in ous immune functions. Helper T cells which the cellulose fi brils of the plant cell are stimulated to divide after they are wall are embedded. exposed to a foreign MHC antigen that is presented to it by specialized antigen pro- hemidesmosome Literally meaning “half- cessing cells; the stimulatory activity of T desmosome,” a hemidesmosome is spe- helper cells is mediated by interleukins. cialized membrane-junctional complex in the epithelial cell membrane that helper virus A virus that provides structurally resembles a desmosome but, a critical function to a defective virus unlike a desmosome, is present at the site when they both simultaneously infect where an epithelial makes contact with the same cell. The oncogene-carrying the basal lamina. retroviruses are examples of replica- tion-defective viruses that can grow only hemizygous The cellular state of hav- when coinfected with the normal wild- ing one copy of a gene in a genome that type counterpart that does not carry an is normally diploid for all genes. The oncogene. term always refers to a particular gene or group of genes; for example, a cell is said hemagglutinin Any substance that can to be hemizygous for gene x. cause red blood cells (RBCs) to agglu- tinate by binding to certain sites on the hemoglobin The large blood-borne RBC membrane. Because the clumping molecule that carries oxygen and car- (agglutination) of RBCs is easily seen even bon dioxide between the lung and tissue. in the presence of small amounts of hem- Hemoglobin consists of a heme group agglutinin, hemagglutination has been and four polypeptide chains; two alpha- widely used as an assay for the presence globin chains and two beta-globin chains. of certain hemagglutinating viruses or other antigens. hemolymph The fl uid found in the body cavity of insects that serves the hemagglutination-inhibition assay An same gas-exchange functions as blood. assay for the presence of a hemagglutinat- ing virus or other antigen by observing the hemolysins A group of bacterial tox- loss of the ability of a test sample to agglu- ins that cause hemolysis by attacking red tinate red blood cells after being treated blood cell membranes. with an antibody against the agglutinin whose presence is suspected. hemolysis The lysis of red blood cells.
118 干细胞之家www.stemcell8.cn ←点击进入
Herpesverso
hemolytic plaque assay An assay ious drugs, toxic agents, and autoimmune based on the localized hemolysis of red reaction. blood cells (RBCs) that appears as a plaque when the RBCs are spread out in a hepatitis virus The viral agent, a small layer of agar. The hemolytic plaque assay DNA virus, that causes the infectious is used to demonstrate the secretion of form of hepatitis that infects a large frac- specifi c antibodies by antibody-produc- tion of the individuals in certain areas of ing cells that are mixed together with the the world. Hepatitis viruses fall into three RBCs. subclasses, termed simply A, B, and C.
hemophilia A genetic disease based on heptad repeat A tandemly repeated the inability of the affl icted individual to segment of seven amino acids in certain make a critical component (factor VIII) proteins. The heptad repeat is a promi- of the blood-clotting system. As a result, nent feature of intermediate fi lament pro- even minor cuts or bruises may result in teins that are found in virtually all inter- dangerous, uncontrolled internal hemor- mediate fi lament proteins throughout the rhage or bleeding. animal kingdom. A chemical agent that is toxic hemopoiesis The generation of red herbicide to plants. blood cells by cell division of certain stem cells in the bone marrow. Herceptin A monoclonal antibody directed against the HER2 receptor pres- A Henderson-Hasselbalch equation ent on some tumors. Herceptin is active mathematical formulation that governs in inhibiting the growth of breast tumors the pH of a given buffer solution. If pK is that express HER2 by blocking access of the negative logarithm of the equilibrium growth factors to the receptor. Herceptin constant (Kd) for the ionization of the is only active against tumors that express acid form of the compound that is used to high levels of HER2 (ca. 20 percent of all buffer the solution for the reaction breast cancer patients) and whose growth ← + – HA → H + A is therefore dependent on growth factors. and – [HA] and [A ] are the molar concentra- hereditary disease See genetic dis- tions of the unionized and ionized forms ease. of the buffer respectively, then heredity The study of how physical pH = pK + log ([A–]/[HA]). traits are transmitted from parent to offspring: the study of inheritance. See heparin A sulfated glycosaminoglycan Mendel’s law. that is used medically to block blood clot- ting. The anticoagulant activity of hepa- heregulin A protein that stimulates the rin is based partly on the strong binding growth of breast cancer cells by binding of the heparin molecule to antiprothrom- to, and activating, the HER2 and HER4 bin III, a blood protein that plays a criti- receptors that are present on the surface cal role in the blood-clotting pathway. of the cancer cells. In the more advanced stages of breast cancer, the HER recep- hepatitis An infl ammatory disease of tors are often overproduced and may the liver characterized by severe, chronic therefore be more responsive to the jaundice caused by accumulation of liver growth-promoting effects of heregulin. by-products and general malaise. Most For this reason, heregulin is a target of cases of acute hepatitis are due to viral therapeutic strategies employed in late- infections that currently fall into six main stage breast cancer. types: hepatitis A, B, C, D (but only with B-type virus present), E, and G. Other Herpes A family of large DNA viruses causes of hepatitis are alcohol abuse, var- that infect humans and produce both
119 干细胞之家www.stemcell8.cn ←点击进入
rectoHerpes simplex virus
acute infections such as chicken pox and cessed RNAs in the nucleus. The name infections that result from persistent, derives from the great heterogeneity latent infections, for example, shingles in size and type of RNA present in the that results from the same virus, that is, nucleus before the RNAs are processed Herpes zoster. The members of the her- and transported to the cytoplasm. pes family of viruses are Herpes simplex, Herpesvirus simiae, Varicella zoster, cyto- heterokaryon A multinucleated hybrid megalovirus, and Epstein-Barr virus. cell created either from the fusion between two or more cells or by cell division with- Herpes simplex virus (HSV) A mem- out cytokinesis. ber of the herpes family of viruses that has been implicated as the causative agent heterolactic fermentation Heterofer- in some cervical cancers. mentation.
Hershey-Chase experiment A classic heterologous gene expression The experiment, conducted by Martha Hershey synthesis of foreign proteins in a host and Alfred Chase in 1952, that demon- organism when that organism has been strated that DNA was the hereditary mate- transformed with a vector carrying genes rial. In their experiment, bacteriophages from a different organism. This can be a containing 32P-DNA and 35S-protein were problem if DNA technology is to be used to allowed to attach to host bacteria. When, produce proteins in bacterial hosts because after several minutes, the attached bacte- some heterologous proteins are broken riophages were stripped from the bacte- down by bacterial proteases, or are depos- ria by strong mechanical agitation, it was ited into insoluble inclusion bodies, and/or found that the 32P label and not the 35S do not fold properly. In addition, bacteria cannot add sugar residues to those proteins label had entered the host cells. requiring glycosylation after synthesis. heterochromatin A very condensed heterotroph An organism, for example, form of chromatin, seen in the nucleus an auxotrophic mutant, that is defective during interphase, that was found to be a in the ability to synthesize essential com- transcriptionally inactive form. plex organic molecules. A heterotroph therefore requires supplementation of the heteroduplex Base pairing between growth medium, diet, and so on, with nucleic acid strands from different either the essential compounds or certain sources, for example, RNA and DNA or precursors that it can use to make them. DNA from two different species. heterozygote An individual who is het- heteroduplex mapping A technique for erozygous for a particular gene. the determination of the location of a par- ticular sequence of nucleotide bases along heterozygous The state of containing a segment of a nucleic acid by creating a two different alleles of a particular gene. heteroduplex between the nucleic acid to be For example, a cell or an individual is mapped and a reference nucleic acid strand. said to be heterozygous for the trait that causes sickle cell anemia if both the nor- heterofermentation (heterolactic fer- mal and the abnormal copies of the glo- mentation) A type of fermentation bin gene is present. characteristic of enteric bacteria (Enter- bacteriaceae) in which only part of the hexose Any six-carbon sugar. fermentation product is lactic acid; the other part is formate and acetyl CoA. HGPRT Hypoxanthine-guanine phos- phoribosyl transferase; an enzyme that heterogeneous nuclear RNA (hnRNA) catalyzes a major step in the formation of The general name given to all the unpro- ATP and GTP from guanine. This path-
120 干细胞之家www.stemcell8.cn ←点击进入
Hognessverso box
way is the only means by which guanine histamine A substance stored in the or other purine analogs can enter into granules of mast cells that is released dur- nucleic acids. Thus, as is true for thymi- ing allergic response. Histamine release dine kinase in the pyrimidine pathway, causes smooth muscle contraction, secre- manipulation of this enzymatic step pro- tory activity in mucous epithelium, and vides an important experimental tool for other symptoms of allergic reaction. studying gene action by the incorporation of modifi ed bases into DNA. histidine An amino acid whose side chain is HGPRT marker A term that refers –CH2–C=CH to the use of the gene that codes for the | | HGPRT enzyme as a selectable marker. HN NH Cells containing mutant HGPRT genes \ | are resistant to purine derivatives that are CH toxic because they become incorporated into DNA via the HGPRT dependent histocompatability The state of simi- pathway. See HGPRT. larity or dissimilarity between the pro- teins of a grafted tissue and proteins of high-frequency recombination strain the host on which the tissue is grafted. Certain strains of donor-type bacte- The degree of histocompatibility is the ria in which the bacterial genomes are major factor in determining whether a observed to undergo much higher rates host will accept or reject a tissue graft. of gene transfer and recombination than other bacteria in the same culture. histones A group of proteins that are The high frequency of recombination is tightly associated with DNA to form struc- based on the presence of an F factor tures known as nucleosomes. The histones that has integrated into the genome, fall into fi ve subgroups: H2a, H2b, H3, which allows mating to occur between H4, and H1. They appear to play a role in neighboring bacteria. See conjuga- regulating the expression of genes. tion, bacterial. HIV See human immunodefi ciency highly repetitive DNA A fraction of virus. the genomic DNA in eukarkyotic cells that consists of short sequences that are repeated thousands of times throughout HLA antigens The proteins of the the genome and that has been found to be major histocompatibility locus in the hu- equivalent to satellite DNA. man; an acronym for human leukocyte- associated antigens. high-mobility group protein A het- erogeneous group of proteins of unknown hnRNA See heterogeneous nuclear function that are part of the chromatin RNA. but are not histones. Hodgkin’s disease A type of cancer of Hill reactions The light-energy har- the tissue of the lymphatic system, includ- vesting reactions in photosynthesis in ing the lymph nodes, spleen, tonsils, and which light energy is stored in the form of thymus gland. The disease is character- high-energy electrons. The Hill reactions ized by fever, lymph node enlargement, were discovered by Robert Hill in 1939. and weight loss.
Hind III A restriction enzyme whose Hogness box A sequence of TATAAA recognition sequence is that defi nes the part of the promoter 5′ AAGCTT 3′ region where RNA polymerase will bind 3′ TTCGAA 5′ in eukaryotic organisms. It is located
121 干细胞之家www.stemcell8.cn ←点击进入
rectoHolliday junction
term is used to describe a group of bio- adjacent double- chemical reactions that act together as a stranded system of checks and balances to prevent DNAs “overreaction” on the part of any reaction.
cross-strand exchange homeotic genes A cluster of genes that branch migration determines limb and appendage develop- ment in the fruit fl y, Drosophila melanogas- ter. The homeotic genes have been defi ned in terms of mutations at certain genetic loci that may cause one type of appendage to develop in place of another, for example, an insect leg in place of an antenna. See segments, segmentation. Holliday junction homeotic selector genes The genes of the bithorax and the antennapedia com- plexes taken together.
homofermentation (homolactic fer- mentation) The type of fermentation characteristic of lactic bacteria in which Holliday junction sugar is oxidized by the fermentation pathway to a single product: lactate.
about 30 bp upstream from the start of homogenate A crude slurry resulting transcription. See TATA box. from the disruption of cell/tissue struc- ture by mechanical means, for example, Holliday junction The linkage of two by grinding. homologous double-stranded DNAs by ligation of the broken end of one strand with the broken end of the correspond- homogeneously staining region (HSR) ing strand on the homologous DNA. The A region of a chromosome that contains Holliday junction is considered to be the multiple copies of a particular gene and essential intermediate in the process of that can be identifi ed as a segment that recombination. stains homogeneously (as opposed to showing a number of bands as is normally holoenzyme The complete and func- true) with certain stains used to visualize tional form of an enzyme; the polypeptide chromosomes under the microscope. The portion of enzyme plus any other factors amplifi cation of the dihydrofolate reduc- necessary for normal enzymatic activity, tase gene (DHFR) in cells exposed to the for example, coenzymes and cofactors. anticancer agent, methotrexate, is seen as a homogeneously staining region of giant homeobox Those DNA sequences that chromosomes. are found in homeotic genes of the fruit fl y, Drosophila melanogaster, that are homolactic fermentation Homofer- also found in amphibians and mammals. mentation. The homeobox sequences are expressed in early development and appear to play a homologous chromosomes Two chro- role in limb/appendage development simi- mosomes, generally one from each par- lar to the role of the homeotic genes. ent, that are identical in terms of the genes they carry but which differ from homeostasis The state of being in bal- each other in terms of the alleles of the ance. As applied to biological systems, the genes they carry.
122 干细胞之家www.stemcell8.cn ←点击进入
host restriction-modifi cationverso
homologous recombination Recom- example, FSH, LH, or the steroid hor- bination between two DNAs at certain mones, estrogen and testosterone. sites where the two DNAs show sequence homology to one another. hormone response elements (HREs) Nucleotide sequences to which nuclear homology In general meaning, simi- steroid hormone receptors bind to regu- lar but not necessarily identical to some- late expression of a particular target thing. In molecular biology, the term gene. the HREs are usually located in homology is generally taken to mean the 5´ upstream regulatory region of a sequence homology. target gene and generally consist of two hexameric core sequences separated by homopolymer In general meaning, a spacer sequence to form the complete any polymeric molecule containing a sin- binding site designated by the symbol gle type of monomer. In molecular biol- RXR. The R sequences can be either ogy, the term refers to a short nucleic acid inverted or direct repeats, and the spacer segment that consists of a single type of sequence (X) generally varies between nucleotide, for example, oligo dT. one and fi ve base pairs.
homopolymer tailing The technique horse-radish peroxidase (HRP) An of attaching a nucleic acid homopolymer enzyme that causes the breakdown of to the end(s) of a piece of DNA gener- peroxides by catalyzing the transfer of ally as an intermediate step in cloning. hydrogen atoms to an oxygen atom on Homopolymer tailing has been widely the peroxide. The activity of the enzyme exploited as a means of cloning cDNAs has been exploited as a technique for by attaching homopolymer tails to the labeling proteins and nucleic acids col- ends of the cDNA that can then be easily orimetrically instead of by radiolabeling. annealed to complementary homopoly- For this purpose, the molecule is attached mer tails attached to the ends of a vector to an HRP molecule that is then visual- molecule. ized using a substrate (S) that attains a color when it is oxidized by HRP: homoserine The precursor molecule peroxidase from which, in plants and bacteria, the H O + Substrate–H - - > 2 H O + Substrate amino acids, methionine, threonine, and 2 2 2 2 ox (uncolored) (colored) isoleucine, are made. Any cell that is infected by homozygous The state in which the host cell genome contains two copies of the same a virus is referred to as the host cell for allele of a particular gene. Organisms are that virus. said to be homozygous for a gene. host range The group of all cell types Hoogsteen base pairs An unusual that are susceptible to infection by a par- type of base pairing that occurs in triple ticular virus. helical DNAs, a type of structure that is formed under special conditions. In the host restriction-modifi cation Restric- triple helix, one of the bases is hydrogen tion enzyme systems that have been devel- bonded to another base from each of the oped by bacteria that inactivate the DNA other two strands to form the unusual of infecting bacteriophages by cleav- base pairs, such as: T=A-T or C=G-C. ing them with restriction enzymes pro- duced by the bacterial host, while at the hormone Any molecule that is made same time protecting the host DNA from and secreted by a specifi c tissue and cleavage by the same restriction enzyme that causes or induces a specifi c action through another system that modifi es the or behavior in another (target) tissue, for host DNA usually by methylation.
123 干细胞之家www.stemcell8.cn ←点击进入
rectohost-vector system
host-vector system A combination of humoral antibody Secreted antibody host cell and virus vector to be used for produced by B cells circulating in the cloning. For example, a particular strain blood. Humoral antibodies mediate the of the bacterium E. coli and a particular immune response to soluble antigens as strain of bacteriophage lambda (vector) opposed to graft rejection. that grows especially well in the host cell. huntingtin The protein encoded by hotspot A genetic locus particularly the gene responsible for Huntington’s prone to spontaneous alteration or muta- disease, a genetic neurodegenerative tion. disease. In the version of the gene that causes the disease, there are multiple housekeeping genes A vernacular repeats of a CAG triplet that leads to term to describe the genes necessary for the insertion of an additional string basic cell functions required by and, of glutamine residues. Huntingtin is a therefore, expressed in all cells. cytoplasmic protein, but its function is unknown. The mutant huntingtin forms HOX genes Homologous genes in aggregates in nuclear inclusions in neu- mammals to certain homeotic genes in rons. The gene for huntingtin is at gene Drosophila. map locus 4p16.3. See Huntington’s disease. HPFH Hereditary persistence of fetal hemoglobin; a genetic state in which the Huntington’s disease A genetic degen- normal adult α and β hemoglobin genes erative disease of the nervous system are absent, and so the fetal hemoglobin caused by a dominant gene. Symptoms genes continue to be expressed past the that appear in midlife include involuntary time when they would normally be turned movements of the face and limbs, mood off. swings, and forgetfulness. Disease symp- toms progress until death within 20 years. HPLC High-performance liqid chro- matography. A variation of liquid chro- hyaluronic acid (HA) A type of gly- matography that uses small (three to 10 cosaminoglycan in which the repeating disaccharide consists of the sugars gluc- μm in diameter) silica beads to achieve high-resolution separations. uronic acid and N-acetylglucosamine. The linear polysaccharide is a component of the extracellular matrix in vertebrates, H-ras gene The human proto-oncogene where it forms the core of proteoglycan homologue of the ras oncogene carried by aggregates. It is also found in synovial the Harvey sarcoma virus.
HTLV A group of human retroviruses that cause human T cell leukemias; an CH OH acronym for human T-cell leukemia virus. 2 O H O human growth hormone (somato- COO– H H O HO tropin) A polypeptide hormone pro- H duced by the anterior pituitary that O H NH OH stimulates the liver to produce somato- H C O medin-1, which in turn causes growth of H OH CH muscle and bone. 3 glucuronic acid N-acetyl (GlcA) glucosamine human immunodefi ciency virus (HIV) (GlcNAc) n The retrovirus that causes acquired immunodefi eiency syndrome (AIDS). HyHyaluronicaluronic acid acid
124 干细胞之家www.stemcell8.cn ←点击进入
hydrolysisverso
fl uid that lubricates joints and in the vit- tion probe and the target nucleic. Thus, reous humor of the eye. the chemical and physical conditions under which a hybridization occurs can hybrid An organism that is the off- be adjusted so that the level of homol- spring of parents of different genotypes. ogy between the probe and the target is 85 percent, 90 percent, and so on. Levels hybrid-arrested translation An experi- of homology below about 70 percent are mental technique that identifi es a cDNA generally considered to be nonhomolo- for a specifi c protein by making a hybrid gous, and so hybridization conditions between a cDNA and mRNA. If the permitting duplex formation between cDNA does hybridize to the putative nonhomologous nucleic acids are called mRNA for the protein, then the mRNA nonstringent. containing the hybrid will not be able to be translated in an in vitro translation hybridoma An immortalized antibody- system, which will be indicated by the secreting cell created by fusing a myeloma absence of that protein in a protein gel of cell to lymphocytes from the spleen of the protein products. an animal that has been immunized to a particular antigen. Antibody-secreting hybrid cell A cell that was produced by hybridomas are the source of monoclonal cell fusion but that, after several cell divi- antibodies. sions following fusion, now contains one nucleus with chromosomal material from hybrid vigor The state in which an off- the original parent cells. spring is genetically more robust and/or better equipped for survival than either hybrid dysgenesis The term that is parent as the result of heterozygosity, applied to the inability of certain strains that is, receiving a benefi cial combination of the fruit fl y, D. melanogaster, to inter- of traits from its parents. breed because offspring resulting from matings between the strains are sterile. hydrocarbon Any organic molecule composed only of hydrogen and carbon. hybridization The formation, in vitro, The most common hydrocarbons are of a double-stranded nucleic acid segment those that are derived from a linear chain by hydrogen bonding between two single of carbon atoms. strands. Experimental use of hybridiza- hydrogen bonds Electrostatic attrac- tion is the basis of DNA probe technol- tions between positively charged hydro- ogy including Southern and northern blot gen atoms and negatively charged atoms analyses, primer annealing, and hetero- on other parts of a molecule or on other duplex analysis. molecules. Hydrogen bonds are the major forces that stabilize the structures hybridization probe Any labeled nu- of many proteins and the DNA double cleic acid segment that is used in any of helix. a variety of assays based on hybridiza- tion of the labeled nucleic acid to a target hydrolase The general class of enzymes nucleic acid. that catalyze reactions involving hydro- lysis. hybridization stringency A term used to describe the degree of mismatch tol- hydrolysate The product of the hydro- erated by a specifi c set of hybridization lysis of a material, for example, a protein conditions. Hybridization stringency is hydrolysate or a casein hydrolysate. usually given in terms of the minimal per- cent base match that will be required for hydrolysis The breakage of any cova- duplex formation between the hybridiza- lent bond that involves the insertion of
125 干细胞之家www.stemcell8.cn ←点击进入
rectohydronium ion
a water molecule across the bond; for hydrops fetalis A type of thalassemia in example: which all four alpha-chains missing in the –C=O H2O –C=O NH– hemaglobin molecule are missing as a result \ ------> \ + \ of a defect in the DNA that codes for these NH– OH H proteins. Infants carrying the defect almost In the above example, the carbon-nitrogen inevitably die at or before birth. bond is said to have undergone hydroly- sis. hydroxyapatite A form of calcium phosphate (CaPO4) that is used for sep- hydronium ion A water molecule to aration of single- and double-stranded which a hydrogen ion is attached: H+ + nucleic acids by column chromatogra- + H2O ---> H3O . Hydronium ions are the phy in which the double-stranded form form in which hydrogen ions are nor- is preferentially retained on the hydroxy- mally carried in aqueous solutions. apatite matrix.
hydropathy plot A graph showing the 5-hydroxymethylcytosine An unusu- degree of hydrophobicity of each amino al derivative of cytosine that is used in acid in a polypeptide as a function of its place of cytosine in the DNA of the bac- location in the polypeptide. Hydropa- teriophage T4. This base protects the T4 thy plots are often used to visualize the DNA from nucleases, which the bacterio- clustering of hydrophobic amino acids. If phage produces during its growth cycle. such clustering is observed, it may indi- cate that the polypeptide in question is a hydroxyproline A derivative of the transmembrane protein, with the hydro- amino acid, proline, that is found in col- phobic cluster representing a transmem- lagen and that helps to stabilize the mol- brane domain. ecule. Because the formation of hydroxy- proline is dependent on vitamin C, a hydrophilic The property of an atom, defi ciency of the vitamin is manifest by a molecule, or a molecular group that a weakening of the collagen fi bers, which has an electrostatic attraction to water results in the skin lesions characteristic of molecules. Hydrophilic groups tend to be the disease scurvy. soluble in water. hygromycin An aminocyclitol anti- hydrophilic-signaling molecule A biotic produced by Streptomyces hygro- large class of highly water-soluble mol- scopicus with activity against both pro- ecules that, because of their solubil- karyotes and eukaryotes. Hygromycin B ity, can diffuse easily across an aque- acts by causing aminoacyl-tRNAs to be ous medium between a cell from which misread and also introduces errors into they are secreted to a target cell where the ribosomal translocation process. The they trigger some specifi c event. Various hygromycin B phosphotransferase (Hph) growth factors and hormones are com- gene confers resistance to the antibiotic. monly encountered by hydrophilic-signal- By including the Hph gene in tranfec- ing molecules. tion vectors, hygromycin can be used to select, from a large cell population, the hydrophobic The property of an atom, subpopulation of cells containing a par- a molecule, or a molecular group that has ticular transfected gene. no or very little electrostatic attraction to water molecules. Hydrophobic groups hyperchromicity, hypochromicity The tend to be insoluble in water. change in the optical density of a solu- tion of a nucleic acid upon denaturation hydroponics The science of growing or renaturation. Denaturation of double- plants in a synthetic, aqueous nutrient stranded DNA to the single-stranded medium. state results in an increase in the opti-
126 干细胞之家www.stemcell8.cn ←点击进入
hypoxanthineverso
cal density of the sample (hyperchromic shift) at 260 nm, and a reduction in opti- cal density (hypochromic shift) accompa- nies renaturation of single strands to the double-stranded form.
hyperimmune A state in which an extreme immune response is provoked by an antigen present in quantities that are normally not effective in stimulating the Hypoxanthine immune system.
hypermutable phenotype Bacterial hypervariable region A region of the strains lacking the ability to remove ura- immunoglobulin gene that shows a high cil molecules that aberrantly arise in the degree of variability in sequence from one cell DNA in place of cytosine. The per- antibody to the next. sistence of uracil results in high rates of mutation in strains that carry this defi - hypha A long, branching fi lament of ciency. connected cells in fungi. Hyphae may be either segmented, in which individual hyperproliferation A state in which nuclei are separated from one another by cell division occurs at a greater-than- a cell wall, or nonsegmented, in which normal rate. many nuclei share a common cytoplasm (multinucleated). hypersensitive site, DNase I A region of the chromatin at which the DNA is hypoxanthine A purine intermediate accessible to the enzyme DNase I. Exper- in the degradative pathway of adenosine. imental evidence has shown that many of Hypoxanthine can also serve as a precur- these sites are places where gene activity sor for nucleic acid synthesis by a series of is regulated. reactions known as the salvage pathway.
127 干细胞之家www.stemcell8.cn ←点击进入
AI
Ia antigen Proteins encoded by the I locus of the mouse H-2 histocompatibil- ity complex. p13.3 ICE Il-1β converting enzyme; an alter- p13.2 native name for caspase 1 that is derived from the fact that it can convert pro IL-1β p13.1 to its active form by proteolytic cleavage. p12 Ich-3 (caspase 5) A cysteine protease member of the Ced3/ICE family. Ich-3 p11.2 is activated through cleavage by the ser- p11.1 ine protease, granzyme B, in cytotoxic T cells, which leads to apoptosis in these q11.1 cells. Activating cleavage of Ich-3 gener- ates the subunits p20 and p10, which q11.2 share a high degree of homology to other caspases. q12.1 q12.2 ideogram A type of chromosome map based on a pattern of chromosomal q13 bands called G banding produced by q21 staining with Geimsa. Each homologous chromosome pair will show a unique pattern of G bands that can be depicted q22 by an internationally agreed upon sche- matic.
idiotope An antigenic peptide sequence q23 located on the IgG antibody molecule near the antigen binding site; a specifi c idiotope is associated with a specifi c anti- q24 gen binding site so that the same number of idiotopes exist as there are different antibodies.
idiotype The set of idiotopes on an IgG molecule. ChromosomeChromosome 16 16
i-gene The bacterial gene that codes for illegitimate recombination A rare the lac operon repressor protein. event in which recombination occurs between two DNAs at an apparently ran- IgG See immunoglobulin. domly chosen site(s).
128 干细胞之家www.stemcell8.cn ←点击进入
immunoglobulin gene switchingverso
imaginal disk Disk-shaped structures antibodies to the antigen after the antigen symmetrically located on either side of has been separated according to size and/ the embryos of fl y larvae that give rise or charge by gel electrophoresis and then to certain adult structures, for example, transferred to a membrane. legs, eyes, and wings. immunodefi ciency The state of im- immortalized cells Cells that continue pairment of the immune system result- to divide indefi nitely in tissue culture. ing in the inability or lowered ability of Immortalization is a defi ning property the immune system to mount an immune of transformed cells; cells expressing the response to a cell or particular antigen. properties of cancer cells (i.e., the trans- formed phenotype). immunodiffusion A technique for determining the presence of an antigen immune response The proliferation of by allowing an antigen and an appropri- specifi c antibodies or cells of the immune ate antibody to diffuse into a gel where system, such as macrophages, T and B an immune precipitate forms at the point lymphocytes, and so on, in response to a where antigen and antibody meet. foreign antigen. immunoelectrophoresis A variation immune system The collection of all of the immunodiffusion technique in the cells and tissues (thymus, spleen, lym- which the antigen is subjected to elec- phocytes) that are involved in providing trophoresis in a gel that is then used for an immune response. assay by immunodiffusion.
immunization The injection of an ani- immunofl uorescence A technique for mal with an immunogen sometimes in visualizing structures in a cell or a tissue combination with an adjuvent to induce through the use of antibodies attached to the production of antibodies that will spe- a fl uorescing label that bind to antigens cifi cally bind to the immunogen injected. in the target structures. immunoadsorbant A solid matrix to immunogen Any substance capable of which antibodies are attached and that is provoking an immune response. used to purify the antigens from a biolog- ical preparation by allowing the antigens to bind to the matrix-bound antibodies. immunogenicity The property of being an immunogen, that is, the prop- immunoaffi nity chromatography A erty of being capable of provoking an technique for purifying antigens by pass- immune response. ing a biological preparation or extract over a column containing an immunoad- immunoglobulin Any of the globular sorbent. serum proteins secreted by cells of the immune system for the purpose of deal- immunoassay Any technique for deter- ing with foreign antigens. Immunoglob- mination of the quantity of an antigen ulins are divided into fi ve classes: IgM, based upon the binding of the antigen to IgG, IgA, IgD, and IgE. its specifi c antibody. See complement- fi xation test, hemagglutination- immunoglobulin gene switching inhibition assay, and radioimmunoas- Developmental changes in the class of say. immunoglobulin (such as from IgM to IgG) produced by a single lymphocyte as immunoblotting A technique for the result of the expression of different determination of the presence and prop- genes. Gene switching is accomplished erties of an antigen by reaction of labeled by recombination and changes in the way
129 干细胞之家www.stemcell8.cn ←点击进入
rectoimmunolabeling
resent. For example, if it is supposed that the nucleosome-binding DNA sequence is a unique sequence, then a probe may be constructed from the end portion of this sequence, and any DNA that is isolated from a nucleosome should hydridize to the probe. See nucleosome phasing.
inducer Any agent, chemical or physi- cal, that brings about the expression of a gene or gene cluster.
inducible enzyme An enzyme whose expression requires the presence of a spe- cifi c inducer.
Immunoglobulin induction, gene Transcription of a gene(s) brought about in the presence of a specifi c agent that is referred to as the RNA is spliced so that the products of inducer. different portions of the immunoglobulin genes are fused to one another in differ- induction, phage The production of lytic ent arrangements. bacteriophage in bacteria that carries a lyso- genic prophage, brought about by treatment immunolabeling The technique of with some chemical of physical agent. labeling molecules and/or biologic struc- tures through the use of antibodies bound informative meiosis A mating that to other molecules that serve as labels for generates a crossing over between two the antibody-antigen complex. genetic markers so that linkage between the two markers can be determined. immunology The study of the immune Informative meioses have been used in system. the genetic analyses of genetic disease such as cystic fi brosis to establish linkage between RFLPs known to be associated impermeable junction A term used to with the disease. describe any cell-cell junctional complex that connects cells together so that even infrared spectroscopy An analytical small molecules cannot diffuse between technique for determination of the chemi- the connected cells. Impermeable junc- cal structure of an unknown by observing tions are generally used as synonymous how much light is absorbed by a sample with tight junctions. of the unknown at different light wave- lengths in the infrared spectrum (>1,000 inclusion bodies Clumps of material nm). The absorption of light in this region that accumulate in the nucleus or cyto- of the spectrum refl ects, and is analyzed plasm of virus-infected cells. Inclusion in terms of, the presence of certain types bodies consist of aggregates of viral struc- of chemical bonds, for example, C=O, tural components such as virion proteins. C–OH, and C–C, that produce charac- teristic absorption patterns. indirect end labeling A technique for demonstrating the unique nature of a inhibitory postsynaptic potential A DNA fragment by hybridizing the frag- membrane potential across the postsyn- ment to a probe representing an end piece aptic membrane in a neuron that inhib- of the sequence that it is proposed to rep- its the generation of an action potential
130 干细胞之家www.stemcell8.cn ←点击进入
inverso situ
in that neuron. Inhibitory potentials are be an important step in the pathway those in which the membrane is more by which cells respond to extracellular polarized (hyperpolarized) than in the signals. resting state. insert In molecular biology, the term initiation codon An AUG codon in insert refers to a piece of DNA ligated messenger RNA that codes for the first into a specifi c site in a vector for molecu- amino acid (methionine) in a polypep- lar cloning. The resulting recombinant tide. All polypeptides in both prokary- molecule composed of vector and insert otic and eukaryotic cells begin with is designed to allow replication of the a methionine coded for by an initiat- recombinant in an appropriate host. ing AUG codon during the process of translation. insertional inactivation The loss of gene activity as the result of insertion of initiation factor (IF) Certain proteins a segment of DNA into a region critical that catalyze the formation of the initia- to the expression of the gene. Insertional tion complex between the mRNA and the inactivation of genes coding for resistance ribosome in the process of translation. to an antibiotic by insertion of a cloned DNA is often used as a means by which INK4 A gene locus that codes for bacteria containing the recombinant plas- a group of tumor suppressors des- mid are selected. ignated INK4A (CDKN2A), INK4B (CDKN2B), INK4C (CDKN2C), and insertion mutation A mutation caused INK4D (CDKN2D). The INK4 pro- by the insertion of a nucleotide or oli- teins act to inhibit the progression of gonucleotide sequence into the coding cells into S phase by blocking the activ- region of a gene. Insertion of oligonucle- ity of the cyclinD-cdk4/cdk6 complex. otide sequences containing any number of Two of the INK4 tumor suppressors, nucleotides not evenly divisable by three 4A (p16INK4A) and ARF (p19ARF), are will result in a frame shift. produced by alternative splicing of a single transcript that acts upon differ- in situ In the natural setting or envi- ent secondary tumor suppressors, Rb ronment; generally, the intact tissue as and p53, respectively. p16INK4A acts opposed to a biochemical extract or directly to prevent phosphorylation of preparation. Rb by the cdk4/cdk6 kinase complex, while p19ARF is an antogonist of mdm2, which in turn leads to enhancement of p53 activity.
inosine The purine base in inosine monophosphate (IMP), the nucleotide from which the normal purine nucleo- tides, adenosine monophosphate (AMP) and guanosine monophosphate (GMP), are synthesized biologically.
inositol A fi ve-carbon sugar that is a major constituent of the phospholipids found in cell membranes. The release of inositol in the cell membrane resulting from the action of certain growth fac- tors and other effectors of cell growth and differentiation is now believed to Inosine
131 干细胞之家www.stemcell8.cn ←点击进入
rectoin situ hybridization
in situ hybridization Nucleic acid into the cell membrane; that is, it pen- hybridization carried out on sections of etrates into the membrane lipid bilayer. intact tissue or chromosomes. Most eukaryotic receptors (e.g., RTKs) are integral membrane proteins. insulin A polypeptide hormone secreted by a part of the pancreas known as the integrant A cell in which a transfected islets of Langerhans, which controls the gene has become stably integrated into the entry of glucose into cells. A defi ciency of genome of the recipient. See transfection. insulin production is the underlying cause of diabetes. integrase The enzyme that catalyzes the site-specifi c recombination of lambda int 1 gene An oncogene activated by bacteriophage DNA with the bacterial the nearby integration of the mouse host DNA that results in integration of mammary-tumor virus (MMTV) that the bacteriophage DNA. produces mammary tumors in mice. The int 1 gene homologue in Drosophila integration In molecular genetics, the melanogaster has been shown to play a insertion of a foreign DNA into the genome crucial role in wing development, suggest- of a recipient cell. The term is most often ing that the mammalian int 1 gene may applied to the integration of viral DNA play a regulatory role in development. into the genome of an infected host, for example, integration of the prophage in a intasome A complex between bacterio- bacterium infected by a bacteriophage. phage DNA and two proteins (Int and IHF) that is required for bacteriophage DNA to integrin-linked kinase (ILK) An integrate into the bacterial host DNA when enzyme associated with the cytoplasmic a bacteriophage enters into lysogeny. domains of integrins and also attached to the actin cytoskeleton at regions of the cell integral membrane protein (intrinsic membrane called focal adhesions (FAs). protein) A protein that is integrated Integrin-linked kinases act to transduce
bacteriophage DNA
bacterial host DNA
specialized protein complex
intasome
integrated bacteriophage
Intasome
132 干细胞之家www.stemcell8.cn ←点击进入
interleukinsverso
signals from ligand-activated integrins by ing cytokine signaling, antiviral defense, phosphorylation of other signal transduc- regulation of cell growth, and immune tion components; for example, Akt and activation by inducing the transcription of GSK-3. genes.
integrins A very large family of trans- interleukins (lymphokines) A sub- membrane proteins that act as adhesion group of soluble proteins called cyto- molecules in cell-cell and cell-extracel- kines. Interleukins act as signal molecules lular matrix interactions. The integrins to control immunologic and infl am- are dimeric glycoproteins comprised of matory responses. At present there are one α (16 identifi ed) and one β subunit at least 18 known interleukins, most of (eight identifi ed) to form at least 22 dif- which have only recently been discovered. ferent integrins. The integrins can bind Most cytokines, with the exception of IL- to a variety of extracellular matrix com- 1, transmit intracellular signals via the ponents as ligands, particularly fi bro- Jak-STAT signaling pathway. Interleu- nectin and laminin. Integrins also func- kins are mostly secreted by white blood tion as receptors in signal transduction, cells (leukocytes) and stimulate a variety which, upon ligand binding, can stimu- of responses in other leukocytes, includ- late signaling through a number of sig- ing stimulating proliferation, inducing or naling pathways, involving activation of inhibiting the release of other cytokines, integrin-associated kinases such as FAK and activating themselves. The cellular (focal adhesion kinase) and MAPK targets of the known interleukins (IL-x) kinase. and their actions are summarized below:
interbands Lightly staining regions in • IL-1—Macrophages stimulate secre- polytene chromosomes. tion of IL-2 from T cells. • IL-2—Helper T cells cause activated intercalate In biochemistry, to fi t a T cells and B cells to divide. Induces molecule in between biomolecules that antibody synthesis are part of an array. The term is com- • IL-3—T cells induce proliferation of monly applied to certain dyes that stain other leukocytes; induce hematopoi- nucleic acids by inserting themselves in etic stem cells to differentiate into leu- between the purine and pyrimidine bases kocytes. arrayed along the nucleic acid backbone. See ethidium bromide. • IL-4—Helper T cells stimulate growth of T cells and B cells. A factor in the interferon(s) A group of small glycopro- production of IgE antibodies teins produced by virus-infected cells that • IL-5—Helper T cells stimulate growth act to inhibit viral infection. The interfer- of B cells and eosinophils. Induce pro- ons are heterogeneous both with respect liferation of B cells that produce IgA to structure and mode of action. The antibodies genes for various interferons have been • IL-6—T cells and macrophages induce cloned and have been tested as therapeu- B-cell differentiation together with tic agents for various diseases, including alpha-interferon. Kaposi’s sarcoma in HIV-infected individ- • IL-7—Stromal cells induce differentia- uals. Gamma interferon has been found to tion of lymphoid stem cells into pro- induce MHC class II antigens in B cells, genitor T cells and B cells. macrophages, and endothelial cells. • IL-8—T cells and neutrophils help interferon regulatory factors (IRFs) A to recruit these cells to the site of an small group of transcription factors that are infl ammation. activated by interferons. Interferons mediate • IL-9—Helper T cells stimulate the various functions of interferons, includ- growth.
133 干细胞之家www.stemcell8.cn ←点击进入
rectointernal guide sequence
• IL-10—Produced by T cells, B cells, interphase The period between mito- monocytes; represses the production ses. The interphase is divided into the G1, of gamma interferon, TNF-alpha, IL- S, and G2 phases of the cell cycle. 1, and IL-6 • IL-11—Plasmacytoma cells stimulate intracellular Within the cell. growth. • IL-12—Produced by macrophages and intramuscular Located in or directly B cells; stimulates T cells and natural administered to muscle tissue. killer cells to proliferate intraperitoneal Located in or directly • IL-13—Produced by T cells; induces administered to the cavity between the B-cell differentiation and inhibits pro- internal organs of the abdomen and the duction of infl ammatory cytokines abdomen wall. Intraperitoneal inocu- • IL-14—Produced by T cells; enhances lation of transformed cells into mice is memory B-cell proliferation widely used to promote the growth • IL-15—Stimulates T-cell proliferation of transformed cells or to derive large quantities of substances they secrete, for • IL-16—An adhesion molecule and example, monoclonal antibodies. activator for T cells. Plays a role in asthma and autoimmune diseases intravenous In a venous blood vessel • IL-17—T cells activate neutrophils. (vein); for example, the route of an intra- • IL-18—Stimulates the release of inter- venous injection. teron gamma and Th1 cytokines intrinsic factor A glycoprotein secreted internal guide sequence A nucleotide by the parietal cells of the lining of the sequence in group I introns that plays a intestines (the gastric mucosa) that plays a key role in precisely localizing the 3´ splice critical role in the absorption of vitamin B (cobalamin) in the intestine. The inabil- site during the process of RNA splicing. 12 ity to produce or utilize the intrinsic factor The mechanism of splice-site localization leads to the condition known as pernicious involves base pairing between the inter- anemia caused by vitamin B defi ciency. nal guide sequence and sequences at the 5´ 12 splice site. intron The nucleotide sequences in between the exons of a gene. Introns in intermediary metabolism That part the genomic DNA are copied during tran- of biochemistry that deals with how scription but are removed by the process energy is derived from nutritive biomol- of splicing. ecules and how that energy is used in the metabolism of other biomolecules. inulin A long polysaccharide composed largely of repeating fructose subunits. intermediate fi laments A type of fi l- Because it is a large molecule and largely ament that makes up one kind of cyto- inert, inulin is used experimentally to skeleton in mammalian cells. Intermedi- control osmotic fl ow across membranes ate fi laments are distinguished by virtue and as a diagnostic aid for kidney func- of their size (approximately 8–10 nm in tion. diameter), which places them in a range intermediate between the actin and inversion The alteration of cellular microtubule type cytoskeletal fi laments. DNA sequences in which the orientation Intermediate fi laments are divided into of a DNA segment is reversed; placed six classes: keratins, desmins, vimen- into an inverted orientation. Inversions tins, glial fi laments, neurofi laments, and are frequently caused by the movement of nuclear lamins. transposons, especially in cells carrying
134 干细胞之家www.stemcell8.cn ←点击进入
ionophoreverso
two copies of a transposons in opposite molecular components necessary to repro- orientation to one another. duce the normal process of polypeptide biosynthesis as it occurs in the intact cell. invertase The enzyme β-D-galactosi- dase that catalyzes the cleavage of lactose in vitro transcription/translation The into the monosaccharides, glucose, and synthesis of both mRNA and its encoded galactose. The enzyme derives its name protein in an artifi cial mixture contain- from the fact that action of the enzyme ing the appropriate DNA, ribosomes, and causes the resulting sugars to undergo all the molecular components necessary to conversion to the opposite optical iso- reproduce the normal processes of tran- mer (i.e., from D form to L form). A lack scription and polypeptide biosynthesis as of this enzyme is responsible for lactose they occur in the intact cell. intolerance. in vivo In the intact cell or tissue. inverted terminal repeats Segments of DNA at the ends of an insertion ele- iododeoxyuridine (IUdR) A synthetic ment, such as a transposon, that are nucleoside that is an inducer of Epstein- inversions of one another, for example, Barr virus (EBV) gene expression in EBV- AACGCTTCG and GCTTCGCAA. infected cells that otherwise produce no Inverted terminal repeats are essential viral proteins. for the transposability of the insertion sequence. ion-exchange chromatography A tech- in vitro Biological material outside of nique for separating substances in a the normal setting, for example, in cell or mixture, based on passing the mixture tissue culture or in cell or tissue extracts. through a column containing a matrix that binds the substances in the mixture in vitro fertilization The process of according to their electric charge. carrying out fertilization with egg and sperm outside the body in a petri dish or ion-exchange resin A material used to a similar vessel. Fertilization is observed separate substances in a mixture by ion under the microscope, and the fertilized exchange chromatography. Ion-exchange egg is then implanted in the uterus for resins are generally in the form of beads normal fetal development and birth. In that are composed of an inert polymeric vitro fertilization is a procedure widely substance, such as cellulose or sepharose, used to acheive pregnancy in certain that is covalently attached to molecules types of infertility. that are electrically charged.
in vitro mutagenesis Mutagenesis of ionizing radiation Any electromag- cells in vitro, that is, by exposure of cells netic radiation that can knock electrons in tissue culture to mutagenic agents. from molecules, thereby producing ions. Alpha, beta, gamma radiation, and X- in vitro packaging The formation of rays are all considered to be ionizing the viral coat around a viral nucleic acid radiation. using biological preparations or extracts in an artifi cial environment, for example, ionophore Any of a number of rela- a mixture containing biological extracts, tively small organic molecules that act salts, and necessary biological molecules. to allow the osmotic passage of ions and other molecules across cell membranes in vitro protein synthesis The syn- that would otherwise be impermeable to thesis of a polypeptide using mRNA that them. Ionophores have been widely used codes for that polypeptide in an artifi cial experimentally to study the function of mixture containing ribosomes and all the ion gradients across membranes, for
135 干细胞之家www.stemcell8.cn ←点击进入
rectoion-selective electrode
example, the Na+–K+ gradients in neu- the individual subgroups) on a molecule rons. is exactly zero.
ion-selective electrode An instrument isoleucine An amino acid whose side for measuring the concentration of ions chain is of one specifi c atom in a solution by mea- –CH2–CH–CH2–CH3 suring the current produced when a probe \ containing the oxidized or reduced form CH3 of the atoms to be tested is immersed in the solution. isomerase Any of a class of enzymes that catalyzes the rearrangement of atoms IPTG Isopropyl-β-D-thiogalactopy- in a molecule. ranoside; a synthetic analog of naturally occurring galactosides, for example, lac- isoprene An organic molecule that tose. IPTG is widely used in place of lac- appears in polymeric form in a number tose as a potent inducer of the lac operon of important molecules that act as inter- and, unlike lactose, is not acted on by mediates in electron transfers in vari- the enzyme, alpha-galactosidase, that it ous metabolic reactions in intermediary induces. metabolism, for example, ubiquinone (coenzyme Q) and chlorophyll. The struc- islets of Langerhans Small clusters of ture of isoprene is cells scattered throughout the pancreas
that produce the hormones insulin and CH2=CH–C=CH2 glucagon. Because loss of ability of the \ islet cells to produce suffi cient quantities CH3 of insulin is a cause of one form of dia- betes (insulin-dependent diabetes), intro- isoschizomer Any one of a group of duction of insulin genes targeted to the different restriction enzymes that recog- islet cells is a strategy being developed to nizes the same nucleotide sequence. treat this disease through gene therapy. isotonic point The point at which the isoaccepting tRNAs Different tRNAs concentration of all solutes in a solution that carry the same amino acid. See results in an osmotic pressure across a adaptor molecule. membrane that is exactly the same as the osmotic pressure of a reference solu- isoantigen (alloantigen) An antigen tion. This term or synonyms for it are that is produced by only some members frequently used to describe solutions of a species but not others and that is that can be introduced into a biologi- capable of eliciting an immune response cal system without causing osmotic lysis in the individuals of the species that lack of the cells; for example, solutions that the antigen. Blood group antigens are are injected into the bloodstream with- examples of alloantigens. out causing hemolysis are called isotonic solutions. isoelectric focusing A variation of poly- acrylamide gel electrophoresis in which isotope One of any alternative forms of proteins in a mixture are separated on the an element that differ from one another basis of their individual isoelectric points. in terms of the number of neutrons in the nuclei of their atoms. isoelectric point The pH at which the net charge (the sum of the charges on all
136 干细胞之家www.stemcell8.cn ←点击进入
AJ
jagged 1 (JAG1) A gene that codes fi rst isolated from the brain tissue of a for a protein called jagged 1. The jag- patient with progressive multifocal leuko- ged 1 protein binds to notch proteins encephalopathy (PML), which the virus is that are receptors on the surfaces of cer- believed to cause. tain cells. The formation of the jagged 1–notch complex sets in motion a series jnk Jun N-terminal kinase; the pro- of signaling reactions that controls the tein is a member of the MAP kinase development of various cell types in an family. MAP kinases act as an inte- embryo, including the heart, liver, eyes, gration point for multiple biochemi- ears, spinal column, and blood cells. cal signals and are involved in a wide Certain mutations in JAG1 can cause variety of cellular processes, such as Alagille syndrome, which is character- proliferation, differentiation, tran- ized by missing or narrowed bile ducts scription regulation, and development. in the liver, heart defects, and charac- This kinase is activated by various cell teristic facial features. Other mutations stimuli and targets specifi c transcrip- in JAG1 result in various other abnor- tion factors, and thus mediates imme- malities, including a heart defect called diate-early gene expression in response Tetralogy of Fallot, deafness, and a to cell stimuli. The activation of this liver condition called extrahepatic bili- kinase by tumor-necrosis factor alpha ary atresia (EHBA). The JAG1 gene is (TNF-alpha) is found to be required located on chromosome 20 at gene map for TNF-alpha-induced apoptosis. This locus p12.1-11.23. kinase is also involved in ultraviolet radiation–induced apoptosis, which is thought to be related to cytochrome Janus kinases; tyrosine kinases JAKs c-mediated cell-death pathway. Studies that are one of the two main components of the mouse counterpart of this gene of the JAK/STAT signaling pathway. suggest that this kinase plays a key JAKs are activated by certain receptors role in T-cell proliferation, apoptosis, for cytokines, lymphokines, and growth and differentiation. factors. Ligand binding causes dimeriza- tion of the receptors, which then act to joining gene (j gene) A DNA seg- phosphorylate, and activate, JAKs. The ment in the immunoglobulin gene clus- activated JAKs in turn phosphorylate ter that joins the constant and variable the cytoplasmic ends of the receptor, immuno globulin gene regions during B which then serves as a docking site for cell maturation. During the maturation STATS. Mutations in the genes for JAKs process, antibody diversity is gener- are associated with several leukemias, ated by joining a constant region with including polycythemia vera, thrombo- a large number of different variable cythemia, and myeloid metaplasia. regions.
JC virus A human virus member of the jun An oncogene transduced by a Papova group. JC virus, which is closely chicken retrovirus that causes fi brosar- related to the monkey virus, SV40, was coma tumors. The jun proto-oncogene
137 干细胞之家www.stemcell8.cn ←点击进入
rectojunin virus
ligand
JAK JAK JAK JAK P P STAT receptor
STAT P P STAT STAT
P P STAT STAT
nucleus
The JAK-STAT pathway
has been found to share identity with the junin virus A member of the taca- transcription regulation factor, AP-1, and ribe subgroup of the arenaviruses. Junin apparently exerts its oncogenic effects by virus, which causes hemorrhagic fever, is inducing aberrant gene transcription. carried by bats and rodents.
138 干细胞之家www.stemcell8.cn ←点击进入
K
Kallmann syndrome protein The karyokenesis The division of the nucleus protein implicated in causing Kallman during cell division. syndrome, a congenital condition char- acterized by anosmia, small genitalia, karyoplast The cell fraction containing and sterile gonads. Kallman syndrome the nucleus surrounded by a small ring results from the failure of gonadotropin- of cytoplasm in cells enucleated by treat- releasing hormone-secreting neurons to ment with cytochalasin. migrate into the brain from the olfac- tory placode during development. The karyotype The characterization of defect is due to mutations in a gene the chromosomes of a cell type normally called KAL-1, which codes for a pro- including chromosome morphology, chro- tein called anosmin-1. Sequence analysis mosome number, chromosome banding predicts anosmin-1 to be a cell-adhesion patterns, and any abnormalities of these protein that may mediate axon-axon characteristics. adhesion. KAL-1 is at gene map locus Xp22.3. keratin A type of intermediate fi lament found almost exclusively in the epithe- kanamycin A broad spectrum antibi- lial cells of mammals and the feathers of otic active against both Gram-positive birds. The mammalian keratin proteins and Gram-negative bacteria and a num- are a large and diverse family of proteins ber of types of mycoplasma. Kanamycin of which more than 30 different polypep- is an aminoglycoside derived from the soil tides are known, of which only a small bacterium Streptomyces kanamyceticus. number is required for fi lament forma- tion in any one epithelial cell subtype. kappa light chains One of the two types of light chains in IgG antibody keratinocyte Any mammalian epithe- molecules. The lambda-type light chain lial cell. is distinguished from the kappa-type on the basis of antiserum to light chain keratinocyte growth factor (KGF) A proteins; immunoreactivity of the light cytokine that stimulates the growth of chains show that they are of either the epithelial cells (keratinocytes). Human kappa or lambda type, but not both. KGF-1 (also called FGF-7) is produced by Kappa and lambda light chains are recombinant DNA techniques (FGF-7) as secreted by myeloma tumors and appear a polypeptide chain of 164 amino acids in the urine of myeloma patients where and is considered to be one of a class of they were originally called Bence-Jones synthetic drugs called biological response proteins. This discovery helped to eluci- modifi ers. KGF is being tested as treat- date the structure of the IgG molecule. ment for mouth sores (oral mucositis) See immunoglobulin. caused by radiation or chemotherapy.
karyogamy The fusion of two nuclei; ketone body Any of either acetone, ace- for example the fusion of pronuclei that toacetate, or beta-hydroxybutyrate, pro- occurs during fertilization of the egg. duced as the result of the accumulation
139 干细胞之家www.stemcell8.cn ←点击进入
ketose
of acetyl CoA as might be caused by kinetochore fi bers The microtubules blockage of normal glucose metabo- extending between the kinetochore of the lism via the Krebs cycle, for example, as chromosome(s) and polar bodies that pull occurs in diabetes. the chromosomes to the poles of a divid- ing cell during mitosis. ketose Any sugar containing a keto (as opposed to an aldo) group: kininogen A factor in the intrinsic R1 blood-coagulation (clotting) pathway. Ki- \ nogen is one of two factors reqired for C=O<------keto group activation of factor XII (Hageman factor). / R2 kinins (cytokinins) Plant hormones that, in combination with auxins, stimulate Khorana, Har Gobind (b. 1922) A cell division and differentiation in a variety biochemist who carried out experiments of plant tissues. Chemically, the cytokinins using synthetic oligoribonucleotides to are purines with terpenoid side chains. program synthesis of peptides. The amino acid composition of the resulting peptides kirromycin An antibiotic that acts by allowed assignment of amino acids to spe- inhibiting protein synthesis on the bacte- cifi c codons and thus the deciphering of rial ribosome. Kiromycin forms a com- the genetic code. For this work he received plex with a tRNA that prevents the elon- the Nobel Prize in medicine in 1968. gation of the growing polypeptide chain.
kilobase (kb) A measure of the length Kirsten sarcoma virus (Ki-MuSV) A of a nucleic-acid-strand equivalent to retrovirus that infects rats and that pro- 1,000 nucleotides. duces sarcomas and erythroleukemia in the infected host. Ki-MuSV carries the kilodalton (kD) A measure of the Ki-ras oncogene. size of large biomolecules, but generally applied to proteins, that is equivalent KISS-1 (KISS-1 metastasis-suppressor) to the molecular weight of the molecule A gene that has been shown to suppress che- divided by 1,000. For example, a protein motaxis, invasion, and metastasis of cancer of 125,000 molecular weight correspond cells in human melanoma and breast car- to 125 kD. cinoma cells. The KISS-1 gene codes for a peptide that binds to a G-protein-coupled kinase A class of enzymes that catalyze receptor named hOT7T175. Lymph node the transfer of a phosphate group from one metastasis is the most important predictor substrate to another. Phosphorylation is a of prognosis in esophageal squamous-cell means of regulating the activities of a num- carcinoma (ESCC). Recently, KISS-1 was ber of other enzymes, and so kinases may cloned as a human metastasis suppressor control a wide variety of biochemical path- gene, and an orphan G-protein-coupled ways through a single phosphorylation. receptor (hOT7T175) was identifi ed as the endogenous receptor of the KISS-1 product. kinesin A protein involved in the move- However, the clinical importance of KISS-1 ment of small vesicles along a microtu- and hOT7T175 gene expression in ESCC bule in the axons of nerves and perhaps remains unclear. in other cell types. Kinesin is an ATPase that uses the energy released by ATP Kleibsiella An important nitrogen- hydrolysis to induce movement. fi xing soil bacterium. See nitrogen fi xa- tion. kinetochore A dense structure in the centromeric region of a chromosome to Klenow fragment, enzyme A sub- which the spindle fi bers are attached. fragment of DNA polymerase I produced
140 干细胞之家www.stemcell8.cn ←点击进入
KSS1, FUS3
by proteolytic cleavage of the 103 kD Arthur Kornberg. Originally believed to enzyme by subtilisin. The Klenow frag- be responsible for the bulk of DNA syn- ment is the larger (68 kD) of the two sub- thesis. This was later disproved. fragments produced by subtilisin treat- ment. This fragment retains the normal K-ras The oncogene carried by the DNA polymerase and 3′→5′ exonuclease Kirsten sarcoma virus. K-ras is a member activities but lacks the 5′→3′ exonuclease of the ras oncogene family that contains of the intact enzyme. Ha-ras and N-ras. The family is defi ned by base sequence homology of the mem- Klett unit A unit of light absorbtion bers to one another. used in measuring bacterial cell num- ber in terms of the turbidity of bacterial Krebs cycle See tricarboxylic acid liquid cultures. Klett units, measured at cycle. wavelengths between 490 and 550 nm, are approximately proportional to cell KRPs kinesin-related proteins; a class number during logarithmic growth. of proteins related to kinesin and serv- ing the same basic function, that is, pro- Klinefelter’s syndrome A chromo- viding the motor that moves cytosolic somal aberration involving the sex chro- mosomes in which cells contain two X structures along microtubules. However, chromosomes and one Y chromosome. kinesin-related proteins differ from kine- Affl icted individuals have the physical sins in that KRPs are involved in spin- appearance of males but are infertile and dle assembly and chromosome segrega- have underdeveloped testicles and other tion during mitosis, while kinesins are physical abnormalities. involved in the movement of transport vesicles. Kornberg, Arthur (b. 1918) The dis- coverer of DNA polymerase I, which he Kruppel gene One of the homeobox isolated from E. coli bacteria in work gap genes identifi ed in Drosophila mela- dating from 1956. The discovery of the nogaster. In mutants of the Kruppel gene, fi rst enzyme known to be responsible for abdominal segments are deleted from the synthesis of DNA won him the Nobel larva. Prize in physiology and medicine in 1959. In 1967 Kornberg stunned the scientifi c KSS1, FUS3 Yeast MAP kinases that community by creating a biologically function in the same way in a pheromone- active virus ΦX174 from isolated com- responsive signaling pathway that acti- ponents, the fi rst time a virus had been vates functions required for mating. Fus3 produced in the laboratory. is activated by phosphorylation carried out by Ste7p. Either KSS1 or Fus3 can acti- Kornberg enzyme DNA polymerase vate Ste12, a transcription factor, through I, the bacterial enzyme discovered by phosphorylation.
141 干细胞之家www.stemcell8.cn ←点击进入
L
lac operon (lactose operon) The lactate dehyrogenase The enzyme operon that contains the three genes cod- responsible for catalyzing the conversion ing for proteins that are involved in the of pyruvate, in the presence of NADH metabolism of the sugar, lactose, and (the reduced form of NAD), to lactic acid. other beta-galactosides: beta-galactosi- dase, galactoside permease, and galacto- lactic acid The product formed from side acetylase. pyruvate by lactate dehydrogenase when sugars are oxidized under anaerobic conditions such as occur in muscle tis- lac repressor protein A protein (pro- sue after prolonged exercise or in bacteria duced by the i gene) that blocks transcription that thrive in low-oxygen environments. of the genes in the lac operon by binding to See fermentation. the operator region of the lac promoter. lactic acid bacteria anaerobic bacteria lactam antibiotics A class of antibiotics that generate lactic acid during the pro- whose molecular structure is derived from cess of sugar oxidation. The production the lactam ring, usually penicillin and its of acid by lactic acid bacteria is respon- synthetic derivatives, for example, oxacillin, sible for the souring of milk and the sour nafcillin, and benzyl penicillin (penicillin G). taste of sauerkraut.
lactamase An enzyme made by penicil- lactoperoxidase labeling A technique lin-resistant bacteria that cleaves the bond for labeling proteins on the outside of cell between NH and C=O in the lactam ring. membranes with radioactive isotopes of iodine (e.g., 125I). Lactoperoxidase cata- C=O lactamase COOH lyzes the transfer of iodine from iodo- / \ ------> / acetamide to the tyrosine residues of the (CH2)n– NH (CH2)n–NH2 protein to be labeled.
lactam ring Any molecule with the lacZ gene The gene that codes for the general structure enzyme beta-galactosidase in the lac ope- C=O ron of bacteria. The lacZ gene is incorpo- / \ rated into many cloning vectors as a means (CH2)n– NH of determining whether recombinant vec-
Lac operon
142 干细胞之家www.stemcell8.cn ←点击进入
Lassa fever virus
tors have been stably introduced into a lamella A thin membrane or plate recipient cell or clone of cells. In a popula- dividing certain biological compart- tion of transfected cells, expression of the ments, for example, the region in between lacZ gene in a transfectant(s) can be deter- the cell walls of opposing cells of certain mined from the appearance of blue color plants (i.e., the middle lamella). in the cells when they are exposed to the synthetic galactoside X-gal (5-bromo-4- lamellipoda A cytoplasm-containing chloro-3-indoyl-β-D-Galactopyranoside), protrusion or villus extending out of the which is hydrolyzed by the enzyme to pro- leading edge of an animal cell during its duce a visible blue precipitate. movement along some substrate and ori- ented along the axis of movement. Lafora disease Lafora disease is a form of epilepsy caused by an autosomal reces- laminar fl ow A uniform, eddy-free fl ow sive mutation(s) in the EPM2A gene car- of air or liquid. Laboratory work requir- ried on chromosome 6q24. The EPM2A ing particular care to avoid chemical or gene is believed to code for a protein microbial contamination is carried out in tyrosine phosphatase. Lafora disease is specialized, laminar fl ow hoods that main- a stimulus-sensitive myoclonic epilepsy tain a continuous stream of fi ltered air. that falls into two subtypes: Unverricht (earlier onset, more severe) and Lundborg laminin A protein component of the (later onset, less severe). The disease is basement membrane that forms under- associated with inclusion bodies in the neath epithelial cells where the cells neurons of the brain (Lafora bodies); in adhere to the basement membrane or particular in the cerebral and cerebel- other substrate. lar cortex and in the brain stem. Lafora bodies are mostly glucose, 80–93 percent lampbrush chromosomes Enlarged in α(1->4) and α(1->6), but also contain chro mosomes seen in amphibian oocytes protein (ca. 6 percent). during meiotic prophase. Lampbrush chromosomes are characterized by large lagging strand During DNA synthesis, protruding loops of transcriptionally the DNA strand whose synthesis begins active DNA. at the replication fork. Because the repli- cation fork is continually moving, DNA lariat An intermediate stage in the splic- synthesis on the lagging strand must be ing out of introns during the formation of mRNA in the nucleus. In a lariat, the continually reinitiated resulting in a series intron of an mRNA precursor is cut at of contiguous but not covalently joined one end; the cut end then forms a covalent fragments. See Okazaki fragments. bond to a nucleotide in the interior of the intron to form the lariat structure. (See lag phase The period of slow growth fi gure on next page.) between the time when a microorganism is inoculated into a nutrient broth and the laser Light amplifi cation by stimulated time when those microorganisms enter emission of radiation; laser light is cre- into logarithmic growth. ated by causing a group of atoms to emit photons in synchrony. Lasers are used lambda exonuclease An enzyme that in varous types of molecular biological catalyzes the cleavage of single nucleo- analyses, for example, fl ow cytometry. tides with 5′ phosphate groups from the 5′ ends of double-stranded DNA. Lassa fever virus An RNA-containing virus member of the Arenavirus family. lambda light chain One the two types First discovered in Nigeria, the virus is of light chains in IgG antibody molecules; known to cause an acute infection char- a Bence-Jones protein. See kappa light acterized by fever, malaise, throat lesions, chain. and pneumonia.
143 干细胞之家www.stemcell8.cn ←点击进入
late genes
intron
UG A AU 5´ splice site 3´ splice site
A
OH UG AU
A G
U AU lariat structure
Lariat
late genes In viral infection, a set of the French discoverers of the virus at the genes that are always expressed late in Pasteur Institute. the life cycle of the virus. Generally, the late genes code for proteins required for LD-50 The dose of a test drug that packaging of the viral DNA that is repli- is fatal to 50 percent of test animals to cated early in the viral life cycle. which it is administered.
lateral meristem Meristem tissue lining LDL receptor A transmembrane the plant stem. Because the meristem is protein in liver cells that binds spe- mitotically active, the lateral meristem is cifically to low-density lipoproteins responsible for growth in diameter of the (LDLs), after which the LDLs are plant stem. taken into the cells by endocytosis and degraded. Uptake of LDLs by LAV Lympho adenopathy virus; ano- this mechanism is one of the major ther name for HIV, the virus that causes pathways for the metabolism of LDL- AIDS. The designation LAV was used by associated cholesterol.
144 干细胞之家www.stemcell8.cn ←点击进入
leptin
leader peptidase An integral membrane covering the phenomenon of transduction protein that catalyzes the cleavage of the by bacteriophage. He also introduced the leader sequence during the insertion of technique of replica plating to study genetic preproteins into their target membranes. linkage and recombination in bacteria. His work led to the elucidation of the process leader sequence In RNA transcripts by which various genes, especially those for mRNAs, an RNA segment upstream responsible for conferring antibiotic resis- from the part of the mRNA that encodes tance, are transferred between bacteria. He the protein. This term is also used to refer was awarded the Nobel Prize in physiology to a short segment at the beginning of a and medicine in 1958. newly synthesized peptide that serves as a signal that the peptide is to be trans- legume A member of the pea fam- ported outside the cell, that is, secreted or ily of plants. The roots of leguminous deposited on the outer surface of the cell plants maintain a symbiotic relationship membrane. See signal sequence. with nitrogen fi xing bacteria so that the legumes are a rich source of nitrogen leading strand During DNA replica- stored in the form of nitrates. tion, the strand that is synthesized con- tinuously in the 5′–3′ direction. Lehninger, Albert (1917–1986) A bio- chemist famous for his work on the process leaky mutant A mutant microorganism of oxidative phosphorylation. Lehninger is in which the normal properties continue best known for identifying the mitochon- to be expressed at a low level or in which drion as the site at which the Kreb’s cycle, the mutation is only partly expressed. fatty acid oxidation, and oxidative phos- phorylation all take place. His classic Leber’s Hereditary Optic Neuropathy work on the subject was published in 1948 (LHON) A genetic disease carried in together with the noted biochemist Eugene the mitochodrial genome characterized by Kennedy, who was then his graduate stu- blindness resulting from degeneration of dent. The duo are also known for helping the optic nerve. Because the genetic defects to perfect a technique for the isolation of are carried in the mitochondria, the pat- mitochondria, which made their discover- tern of inheritance is always maternal. ies possible. Lehninger made a number of The vast majority of LHON cases carry other contributions to the study of bioen- point mutations in the region of the mito- ergetics, including the elucidation of impor- chondrial genome that codes for the ND1 tant differences in metabolism between subunit of complex I of the electron chain (NADH-ubiqinone oxidoreductase), and, normal and cancer cells. for this reason, the disease is believed to result from intracellular ATP defi ciency. lentivirus Literally, “slow virus.” A type of retrovirus that produces a chronic, gen- lecithin The common name for the mem- erally subclinical infection, for example, a brane phospholipid, phosphatidyl choline. visna virus that infects the brain cells of Lecithin is believed by some to possess sheep. However, infection may invoke an detergent properties capable of dissolving immune response that can result in demye- cholesterol present in arterial plaques. lination of the nerve cells. It is believed that some demyelinating diseases in humans lectins Plant-derived proteins that bind may follow the same paradigm. to specifi c polysaccharides. Lectins are used to label the cell surfaces of, or to leptin A polypeptide protein hormone agglutinate, cell types that bear the par- produced by adipose tissue that acts as ticular polysaccharides. a signal to the brain in the regulation of appetite and metabolism. Leptin binds Lederberg, Joshua (b. 1925) A bac- to receptors in the hypothalamus, where terial geneticist who is credited with dis- it inhibits the actions of neuropeptide Y
145 干细胞之家www.stemcell8.cn ←点击进入
Lesh-Nyhan syndrome
(NPY) and agouti-related peptide (AgRP) leukotrienes One of a class of hor- and by enhancing the actions of alpha- monelike biochemicals called eicosanoids. melanocortin stimulating hormone (α- Leukotrienes cause a number of wide- MSH). Binding of leptin to its receptor ranging effects on tissues distal from alters gene expression by the JAK/STAT where they are produced, including the signaling pathway, which is coupled to contraction of smooth muscle that lines the receptor. As a natural regulator of the airways; overproduction of leukot- appetite, leptin and/or components of riences leads to asthma attacks. leptin action are potential targets of new antiobesity drugs. levorotatory isomer One of the two main classes of optical isomers. When polar- Lesh-Nyhan syndrome A genetic dis- ized light is passed through a solution of a ease characterized by mental retardation levorotatory isomer, the plane of polarized and loss of coordination. The disease, light is rotated in a counterclockwise direc- which becomes manifest by the age of two, tion from the point of view of the observer. is due to the lack of the enzyme hypoxan- thine-guanine phophoribosyltransferase library A large set of DNA sequences (HGPRT) and was identifi ed by Michael from some specifi ed source, for example, Lesch and William Nyhan in 1964. cDNAs or fragments of chromosomal DNA derived from a certain tissue or cell lethal locus A genetic locus where type. This term is also applied to pep- mutations tend to prove lethal to organ- tides as in libraries created in automated isms carrying the mutation(s). peptide synthesizers that contain a large number of different peptides. lethal mutation Any mutation whose presence leads to the death of the organ- ligand Any molecule that is bound by a ism in which the mutation is present. specifi c receptor for that molecule.
leucine The amino acid that contains ligand-gated channels Channels in as a side chain: cell membranes that permit the passage CH3 of ions through the membrane when, and / only when, a specifi c ligand is bound to –CH2–CH its membrane receptor (“ligand gating”). \ Ligand-gated channels are the means by CH3 which nerve impulses are propagated when a neurotransmitter produced by leucine zipper A structural motif on one neuron binds to a receptor on the DNA binding regulatory proteins. Leu- membrane of another neuron. cine- zipper proteins are helices in which hydrophobic amino acids are arrayed ligase A type of enzyme that catalyzes along one side of the helix. In the active the formation of a covalent bond between dimeric form, leucine residues at approxi- the free ends of two nucleic acids. mately every seventh position are hydro- phobically bonded to the leucine residues ligase, DNA Catalyzes the linkage in a second helix so that the two helices between a 5′ terminal phosphate group are wound around each other in a coiled- at the end of one DNA and a 3′ terminal coil arrangement. hydroxyl group at the end of another.
leukemia A cancer of the blood char- ligation The chemical linking of the acterized by the uncontrolled prolifera- free ends of two nucleic acids to form one tion of white blood cells (leukocytes). larger strand out of two smaller ones.
leukocyte A white blood cell. The light chain Either of the two shorter white blood cells are largely composed of peptides that make up an immunoglobulin the cells of the immune system. molecule.
146 干细胞之家www.stemcell8.cn ←点击进入
linkage map
light-dependent reactions Those chem- peptides by blocking elongation of par- ical reactions in photosynthesis that require tially synthesized peptide chains. light. The so-called light reaction(s) involves the capturing of light energy by pigments, LINEs Long interspersed elements; a including chlorophyll, in the form of high- repeated sequence of intermediate redun- energy electrons. The activated electrons dancy (~50,000 copies/genome in human are derived from water that is split during cells) that acts as a mobile element using the process to liberate free oxygen. a reverse transcription mechanism simi- lar to retroposons. LINEs contain genes light-harvesting complex (LHC) A encoding proteins similar to the reverse complex of pigments associated with the transcriptases of retroviruses and may photochemical reaction centers in chlo- contain other open reading frames as roplasts that serve to collect the pho- well. LINEs also differ from retroposons tons falling on an area of the thylakoid in that the coding regions are fl anked by disk. Then the photon energy is trans- short direct repeats rather than long ter- ferred to a chlorophyll molecule in the minal repeats. form of an excited electron whose energy is then used to store the energy as ATP Lineweaver-Burk plot A plot of the or NADPH (the reduced form of NADP). reciprocal of substrate concentration (1/ Light-harvesting complexes contain a S) versus the reciprocal of the reaction variety of pigments that act as “antenna velocity (1/Vo) for an enzyme catalyzed molecules” for collecting light. These pig- reaction; also called a double reciprocal ments include carotenoids, phycobillins, plot. This type of plot is useful for graph- phycoerythrins, and chlorophylls. ical determination of Km and Vmax for a given enzymatic reaction. light-independent reactions Those chemical reactons in photosynthesis that linkage The degree to which any two are carried out in the absence of light. genetic markers are associated with each The so-called dark reactions are respon- other as determined by the frequency with sible for the trapping of carbon dioxide which the two markers appear together in and water to create sugars. the same individual during genetic trans- mission (e.g., in offspring or in micro- lignin A phenolic polymer that forms organisms in which the genetic markers a matrix in which the cellulose fi bers of have been transferred by transduction or the plant cell wall are embedded. Lignin conjugation). Genetic linkage is related forms the “cement” that holds the fi bers to, but is not the same as, the physical in place and also lends tensile strength to distance between the two markers. the cell wall. linkage disequilibrium A term to limit digest The product of a degrada- indicate the tendency of some genes, tive enzymatic reaction in which the sub- or genetic loci, to remain linked to one strate has been digested to the maximal another; in other words to show patterns extent possible. Limitation of the extent of inheritance that are statistically differ- of digestion may be imposed by physical ent from what would be expected if the constraints, for example, clumping of the genes recombined at random. If there is substrate material or failure of the sub- no statistical deviation in the distribution strate to enter into solution completely. of genes from what would be expected from random recombination, the linkage lincomycin (lincocin) An antibiotic disequilibrium would then be zero. produced by Streptomyces lincolnensis. The antimicrobial action of lincocin is linkage map A genetic map based due to its binding to the large subunit of upon genetic linkage as opposed to actual the ribosome that prevents synthesis of physical distances.
147 干细胞之家www.stemcell8.cn ←点击进入
linked genes
Lipid bilayer
linked genes Genes that are located mutations whose effect on the activity of within close enough physical proximity a promoter is to be tested. The promoter to one another that they appear together sequence that has been altered by inser- in virtually all organisms to which one or tion of the linker is tested for activity in the other is transmitted. vitro, for example, by CAT assay.
linker A synthetic molecule that serves linking number The number of com- as a molecular bridge between two other plete helical turns in a circular DNA mol- molecules, for example, a synthetic oligo- ecule. The linking number is related to nucleotide that joins together two DNA the degree of supercoiling of the DNA. fragments. linking-number paradox In experi- linker-scanner mutations The replace- mental determinations of the number of ment of a segment of DNA with a synthetic winds of DNA around each nucleosome, oligonucleotide (a linker) that contains the linking-number paradox refers to the
148 干细胞之家www.stemcell8.cn ←点击进入
LOD score
discrepancy between the values obtained by different experimental methods. For example, digestion of nucleosomes by endonucleases gives about 1.8 DNA coils per nucleosome, but measurements based on supercoiling of DNA after the nucleo- somes are removed give a value of about 1 coil per nucleosome. The discrepancy is of theoretical signifi cance for models of the helical structure of the DNA molecule.
lipase Any of a variety of enzymes that catalyzes the breakage of an ester link- age in a lipid, thereby participating in the breakdown of that lipid.
lipid Any of a variety of oily, highly insoluble biomolecules associated with cell membranes and fatty tissues. Lipids are divided into six major classes: fatty acids, triglycerides, phosphatides, spingo- sines, waxes, and cholesterol derivatives.
lipid bilayer A thin fi lm of regular thickness that, under certain conditions, is spontaneously formed by amphipa- Liposomes thic lipids when they are placed in water. The plasma membranes of animal cells the cell plasma membrane, liposomes are is formed, in large part, from naturally being studied as vehicles specifi cally to occurring bilayers of phospholipids. introduce drugs or other bioactive chemi- cals directly into target cells. lipopolysaccharide Lipids that are bound to polysaccharides. Lipopolysac- lipotropic agents Lipid solvents or charides are found attached to the out- chemicals with hydrophobic properties sides of many cell membranes, including that permit them to form nonpolar bonds bacterial cell membranes. with lipid molecules. Certain lipotropic agents have application as virus inactivat- lipoprotein Complexes of lipids and ing drugs. proteins. The most important and abun- dant examples of lipoproteins are the lipo- locus The position occupied by a gene proteins that function to transport fats in or a genetic marker on a chromosome. the blood and that are classifi ed mainly in terms of their densities: high-density LOD score A numerical value used lipoproteins (HDLs), intermediate-density to indicate genetic linkage between two lipoproteins (IDLs), low-density lipopro- markers. The LOD score is defi ned as teins (LDLs), and very-low-density lipo- LOD = log10(Plinked/Punlinked) proteins (VLDLs). where Plinked is the probability that the fre- liposome A synthetic structure com- quency with which two markers segrate posed of a lipid bilayer that completely from one another in the offspring of a encloses an interior cavity in which may mating could have occurred if the mark- be carried various substances of interest. ers were linked. Because the lipid bilayer of the liposome Punlinked is the probability that the fre- can spontaneously fuse with the lipids of quency with which two markers segrate
149 干细胞之家www.stemcell8.cn ←点击进入
logarithmic [growth] phase
from one another in the offspring of a isms may not reproduce or give rise to mating could have occurred if the mark- only one daughter during reproduction. ers were unlinked from one another. By convention, a LOD score of 3 is long QT syndrome (LQTS) An considered the threshold value for declar- hereditary disorder, usually seen in chil- ing that two markers are linked to one dren, that affects the heart’s electrical another. rhythm such that the interval between the Q and T parts of the contraction wave logarithmic [growth] phase The term (contraction-relaxation of the ventricles) used to describe the growth of a culture of is abnormally long. This leads to a rapid microorganisms under conditions where, heart rhythm (arrhythmia) called Torsade on the average, one organism gives rise des pointes, which can cause fainting in to two daughters at a consistent uniform a matter of seconds. The biological bases rate. Logarithmic phase of growth fol- of LQTS are mutations in genes that code lows lag phase during which some organ- for ion channels that cause the channels
reverse transcriptase
RNA 5´ R U5 gag pol ENV U3 R 3'
cDNA 3´ R U5 gag pol 5'
5´ R U5 gag pol ENV U3 R 3'
partial degradation of 5´ end of RNA template R U5 gag pol resulting in loss of R
U5 gag pol ENV U3 R 3'
head-to-tail alignment of second viral RNA by base pairing of R segments
extension of cDNA by reverse transcriptase R U5 gag pol
5' R U5 gag pol ENV U3 R U5 gag pol ENV U3 R 3'
continue reverse transcription to end of template LTR
ENV U3 R U5 gag pol
5' R U5 gag pol ENV U3 R U5 gag pol ENV U3 R 3'
Formation of long terminal repeats during reverse transcription
150 干细胞之家www.stemcell8.cn ←点击进入
luxury genes
to malfunction. At least fi ve genes are characteristic light fl ashes. Luciferase known to be involved in LQTS: 1. the catalyzes the decarboxylation of the sub- KCNQ1 gene on chromosome 11 (encodes strate, luciferyl andenylate, to generate a potassium channel), 2. the HERG gene light. This reaction has been exploited as on chromosome 7 (encodes a potassium a nonradioactive means of labeling mol- channel), 3. the SCN5A gene on chromo- ecules for analytical purposes. some 3 (encodes a sodium channel), 4. the ATP luciferase LQT5 gene (also called MinK, or KCNE1) luciferin —> luciferyl adenylate —> oxyluciferin on chromosome 21 (encodes part of the +AMP oxygen +CO2 potassium channel together with the + AMP KCNQ1 gene product; mutations of this + LIGHT gene—like those of KCNQ1—produce the LQT1 form of LQTS), and 5. the MiRP1 lucifer yellow A fl uorescent dye used gene on chromosome 21 (encodes part of as an intracellular tracer to visualize liv- the potassium channel together with the ing cells. Lucifer yellow and other tracer HERG gene product). dyes have much application in neurobiol- ogy for discriminating individual nerve long terminal repeat (LTR) Special- cells in a cluster. ized sequences located at the 5′ and 3′ termini of the genome of retroviruses. luminometer A device for measuring LTRs mediate the integration of the ret- emitted light. Luminometers have par- rovirus into the host genome and regu- ticular application as an analytical tool late the transcription of the retrovirus for determining the cellular content of genes. Because many LTRs contain strong ATP and other energy-containing nucleo- enhancer elements, they are often used in tide phosphates by utilizing biochemical synthetic constructs for the purpose of reactions that emit light, for example, the expressing foreign or engineered genes in ATP-luciferase reaction. recipient cells. Luria, Salvador (1912–1991) A genet- loop, looped domains A single- icist whose work with bacterial and bac- stranded region in either RNA or sin- gle-stranded DNA that forms a hairpin teriophage mutants led to the elucidation structure. The sequence between inverted of gene structure. He carried out a famous repeating sequences forms looped experiment in 1943 that demonstrated the domains because of base pairing between inheritance of antibiotic resistance in bac- the inverted repeated. teria and showed that the pattern of inheri- tance followed Darwinian rather than Lar- low-density lipoprotein (LDL) A marckian principles. Luria won the Nobel class of lipoprotein particles that carry Prize in medicine in 1969. cholesterol esters to cells that have spe- cialized LDL receptors. Receptor-bound luteinizing hormone (LH) A glyco- LDLs are taken up into the cell where the protein hormone released from the ante- cholesterols are metabolized. rior pituitary. LH stimulates oocyte mat- uration and ovulation and progesterone L-phase variants Bacterial variants secretion in the ovary. that lack a cell wall. L-phase variants are produced under conditions in which cell- luxury genes A vernacular term to wall synthesis is inhibited, for example, describe the genes that are not essential the presence of penicillin. The L-phase for basic cell functions, but rather are variants pass through fi lters that retain made by only a certain cell type and that normal bacteria. perform a function necessary to the func- tioning of the organism as a whole, for luciferase An enzyme isolated from example, hemaglobin genes. See differ- fi refl ies that is responsible for their entiation antigen.
151 干细胞之家www.stemcell8.cn ←点击进入
lymphocyte
lymphocyte The subclass of white lysogen A bacterial strain harboring a blood cells responsible for carrying out lysogenic virus (bacteriophage). See pro- the immune response. Lymphocytes are phage. further subdivided into T and B lympho- cytes and are found mostly in the thymus, lysogenic The property of certain bac- lymph nodes, the spleen, and the appen- teriophage mutants to integrate into and dix. remain dormant in the bacterial host DNA. Although lysogenic bacteriophages lymphokines (interleukins) Hormones do not immediately cause lysis, they may secreted by certain antigen-processing be induced to do so by various chemical cells of the immune system that cause T agents or by ultraviolet light. cells specifi c for the antigen to proliferate. lysogeny The state of being lysogenic. Lyon effect The silencing of expression of the genes on one of the two X chro- lysosome A cytoplasmic organelle in mosomes in the cells in a female animal. eukaryotic cells in which digestion of Silencing of the particular X chromosome particulate material brought into the cell occurs at random and is maintained in all via endocytosis or phagocytosis occurs. the progeny cells. Lysosomes are characterized by a highly acidic internal environment and the pres- lyophilization The removal of water ence of enzymes (acid hydrolases) that from a frozen biological specimen by carry out the digestive process. placing the specimen in a vacuum; often referred to as freeze-drying. lysozyme An enzyme that derives its name from its ability to cause certain lysate The resultant mixture of cell bacteria to lyse. Lysozyme acts by cleav- debris and soluble cytoplasmic substances that results from mass cellular lysis of a ing polysaccharides in the bacterial cell cell culture or tissue. wall. Lysozyme is used as a reagent in preparing DNA from bacteria and in the lyse (lysis) A breaking open of cells creation of protoplasts. by damage to the cell membrane by any mechanical, biological, or chemical lytic cycle The events in the growth agent. cycle of a lytic virus. The term is usually applied to bacteriophages. lysine An amino acid with an amino butyl side chain: –(CH2)4–NH2. The lytic virus Any virus that as part of amino group makes lysine a basic amino its life cycle, causes lysis of the host cells acid. that it infects.
152 干细胞之家www.stemcell8.cn ←点击进入
M
Machado-Joseph disease protein A or size fractionation of large proteins or neurological genetic disorder, also known substances such as viruses. as spinocerebellar ataxia-3, that is trans- mitted to offspring in an autosomal domi- magic spot nucleotides Nucleotides nant. The disease is caused by degenera- with two or more phosphate groups on tion of specifi c groups of neurons and is both the 3′ and 5′ carbon atoms that characterized by spinocerebellar ataxia, accumulate in bacterial cells during the limited eye movement and rigidity. The stringent response. gene involved in Machado-Joseph dis- ease (MJD) is MJD1 (ataxin 3), and the main band The band that corresponds associated disease-causing mutation is to the bulk of DNA, as opposed to satel- lite DNA, when a preparation of mam- an expansion of CAG repeats in the cod- malian genomic DNA is subjected to den- ing region from the normal number of sity gradient centrifugation analysis. 13–36 to 68–79. While the function of the disease gene is unknown, it appears major facilitator superfamily (MFS) One that pathogenesis is associated with mis- of the two largest families of membrane folding and aggregation of the protein in transporters. The MFS is found in both the nuclei of affected neurons. MJD1 is prokaryotes and eukaryotes and functions located at gene map locus 14q24.3-q32.2. to transport a wide variety of ions, sug- ars, amino acids, drugs, and other solutes. macrolides A group of antibiotics with Members of the MFS are grouped together a large aliphatic ring structure with many on the basis of sequence homology as a hydroxyl and keto groups. Erythromycin result of sequence analyses of public data- is the best-known member of this group bases completed in 1997. Phylogenetically, of antibiotics. 17 distinct subfamilies can be delineated within the MFS, each of which usually macromolecule A large molecule made transports one type of compound. All 17 up of many individual units such as subfamilies contain 12 or 14 transmem- amino acids in proteins, nucleotides in brane alpha-helices and show a highly con- nucleic acids, and unit sugars in large served motif between transmembrane link- carbohydrates. ing peptides 2 and 3. The MFS is believed to have evolved from a common ancestral macrophage A large phagocytic white gene through a process of gene duplication. blood cell. Macrophages travel in the blood but are capable of leaving the blood major histocompatability complex to enter tissue. They function as a defense (MHC) A cluster of genes present in by ingesting invading bacteria and other the genomes of most higher vertebrates foreign cells as well as by removing par- that code for cell surface proteins that are ticulate debris. recognized as the main transplantation antigens when cells are transplanted to a macroporous gels A chromatogra- foreign environment. The MHC proteins phy matrix composed usually of cellu- are therefore the antigens mainly respon- lose or agarose gels that are useful for sible for provoking graft rejection in ani- ion exchange or affi nity chromatography mals receiving foreign tissue grafts.
153 干细胞之家www.stemcell8.cn ←点击进入
malaria A chronic disease character- MAP kinase A class of enzymes that ized by periodic acute attacks of chills phosphorylate MAPs. Phosphorylation and fever. The disease is the result of (and dephosphorylation) of MAPs regu- infection by the sporozooite parasite, lates the polymerization of microtubules plasmodium, that lives in red blood cells and therefore functions as a means to and is transmitted to humans via the control the entry of cells into mitosis. Anopheles mosquito. MAP kinases are activated by signal- ing pathways, such as those mediated by maltase The enzyme that catalyzes the receptor tyrosine kinases (RTKs). For breakdown of the malt sugar, maltose this reason MAP kinase in the context maltase of signaling pathways is an acronym for maltose ------> 2 glucose mitogen-activated protein kinase.
maltose-binding protein A protein MAPs See microtubule-associated produced by the bacterium Escherichia proteins. coli that is used to transport the disac- charide sugar maltose across the bacterial MAR (SAR) Matrix attachment re- plasma membrane. gions (Scaffold attachment regions); spe- cifi c DNA sequences at which attachment mammalian cell culture The main- to the nuclear scaffold network occurs. tenance of mammalian cells outside the body using synthetic media to meet the Marburg virus A virus discovered as nutritional requirements normally sup- a contaminant of tissues from African plied by the blood. green monkeys in Marburg and Frank- fort, Germany, in 1967. The classifi cation mammalian expression systems The of Marburg virus is unclear. The disease term for expression vectors that are specif- is characterized by fever, rash, gastroin- ically designed to express cloned genes in testinal upset, and central nervous system mammalian cells. See expression system. involvement and is potentially fatal.
mannose A sugar that is an optical iso- Marfan syndrome An inherited disor- mer of the main energy-producing sugar, der of connective tissue that affects the glucose. Because mannose differs from skeleton, lungs, eyes, heart, and blood glucose at only one of the six carbons, vessels. The disease is characterized by mannose is called an epimer of glucose unusually long limbs. Marfan syndrome is and can be converted directly into glu- carried as an autosomal dominant linked cose by enzymes. to mutations in the FBN1 gene on chro- mosome 15q21.1, which encodes a gly- Manton-Gaulin homogenizer An coprotein called fi brillin that is a major apparatus used for large-scale breakage building block of microfi brils. Microfi brils of cells to release their internal contents, are structural components of the support- using the mechanism of liquid shear. See ing matrices of the tissue of the eye, aorta, cell disruption. lung airways, and the dura of spinal col- umn. Mutations in FBN1 produce abnor- map distance A means of defi ning mal fi brillin-1 monomers that prevent distance between two markers on a seg- microfi bril formation. This is an example ment of chromosomal DNA. In bacte- of a dominant-negative effect because the rial systems, map distance is measured in mutant fi brillin-1 disrupts microfi bril for- terms of map units, defi ned as the recom- mation even with normal fi brillin is being bination frequency between two genetic produced by the other allele. markers and expressed as a percentage. In eukaryotic chromosomes, map units marker Any genetic element that pro- are given in centimorgans. duces a variation in expression of a trait
154 干细胞之家www.stemcell8.cn ←点击进入
MDM2
(e.g., hair color) and that resides at a par- haploid cells of opposite mating types. ticular locus. The mating process converts yeast cells from haploid asexual cells to diploid sex- Marshall, Barry J. (1902–1992) One ually reproducing cells. of the codiscoverers of the ulcer- causing bacterium Helicobacter pylori. mating-type locus (MAT) A locus This discovery earned him the Nobel containing master regulatory genes in Prize in physiology or medicine in 2005, yeast that determine the male and female which he shared with Robin Warren. mating types. Marshall became well known for having tested the ulcer-causing properties of the maturing face [trans face (Golgi)] The bacterium on himself. outermost membrane in a Golgi stack. The maturing face of the Golgi stack is mass spectrometry An analytical the place where proteins that have been technique for determining the molecular structure of an unknown compound by processed in the Golgi exit for various cel- observing the paths that fragments of the lular destinations. See Golgi apparatus. molecule take when they are forced to migrate in a magnetic fi eld. Maxam-Gilbert sequencing A tech- nique for determining the sequence of a mast cell A connective tissue cell located nucleic acid by chemical treatments that near capillaries and most abundant in the cleave the nucleic acid strand at only one lung, the skin, and the gastrointestinal of the four nucleotide bases (i.e., adenine, tract. Mast cells possess receptors for IgE cytosine, guanine, or thymine), depend- and release histamine when bound to IgE. ing on the chemicals used. The fragments The release of histamine is responsible for produced by chemical cleavage are then the runny nose, itchiness, and other respi- separated by electrophoresis, and the ratory symptoms of allergy. sequence is determined from the size of the different fragments. master regulatory genes A cluster of genes that governs the development MBP vector Maltose binding protein of the major structural features during vector; an expression vector designed to embryogeneis, for example, the bithorax facilitate the purifi cation of the proteins complex in Drosophila melanogaster that are expressed via the vector. In MBP that is responsible for development of the vectors, the gene to be expressed is fused abdominal and thoracic segments. to the gene coding for the maltose bind- ing protein. The fusion protein expressed maternal effect Characteristics con- by the vector can be purifi ed by running trolled by the mother and expressed in a cell extract over an amylose column. the offspring. Usually, maternal effects are caused by mRNA or a transcription factor produced by the mother and passed McClintock, Barbara (1902–1992) A into the egg. geneticist whose work on the cytogenet- ics of maize led her to postulate the idea maternal inheritance Inheritance of that genes could be transposable, both genes of extrachromosomal factors such within a chromosome and between chro- as the mitochondria that are transmitted mosomes. Her work on transposable ele- through the egg cytoplasm. ments won her the Nobel Prize in medi- cine in 1983. mating type One of two alternative states (α or a mating types) that the hap- MDM2 Murine double minute 2; loid (budding) form of yeast can assume MDM2 is a nuclear phosphoprotein for the purpose of mating. During mat- with an apparent molecular mass of ing, diploid cells are formed by fusion of 90 kD that forms a complex with the
155 干细胞之家www.stemcell8.cn ←点击进入
mDNA
p53 tumor-suppressor protein. Human activates MEK. Activated MEK is a phos- MDM2 was identifi ed as a homolo- phorylase that phosphorylates a MAP gous product of the murine double min- kinase, the next intermediate in the path- ute 2 gene. The MDM2 gene enhances way. See signal transduction. the tumorigenic potential of cells when it is overexpressed and encodes a puta- melanin The brown, reddish, or black tive transcription factor. Forming a tight pigment that, in mammals, gives skin and complex with the p53 gene, the MDM2 hair their characteristic color(s). Melanin oncogene can inhibit p53-mediated trans- is derived from the amino acid, tyrosine, activation, and MDM2 also binds to p53 and is also found in parts of the brain and protein. Inactivation of tumor-suppressor the eye, where its function is unknown. genes leads to deregulated cell prolifera- tion and is a key factor in human tumori- melanocyte A specialized cell type genesis. p53 can be subjected to negative found beneath the epidermal layer of skin regulation by the product of a single cel- that produces melanin for the purpose of lular proto-oncogene. The interference of skin pigmentation. Melanin made in the binding to p53 prevents the interaction melanocyte is passed on to the upper layers of MDM2 and its regulation of the tran- of skin through dendritic cell processes. scriptional activity of p53 in vivo. Direct association of p53 with the cellular pro- melanoma A highly malignant skin tein MDM2 results in ubiquitination and cancer originating in the melanocytes. subsequent degradation of p53. MDM2 p53 complexes were preferentially found melting of DNA The breakage, by in S/G2M phases of the cell cycle. The heating, of the hydrogen bonds that hold MDM2 gene is alternatively spliced, pro- the double-stranded helical structure of ducing fi ve additional splice-variant tran- DNA together. On melting, DNA changes scripts from the full-length MDM2 gene. from double stranded to single stranded. The alternatively spliced transcripts tend to be expressed in tumorigenic tissue, melting temperature Defi ned as the whereas the full-length MDM2 transcript temperature at which 50 percent of the is expressed in normal tissue. double-stranded DNA is turned into single-stranded DNA. mDNA The DNA that represents genes that are expressed in a variety of tis- membrane In general a fl exible sheet or sues. The mDNA is presumed to repre- layered material that separates two chemi- sent genes that are required for processes cally different environments. Biologically, required in all cell types. membranes are made up primarily of lip- ids and proteins and are the structures medium The nutrient broth used to that defi ne the compartments of the cell, grow cultures of cells, bacteria, or micro- the organelle, and the nucleus. Synthetic organisms. membranes are used biochemically to separate chemically different liquids and meiosis The process of cell division that gases from one another for experimental takes place in the reproductive tissue and purposes. that produces gametes (sperm and egg in animals). The meiotic process leaves each membrane fi ltration A method of daughter cell that becomes a gamete with clarifying microbial cell extracts. The half the number of chromosomes as are procedure may not be optimal because found in other cell types in the body. microbial preparations can be gelatinous and block the fi lter. To compensate for MEK An intermediate in ras signal this problem, membranes with an asym- transduction pathways. In these path- metric pore structure have been used ways, phosphorylation of MEK by raf successfully in large-scale operations to
156 干细胞之家www.stemcell8.cn ←点击进入
metabolic disease
isolate certain enzymes from lysed micro- mercaptoethanol A widely used organisms. reducing agent, particularly useful in bio- chemical procedures where breakage of membrane potential The electric disulfi de bonds is desirable. potential (voltage) created by the differ- –S–S– ------> –SH HS– ence in ion concentration on different sides of a membrane. Membrane poten- 6-mercaptopurine A purine analog tials drive certain kinds of transport whose DNA-damaging effects particu- systems through the membrane and are larly target the production of T lympho- responsible for nerve impulses. See pro- cytes. For this reason, 6-mercaptopurine ton gradient. is given as an immunosuppressant drug to prevent graft rejection. membrane ruffl ing A wavelike move- ment observed at the leading edge of a cell meristem The mitotically active tissue membrane during movement; the location in higher plants that, through cell divi- of the ruffl ed portion of the membrane sion, forms new plant tissues. Meriste- indicates the direction of cell movement. matic cells are found in the root (apical meristem) and along the outside of the memory, immunologic The ability of stem (lateral meristem). the immune system to respond to antigens to which it has previously been exposed; meristem culture A technique used the maintenance of immunity to an anti- to produce pathogen-free plants. The gen over long periods of time. meristem is a dome of actively dividing cells that is resistant to contamination by memory cells Small populations of B microbes. When the lab growth of meri- cells and T cells of the immune system stems is combined with micropropagation that produce antibodies or have receptors techniques, large numbers of disease-free for an antigen that appears after an initial plants can be cultured. exposure of the organism to that antigen. merozygote The stage in bacterial con- Mendel, Gregor (1822–1884) The jugation in which the recipient bacterium, founder of the fi eld of genetics. His prior to division, contains two bacterial experiments on crossbreeding of peas led chromosomes. to the fi rst formulation of the principles of heredity based on the idea of indepen- Meselson, Matthew (b. 1930) A bio- dent assortment of genetic units (chro- chemist who, in collaboration with Franklin mosomes) that are still in use today. Stahl, carried out the critical experiments that demonstrated the semiconservation Mendelian genetics Genetics based nature of DNA replication in 1957. on the concepts originally proposed by mesophile Bacteria that grow in the Gregor Mendel, that is, that genetic traits narrow temperature range of the mam- are contained on completely independent, malian body; from about 37°C to 44°C. randomly reassorting genetic elements (i.e., chromosomes). Recombination is not messenger RNA (mRNA) A ribonu- taken into account in classical Mendelian cleic acid strand that carries the genetic genetics. code for a protein. The mRNA is copied from DNA in the nucleus, is processed, Mendel’s law The principle that genetic and is then transported to the cytoplasm elements controlling individual traits can where its code is read on ribosomes and reassort themselves independently of one translated into a polypeptide. another during the reproductive process. The postulated genetic elements were later metabolic disease A disease stemming found to be based on physically discern- from a defect in an essential metabolic ible structures: chromosomes. pathway.
157 干细胞之家www.stemcell8.cn ←点击进入
metabolic pathway
metabolic pathway A series of succes- metaphase The phase in mitosis in sive biochemical steps in the metabolism which the chromosome pairs are aligned of a nutrient molecule. In a metabolic along the axis of the cell just prior to telo- pathway, the input molecule is progres- phase. sively altered until a specifi c fi nal metab- olite is produced. metastasis The spread of cancer cells from a primary lesion to other parts of metabolism The process of altering a the body. nutrient molecule via a metabolic path- way for the purpose of energy production methane The simplest hydrocarbon made or the creation of important biomolecules, up of one carbon and four hydrogen atoms for example, amino acids, hormones, and (CH4). Methane is a gas that is generated nucleic acids. from carbon dioxide by certain bacteria during the oxidation of fatty acids. metabolite One of the intermediate molecules generated during the metabo- methanogenic bacteria Bacteria that lism of a nutrient. generate methane gas during metabolism.
metabolomics A recently formed subdi- methanol The alcohol of methane vision of bioinformatics devoted to high (CH3–OH), also known as wood alcohol. throughput analyses of metabolites accord- ing to their physical and chemical proper- methanophile (methanotroph) Any ties using various techniques, including of a class of bacteria that derives its gas chromatography, high-pressure liquid energy from the metabolism of methane. chromatography, capillary electrophore- sis, and mass spectrometry. methicillin A synthetic derivative of penicillin created by the addition of a An enzyme requiring metalloenzyme dimethoxyphenyl group to the side chain a metal atom(s) for normal activity. of penicillin. Because methicillin is not susceptible to the action of penicillinase, metallothionein Any of a class of metal methicillin can be used in cases of infec- binding proteins that play a role in pre- tion by penicillin-resistant bacteria. venting toxicity due to metal accumulation in cells. Because metallothionein synthesis is induced by the presence of metal ions, methionine One of the two sulfur- the metallothionein promoter has been containing amino acids whose side chain widely used to control the expression of is: –CH2–CH2–S–CH3. Methionine is an essential amino acid that is important as genetically engineered genes. a methyl group donor. metamerism A concept that usually applies to arthropod development but methionine-enkephalin (met-enkephalin) which refers to unique features on serially A short peptide with the structure: Tyr- repeating segments; for example, the seg- Gly-Gly-Phe-Met. Met-enkephalin is one ments of the embryo of Drosophila mela- of a class of pain inhibiting neuropeptides nogaster, which are initially identical in known as endorphins that act by binding appearance but later develop appendages to the opiod receptor in the brain. associated with the head, thorax, and abdomen. Metamerism is the result of the methotrexate An antibiotic and chemo- action of various segmentation genes such therapeutic agent that blocks the enzyme as the homeobox genes. dihydrofolate reductase (DHFR), which is necessary for purine biosynthesis. Because metamorphosis The maturational pro- certain cancer cells have a high require- cess in amphibians and insects as exem- ment for this enzyme, methotrexate can plifi ed by the transition from tadpole to specifi cally target metabolism of these can- adult frog. cer cells to inhibit their growth. Resistance
158 干细胞之家www.stemcell8.cn ←点击进入
Michaelis-Menten constant
to metho trexate arises when the DHFR enzyme that catalyzes this reaction is meth- mutates to a form that no longer responds ylmalonyl-CoA mutase, encoded by a gene to methotrexate. However, it has been located at gene map locus 6p21. shown that when methotrexate is added to certain cell lines, resistance arises due to methyl tetrahydrofolate A form of the amplifi cation of the gene for DHFR, the B vitamin folic acid that acts as a thus producing more copies of the protein. coenzyme in methyl group transferring This phenomenon has been exploited by reactions in the synthesis of purines. biotechnologists, and metho trex ate is used to amplify genes or parts of chromosomes methyl transferases A set of enzymes cloned near the gene for DHFR. that catalyzes the transfer of methyl groups from S-adenosylmethionine (SAM) methyl-accepting chemotaxis proteins to another substrate, particularly nucleic (MCPs) A class of bacterial transmem- acids or nucleic acid precursors. brane proteins involved in chemotaxis. The portion of the MCPs that extend into methylcellulose An inert polymeric the bacterial cytosol becomes methyl- substance used to increase the density ated when the portion of the protein that of culture medium to maintain growing extends outside the cell binds an attractant microorganisms in suspension. substance. However, it becomes demethyl- ated if a repellent substance is bound. 5-methylcytosine (5MeC) A modifi ed form of cytosine to which a methyl group methylation of nucleic acids The has been added by a methylase. These addition of methyl groups to nitrogen modifi ed residues are found at specifi c sites atoms on the bases in nucleic acids. Meth- along the DNA and provide hotspots for ylation of nucleic acids is known to serve transition type mutations. They are readily at least three functions: spontaneously deaminated, resulting in the (1) Methylation of the bases in DNA is conversion of 5MeC to thymine, leaving a believed to be a mechanism for control- mispaired G-T base pair. On subsequent ling gene expression (methylated DNA is DNA replication, one newly synthesized not expressed). strand will contain the A-T mutation. (2) Methylation of the 5′ terminal gua- nine in mRNA is required for the mRNA MHC See major histocompatibility to be functional. complex. (3) Methylation of restriction enzyme sites in the DNA of bacterial cells that micelle A more or less spherical struc- make restriction enzymes as a defense ture that amphipathic lipids spontane- against invading bacteriophage; meth- ously assume when mixed with water. In ylation of the sites on the bacterial DNA a micelle, the polar portion of the lipid is prevents cleavage of the DNA by its own oriented outward in contact with the water restriction enzymes. molecules, but the hydrophobic portions of the lipids are in the interior of the spheroid. methylmalonic academia An autoso- mal recessive genetic disorder of the metab- Michaelis-Menten constant (KM) A olism of any of four amino acids (methio- reaction rate constant pertaining to nine, threonine, isoleucine, and valine) in enzyme-catalyzed reactions: which the blood and body tissues become k1 k2 acidic. The acute form is characterized by E + S <------> ES ------> E + P drowsiness, coma, and sometimes seizures. k–1 Over the long term, mental retardation may where be a consequence. The metabolic defect E = free enzyme is the inability to convert methylmalonyl- S = substrate CoA to succinyl-CoA, which leads to the ES = enzyme-substrate complex accumulation of methylmalonic acid. The P = product of the reaction
159 干细胞之家www.stemcell8.cn ←点击进入
Michaelis-Menten equation
k1,k–1, k2 = reaction rate constants for microfi brils A bundle of fi ne cellulose the individual reactions fi bers that make up the plant cell wall. KM is defi ned by KM = (k2 + k–1)/k1. microfi lament An actin-containing fi la- Michaelis-Menten equation Defi nes ment that makes up one type of cytoskel- the relationship between KM, the reaction eton in mammalian cells. Microfi laments rate velocity (v), the maximum reaction are believed to be the basis for movement rate attainable at a given concentration of cells in culture. of enzyme, and the concentration of sub- strate [S] microglobulin A short peptide that is v = Vmax[S]/([S] + KM) noncovalently bound to the class I major histocompatibility complex glycoprotein. microaerophile A microorganism that is neither aerobic or anaerobic but can grow microgram 0.000001, or 10–6 grams. under conditions of very limited oxygen. microheterogeneity Slight variation in microarray, cDNA A tool for analysis the nucleotide sequences of a repeated of patterns of gene expression in which unit of DNA. For example, the spacer the levels of gene products of a large num- regions in the histone genes are copies of ber of genes are assayed simultaneously. one another, but there is some slight vari- Microarrays consist of cDNAs (cDNA ation in their restriction fragment profi les microarrays), proteins, or antibodies to that is referred to as microheterogeneity. proteins (antibody microarrays) that are bonded to a solid substrate (such as glass, microinjection The injection of mate- plastic, or nylon membranes) in a regu- rials directly into individual cells using a lar array of spots. The arrays are reacted small glass micropipet. with labeled probes representing the pro- teins or RNAs present in a population of micromanipulator An instrument for cells or tissues and scanned to quantitate guiding extremely small instruments, the relative signal intensity corresponding for example, microinjection pipets and to probe bound to each spot. Computer microelectrodes into individual target analyses of signal intensities can generate cells under a microscope. gene expression profi les that can be used to characterize cellular responses to drugs, micron (m) 0.000001, or 10–6 meters. genes expressed in disease states, or genes involved in normal regulatory processes. microporous gels A chromatography matrix made up of cross-linked dextrans microbe A microorganism. Often used or polyacrylamide used to fractionate as synonymous with germ. proteins. micropropagation A technique used microcapsule A very thin version of the in plant breeding to produce many genetic capsule that covers the bacterial cell wall; a clones of the same plant. Small pieces of a gellike, largely polysaccharide matrix that plant are taken from a shoot tip, leaf, protects the bacterium from phagocytosis. lateral bud, stem, or root tissue and are grown in culture medium. Subculturing micrococcal nuclease An endonucle- of the buds or shoot is repeated many ase isolated from Staphylococcus aureus times until many plants are produced, all that cleaves DNA strands by breaking having the genetic characteristics of the the deoxyribose-phosphate backbone of original plant. DNA at the 5′ carbon atom. Micrococ- cal nuclease is sometimes used in place microsatellite markers A type of of DNase I for mapping protein binding marker, used in DNA fi ngerprinting, sites on DNA. See footprint. that is composed of short, repeat DNA
160 干细胞之家www.stemcell8.cn ←点击进入
milk agent
antigen and its corresponding antibody bind to one another. The test is carried out in a series of small wells in a plas- tic tray (microtiter tray) in which a fi xed endoplasmic amount of antigen (or antibody) is added reticulum to wells containing dilutions of a sam- ple of an unknown amount of the cor- responding antibody (or antigen). Semi- quantitative results are obtained as the highest dilution at which a precipitate mechanical disruption, can no longer be detected by eye. e.g., sonication microtome An instrument for creating extremely thin slices (sections) of biological specimens for microscopic examination.
microtubule Small tubules composed of a protein called tubulin that are attached to the centromeres of chromosomes and are responsible for the segregating move- ment of chromosomes during mitosis. microtubule-associated proteins (MAPs) resealed ER fragments (microsomes) A large class of proteins that is believed to stabilize microtubules by binding to Microsomes their tubulin subunits. Because MAPs can bind to several tubulin molecules at once, MAPs also accelerate the rate sequences interspersed throughout the at which microtubules are polymerized genome. See DNA fi ngerprinting. from the tubulin subunits. MAPs are also believed serve as a binding material that microsomes An experimental prepa- glues microtubules to other proteins and ration derived by fragmentation of the cellular structures such as the chromo- endoplasmic reticulum (ER); the small, some centromere. roughly spherical bodies consisting of bits of ER membrane that form spontaneously microvillus A fi ngerlike projection that when animal cells are broken. Micosomes is actually an actin fi lament–fi lled out- are categorized as either rough or smooth pocketing of the cell membrane. Because microsomes depending on whether they microvilli are especially abundant on are derived from rough or smooth ER. The absorptive cells such as intestinal epithelial experimental signifi cance of microsomes cells, microvilli are thought to function as stems from the fact that, whereas the intact a mechanism for increasing the absorptive ER itself is diffi cult to isolate, microsomes surface area of the cell membrane. are not and thus provide a convenient means of studying ER function. migration-inhibitory factor (MIF) A factor(s) produced by certain T cells after microspikes Very thin (0.1 μm diam- stimulation by an antigen that inhibits the eter × 5–10 μm long), actin-containing chemotactic response in macrophages. projections that protrude out of the mem- brane of cultured animal cells. mil The oncogene of the chicken sar- coma virus. Mil is believed to function as microtiter agglutination test A mi- a serine kinase. croscale test for the presence of an anti- body or an antigen that is based on the milk agent Mouse mammary tumor presence of a precipitate formed when an virus (MMTV), a retrovirus that causes
161 干细胞之家www.stemcell8.cn ←点击进入
milligram
cancers in mice. It was fi rst identifi ed as mismatch repair A type of excision the agent that causes cancers in suck- repair process that targets any region ling mice nursed by mothers carrying of DNA in which damage or mutation the virus and was among the fi rst tumor has resulted in a region where nucleotide causing viruses to be described. bases on complementary DNA strands are improperly paired with one another. –3 milligram 0.001, or 10 grams. In the bacterium Escherichia coli, mis- match repair involves the actions of the Milstein, Cesar (1927–2002) The re- genes, mutH, mutL, mutS, and mutU. See searcher who, together with Georges excision repair. Kohler, developed the technique of cre- ating hybridomas for the production of missense mutation A point mutation monoclonal antibodies by fusion of mouse that results in the replacement of one spleen lymphocytes with myeloma cells. amino acid with another in the protein This work won him the Nobel Prize in that is coded for by the gene in which the medicine in 1984. mutation occurs. minicells A daughter cell that is pro- mitochondrion A cytoplasmic organelle duced by cell division of a certain type that is responsible for the bulk of energy of bacterial mutant that lacks a chromo- production in eukaryotic cells. The mito- some. Because minicells lack the bacterial chondrion is the site at which the electron chromosome, minicells that are found to transport process and the Krebs cycle por- contain DNA have been used to study aberrations of DNA replication and the tions of sugar metabolism take place. properties of nonchromosomal DNAs mitogen Any agent, such as a growth such as plasmids. factor, that stimulates a cell to divide. minichromosome The nucleosome- One of a class of anti- bound form of polyoma or SV40 DNA mitomycin C that is found in the nuclei of the virus tumor antibiotics (the mitomycins) that infected cells. is isolated from the soil bacterium Strep- tomyces caispitosus. Mitomycin C exerts minimal medium A bacterial medium its antibiotic effects as an inhibitor of containing inorganic salts, inorganic DNA synthesis. nitrogen, and a simple sugar; the minimal requirements necessary to support bacte- mitosis The orderly parceling out of rial growth. Minimal medium was clas- replicated chromosomes to daughter cells. sically used for the detection of mutants See M phase. that were unable to synthesize an essential biochemical, for example, an amino acid mitotic apparatus A term used to or nucleoside. See defi ned medium. describe the mitotic spindle apparatus that consists of microtubule bundles minisatellite DNA Tandem repeats of a attached at one end to the centromere short core sequence. The number of repeats of the chromosome and at the other to varies greatly between individuals, and the the centriole located at one of the two lengths of the minisatellites have been used cell poles. as a characteristic in DNA profi ling. mitotic index The percentage of cells minisatellite variant repeat map- that are in mitosis at any given moment. ping A technique used in DNA profi l- ing in which not only the length of the mitotic recombination Crossing over minisatellite is analyzed but also the of chromosomal segments between ho- sequence variation, which may be only mologous chromosomes in a somatic cell. one base difference between individuals Such recombination is a normal event in that is examined. meiosis but occurs rarely in somatic cells;
162 干细胞之家www.stemcell8.cn ←点击进入
modafi nil
the recombined chromosomes are not percent of cases have mutations in MSH2 passed on to progeny. and about 60 percent of cases have muta- tions in MLH1. mitotic shake-off A method for ob- taining a cell-cycle synchronized popula- MN blood group A group of red tion of cells in tissue culture. The method blood cell surface glycoproteins (oligo- depends on the fact that cells engaged saccharide derivatives of the protein gly- in mitosis are not well attached to the cophorin) that form a blood group family, bottom of the tissue culture vessel; there- distinguishable on the basis of naturally fore, the subpopulation of cells that are occurring antibodies, which is distinct easily detached by light shaking are, for from the ABO blood group. the most part, those in mitosis. See syn- chronous culture. mobile genetic element(s) Insertional elements (IS). mitotic spindle The microtubule part of the mitotic apparatus. modafi nil A drug used to treat nar- colepsy in which its activity is based on MLH1, MSH2, and MSH6 Genes its ability to act as an agonist of recep- involved in hereditary nonpolyposis tors for a class of neuropeptides known colon cancer (HNPCC), a form of colon as orexins. Orexins stimulate wakeful- cancer with an early age of onset that is ness and mood by binding to receptors transmitted as an autosomal dominant. in a group of specialized neurons in the There is a high frequency of association lateral hypothalamus. Modafi nil is also with mutations in MLH1, MSH2, and currently being used to treat some of the MSH6, three genes that code for proteins symptoms of Alzheimer’s disease and involved in excision repair—about 35 depression.
Mitotic spindle
163 干细胞之家www.stemcell8.cn ←点击进入
molar
molar (M) The concentration of a solu- monoclonal antibody An antibody tion given as moles of the solute per liter produced by the daughter cells derived of solution. from a single antibody-producing cell.
mold The fi lamentous, multicellular monocotyledon A subclass of the subfamily of the fungi. higher plants known as angiosperms, characterized by the presence of a single, mole A measure of the amount of a par- as opposed to a double, seed leaf. ticular molecule such that 1 mole = 6.023 × 1023 molecules (Avagadro’s number). One monocyte A large leukocyte with pha- mole of a substance has a weight, in grams, gocytic properties. It is distinguished that is equal to its molecular weight. from other phagocytes by its size and the presence of small cytoplasmic granules. molecular evolution The fi eld of study devoted to establishing evolutionary monomer The single subunit of a poly- relationships between species by analy- meric molecule. sis of the relatedness (homology) of the A single, or simple, sequences of the nucleic acids or proteins monosaccharide sugar. A term generally referring to a sub- of different organisms. unit of a polyasaccharide. molecular genetics The study of the Morgan, T. H. (1866–1945) A genet- molecular basis of genetics; the structure icist whose classic studies on the genetics and function of the DNA sequences in of the fruit fl y, Drosophila melanogaster, genes and control of gene transcription confi rmed the Mendelian laws of transmis- and expression. sion of traits from parent to offspring and gave rise to the concept of the gene. He molecular symmetries In a macromol- was awarded the Nobel Prize in medicine ecule such as a protein consisting of iden- in 1933. tical multimers, a term applied to differ- ent arrangements of the subunits in such morphogenesis The developmental pro - a way that the resulting structure can be cess by which an appendage, limb, or divided into identical halves along an axis. organ comes to assume a specifi c form and Multimeric proteins can display a number structure. of different types of symmetry, including rotational, helical, cyclic, dihedral, and morphogens Certain factors of mater- icosohedral. nal origin that are present in an egg that help to determine the location where molecular weight A measure of the limbs and other structures of the mature mass of a molecule based upon a system organism will appear in the developing where the mass of the hydrogen atom is embryo. taken as 1 and all other atoms are then assigned a molecular weight relative to morphology The study of morphogen- hydrogen. See dalton. esis.
molecule Any group of covalently mosaicism The property of a tissue bonded atoms. being a mixture of clonal populations of cells. By the Lyon effect, only one molt In arthropods, a shedding of the X chromosome of the pair will be outer covering (the exoskeleton) during expressed in any one cell lineage; there- maturation to accommodate growth of fore, the presence of cells with different the body. X chromosomes activated in a cell popu- lation indicates that the cell population monocistronic RNA A bacterial mRNA is a mixture of cell clones. Conversely, that codes for a single protein. the presence of cells in which the same
164 干细胞之家www.stemcell8.cn ←点击进入
mutagen
X chromosome is always active indicates also the centrosome in most cells, serves that the cell population is of clonal ori- as a nucleation center for the polymeriza- gin. This type of analysis has been used tion of microtubules. to demonstrate that most tumors prob- ably derive from a single cell. MuD phage A variant of the bacterio- phage, Mu that has been engineered as a mos oncogene An oncogene that is vector to be used for the determination of found in a retrovirus that causes sarcoma promoter activity using the beta-galacto- tumors in mice. The name is an acronym sidase gene as a reporter gene. derived from: moloney sarcoma virus. multidrug-resistant gene Genes that MPF Maturation-promoting factor; a confer resistance to the lethal effects factor isolated from the cytoplasm of of certain drugs, particularly chemo- progesterone-stimulated Xenopus laevis therapeutic agents, for example, metho- oocytes that was shown to stimulate mei- trexate. Multidrug-resistant genes arise otic cell division in unstimulated oocytes through massive amplifi cation of a single when microinjected into the cytoplasm. copy gene and are present in homog- The maturation-stimulating factor in enously staining regions or double minute MPF was later shown to consist of a chromosomes. cyclin B-cdk complex. multilocus probes (MLP) A tech- M phase The period of the cell cycle nique used in DNA profi ling in which covering mitosis. M phase is divided into the DNA from an individual, blotted to fi ve subphases: prophase, prometaphase, a membrane (see Southern blot), is metaphase, anaphase, and telophase. mixed with a probe under conditions that will allow it to bind not only to the target A protein M-phase promoting factor but also to similar sequences as well. factor isolated from eggs of the frog, Xen- opus laevis, that forces cells at any stage multinucleate Having more than one in the cell cycle into mitosis (M phase). nucleus within the same cytoplasm. See msr, msd Loci that code for an unusual heterokaryon and syncitium. RNA-DNA hybrid molecule in which RNA transcribed from msr is covalently mung-bean nuclease An enzyme that linked to msd DNA. This type of struc- catalyzes the breakdown of single- ture was fi rst discovered in myxobacteria stranded DNA into single nucleotides and but has also been discovered in the soil short oligonucleotides that have phos- bacterium Stigmatella aurantiaca. phate groups on their 5′ ends.
mtDNA Mitochondrial DNA. murine Of or pertaining to the genus Mus, which includes mice, rats, and other MTF-1 Metal-regulatory transcription rodents. factor 1; a zinc fi nger transcription factor that is activated by various heavy metals murine leukemia virus (MuLV) A such as zinc, cadmium, and copper but retrovirus that causes leukemia in mice also by stressors such as oxidative stress and that carries the abl oncogene. and hypoxia. MTF-1 activates a number of genes, including metallothionein genes murine sarcoma virus Also known as and other target genes. the Moloney sarcoma virus, the retrovi- rus that carries the mos oncogene. MTOC Microtubule organizing center; an amorphous mass to which microtu- mutagen Any chemical, physical, or bules are found to be attached in a “hub- biological agent that causes permanent, and-spoke”–like structure in the cytosol heritable alterations in the sequence of of interphase cells. The MTOC, which is bases in DNA.
165 干细胞之家www.stemcell8.cn ←点击进入
mutagenesis
mutagenesis The process of introducing required for hematopoietic cell prolifera- mutations by exposing cells to a mutagen(s). tion. The human myb gene is located at 6q22-23. mutagenesis, site-directed A tech- nique for introducing specifi c changes myc The oncogene carried by the avian in base sequence in a cloned segment of leukosis retrovirus that causes a type of DNA, usually by replacing a portion with leukemia in birds. The human myc proto- a synthetic oligonucleotide. oncogene encodes a nuclear transcrip- tion factor. Activation of the myc gene by mutagenesis in vitro Mutagenesis translocation to regions of chromosomes of cells in culture that may differ from 2, 14, or 22 causes a type of leukemia mutagenesis using the same mutagen in known as Burkitt’s lymphoma. The myc the intact organism in terms of the type gene is located on chromosome 8q24.12- q24.13. and number of mutations. mycelium A mass of hyphae. mutations, somatic Mutations that occur in the cells of the body as opposed mycobacteria A group of rod-shaped to the germline, or reproductive cells. acidophilic bacteria that includes the bac- Somatic mutations are not passed on to teria that cause leprosy and tuberculosis. an organism’s offspring, whereas germ- line mutations are. mycology The study of molds (fungi).
mutator loci Genes whose function is mycoplasma The smallest indepen- associated with the fi delity of DNA syn- dently growing organisms known. Myco- thesis; for example, plasmas were isolated and characterized mutD = subunit of DNA polymerase III on the basis of their role in causing a type mutU = DNA helicase of pneumonia. Mycoplasmas are also mutY = endonuclease that cleaves mis- known as PPLO (pleuropneumonia-like matches between A and G organisms).
mutator phenotype A strong tendency mycotoxin Any toxic substance pro- to undergo mutation. The mutator phe- duced by a fungus or mold. Among the notype is expressed by any organism that mycotoxins that have been used in molec- carries a mutation in a gene involved in ular biological research are muscarine, maintaining the fi delity of DNA synthesis. phalloidin, ergotamine, and various anti- biotics.
muteins Modifi ed therapeutic proteins myelin A class of lipids that comprise with improved or novel biological activi- the outer sheath that surrounds the axon ties that have been produced by mutagen- of neurons. In this location, it serves as esis in the lab. an electrical insulator without which nerve impulses could not be propagated. myasthenia gravis An autoimmune disease of the nervous system charac- myelin basic protein (MBP) A small terized by a progressive paralysis of the (20 kDa) protein that is the most abun- motor nerves. The disease is caused by dant component of the myelin sheath of the formation of antibodies to one’s own the neurons of the central nervous sys- neurotransmitter receptors that act at the tem. MBP is believed to play an important neuromuscular junction. role(s) in assembly and stabilization of the myelin sheath. There are at least six iso- myb The oncogene carried by the avian forms of MBP: C1, C2, C3, C4, C5, and myeloblastosis virus that causes myelo- C6. Tests that measure the level of MBP blastic leukemia in chickens. The human in the cerebrospinal fl uid (CSF) are used proto-oncogene (c-myb) codes for a tran- as indications of disease states involving scription factor that is believed to be breakdown of the myelin sheath.
166 干细胞之家www.stemcell8.cn ←点击进入
myxovirus
Actin and myosin fi laments in muscle
myeloid cell The collective term for all myoD One of a family of proteins, classes of blood cells, not including T and referred to as myogenic proteins, that B lymphocytes; that is, all bone marrow– induces cells to differentiate into muscle derived blood cells. cells. myoD exhibits the helix-loop-helix motif characteristic of certain transcrip- myeloma A tumor of the antibody tion factors and is believed to act, at least secreting lymphocyte cells. Also known in part, by inducing the transcription of as plasmacytoma. another mygenic gene, myogenin.
myeloma proteins An antibody mole- myoglobin The protein that carries and cule of the Ig class secreted by a myeloma exchanges oxygen for CO2 in muscle tis- tumor. Each myeloma antibody repre- sue. Like hemaglobin, myoglobin carries sents the specifi city of a single antibody oxygen on a heme group attached to a sin- cell (monoclonal antibody). gle polypeptide (globin), but, unlike hema- globin, is present only as a monomer. myoblast Embryonic cells that fuse with one another to form mature muscle myosin One of the two contractile pro- cells. teins of muscle. Myosin bundles interdigi- tate with actin bundles, and muscle con- myoclonic epilepsy and ragged-red traction is the result of the two proteins fi ber disease (MERRF) A maternally sliding over one another. inherited disorder of muscle functioning caused by a mutation in the gene that myxobacteria Bacteria that normally encodes lysyl tRNA, which in turn leads live in the soil as individual cells but that, to malfunctioning of a number of other under conditions where nutrients become important proteins in mitochondria (mi- limiting, form multicellular aggregates sim- tochondrial encephalomyopathy) that impair ilar to primitive multicellular organisms. the functioning of the electron transport chain. The disorder is characterized by myxovirus A class of viruses that was myoclonic seizures, ataxia, speech dif- identifi ed and characterized on the basis fi culty (dysarthria), hearing loss, and of their role in causing infl uenza. Myxo- dementia. Biopsies of muscle show viruses are divided into two families: ragged-red fi bers. orthomyxoviruses and paramyxoviruses.
167 干细胞之家www.stemcell8.cn ←点击进入
NA
NAD, NAD(P) Nicotamide adenine National Center for Biotechnology dinucleotide (phosphate). A cofactor for Information (NCBI) Created as a enzymes involved in oxidoreductions and national resource for molecular biology electron transfer in numerous biochemi- information, this center creates public cal reactions, but particularly those databases and conducts research in com- involved in the oxidative metabolism of putational biology. sugars for energy production. NAD is a combination of two nucleo tides, one National Human Genome Research of which is derived from the B vitamin Institute (NHGRI) An institute of niacin. the National Institutes of Health created to head up the Human Genome Project. It supports not only large-scale sequenc- ing and analysis of the human genome but also comparative genome projects, genome informatics, and programs that anticipate and address the ethical, legal, and social issues that arise as the result of human genome research.
native conformation The three- dimensional shape that a biomolecule naturally assumes in its normal biological environment. NAD (nicotamide adenine dinucleotide) natural killer cells A type of thy- mocyte (T lymphocyte) found in the nalidixic acid A synthetic antibiotic spleen that is responsible for a particular that mimics the action of the natural immune response to various tumor cells. antibiotic novobiocin. N-CAM Neural cell adhesion mol- ecule; a protein present on the surface of NANA N-acetylneuraminic acid. The neurons that causes them to aggregate. molecule attached to a glycoprotein N-CAM is expressed at specifi c times that forms the red-blood-cell membrane during development suggesting that it receptor for infl uenza virus that accounts plays a role in the development of neural for the ability of the virus to cause hem- structures such as ganglia. agglutination. Neuraminidase cleaves off the NANA residue, thereby inactivating nebulin A large fi lamentous actin- the receptor. binding protein in the muscle sarcomere that is believed to maintain the actin fi l- nanogram 0.000000001, or 10–9 grams. aments at a uniform distance from the myosin containing thick fi laments and nascent protein A polypeptide in the that also may help to determine the length process of being synthesized on ribosomes. of the actin fi laments.
168 干细胞之家www.stemcell8.cn ←点击进入
neuropeptideverso Y
negative complementation The sup- causes selective outgrowth of sensory and pression of a normal gene by a mutant of sympathetic neurons. NGF is essential for that gene. proper growth and survival of these types of neurons during development. negative regulation (negative regulators) A term applied to regulation of gene expres- nested deletion A deleted region of a sion based on repression rather than stimu- nucleic acid that occurs within a region lation of gene expression. In negative regu- covered by a second, larger deletion of the lation, the target gene is normally expressed same nucleic acid. The smaller deletion is to its maximal extent, and under appropri- said to be nested within the larger deletion. ate environmental conditions, expression is controlled by lowering its level of expres- neu oncogene An oncogene isolated sion. See lac operon. from rat cells by transfection into 3T3 cells. neu is not carried by a retrovirus negative selection The selection of and is apparently activated by a point cells or organisms within a population mutation of the proto-oncogene form of that expresses a desired trait by elimina- neu. The neu sequence is homologous to tion of members of the population that do the erb-B oncogene. not express the trait. Negative selection is commonly used to select microorganisms neuraminidase A glycoprotein present that express a gene such as resistance to as a spike on the outside of the infl uenza an antibiotic that allows them to survive virus envelope. Neuraminidase acts to in the presence of that antibiotic while break down an inhibitor of the infl uenza other microorganisms that do not have, virus hemagglutinin (HA) protein. or express, the gene are eliminated. See HAT selection. neuroblastoma Cancerous growth of the neuroblast cells, or the cells of the neomycin A synthetic antibiotic derived developing embryo that go on to form the from streptomycin. Neomycin and other nervous system. related antibiotics act on the ribosome to inhibit bacterial protein synthesis. neurofi lament proteins Three pro- teins that are the subunits of the neuro- neoplasia Any abnormal growth of an fi laments, a type of intermediate fi lament adult tissue. found in neurons. The function of neuro- fi laments is unknown. Nernst equation An equation that relates the free energy change for a given neuron The brain cell type that car- reaction ries the nerve impulses involved in higher + R1+R2+R3+. . . Rn------> thought and movement. P1+P2+P3+. . .+Pn (where Ri represents a reactant and Pi neuropeptide Any of a class of short represents a product) to the concentra- polypeptides that function as neurotrans- tions of the reactants and products: mitters. Thyrotropin-releasing hormone ° ΔG = ΔG + 2.303RT × log([R1][R2]. . . (TRH) and luteinizing hormone–releasing [Rn])/([P1][P2]. . .[Pn]) hormone (LHRH), which act to trigger and the release of hormones from the pituitary R = universal gas constant gland are examples of neuropeptides. T = temperature in degrees Kelvin ΔG° = a constant for a given reaction neuropeptide Y (NPY) A small (36 amino acid) peptide neurotransmitter nerve growth factor (NGF) A fac- that potentiates the effects of noradrener- tor, originally isolated from a tumor gic neurons in causing vasoconstriction. transplanted into a chicken embryo, that NPY binds to six classes of receptors, Y1,
169 干细胞之家www.stemcell8.cn ←点击进入
rectoNeurospora
Y2, Y3, Y4, Y5, and Y6. NPY binding aminobutyric acid (GABA; arousal relax- to the Y3 receptor inhibits catecholamine ation), and serotonin (mood). synthesis while the Y2 subtype causes inhibition of catecholamine release. NPY neutral substitution A change in a release stimulates appetite in a region nucleotide base in the coding region of of the hypothalamus called the arcurate a gene that does not produce a change in nucleus. The gene for NPY is located at the activity of the protein. gene map locus 7p15.1. neutrophil One of the three subclasses Neurospora A genus of mold that has of white blood cells known as granulo- been used as a tool in genetic experiments cytes, also known as polymorphonuclear because it is normally haploid and because leucocytes (PMNs). Neutrophils contain it forms a structure (the ascus) from which large multilobed nuclei and phagocytose single-celled spores can be readily isolated. small invading organisms such as bacteria. Neurospora crassa was the organism origi- nally used to demonstrate that genes coded nick A gap in the sugar-phosphate for individual proteins. backbone of a nucleic acid.
neurotransmitter A type of chemical, nick translation A technique for label- usually a small organic molecule, released ing double-stranded DNA fragments to be from the terminal button of an axon of used as hybridization probes. DNA poly- one neuron that induces a nerve impulse merase is used in the presence of labeled in an adjacent neuron when it binds to a deoxyribonucleotides to fi ll in nicks pro- specifi c receptor in the dendritic membrane duced by treatment with low levels of the of the second neuron. Different neurotrans- endonuclease DNase I. mitters are associated with different neural functions, e.g., dopamine (movement and nicotinic receptors One of the two mood), acetylcholine (movement), gamma types of cholinergic receptors in brain
double-stranded DNA
single-stranded nicks
Nick translation
170 干细胞之家www.stemcell8.cn ←点击进入
nondisjunctionverso
cells; named because of its sensitivity to a variety of biological materials, includ- nicotine. ing proteins and nucleic acids. Because of this property, nitrocellulose is widely ninhydrin A chemical that forms a used as a binding material for carrying purple pigment after reacting with amino out colony and plaque hybridizations and groups. This reaction is used in the detec- Southern, northern, and western blots. tion and quantitation of proteins. nitrogen cycle The global process of ninjurin Nerve injury-induced protein; nitrogen recycling. The nitrogen cycle a protein that is upregulated after nerve involves the breakdown of organic mate- injury in neurons of the dorsal root gan- rials with the liberation of ammonia glion in Schwann cells. It has properties and other inorganic nitrogen-contain- similar to other biomolecules that serve ing compounds. Ammonia is converted as adhesion molecules and is believed to into nitrates and nitrites and then into play a role in nerve regeneration. The gene nitrogen gas by soil bacteria. Atmo- that encodes ninjurin is NINJ1, located spheric nitrogen is then converted back at gene map locus 9q22. A second gene into ammonia by nitrogen-fi xing bacte- that codes for the protein ninjurin-2 is a ria associated with the roots of certain homologue of ninjurin that contains the plants, thereby completing the cycle. same transmembrane region as ninjurin but does not contain the same adhesion nitrogen fi xation The process by motifs. Ninjurin-2 shows the same nerve which nitrifying bacteria convert nitro- injury-induced upregulation as ninjurin. gen gas in the atmosphere into ammonia. Nitrogen fi xation utilizes two systems: (1) Nirenberg, Marshall (b. 1927) A the reductase that generates electrons and biochemist who carried out the fi rst exper- (2) the nitrogenase that uses the electrons iments using synthetic oligoribonucleo- generated from the reductase to reduce tides that ultimately led to the decipher- nitrogen (as N2) to ammonia (NH3). ing of the genetic code by others using variations of the technique pioneered by NMDA receptor A specialized type of Nirenberg (see Khorana, Har Gobind). glutamate receptor on the postsynaptic He was awarded the Nobel Prize in physi- membrane of neurons that is known to ology and medicine in 1968. mediate long-term potentiation, a process involved in memory. NMDA is derived nitrifying bacteria Bacteria that carry from N-methy-D-aspartate, a synthetic out the process by which nitrogen gas in glutamate analog used to study this the atmosphere becomes converted into receptor. ammonia. This is the only means by which nitrogen can become incorporated into bio- NMR See nuclear magnetic resonance. logically useful molecules such as proteins and nucleic acids. See nitrogen fi xation. nonautonomous controlling ele- ments Defective transposons that are nitro-blue tetrazolium (NBT) A chem- unable to transpose but that can do so ical that forms a blue precipitate when cer- when a normal transposon is also present. tain substrates are acted upon by alkaline phosphatase. For this reason, NBT is used noncompetitive inhibition Inhibition as a colorimetric indicator in techniques of enzymatic activity by a substance that that utilize alkaline phosphatase labels. acts at site on the enzyme different from See alkaline phosphatase. the active site.
nitrocellulose fi lter A thin fl exible nondisjunction An error of chromo- membrane made of nitrocellulose, a mate- some segregation during cell division rial that noncovalently binds tightly to (either meiosis or mitosis) in which the
171 干细胞之家www.stemcell8.cn ←点击进入
rectononessential amino acid
daughter chromosomes (sister chroma- TAG, or TGA). This type of mutation tids) fail to move to opposite poles. causes premature termination of synthe- sis of the protein in which it occurs. nonessential amino acid An amino acid that can be synthesized from other nonsense suppressor A mutant tRNA amino acids or other precursors. For this that permits the placement of an amino reason, the nonessential amino acids, in acid in a polypeptide when one of the contrast to the essential amino acids, can nonsense codons is encountered during be omitted from the diet without causing translation of an mRNA. Such tRNAs death. can reverse the effects of nonsense muta- tions (suppressor effects). nonheme iron Iron atoms that are found in iron-sulfur proteins as opposed nontranscribed spacer See spacer DNA. to heme groups. The iron-sulfur proteins are electron carriers in the process of noradrenaline (norepinephrine) A electron transport. chemical that is both a neurotransmitter and a hormone released by the adrenal nonidet P40 (NP40) A nonionic deter- glands. As a neurotransmitter, noradren- gent (octylphenyl-ethylene oxide) that aline acts on certain neurons of the sym- selectively breaks open the plasma mem- pathetic nervous system. As a hormone, brane in animal cells but not the nuclear noradrenaline acts on cells of the liver membrane. For this reason, NP40 is often and muscle to stimulate both sugar mobi- used for rapid isolation of nuclei and lization and storage. cytoplasmic fractions of cells.
nonpermissive cell A host cell type that can become infected by a particular virus but does not support its replication. For example, monkey cells are permissive for SV40 virus but mouse cells are non- permissive for SV40.
nonpolar group A small group of Noradrenaline (norepinephrine) atoms held together by linkages where electrons are more or less equally dis- tributed among the constituent atoms so northern blot An analytical tech- that the linkages have no polar character. nique in which RNA is run on an aga- Such groups are important in biological rose gel, blotted onto a membrane where systems because they are not soluble in it is hybridized to a specific probe. This water. technique is particularly useful as a means of detecting the expression of a nonreciprocal recombinant chromo- particular mRNA. See hybridization somes The result of recombination and blot. between misaligned chromosomes such that a gene on one chromosome receives NOS Nitric oxide synthase; a group of a duplication of part of the gene, while enzymes that catalyze the formation of the copy of that gene on the other chro- nitric oxide (NO) from L-arginine. NO mosome suffers a deletion of the same acts as a neurotransmitter in the brain material. and as a signaling molecule in endo- thelial cells that induces vasodilation, nonsense mutation A mutation that platelet aggregation, and cardiovascular causes a normal codon to change into one homeostasis. NOS is designated bNOS of the three termination codons (TAA, (brain) or nNOS (neuronal), and there
172 干细胞之家www.stemcell8.cn ←点击进入
nuclear membraneverso
are two forms produced by endothelial genes involved in nitrogen metabolism cells: eNOS, which is constitutive, and under conditions of nitrogen defi ciency an inducible form designated iNOS. The in bacteria. When nitrogen-containing activity of NOS in both the brain and compounds in the bacterial medium drop endothelium requires binding of the cal- to low levels, the NtrB protein becomes cium/calmodulin complex and is regu- activated; the activated form of NtrB is lated by calcium levels. responsible for phosphorylation of NtrC protein that stimulates the gene transcrip- notch protein A transmembrane sig- tion. See nitrogen fi xation. nal transduction protein that functions in development of the Drosophila nervous nuclear lamina A thin matrix com- system. Binding of critical ligands to the posed of dense fi laments just beneath the extracellular domain (receptor region) envelope that surrounds the cell nucleus. of notch is believed to result in selection of the cell carrying the bound ligand for nuclear lamins The intermediate fi la- development as a sensory organ cell. ments that comprise the nuclear lamina.
novobiocin An antibiotic produced by nuclear localization signal (NLS) A Streptomyces niveus. Novobiocin acts by sequence of amino acids in some pro- preventing ATP binding to the enzyme teins that serves as a signal for their DNA gyrase, thereby stopping DNA syn- import into the nucleus. After synthesis thesis in the infectious bacteria. of a nuclear protein in the cytoplasm, it NSAIDs Nonsteroidal anti-infl ammatory is actively transported through nuclear drugs; a class of anti-infl ammatory drugs pore complexes through a process that that block the formation of the pro- involves the Ran GTPase. Most of the infl ammatory prostaglandin hormones by NLSs are rich in basic amino acids (e.g., inhibiting a critical step in the synthesis of lysine or arginine). prostaglandins that is mediated by activ- ity of enzymes known as cyclooxygenases nuclear magnetic resonance (NMR) (COXs). The popular NSAIDs aspirin, acet- A type of spectroscopy based on the mag- aminophen, ibuprofen, celecoxib (Cele- netic properties of atoms. In this tech- brex), rofecoxeb (Vioxx), and naproxen nique, a compound is placed in a magnetic are all COX inhibitors. As suggested by fi eld, and the energy (i.e., the electric cur- their name, these agents provide an alter- rent required to create a certain magnetic native to steroid anti-infl ammatory drugs fi eld) required to change the magnetic ori- that often have debilitating side effects. entation of individual atoms, usually only the hydrogen atoms, is measured. Because NSF A tetrameric cytosolic protein that the electric environment of different atoms mediates the fusion of a transport vesicle differs from one another depending upon and a vesicle of the Golgi. the other atoms to which it is attached, each compound gives a different “fi n- NTG An acronym for neomycin, thy- gerprint” (spectrum) of fi eld strengths at midine kinase, glucocerebroside. which individual atoms reorient in the magnetic fi eld. In biological preparations, NTG vector A mammalian expres- the absorption characteristics of a mole- sion vector that combines the enhancer/ cule is infl uenced by its three-dimensional promoter activities of the long terminal structure and the biochemical environ- repeats (LTRs) from the Moloney murine ment that can be revealed by the NMR leukemia virus with the bacterial-derived spectrum of a biochemical sample. neomycin resistance gene (neor) as a select- able marker. See APH. nuclear membrane (nuclear envelope) A double-walled membrane that forms the NtrB, NtrC proteins Regulatory enclosure surrounding the nuclear com- proteins in the control of expression of partment. The outer membrane is joined
173 干细胞之家www.stemcell8.cn ←点击进入
rectonuclear pore complex
to and may actually be thought of as part numerous loops of chromatin-bound DNA of the endoplasmic reticulum. that contains clusters of tandemly repeated ribosomal RNA genes. The nucleolus is nuclear pore complex An octagonal therefore the structure responsible for the array of large protein granules that sur- production of rRNA and is continually round pores that perforate the double-lay- engaged in high levels of synthesis of rRNA. ered nuclear membrane at various points. The nuclear pore complex is a special- nucleophilic group Any cluster of ized channel through which nucleic acids covalently linked atoms that tends to and other materials shuttle between the donate electrons in a chemical reaction. nucleus and the cytoplasm. Nucleophilic groups often initiate impor- tant biochemical reactions by attacking nuclear scaffold A fi brous network electron-defi cient carbon atoms that are that extends from the inside of the nuclear attached to oxygen atoms. membrane and is distributed all through- out the nucleus and that is attached to the nucleoplasmin An acidic nonhistone cellular DNA at specifi c sites. The nuclear protein that binds to histones H2A and scaffold is seen by electron microscopy in H2B during histone assembly with free isolated nuclei that are carefully treated DNA to form nucleosomes. with nucleases and either salt or detergents to remove histones, some nonhistone pro- nucleoprotein particles Complexes of teins, and the free (i.e., unattached) DNA protein and RNA, primarily in the nucleus, strands from the chromatin. The function that play a role in the processing of RNA. of the nuclear scaffold is unknown but is believed to play a role similar to the chro- nucleor organizer region A cluster matin itself in control of gene expression. of rRNA genes on a DNA loop in the nucleolus. nuclear transplantation A technique for removing the nucleus from one cell nucleoside A ribose or deoxyribose and placing it into the foreign cytoplasm molecule that is attached to any purine or of a second cell (i.e., an enucleated cell). pyrimidine base via the fi rst carbon atom of the sugar. The common nucleosides Any of a class of enzymes nuclease that are found in DNA and RNA are: that catalyze the breakdown of a nucleic (deoxy-) adenosine, (deoxy-) cytidine, acid(s) by cleavage of the phosphodiester (deoxy-) guanosine, thymidine (deoxy- bonds of the sugar-phosphate backbone. form only), and uridine. nucleic acid A molecule of either DNA or RNA. nucleoside antibiotic An antibiotic that is a nucleoside containing an ana- nucleohistone (histone) Any of the fi ve log of a purine or pyrimidine base. These different proteins that make up a nucleosome, antibiotics act by inhibiting the normal designated: H2A, H2B, H3, H4, and H1. mechanisms of DNA and RNA synthesis in rapidly growing microorganisms. The nucleoid body The analog of the nucleoside antibiotics (e.g., cytosine ara- nucleus in bacteria. The nucleoid body, binoside), unlike other types of antibiot- which contains the bacterial genomic ics, are active against viral infections. DNA, is not enclosed in a membrane, and the DNA is not complexed with chromatin nucleosome An octameric structure but is distinguishable as a large centrally that is complexed around a strand of located mass that appears less dense than DNA. Nucleosomes are evenly spaced the surrounding cytoplasm. along the DNA strand, forming a linker (nonhistone-complexed) region of 142 nucleolus A large structure within the base pairs. Nucleosomes are composed of nucleus of eukaryotic cells consisting of two each of the different “H” histones 174 干细胞之家www.stemcell8.cn ←点击进入
nystatinverso
the third carbon of the ribose or deoxyri- bose sugar. Nucleosomes nucleus The central, membrane-enclosed H2A H2B structure that contains the cell DNA x2 in the form of chromatin in eukaryotic H3 H4 cells. DNA strand histone core H2A H2B null DNA The DNA that represents H3 H4 genes that are only expressed in single cell or tissue type. Null DNA is presumed to represent genes for specialized proteins that are unique to a specifi c cell type, for linker DNA example, hemoglobin genes in red blood cells.
null mutation The result of a muta- tional event that results in the complete and are believed to play a role in regu- elimination of a gene. lating the expression of the genes with which they are complexed. nurse cell Accessory cells in the ovary that surround an oocyte and supply a nucleosome phasing A model of nucleo- variety of macromolecules and nutrients some structure in which a certain DNA to the oocyte via cytoplasmic bridges. sequence is always located at a certain posi- Ribosomes, mRNAs, and proteins are tion on the nucleosome. If this can be shown passed to insect oocytes in this way. to be true, it implies that some mechanism exists for aligning nucleosomes with certain nystatin An antibiotic with a polyene sequences on the DNA in the nucleosome structure (i.e., containing many carbon- complex. carbon double bonds) that is active against fungal infections. Nystatin is nucleotide A nucleoside with a phos- active against Candida infections when phate group attached either to the fi fth or applied topically.
175 干细胞之家www.stemcell8.cn ←点击进入
O
O-antigen A branched polysaccharide oligotrophic An environment in which attached to a specifi c lipid (lipid A) on the nutrients are in low abundance. outer surface of the cell envelope of the patho- genic bacterium Salmonella typhimurium onc function The property acquired and other Gram-negative bacteria. by a proto-oncogene of inducing a can- cer or promoting tumorigenesis when it obligate anaerobe Bacteria that have becomes an oncogene. an absolute requirement for oxygen and are not fermenting (e.g., tuberculosis). oncogene The activated form of a proto-oncogene. Mechanisms by which ochre codon The nonsense codon TAA proto-oncogenes become activated include that is a signal for termination of poly- transduction by a retrovirus, mutation, peptide synthesis. and chromosomal translocation whereby the proto-oncogene is placed into a new ochre mutation Any mutation that genetic environment. produces an ochre codon in place of a codon for an amino acid. oncogenic Pertaining to any agent— chemical, physical, or biological—that ochre suppressor See ochre codon, causes cells to undergo changes charac- ochre mutation, suppressor gene, sup- teristic of cancer cells. presor mutation, suppressor tRNA. oncogenic virus Any of a broad range Okazaki fragment A short (1,000– of viruses that cause cells to undergo 2,000 bp) DNA fragment produced changes characteristic of cancer cells or during DNA replication of the lagging to cause tumors in animals. See onco- (5′ terminating) strand of the template gene and RNA tumor virus. DNA. Okazaki fragments are initiated by a short RNA primer that is hybridized oncostatin M (OSM) A cytokine that to the lagging strand and then destroyed regulates growth of both normal and after synthesis of the Okazaki fragment is tumor cells although in a cell-type specifi c complete. See lagging strand. manner. OSM is a glycoprotein about 28 kDa in size that was originally isolated on oligonucleotide A short strand of either the basis of its ability to inhibit the growth DNA or RNA with a length in the range of A375 melanoma and other tumor cells of two to about 30 bases. The term gener- while stimulating the growth of normal ally refers to synthetic polynucleotides. human fi broblasts. The oncostatin M receptor (OSMR) is coupled to the JAK/ oligopeptide A polypeptide of any- STAT signal transduction pathway. The where between approximately two and OSM gene is located on chromosome 10 amino acids. 22q12. OSM belongs to the same family of cytokines as interleukin-11 (Il-11), leu- oligosaccharide A chain of sugars con- kemia inhibitory factor (LIF), interleukin-6 taining anywhere between approximately (Il-6), ciliary neurotrophic factor (CNTF), two and 10 monosaccharide subunits. and cardiotrophin-1 (CT-1).
176 干细胞之家www.stemcell8.cn ←点击进入
orthophosphate
ontogenetic Of or pertaining to ontog- optical density The property of ab- eny, the complete life cycle or process of sorption of light by a solution of any development of an organism. given substance. The decrease in intensity of a light beam at a certain wavelength oocyte The diploid germ cells of the as it passes through a solution over a cer- female that generate gametes (eggs) by tain distance is proportional to the molar meiotic division. concentration of the solution. See Beer- Lambert law. oogamy The union of gametes to pro- duce an embryogenic cell, as in fertiliza- organelle Any subcellular, membrane- tion of an egg by fusion with sperm. enclosed structure in the cytoplasm of a eukaryotic cell that carries out a specifi c oogenesis The process by which cellular function, for example, mitochon- the mature egg(s) is generated from an dria, chloroplasts, endoplasmic reticu- oocyte. lum, and Golgi. oogonium (oogonia, pl.) The female ornithine An intermediate in the urea reproductive organ in which the eggs are cycle, the series of reactions in which formed in thallophyte plants. nitrogen in the form of urea is formed. Ornithine is derived from the amino acid ooplasm The cytoplasm of an egg cell, arginine through the loss of urea. or oocyte. orotic acid A pyrimidine base, derived open reading frame (ORF) Any from carbamoyl phosphate and aspartate, nucleic acid segment whose codons spec- that is the common precursor of CTP ify a continuous polypeptide; a nucleic and UTP, the triphosphate nucleotides of acid sequence with a start codon. cytosine and uracil. operator A portion of the promoter Orphan Drug Act An act of Con- in an operon that acts as a regulator gress directed toward rare human dis- of expression of the operon by serving eases (defi ned as having a prevalence of as a site for the binding of a repressor protein. less than 200,000 cases) that grants, as an incentive, a seven-year period of mar- operon A cluster of contiguous bacte- keting exclusivity to the developer(s) of rial genes all under the control of a single therapeutic drugs. promoter. The genes in an operon gener- ally code for enzymes that catalyze steps orphons Genes that are members of a in one biosynthetic pathway, for example, gene family but are in distant locations. the synthesis of an amino acid. ortholog Genes in different species that opiate Any of the chemical derivatives were all derived from a common ancestral of opium. gene. Normally, orthologs retain the same function in the course of evolution. For opines Unusual amino acids synthe- this reason identifi cation of an unknown sized in plants infected by the T DNA gene as an ortholog of one whose func- portion of the Ti plasmid of the parasitic tion is known is an important means of bacterium Agrobacterium tumefaciens. prediction of gene function. The opines include octopine, nopaline, and mannopine. orthophosphate Any salt of ortho phos- phoric acid (H3PO4); the name given to opsonization The process by which an phosphoric acid that has been stripped of antibody is taken up by a phagocyte in one or more of its hydrogen atoms as the the presence of complement. result of its being placed in aqueous solu-
177 干细胞之家www.stemcell8.cn ←点击进入
osmolality
loose joints, bruising, hearing loss (caused by problems with the bones of the middle ear), and scoliosis. The affected genes are the collagen genes COL1A1 and COL1A2. The mutations in the COL1A1 gene tend to reduce the amount of collagen produced, Orthophosphate while, less commonly, mutations in either COL1A1 or COL1A2 alter the structure of the collagen proteins making the colla- tion. Orthophosphate is the form of phos- gen fi bers weaker. The genes are located on phorous that is present in most important human chromosome 17 at gene map loci phosphorous-containing biomolecules, for 17q21.31-q22, 7q22.1. example, nucleic acids. oubain A toxic glycoside that specifi - osmolality The concentration differ- cally inhibits the Na+–K+ ATPase. The ence between osmotic compartments as use of this inhibitor provided important measured by molality; a 1-molal solution information that helped elucidate the is defi ned when one mole of the solute is functioning of the ionic pump. dissolved in 1,000 grams of the solvent.
osmosis The spontaneous diffusion oxic Referring to an aerobic microbial of a substance from a compartment of habitat. relatively high concentration to a com- partment of relatively low concentration oxidative phosphorylation The for- where, generally, the two compartments mation of ATP from ADP (+ phosphate) are separated from one another by a semi- using the energy of the electron transport permeable membrane. Many nutrients and process to drive the reaction. other substances of biochemical impor- tance enter into or pass out of cells by oxidizing agent Any chemical agent osmosis. that takes electrons, either as electrons or as electron-rich atoms, from another osmotic pressure A pressure produced chemical with which it reacts. on the side of a membrane with a higher solute concentration caused by the pas- oxidoreductase The class of enzymes that sage of water across the membrane by carry out electron transfers between two osmosis. substrates. Oxidoreductases are the enzymes that are responsible for many of the electron osteoblast The cells that initiate the transfers that occur in the electron transport formation of bone by secretion of the chain in which energy from the electrons bone matrix, a material composed largely derived from the metabolism of sugars is of collagen that is hardened into bony used for oxidative phosphorylation. bone by the deposition of calcium phos- phate crystals. oxygenases A group of enzymes that add oxygen across double bonds of the osteogenesis imperfecta A genetic dis- substrate molecule. This type of reaction ease caused by mutations in collagen genes is an essential step in the energy-producing that results in bone fragility, making them metabolism of certain molecules, for exam- prone to fracture. Other symptoms include ple, fatty acids.
178 干细胞之家www.stemcell8.cn ←点击进入
P
p19ARF See INK4. missing in every other segment. See seg- ments, segmentation. p53 A human phosphoprotein of 53 kilodaltons in size, originally discovered palindrome A nucleic acid-base sequence in studies of SV40 T antigen to which it that is a “mirror image” of itself; for example, is tightly bound. It was at fi rst thought the base sequence GTGGCCGGTG is a pal- to represent the product of an oncogene indrome because it consists of the sequence but is now known to possess antionco- GTGGC and its “refl ection,” CGGTG. The genic, or tumor-suppressing activity. p53 recognition sequences of most restriction normally functions as a “gatekeeper” to endonuclease enzymes are palindromes. block cells that contain potentially muta- genic DNA damage in the G1 phase of the pandemic A worldwide epidemic. cell cycle. Human cancers often contain mutations in p53, and the frequency of papilloma virus A member of the occurrence of such mutations in tumors papova group of DNA viruses that pro- is much higher than is true for any other duces generally benign tumors (papillomas) known tumor suppressor. of the epithelial cell layer in rabbits, cattle, and humans. Recently discovered members packing ratio The length of a certain of the subclass representing human papil- DNA divided by the length of the com- loma viruses (HPV) are now believed to partment into which it is packaged by cause some malignant genital cancers. folding. For example, if the DNA in the smallest human chromosome is 14 mm par A partioning, functioning gene of (4.6 x 107 bp) and the length of the chro- some plasmids that ensures the proper mosome is 2 µm then the packing ratio is: segregation of plasmids into cells during 14,000 µm/2 µm = 7,000. cell division.
paired-box homeotic gene (PAX5) A paralog Genes related to one another member of the paired-box (PAX) family by duplication of an ancestral gene of transcription factors that are impor- within a certain genome. Paralogs tend to tant as regulators of genes involved in develop new functions as the organisms development; the gene family named for that contain them evolve. a highly conserved DNA binding motif called the paired box. The PAX5 gene paranemic joint A side-by-side non- encodes the B-cell lineage specifi c activa- helical arrangement of DNA strands tor protein (BSAP) that is involved in dif- (as opposed to the usual plectonemic ferentiation of B cells but is also believed relationship) that occurs when a single- to play important roles in neural devel- stranded circular DNA undergoes recA- opment and spermatogenesis. The PAX5 mediated recombination with a linear gene map locus is 9p13. double-stranded DNA.
pair-rule mutants Mutants of the fruit parasegments An alternative scheme fl y, Drosophila melanogaster, in which for labeling the segments of the fruit fl y, features of normal development are Drosophila melanogaster; each paraseg-
179 干细胞之家www.stemcell8.cn ←点击进入
parasexual
ment begins in the middle of a segment. ther by injection of blood components, This scheme gains its utility from the fact for example, blood serum or cells. that some mutants of Drosophila are more easily visualized in terms of parasegments. passive transport Movement of a sub- See segments, segmentation. stance across a membrane from one side where the substance is at a relatively high parasexual The recombination of gen- concentration to the other side where the etic material from different individuals concentration is relatively low. See osmosis. that differs from sexual reproduction in that the genetic material is not derived Pasteur, Louis (1822–1895) French from specialized meiotic cell types, for chemist who demonstrated the principle example, sperm and egg. Parasexual of sterilization, thereby destroying the idea reproduction is characteristic of yeast. that life could arise spontaneously from nonliving organic material (called sponta- p-arm The short arm of the human neous generation). chromosome. Pasteur effect The observation that parthenogenesis The process of reproduc- when a microorganism living under ing without fertilization, that is, asexually. anaerobic (oxygen-free) conditions is sud- denly exposed to oxygen, sugar consump- particle bombardment A technique tion as well as accumulation of the sugar breakdown product, lactate, drops. used to transfer DNA into cells that are resistant to other methods of DNA trans- The process of destroy- formation. This method has been used for pasteurization ing disease-causing microorganisms by certain plants and consists in coating the heat. See sterilization. DNA with tungsten or gold particles and then projecting the DNA into the cells by patch clamp A technique for measur- an apparatus. ing electric current fl ow across a neural membrane. In the patch-clamp technique, partition coeffi cient For some particu- two electrodes, one inside and one outside lar substance that is dissolved in two dif- the cell are used to record the voltage; ferent solvents but that do not mix with simultaneously, a third electrode, usually each other, the partition coeffi cient is the inside the cell, is used to supply what- ratio of the amount of the substance that ever current is needed to hold the mem- remains dissolved in one solvent to the brane potential constant. The amount of amount of the substance that remains dis- current required to maintain a constant solved in the other solvent when the two voltage provides a measure of the current solutions are mixed and then allowed to passing through the membrane. separate from each other. patent A document certifying an inven- passive hemagglutination A test in tor or inventors to exclusive rights to an which the presence (or absence) of an anti- invention and any profi ts that may be body is detected by the ability of the anti- derived from its use, sale, or license. body to cause red blood cells to clump together (hemagglutination). Passive hemag- pathogen Any microorganism that causes glutination differs from the usual hemagglu- disease or produces a pathological condition. tination test because the surface of the red blood cells must be artifi cially modifi ed by pathway A series of biochemical reac- chemical linkage of a protein (the antigen) tions occurring in a specifi ed sequence by for the hemagglutination to take place. which a particular molecule (the precur- sor) is modifi ed to become another; usu- passive immunity Immunity that is ally for purposes of synthesizing essential transferred from one individual to ano- biochemicals or for degrading them.
180 干细胞之家www.stemcell8.cn ←点击进入
pentose
pattern formation Generation of a par- P element(s) A type of transposable ele- ticular three-dimensional body or structure ment found in the fruit fl y, Drosophila. during development of the embryo by the coordination of cell division, cell determi- pellet The sediment portion of a bio- nation, and cell differentiation. logical extract after the extract is sub- jected to centrifugal force. Pauling, Linus (1901–1994) Ameri- can chemist who studied the behavior of pendred syndrome (PDS) An autoso- electrons in chemical bonds. He won the mal recessive disorder that is characterized Nobel Prize in chemistry in 1954 for his by deafness and thyroid goiter. The syn- studies on the nature of structure of bonds drome is caused by mutations in the PDS in proteins (the peptide bond). Linus Paul- gene that encodes pendrin, an anion trans- ing is also known for a wide variety of porter localized at the apical membrane of other contributions to the fi eld of chem- thyroid follicular cells. Pendrin is believed istry, including discoveries in the nature to mediate iodide transport into the lumen of quantum levels in chemical bonds, Van of the follicle. There are at least 50 muta- der Waals forces, electron resonance, and tions in pendrin associated with PDS. The many others. Pauling’s The Nature of the gene for pendrin is located at gene map Chemical Bond is thought by many sci- locus 7q31. entists to be one of the most infl uential scientifi c books of the 20th century. penicillinase An enzyme that inactivates penicillin by breaking a key bond in the pen- pBR322 A commonly used plasmid for icillin molecule by the process of hydrolysis. cloning recombinant DNAs in the bacte- rium E. coli. penicillins Products of the Penicil- PCNA Proliferating cell nuclear anti- lium molds that act as an antibiotic by gen; a protein that functions during DNA destroying bacteria by interfering with replication in eukaryotes. PCNA binds the cross-linking of proteins in the bac- DNA polymerase during synthesis of the terial cell wall, causing the bacterium leading strand and increases processivity to break open, or lyse. The penicillins of the polymerase. are all derived from a common chemi- cal backbone (the lactam ring) by sub- PCR See polymerase chain reaction. stituting various chemical groups (by convention the position of the substitu- pectin A jellylike substance released by ent groups are given the general desig- plants. Pectin is made up of chains of the nation R in diagrams) at a certain posi- sugar derivative, galacturonic acid. tion on the ring. See 6-aminopenicillic acid and lactam antibiotics. pectinase An enzyme that degrades pectin by breaking the links between the pentose Any sugar with a fi ve-carbon- sugar units in pectin. atom backbone.
The penicillin backbone
181 干细胞之家www.stemcell8.cn ←点击进入
peptidases
Peptide
peptidases A class of enzymes that peptone The water-soluble portion of breaks down proteins by cleaving the a protein that has been partially broken peptide bonds between the individual down (i.e., hydrolyzed) such as by boil- amino acids that make up the protein, for ing. See hydrolysate. example, the digestive enzymes, chymo- trypsin, trypsin, and pepsin. The break- perfusion culture A culture in which ing of peptide bonds by peptidases occurs there is a continual infl ow of fl uid that by a process known as hydrolysis. carries nutrients or other substances.
peptide A group of amino acids cova- pericentriolar material Material of lently linked by peptide bonds in a linear unknown composition surrounding the chain. centriole of the chromosome. This mate- rial serves as the anchor points for the peptide antibiotic A short peptide microtubules that pull the chromosomes with antimicrobial properties, for exam- apart during mitosis. ple, gramicidin A. perinuclear space The space between peptide bond A covalent linkage the inner and outer nuclear membranes. between the –NH2 group of one amino acid and the –COOH group of another In a structure that has a amino acid. This type of linkage is periodicity known as an amide bond when applied regularly repeating subunit, periodicity to links between molecules that are not refers to the distance that represents one amino acids. complete subunit.
peptide hormone A short peptide periplasmic space The area between secreted into the bloodstream that induces the cell membrane and cell wall of Gram- biological activity in a distant target negative (see Gram stain) bacteria, such gland or organ; for example, the pituitary as Escherichia coli. hormones—the growth hormone (GH), the thyroid stimulating hormone (TSH), PERL Practical extraction and report and the adrenocorticotropic hormone language; a high-level, open-source com- (ACTH). puter language that was released in 1987. PERL is optimized for scanning and peptidoglycan A peptide covalently extracting information from arbitrary text attached to chains of sugars or sugar deriv- fi les and, for this reason, is often used in atives. Peptidoglycans are structural com- bioinformatics. PERL is also optimized ponents of bacterial cell walls. In Gram- for ease of use and combines features of positive bacteria, the peptidoglycan portion other popular languages such as PASCAL, of the cell wall is present in many layers. C++, and BASIC. The peptidoglycans are the targets of the penicillin antibiotics that are incorporated permissive host A cell that, when into the bacterial peptidoglycan, where infected by a virus, allows the expression they prevent critical peptide cross links that of a particular viral function(s), usually weaken the bacterial cell wall. replication of the virus.
182 干细胞之家www.stemcell8.cn ←点击进入
phagocytic index
peroxidase An enzyme that acts to pro- PFGE See pulsed fi eld-gel electro- mote the breakdown of hydrogen peroxide phoresis. (H2O2) into water according to the reaction peroxidase pH A measure of the acidity of an aque- H2O2 + substrate–H2 ---> 2H2O + substrateox ous solution; if the pH value of a solution is below 7, the solution is considered acid; peroxidase labeling The attachment solutions with a pH value above 7 are of a peroxidase enzyme (e.g., horseradish considered alkaline. peroxidase) to a probe so that the pres- ence of the probe can be visualized by a phage Short form of bacteriophage (lit- colorimetric reaction based on the activ- erally meaning “bacteria eater”), a virus ity of the enzyme. that infects and then usually destroys the bacterium that it infects. The destruction peroxisome Small, self-replicating cyto- of the infected bacterium (the host) with plasmic organelles that contain no DNA the release of progeny viral particles is but are composed largely of the peroxi- the last step in the virus life cycle. dase enzyme, catalase. phage display A technique used to peroxisome proliferator-activated re- search for proteins or peptides that will ceptors (PPARs) PPARs are transcrip- interact with a target protein. A microtiter tion factors that are activated by receptor- plate is bait-coated, or coated with target mediated signaling pathways that activate protein. A library of possible interacting COX enzymes. Three different PPAR iso- proteins or peptides is prepared by cloning types are known: α, β and γ. The gene for DNA, which may encode those sequences PPAR-γ codes for a product that regulates into a vector that places the DNA in a the development of fat cells (adipocytes). gene for a phage head structure. When The PPARs also function as receptors for the phage is grown, millions of phage par- two classes of drugs: the hypolipidemic ticles will be produced, each displaying fi brates and the thiazolidinediones. a different fusion product on its surface. These phages are then portioned out into PEST motif A sequence of amino the microtiter plate wells. When the plates acids (Pro-Glu-Ser-Thr), discovered in are repeatedly washed the phages display- the Notch protein but also present in ing an interacting peptide to the bait will other developmentally important pro- stick to the well, and all other phages will teins, that functions as signal for rapid be washed away. The phages can then be proteolytic degradation. A number of eluted from the well and grown up to iso- developmental processes are believed to late the peptide of interest. be regulated in part by the destruction of regulatory proteins at critical times in phagemid A cloning vector con- development. structed with components from plasmids and bacteriophages so that it can repli- petite mutant A microorganism (espe- cate either as a plasmid or phage. cially yeast and euglena) lacking mito- chondria. In yeast, such mutants form phagocyte Any cell that normally carries tiny colonies when grown on a nutrient out phagocytosis; usually applied to cer- source low in sugar. tain white blood cells, for example, macro- phages that carry out phagocytosis as part P factors DNA sequences carried on of their function in the immune system. various chromosomes in the male fruit fl y that bring about hybrid dysgenesis in phagocytic index An assay for the matings with females of certain strains detection of phagocytic activity in a (referred to M strains for maternal con- blood specimen. Among the tests used tributing). See hybrid dysgenesis. for this purpose are staining by the dye
183 干细胞之家www.stemcell8.cn ←点击进入
phagocytosis
nitro-blue tetrazolium (NBT) that turns by the three letter code Phe or by the blue when particles containing the dye single letter code F. Phenylalanine is also are phagocytized or uptake of latex beads used in the body to make the neurotrans- by phagocytic cells. mitter dopamine as well as adrenaline.
phagocytosis The process by which phenylketonuria (PKU) A genetic dis- a particle or cell becomes engulfed and ease based on an inability to convert the ultimately devoured by another for pur- amino acid phenylalanine into the amino poses of sustenance or defense. acid tyrosine. This results in the accumula- tion of a toxic substance (phenylpyruvate) phagosome Following phagocytosis the that causes severe mental retardation if the engulfed particle is found in a membrane- condition, which is manifest in newborns, enclosed vesicle in the cytoplasm of the is not treated by adherence to a diet low in phagocyte referred to as a phagosome. phenylalanine. Because the disease has been traced to a defi ciency of a particular enzyme phalloidin An alkaloid derived from (phenylalanine hydroxylase), prevention of the toadstool Amanita phalloides that the disease in susceptible individuals is a binds to the actin fi laments in a cell, goal of modern genetic engineering. thereby preventing cell movement. pheromone A chemical signal secreted pharmacology The study of the action by an animal that brings about a specifi c of drugs, particularly as it relates to their behavior (e.g., mating) in an animal of therapeutic uses. the same species.
phase-contrast microscopy A type pheromone-responsive element (PRE) A of microscopy in which the image of the nucleotide sequence in the promoters of cer- specimen being viewed is enhanced by a tain yeast genes that binds the transcription technique involving manipulation of the factor STE12 in response to the binding of light that is defl ected by the specimen. In mating factors (pheromones) to specifi c cell- normal microscopy, only the light passing surface receptors. It is believed that genes straight through the specimen is used to required for mating are, in this way, acti- create the image of the specimen. vated by pheromones. phase variation A mechanism of gene regulation in which a gene is switched on Philadelphia chromosome A type of in response to an environmental condition reciprocal translocation between chro- in some of the cells in a population lead- mosomes 9 and 22 that is seen in patients ing to a mixture of expressing (phase ON) with chronic myelogenous leukemia and non-expressing (phase OFF) cells. (CML). An example of this type of regulation is seen in the expression of type 1 fi mbriae phloem A type of plant vascular tis- (an adhesin) in E. coli. Transcription of a sue surrounding the xylem that makes group of genes (fi m genes) is controlled by up the vessels that conduct fl uids down- a short invertible element in the promoter. ward along the stem or trunk of the plant Expression of the gene cluster is either ON toward the root. or OFF, depending upon the orientation of the invertible element. PHO5 The gene for acid phosphatase. The promoter for this gene has been incor- phenotype The set of characteristics porated in expression vectors for eukary- that make a living organism distinct from otic (see eukaryote) genes. The advantage others. of this promoter is that it can be regulated because it is induced by the removal of phenylalanine One of the 20 amino phosphate from the culture medium. Many acids that make up proteins; designated cloned genes are toxic to the host cell pro-
184 干细胞之家www.stemcell8.cn ←点击进入
phospholipid
ducing them and can only be expressed phosphodiesterase An enzyme that cata- when the cells have reached a maximum lyzes the breakage of phosphodiester bonds. biomass. Thus regulation allows the cells to grow to the maxiumum density before phosphodiester bond A covalent bond the toxic protein is expressed. that attaches a phosphate group to any other group by an oxygen-atom bridge. phorbol esters A class of compounds Phosphodiester bonds are the linkages that act as tumor promoters. See TPA. that join the sugar molecules to one another in the backbone of nucleic acids.
(deoxy–)ribose | (deoxy–)ribose–O–P=O | O–
phosphoglycerate kinase (PGK) An enzyme used in the process of glycolysis, or the breakdown of glucose, to form energy in the cell. Because the gene for PGK is highly expressed, the promoter for this gene has been incorporated in many phorbol myristate acetate expression vectors for eukaryotic genes.
phospholipase Any of a class of en- Phorbol esters zymes that acts to break down phospha- tides by breaking the bonds between the glycerol portion of the phosphatide and phosphatide A type of phospholipid the attached fatty acid(s) or the bonds made up mainly of glycerol, fatty acids, between the glycerol portion and the and phosphate. Phosphatides are the phosphate. Phospholipases are the major type of lipid that make up the bulk of mediators of phosphatide turnover in the the phospholipids found in cell mem- membrane. Phospholipases also play a branes. role in membrane signaling by liberating membrane molecules used in the synthe- phosphatidylethanolamine (PE) A sis of eicosanoids and PIP3 signaling. type of phospholipid common to many cell membranes. PE is also a common phospholipase A2 An enzyme that constituent of many artifi cial mem- catalyzes the hydrolysis of the fatty acid branes, such as those used to construct ester linkage at the second carbon of the liposomes. glycerol backbone of membrane phos- phatides, thereby releasing the esteri- phosphatidyl inositol kinase (P13 fi ed fatty acid as a free molecule. Phos- kinase) An enzyme that adds phos- pholipase A2 is the enzyme responsible phate groups onto the inositol portion of for releasing arachidonic acid from the the membrane phospholipid, phospha- plasma membrane for subsequent eico- tidyl inositol using ATP. The product, sanoid synthesis. phosphatidylinositol-4,5-biphosphate, is an important intermediate in a sig- phospholipid The general class of lipids nal transduction pathway in which the that are made up of fatty acids and phos- phosphoinositol group is cleaved from phate and that are the main component the phospholipid and is released into the of all cell membranes. Phosphatides and cytoplasm, where it acts as a second mes- sphingosines are the two major phospho- senger. lipid subclasses.
185 干细胞之家www.stemcell8.cn ←点击进入
phosphomycin
phosphomycin A phosphate-containing antibiotic produced by streptomyces.
phosphoramidite A chemically modifi ed nucleotide used in the synthesis of oligo- nucleotides that contain an activated phos- phoester group at the 3′ carbon and a dmt blocking group at the 5′ carbon.
Phosphorylation
to the process of sugar oxidation (i.e., breakdown) in animal cells. • substrate level—generation of ATP that occurs as part of the oxidation of sugars but does not require oxygen. Phosphoramidite phosphotyrosine A form of the amino acid tyrosine in which the –OH group on phosphoribosyltransferase An enzyme the side chain is covalently attached to a that is necessary to make nucleotides from phosphate group. Phosphotyrosine resi- free purine and pyrimidine bases. The dues in proteins are of signifi cance because action of this enzyme is responsible for signal-transduction pathways that effect a variety of important biomedical and cell growth regulation and oncogenesis research applications, for example, the involve phosphorylation of specifi c tyro- labeling of nucleic acids or the killing of sine residues by protein kinases. cancer cells with lethal analogs of the nor- mal purines and pyrimidines. phosphotyrosine-binding domain (PTB domain) A region on certain signal trans- phosphoric acid See orthophosphate. duction proteins that binds to a portion of the cytosolic regions of receptor tyrosine phosphorylation Any of a variety of kinases (RTKs) that contain phosphorylated biochemical processes by which a phos- tyrosine residues. While the PTB binds the phate group is added to an organic mol- RTK, a second domain on the same pro- ecule. However, the term usually applies tein, called the src homology (SH2) domain, to the phosphorylation of nucleosides, binds to another protein in the signal trans- particularly adenosine, resulting in the duction chain. These PTB-containing pro- formation of adenosine mono-, di-, and teins are components of signaling pathways tri- phosphates (AMP, ADP, and ATP, often involved in regulating cell growth from respectively). Phosphorylation resulting ligand-activated receptors. in ATP formation is the major means of storing energy for all forms of biological photoaffi nity labeling The use of light activity. ATP formation produced dur- to activate certain light-sensitive mol- ing photosynthesis that is therefore light ecules so that they spontaneously bond to requiring: a protein, a nucleic acid, or another type • oxidative phosphorylation—oxygen- of molecule. This is a technique for label- dependent formation of ATP; this ing biologically important substances if means of generating ATP is coupled the activated molecule provides a highly
186 干细胞之家www.stemcell8.cn ←点击进入
phytochrome
visible color or generates some other type repeated a number of times to amplify the of signal with high detectability. initial photocurrent so that extremely low levels of light can be detected. photoautotroph A photosynthetic or - gan ism capable of living on only minimal photon The unit of light that represents nutrients, that is, capable of making all one discrete packet of light energy. its necessary biomolecules from simple or ganic molecues. photophosphorylation The process in which sunlight is used to produce ATP. photoheterotroph A photosynthetic or- ganism that is defi cient in the ability to photoreactivating enzyme See DNA make one or more of its essential biomol- photolyase. ecules and therefore requires nutritional supplements in its growth medium. photorespiration A salvage process that occurs in plants under conditions of high photolithography An automated tech- O2 and low CO2 concentrations, where the enzyme responsible for fi xing CO instead nique for synthesizing oligonucleotides 2 takes up O and releases CO . at specifi c locations (spots) on a micro- 2 2 array. In photolithography individual photosynthesis The process by which nucleotides are added one at a time to plants utilize light energy to create sugars preexisting nucleotide chains by shining and produce oxygen from carbon dioxide light through a screen. The light activates and water. special light-sensitive nucleotides, caus- ing them to form a covalent bond with photosystem A cluster of chlorophylls the free end of the nucleotide chain(s). An and other pigments that functions to cap- ordered sequence of screens and activated ture the light energy that is used to carry nucleotides programmed by computer out photosynthesis. can generate thousands of oligonucle- otides with defi ned sequences at specifi c phototaxis Movement toward light. locations on the microarray. phototroph An organism that is wholly photolyases A group of light-activated, dependent upon light for nourishment via direct DNA repair enzymes that catalyzes photosynthesis. the repair of pyrimidine dimmers result- ing from ultraviolet radiation. Photoly- phragmoplast The enlarged football- ases use FADH2 and a folate derivative shaped spindle that is seen toward the (MTHFpolyGlu; methenyltetrahydrofolyl- end of mitosis in plant cells; the structure polyglutamate) as coenzymes to repair in which the cell plate forms. the dimers by reducing the pyrimidine- pyrimidine bonds. phycomycetes A class of primitive fungi that shares many features in com- photomultiplier A photosensitive device mon with fungi. that makes use of the phenomenon of pho- toemission and secondary electron emis- phylogeny The construction of evo- sion to detect low levels of light. Electrons lutionary trees based on relatedness of emitted from a photosensitive material by organisms. DNA sequencing and the fi eld incident light are accelerated and focused of bioinformatics are making large con- onto a secondary-emission surface (called tributions to the understanding of the a dynode). Several electrons are emitted evolution of genes and organisms. from the dynode for each primary electron produced. The secondary electrons are phytochrome A pigment-protein that then directed onto a second dynode where is believed to play a role in the initiation more electrons are released. This process is of plant development when activated by
187 干细胞之家www.stemcell8.cn ←点击进入
phytohemagglutinin
light in the red or near-red part of the secretes a number of important polypep- spectrum. tide hormones including follicle stimulat- ing hormone (FSH), leutinizing hormone phytohemagglutinin A class of pro- (LH), and prolactin, all of which play a teins that causes clumping of red blood role in stimulation of the female repro- cells (hemagglutination) by binding to ductive organs. The pituitary gland also certain sugar chains on the cell surface; produces adrenocorticotropic hormone also referred to as lectins. Examples are (ACTH), somatotropin, and thyrotropin. concanavalin A and ricin. pK, pKa Terms that represent the phytotoxin Any of a number of highly “strength” of a chemical reaction; the poisonous substances produced by plants. degree to which some reaction will pro- ceed in the direction written, for example, picogram 10–12 or 0.000000000001 A + B → C + D. The negative logarithm of grams. the equilibrium constant (–log[K], where K = [C][D]/[A][B]) for the chemical reac- picornaviruses A class of RNA vi- tion. ruses originally termed enteroviruses be- cause they were initially discovered in plankton The small fl oating plant and the intestinal tract. Currently, the picor- animal life in a body of water. naviruses are classifi ed into two sub- classes: the enteroviruses (poliovirus, plaque A clear area in an immobilized coxsackievirus, echovirus, and enterovi- carpet of bacteria that is produced by rus) and the rhinoviruses (rhinovirus). local destruction of the bacteria in that The name is derived from pico- (small) area by bacteriophages. and rna to denote RNA. plaque assay A means of determining pilus A hairlike structure, found on the number of bacteriophage in a suspen- donor type Escherichia coli, that is used sion by counting the number of plaques in the attachment of donor-type cells (F+ produced in a certain amount of the sus- and Hfr) to recipient cells (F–) to mediate pension. The results are usually expressed the transfer of DNA during mating. Also as plaque forming units per milliliter of called the sex pilus. suspension (PFU/ml).
pinocytosis A variation of phagocyto- plaque hybridization A process in sis in which the engulfed particle is taken which a labeled probe is annealed to the into the cell in small vacuoles represent- DNA from bacteriophages in a plaque. ing pinched-off pieces of the original par- Plaque hybridization is used to iden- ticle. tify plaques containing bacteriophage- carrying recombinant DNA. piperidine A chemical that causes breakage of the sugar-phosphate back- plasma The liquid portion of blood. bone in nucleic acids at any point along a nucleic acid strand at which the purine or plasma cell An antibody-secreting white pyrimidine rings have been partially oxi- blood cell. dized or completely removed. Piperidine treatment is used to create subfragments plasma gel The protoplasm of a proto- of a larger nucleic acid in the Maxam- zoan that is in the gel form, for example, Gilbert procedure for sequencing nucleic the protoplasm in the pseudopodium of acids. Amoeba proteus.
pituitary gland A small endocrine plasma membrane The membrane gland located at the base of the brain that surrounding the cytoplasm of a eukary-
188 干细胞之家www.stemcell8.cn ←点击进入
polarity
otic cell. The plasma membrane is similar plectonemic supercoiling A term used in structure to the cell membranes of pro- to describe a type of supercoiling in which karyotes and consists of a phospholipid the DNA supercoils are folded over them- bilayer and an overlying extracellular selves to form branches. This type of struc- layer of glycoproteins. ture is believed to represent a mechanism by which DNA is compacted. In plectone- plasma sol The protoplasm of a proto- mically supercoiled DNA, the length of the zoan that is not in gel form. DNA mass is approximately 40 percent of the length of the uncompacted DNA. plasmid A piece of DNA in the cyto- sol of bacteria that replicates indepen- pleiotropic Any agent, such as a hor- dently from the bacterial chromosome. mone, having more than one effect or Naturally occurring plasmids have been having an effect on more than one target. found to carry a number of genes; per- haps most important are the genes that pleomorphic Having variable form, confer resistance to a number of anti- for example, variations in shape, behav- biotics. Genetically engineered plasmids ior, or other characteristics of organisms are important vectors for carrying re- of the same species. combinant DNAs. point mutation A change in a single plasminogen activator An enzyme that nucleotide in a gene resulting in loss of derives its name from the ability to catalyze function or altered functioning of that the conversion of plasminogen to plasmin, gene. which then catalyzes the breakdown of fi brin, a major component of blood clots. pol One of the three major genes of The secretion of plasminogen activator is retroviruses. The pol gene encodes the a marker of cell transformation to a can- protein for the viral enzyme reverse tran- cerous or precancerous state. Plasminogen scriptase. activator is used as a therapeutic agent to dissolve blood clots associated with block- polar body A small cell that is pro- age of the coronary arteries. duced as a result of uneven separation of plastid An organelle found in plant cytoplasm during meiois when an oocyte cells that contain its own genome; chloro- is produced; the larger of the daughter plasts are a type of plastid. cells becomes the oocyte.
platelet A subcellular particle in blood polar group A small group of atoms that is actually a fragment of a mega- held together by dipole-dipole linkages. karyocyte cell that is formed in the bone marrow. Platelets bound to fi brinogen polarimeter An instrument for deter- initiate the formation of a blood clot at mining the percentage of polarized light the site of a wound. in a beam of light. A polarimeter is also used to determine whether polarized light platelet-derived growth factor (PDGF) is rotated after passage through crystals A growth factor that is present in the of a given compound. granules of platelets and that probably plays a role in wound healing. PDGF con- polarity 1. As applied to a molecular sists of two subunits, one of which was bond between two atoms, the term polar- found to represent a slightly changed ver- ity refers to a state in which the electrons sion of the sis oncogene. in the bond are localized more to one atom than the other, giving that atom a plectonemic Pertaining to the standard partial negative charge (the other atom is double helical arrangement of double- partially positively charged). The presence stranded DNA. See double helix. of polar bonds confers a number of impor-
189 干细胞之家www.stemcell8.cn ←点击进入
polar microtubules
tant chemical properties to the compound polyadenylation The addition of long that contains them, including solubility in tracts of adenosine polymers to the tail water. ends (i.e., the 3′ ends) of messenger RNAs 2. As applied to cell microanatomy, in eukaryotic cells. polarity refers to specialization of the cell adenosine adenosine adenosine architecture at different parts of the cell, | | | for example, the presence of cilia and …–phosphate–ribose–phosphate–ribose–phosphate–ribose–… secretory vesicles located at the apical, as opposed to the basal, end of the epithelial polyadenylation signals Certain sequen- cells lining the gut and respiratory tracts. ces of bases in an RNA molecule that are 3. As applied to nucleic-acid strands, the required for polyadenylation to-occur; for term refers to the fact that the two ends example, the sequence AAUAAA located of any nucleic-acid strand are distinguish- in a region 11–30 nucleotides from the able from one another by whether the end end of an mRNA molecule. is 5′ or 3′. This gives the strand a direc- tionality or polarity. polyamine Molecules formed from re- peating hydrocarbon chains separated by polar microtubules The microtubules amino groups. The chain is always termi- extending between the polar bodies that nated at each end by a positively charged have the apparent function of pushing amino group. Because of their positive the poles of a dividing cell apart during charge, the polyamines function to stabi- mitosis. lize nucleic acids by neutralizing the strong negative charge of the nucleic acid phos- polar mutation A nonsense mutation phate backbone. Putrescine, spermidine, that causes early termination of normal and spermine are the common polyamines. transcription in a gene and that therefore also prevents transcription of any subse- poly-A polymerase The enzyme quent genes in a polycistronic unit. responsible for polyadenlylation of an RNA strand. poliovirus A picornavirus that infects individuals via ingestion but then attacks polycistronic A region of a nucleic the central nervous system, resulting in acid that contains sequences representing varying degrees of paralysis. multiple genes (cistrons) in an end-to-end tandem arrangement. polyacrylamide A polymer of acryl- amide: polycistronic mRNA The messenger NH2 RNA transcribed from a polycistronic DNA. | polyclonal antibody A set of antibod- CH2=CH–C=O ies that is secreted by a corresponding set of antibody-producing white blood cells. A gel is formed to which the polyacryl- Although each of the antibodies carries a amide strands are cross linked. Polyacryl- unique specifi city, the set of antibodies as amide gels are used for electrophoresis of a whole reacts with a variety of antigenic proteins and nucleic acids. molecules. polyacrylamide-gel electrophoresis polyelectrolyte A large molecule that Separation of nucleic acids or proteins is highly charged under biological condi- from a heterogeneous mixture on the tions. basis of size or charge by placing the mixture in a polyacrylamide gel and then polyethylene glycol (PEG) A long subjecting it to an electric fi eld. OH polymer of | groups. PEG is used in polyadenylated The general term for –C– nucleic acids that have undergone poly- inducing cell fusion, precipitating micro- adenylation. scopic particles, dehydrating samples of
190 干细胞之家www.stemcell8.cn ←点击进入
polymerase chain reaction
Polymerase chain reaction
biological materials, and stabilizing cer- polymer A chain composed of a single tain enzymes. molecule or small number of similar mol- ecules that are linked together. polylinker A synthetic polynucleotide containing the sequences representing polymerase chain reaction (PCR) A the restriction sites of certain specifi ed technique for rapid amplifi cation of restriction enzymes. extremely small amounts of DNA, using
191 干细胞之家www.stemcell8.cn ←点击进入
polymerases
the heat-stable Taq I DNA polymerase polyribosome (polysome) A number enzyme. PCR has found wide application of ribosomes attached to the same mes- in forensic medicine because analyzable senger RNA. quantities of nucleic acid can be obtained even from microscopic tissue samples. polysaccharide A chain of sugar mol- ecules linked together end-to-end. polymerases A class of enzymes that catalyze the formation of long nucleo- polyspermy Fertilization of a single tide polymers, particularly as a means of egg by more than one sperm. making template-driven copies of nucleic polytene chromosomes Giant chro- acids. See DNA and RNA polymerases. mosomes found in insect salivary gland cells. They are actually made up of thou- polymorphism A naturally occurring sands of copies of the DNA normally variation in the normal nucleotide sequence found in one chromosome. within the individuals in a population. polyteny The state of a cell containing polymyxin A group of antibiotics polytene chromosomes. derived from the bacterium Bacillus poly- myxa, with activity primarily against poly U Poly uridylic acid; a polymer of Gram-negative bacteria. uridine of undefi ned length.
polynucleotide A polymer consisting P/O ratio The amount of phosphate of a long chain of nucleotides. incorporated into ATP divided by the amount of O2 taken up by the mitocho- polynucleotide kinase (polynucleo- drion during the process of respiration; generally taken as a measure of the effi - tide phosphorylase) An enzyme that ciency of energy production when sugars catalyzes the transfer of a phosphate are oxidized. group from ATP to the free 3′ end of a polynucleotide. porins Protein channels in the lipo poly- saccharide layer of Gram-negative (see polynucleotide ligase An enzyme that Gram stain) bacteria that serve as por- links two polynucleotides together. The tals for the fl ow of small molecules. enzyme catalyzes the formation of a cova- lent bond between a phosphate group on porphyrin An organic molecule made the 5′ end of one polynucleotide and the up of four nitrogen-containing rings free 3′ hydroxyl group at the end of the called pyrrolles. Modifi ed porphyrins are other polynucleotide. the basic constituents of the active sites of hemaglobin, myoglobin, chlorophylls, polyoma A member of the papova and cytochromes. group of viruses, which normally infects rodent cells. position effect The infl uence of the position of gene on its activity such as is seen when a gene that is moved (e.g., polypeptide A polymer of amino acids; by translocation) to a new chromosomal the term usually applies to a peptide chain location becomes inactive. of fewer than 100 amino acids. posttranscriptional processing Cer- polyploid Having more than the nor- tain specifi c changes in the RNA that mal diploid number of chromosomes. occur before the RNA leaves the cell nucleus in mature form. Polyadenylation, polyploidy The state of being poly- capping, and splicing are examples of ploid. posttranscriptional processing.
192 干细胞之家www.stemcell8.cn ←点击进入
presenilins
posttranslational import A process PWS was the fi rst human disease based on by which a certain class of proteins is the phenomenon of genomic imprinting in brought into the interior of the endo- which genes are differentially expressed plasmic reticulum (ER) either following depending upon the parent from which or during its synthesis on ribosomes that the disease originated. DNA methylation are bound to the ER; polypeptides that at cytosine bases may be the mechanism of are to be imported are recognized on the this type of imprinting. basis of the fact that they contain a small sequence of amino acids known as a sig- precursor A substance from which nal peptide at one end. another substance is made by a series of sequential changes in molecular struc- posttranslational modifi cation Some ture. alteration in the structure of a polypeptide, for example, addition of a polysaccharide prednisone A synthetic steroid hor- chain (glycolsylation), after it is synthe- mone used to reduce chronic infl amma- sized and usually after it is imported into tion such as occurs in arthritis. the interior of the endoplasmic reticulum. Such modifi cation is required for the poly- pre-mRNA The general term given peptide to take on its biological activity. to that subclass of RNAs present in the nucleus that will be processed to become posttranslational processing Removal mature messenger RNA (mRNA) but that of a specifi c end piece of a polypeptide has not yet undergone that processing. known as the signal peptide, following its See posttranscriptional processing. synthesis on ribosomes; one part of the process of posttranslational import. preproinsulin A precursor of insulin. Proinsulin, which is the immediate precu- sor of insulin, is produced from preproin- posttranslational transfer The import sulin by cleavage of preproinsulin, result- of a polypeptide into the membrane of the ing in the removal of a short polypeptide endoplasmic reticulum or an organelle portion. after synthesis of the polypeptide (i.e., translation) is completed. preprotein The polypeptide precursor of a membrane-bound protein prior to poxvirus A class of DNA viruses that its actual insertion into a membrane. Be- produces transient infl ammatory skin cause the leader sequences of membrane- lesions, for example, chicken pox and bound proteins are removed on insertion smallpox. into the membrane, preproteins have leader sequences. Prader-Willi syndrome (PWS) A dis- order caused by chromosomal deletion prenatal diagnosis The diagnosis and/or disomy involving genes on the that a disease exists in a developing fetus proximal arm of chromosome 15. The made on the basis of examination of cell syndrome is characterized by obesity, or tissue samples taken from the fetus in hypotonia, mental retardation, short stat- the womb. ure, hypogonadotropic hypogonadism, and strabismus. About 70 percent of the presenilins Two proteins (PS1 and PS2) PWS cases show a deletion in the chro- found on the surface of neurons that have mosome 15 region, 15q11.2-q13. Several been found to be involved in the develop- genes possibly involved in the disorder ment of familial Alzheimer’s disease. The have been mapped to this region, including presenilins act together with another pro- a small ribonucleoprotein gene (SNRPN), tein (gamma-secretase) to cleave the amy- type II oculocutaneous albinism (P gene), loid precursor protein that leads to the and a ubiquitin-protein ligase (UBE3A). accumulation of amyloid plaques, causing
193 干细胞之家www.stemcell8.cn ←点击进入
Pribnow box
rapid deterioration of the central nervous prion A type of protein particle that is system at an early age (<60 years). responsible for a number of neurodegenera- tive diseases in humans and animals called Pribnow box A sequence of bases in the transmissible spongiform encephalopa- DNA that makes up part of the promoter thies (TSEs). The TSEs caused by prions of a prokaryotic gene. The Pribnow box includes scrapie (in sheep), kuru (affl icting occurs at 10 base pairs from the site at the cannibalistic Foré tribe in Papua New which transcription starts and consists of Guinea), Creutzfeldt-Jakob disease (CJD), the sequence TATAAT or a close variation. Chronic Wasting Disease, Fatal Familial Insomnia (FFI), Gerstmann-Sträussler- primary culture The cell culture that Scheinker syndrome (GSS), and bovine arises from a tissue specimen when it is spongiform encephalopathy (mad cow dis- fi rst placed into culture. ease). The name prion is derived from the descriptor proteinaceous infectious parti- primary response The elicitation of an cle. Prions are unique as infectious agents immune response to a foreign antigen after because they contain no nucleic acids. an animal is fi rst exposed to the antigen. The fi rst prion protein was discovered by Stanley B. Prusiner, who was awarded the primary stucture The sequence of Nobel Prize in physiology or medicine in amino acids that make up a polypeptide. 1997. The infectious agent was named PrP (prion-related protein) and it is believed primase The enzyme that catalyzes the that the disease is caused by a change in formation of short RNA primers that are shape of this protein (the altered version of required to copy the DNA strand, start- the protein was called PrPSc) and that the misshapen protein can be “transmitted” ing from the 5′ end. by inducing the same change in shape to other nearby normal protein molecules. primeosome A complex of prepriming proteins and DnaG primase with a hairpin probe Any oligonucleotide that con- fold of single-stranded DNA in the bac- tains a chemical label allows the oligo- teriophage ϕX174. This complex is the nucleotide to be traced when the oligo- structure in which synthesis of the RNA nucleotide is annealed by hybridization primers in Okazaki fragments occurs. to some target nucleic acid. To a lesser extent, any biomolecule including a pro- primer A short oligonucleotide that tein, lipid, or polysaccharide that binds anneals to a specifi c region on a DNA or to some target molecule and that bears RNA strand and is used by a polymerase a chemical label that can be traced after as a place to begin synthesis of a comple- binding has occurred. mentary nucleotide strand. processed pseudogenes Pseudogenes primer extension A technique of map- that show a close similarity in nucleotide ping genes in which a primer is annealed sequence to the mRNA for their active to a DNA or RNA fragment and then counterparts. The existence of processed extended, using an RNA or DNA poly- pseudogenes has been taken as evidence merase (e.g., the Klenow fragment of that some pseudogenes were somehow DNA polymerase I) and the four nucleo- originally derived from mRNAs. side triphosphates to copy the nucleic acid to which the primer is annealed. Primer pro-dynorphin/pro-enkephalin/pro- extension is most commonly used to opiomelanocortin Precursor molecules detect mRNAs that contain the primer that give rise to various opioid peptides by sequence. proteolytic processing:
priming The process of annealing a • Pro-opiomelanocortin is processed into primer. γ-MSH, adrenocorticotropic hormone
194 干细胞之家www.stemcell8.cn ←点击进入
(ACTH) and β-lipotropin. The latter progeria A rare disease characterized two peptides are further processed by a collection of symptoms that give the into α-MSH and CLIP (from ACTH) appearance of premature aging, includ- and γ-lipotropin, β-endorphin. ing baldness, prominent scalp veins, thin limbs with prominent joints, short stat- • β-MSH and met-enkephalin (from β- ure, joint stiffness, hip dislocations, and lipotropin) heart and artery disease. At least two • Pro-enkephalin A gives rise to met- forms of the condition are known: Wer- enkephalin and leu-enkephalin and ner syndrome and Hutchinson-Gilford some other larger peptides. Pro- progeria. Hutchinson-Gilford progeria, enkephalin A contains four copies the more severe form, occurs in children of met-enkephalin, one copy of leu- at a frequency of about one in 8 million enkephalin, a heptapeptide (met-enk- and is caused by a point mutation in the arg-phe), and an octapeptide (met-enk- gene for a nuclear lamin, known as lamin arg-gly-leu). A (LMNA; gene map locus 1q21.2). Wer- • Pro-dynorphin (pro-enkephalin B) ner syndrome is caused by mutations in a gene called Wrn, which is a homologue of gives rise to dynorphin A, dynorphin the E. coli helicase RecQ and is located B, and β-neoendorphin as well as the on chromosome 8 at gene map locus smaller peptides dynorphin A1-8 and 8p12-p11.2. leu-enkephalins, three of which are contained within the pro-dynorphin progesterone A steroid hormone pro- peptide. duced by the ovary that prepares the uterus for reception of the fertilized egg. profi lin A protein that complexes with actin proteins, preventing the polymeriza- prokaryote A term for the family of all tion of these proteins into actin fi laments. primitive organisms, for example, bac-
pro-opiomelanocortin
signal peptide
γ -MSH ACTH β -lipotropin
α -MSH CLIP γ-lipotropin β -endorphin
β -MSH met-enkephalin
Opioid peptides
195 干细胞之家www.stemcell8.cn ←点击进入
rectoprolactin
teria, in which the cellular DNA is not prostaglandins A class of hormonelike enclosed in a nucleus. chemicals derived from fatty acids. There are more than 16 prostaglandins that are prolactin A hormone that stimulates classifi ed into nine different groups. Stim- the production of milk by the mammary ulation of muscle contraction and infl am- glands following pregnancy. mation are believed to be caused by pros- taglandins. The anti-infl amatory effects of proline-rich activation domain A characteristic region in a certain class aspirin are related to inhibition of prosta- of transcriptional activator proteins that glandin synthesis. contains a large number of proline resi- dues. Transcriptional activators that con- prostate-specifi c antigen (PSA) A tain proline-rich activation domains can glycoprotein originally isolated from stimulate transcription by binding to semen that is now used as an indica- sequences that are either close to, or far tor of the presence of prostate cancer. away from, the TATA box unlike the The PSA glycoprotein is a protease of glutamine-rich or acidic activators that 33 kDa called Kallikrein 3 (KLK3) that tend to stimulate transcription from loca- is believed to function to keep semen in tions either very close to (glutamine-rich a state of liquefaction. KLK3 is located activators) or far away from (acidic acti- on chromosome 19q13. As a diagnos- vators) the TATA box. Examples of tran- tic indicator, PSA levels in blood are scription factors containing proline-rich reported in terms of ng/milliliter of domains are AP-2 and CTF/NF1. blood: 0–2.5 ng/ml is low, 2.6–10 ng/ml is considered slightly to moderately ele- promoter A sequence of bases in a vated, 10–19.9 ng/ml is considered mod- nucleic-acid strand that serves as a signal for erately elevated, and 20 ng/ml or more is the start of transcription of a given gene. signifi cantly elevated. prometaphase The stage preceding prosthetic group An organic mol- metaphase in which chromosomes that ecule often containing metal atoms that is have newly formed in the cytoplasm begin tightly bound to an enzyme and which is to migrate to the center of the cell where homologous chromosomes will pair with required for the enzyme function. one another during metaphase. protease The class of enzymes that proofreading The ability of the DNA catalyze the cleavage of a polypeptide or polymerase to remove a mismatched base protein into smaller polypeptides. in the replicated strand with an exonucle- Any polypeptide or cluster of ase that cuts 3′–5′ and then to reinsert protein the correct base in the new strand with polypeptides that has a defi ned biological its polymerase activity. Organisms that function. lack this activity through mutation show a high rate of mutagenesis. protein chip A protein microarray. In a protein chip, many individual pro- prophage The genome of a bacterio- teins of a certain type are spotted onto a phage that has become integrated into the solid substrate such as a glass slide for the chromosome of the host bacterium. purpose of determining whether cells are producing factors that interact with the prophase The fi rst phase of mitosis proteins on the chip. For example, some characterized by the appearance of chro- protein chips contain arrays of transcrip- mosomes from the amorphous chromatin. tion factors, and these chips can be used to test particular cells for the presence prophylactic The treatment with a of proteins that interact with particular therapeutic agent to protect an individual transcription factors. In this example the from future disease. proteins in a cell lysate could be labeled
196 干细胞之家www.stemcell8.cn ←点击进入
protoplast fusionverso
with a fl uorescent molecule, and the pres- proteome A bioinformatics term used ence of a protein that interacts with a to describe the proteins produced by all certain transcription factor would then genes in a genome. The human genome is be determined by a fl uorescent signal at currently thought to contain a proteome certain spot(s) on the chip. of ca. 30,000 proteins.
protein hydrolyzate The partial break- proteomics The fi eld of study devoted down product produced by heating a pro- to the study of the proteins that are tein mixture or subjecting it to treatment expressed in different cell types. A major with acid or proteases. technique employed in proteomics is the comparative analyses of two-dimensional protein kinase The class of enzymes that protein gels from different cell types or catalyzes the transfer of a phosphate group from variants of a single cell type. from one compound onto a protein. prothrombin A blood protein that is protein kinase C A protein kinase acted on to form thrombin. embedded in the cell membrane that acts as a signaling molecule by virtue of its prothymocytes Immature T cells that ability to phosphorylate certain cytosolic are formed from stem cells in the bone proteins on serine and threonine residues. marrow prior to the time they enter the ++ Protein kinase C is activated by ca ions thymus. Prothymocytes are recogniz- together with diacylglycerol and tumor able by the presence of an incomplete promoters such as phorbol esters. Acti- set of T-cell receptor proteins on the vated protein kinase C is then believed to cell surface. cause transformation to a cancerous state by phosphorylation of as yet unidentifi ed proton gradient An uneven distribu- protein(s). tion of protons caused by the accumula- tion of protons on one side of a membrane. protein synthesis The process by Proton gradients are a means of storing which amino acids are assembled into energy for synthesis of ATP in mitochon- peptides on ribosomes using the informa- dria and chloroplasts. tion supplied by a messenger RNA. Pro- teins and nucleic acids are held together The amount of by bonds that are susceptible to hydroly- proton-motive force sis, and their assembly is accomplished by energy stored in a proton gradient. a reversal of the hydrolytic reaction. See translation. proton pump A cluster of membrane- embedded proteins that transports protons proteoglycan A large aggregate of pro- from one side of membrane to the other. tein that forms the core, and long poly- meric saccharide chains that constitute proto-oncogene A normal cellular gene the bulk. Hyaluronic acid, chondroitin that, when altered in a particular fashion sulfate, heparan sulfate, dermatan sulfate, (activation), acts to induce a cancerous and keratan sulfate are polysaccharides state. commonly found in proteoglycans. Pro- teoglycans are major components of the protoplast A plant cell or bacte- extracellular matrix and other extracellu- rial cell in which the cell wall has been lar structural components such as carti- removed, for example, by treatment with lage. See GAG. lysozyme.
proteolysis Breakdown of proteins by protoplast fusion A technique for cleaving the bonds between amino acids by introducing foreign or genetically engi- the process of hydrolysis. See protease. neered DNA into a cell by fusion of that
197 干细胞之家www.stemcell8.cn ←点击进入
rectoprototroph
cell with a protoplast carrying the DNA of interest.
prototroph An organism with the same nutritional requirements as the par- ent organisms from which it was derived.
protozoa A phylum of single-celled organisms—for example, Paramecium caudatum or Amoeba proteus—repre- senting the most primitive animals (from proto = fi rst and zoan = animal).
provirus The name given to DNA rep- resenting the genome of a virus that has Purine ribonucleosides become integrated into the DNA of the host that it infects. cin interacts with an elongation factor pseudogene A version of a gene that (EFTu) and prevents the formation of an has become inactive over time as a result essential complex between GTP and an of accumulated mutations. aminoacyl tRNA.
pseudouridine An unusual form of purine A nitrogen-containing, double- uridine found only in transfer RNAs ringed organic molecule that is the par- (tRNA). ent compound for the purines found in nucleic acids. psoralens A type of organic molecule that spontaneously forms a variety of purine bases in nucleic acids The covalent bonds with nucleic acids in the purine derived molecules adenine and presence of ultraviolet light. guanine. In nucleic acids, these molecules are attached to the sugar ribose or deoxy- psychrophile An organism thriving at ribose in the nucleic acid backbone. low temperatures. puromycin An aminonucleoside anti- psychrotroph An organism that requires biotic, derived from the soil bacterium low temperature for normal growth. Streptomyces alboniger, that acts by disrupting the process of protein synthe- Ptashne, Mark (b. 1940) Discoverer of sis. One part of the puromycin molecule the lambda bacteriophage cI repressor pro- resembles the 3’ end of a tRNA and binds tein function. Ptashne was a cofounder of to the ribosome during protein synthesis one of the fi rst biotechnology companies, and then blocks the translocation step of the Genetics Institute, and was a recipient protein synthesis. Puromycin inhibits the of the prestigious Lasker Award. growth of Gram-positive bacteria and some animal and insect cells. The Pac pulsed fi eld-gel electrophoresis A va- gene which codes for a puromycin N- riation of agarose gel electrophoresis that acetyl-transferase confers resistance to the allows the separation of extremely large antibiotic. (several thousand kilobases in length) DNA fragments by agarose gel electrophoresis. purple bacteria A type of bacterium that is capable of carrying out photosynthesis. pulvomycin An antibiotic that acts by blocking the elongation of a polypeptide pyogenic The ability of a substance to chain as it is being synthesized. Pulvomy- induce the formation of pus and abscesses.
198 干细胞之家www.stemcell8.cn ←点击进入
pyrogenverso
ent compound for the pyrimidines found in nucleic acids.
pyrimidine bases, in nucleic acids The pyrimidine-derived molecules thy- mine, uracil, and cytosine. Like the purine bases in nucleic acids, these molecules are attached to the sugar ribose or deoxyribose in the nucleic acid backbone.
pyrogen Any of a number of toxic, fever- causing agents that are usually of bacterial origin, such as endotoxins. The presence of pyrogens is a main concern when prepar- ing solutions for injection because steriliza- tion may destroy live bacteria but not their residual pyrogens.
Purine and pyrinidine bases found in nucleic acids
pyridine An organic molecule that con- tains fi ve carbon atoms and one nitrogen atom in a ring. Used to dissolve otherwise diffi cult-to-solubilize biological materials. Pyrimidine ribonucleosides
pyrimidine A six-membered, nitrogen- containing, ringed molecule that is the par-
199 干细胞之家www.stemcell8.cn ←点击进入
Q
Qa locus One of the genetic subloci queuosine An unusual purine base within the mouse major histocompatibil- found only in transfer RNA. Queuosine ity locus (H2). Qa codes for an antigen is formed by adding a pentenyl ring to 7- that is only found on a subset of blood methylguanosine. cells, and so it is considered to be a dif- ferentiation antigen. quinacrine A synthetic antimalarial compound that is also used as a fl uores- q-arm The long arm of the human chro- cent stain for chromosomes. mosome. quinine An alkaloid drug derived from the bark of the cinchona tree that is found q banding The technique of staining in South America and Indonesia. Quinine chromosomes using quinacrine. This is an antimalarial drug that is also used technique produces a unique pattern of to relieve fever and pain in other diseases. chromosomal bands that can be used At one time, quinine was the only drug clinically for chromosome identifica- available for treatment of malaria, but it tion. has been replaced to a large extent by syn- thetic drugs, such as quinacrine. quadroma An antibody-producing cell that secretes antibodies made up of the quinone A class of cyclic organic com- random association of heavy and light pounds such as phylloquinone, plastoqui- chains from two different antibodies. none, and ubiquinone that is widely used This is an intermediate in the formation to carry hydrogen atoms in certain critical of a bispecifi c antibody, in which the two steps in the process of energy production binding sites recognize different antigens. in both plants and animals. Chemically, The quadroma is formed by the fusion quinones are characterized by the presence of two monoclonal antibody-producing of two ketone groups (C=O) on the same cells. hydrocarbon ring.
200 干细胞之家www.stemcell8.cn ←点击进入
R
R1 particle An intermediate stage in the RAG2) that catalyze the cleavage of DNA formation of the 30S ribosomal subunit. segments within the immunoglobulin genes An R1 particle is formed from a strand of that is the fi rst step in immunoglobulin gene 16S RNA and 15 ribosomal proteins. rearrangements whereby different V (vari- able) segments are linked with different J racemate A mixture of two different forms (joining) segments to create a large spectrum of a molecule that do not differ from each of immunoglobulin molecules with many other chemically but that have a different different specifi cities. The RAG proteins physical arrangement of atoms that can be dis- generate double-strand breaks at sites called tinguished by methods using polarized light. recombination signal sequences (RSS) that are present in both the V and J segments. radial immunodiffusion An immuno- logical test based on the reaction of an anti- Ramachandran plot For a given pep- body with a protein that has been allowed tide, a graph that plots the angle of rota- to seep out of a central well into a slab of tion around the bond between the alpha agar where the reaction takes place. carbon and the carbonyl carbon (ψ) ver- sus the angle of rotation around the bond radioimmunoassay A sensitive test for between the alpha carbon and the amide a particular protein, based on the reac- nitrogen (Φ). This type of plot is used to tion of that protein with an antibody give an idea of the combinations of bond specifi c for it, where one of the reacting angles that occur in the peptide. This agents is radioactively labeled. information can be used to help deter- mine how the peptide is folded. raf A protein intermediate in the signal- transduction-cascade pathway initiated Raman spectroscopy A type of spec- by receptor tyrosine kinase activation. In troscopy that measures the wavelength of this pathway a ras-GTP complex binds “inelastically” scattered photons (i.e., scat- to the N terminal end of cytosolic raf, tered photons whose wavelength is differ- whose C terminal end has serine/threo- ent from that of the incident photons). The nine kinase activity that acts to phos- scattering of light occurs at wavelengths phorylate and thereby activate MEK, a that are shifted from those of the incident MAP-kinase kinase (MAPKK). light by the energies of molecular vibrations (bond stretching). Like infrared spectroscopy, raf oncogene An oncogene that is Raman spectroscopy gives information about found in murine sarcoma virus and that the type of bonds present in a compound but is associated with fi brosarcoma tumors is different from infrared spectroscopy by in both rodents and humans. The normal being able to see signals from bonds that are homologue of the raf oncogene encodes perfectly symmetrical and therefore have no the protein raf. raf is an acronym derived dipole. Raman spectroscopy is used in mak- from rat fibrosarcoma. ing structure determinations of biomolecules.
RAG proteins Recombination activat- random primer labeling A technique ing gene proteins; two proteins (RAG1 and for labeling DNA that is based on the
201 干细胞之家www.stemcell8.cn ←点击进入
ras oncogene
molecular weight that is coded for by the gene associated with the familial form of retinoblastoma. (See fi gure at left.)
R banding A characteristic pattern of bands produced when chromosomes are stained by various dyes, for example, olivomycin. The basis of the pattern of R bands is the abundance of DNA rich in guanine-cytosine (G-C) base pairs.
reactive oxygen species (ROS) Any E2F transcription factors induce the expres- of a group of small molecules containing sion of genes required for cell-cycle progres- a highly active form of oxygen, including sion, but these transcription factors are main- - . superoxide (O2 ), hydroxyl radical (OH ), tained in an inactive state in a complex with hydroxyl ion (OH-), or peroxides R-O-O- the retinoblastoma tumor suppressor, Rb, and R´. ROS are produced as a consequence an Rb-related protein, p107. E2F is released in of ionizing radiation such as X-rays and active form from the complex in late G1 after gamma rays but are also produced natu- phosphorylation of Rb by cdk2-cyclin A. Inacti- rally as a consequence of enzymes pres- vation of Rb by phosphorylation begins in late ent in neutrophils and macrophages G1 and continues throughout the S phase. or normal respiratory chain reactions, especially those involving ubiquinone. Because of their reactivity, ROS are dam- aging to biomolecules, particularly DNA, annealing of a mixture of short primers and unrepaired DNA damage can lead to with randomly determined sequences to cancer-causing mutations. ROS are inac- the DNA strand. Labeling takes place tivated by antioxidants such as vitamin by extension of the primers (see primer C and also by certain enzymes such as extension) using labeled nucleotides. superoxide dismutase (SOD) and cata- lase. ras oncogene The oncogene that is found in rat sarcoma virus and that is reading frame Any one of the three associated with sarcomas in rodents and possible ways of reading a sequence of carcinomas in human. The name is an amino acids from a nucleic acid using the acronym derived from rat sarcoma. In genetic code; the three different reading mammals the ras proto-oncogene has a frames are determined by which base in GTP binding activity that is believed to be any group of three consecutive bases is homologous to the action of G proteins. chosen as the start point.
Rb An abbreviation for the anti- reassociation kinetics A technique oncogene protein product of 110,000 for estimating the number of copies of a
Reading frame
202 干细胞之家www.stemcell8.cn ←点击进入
recombination
particular nucleic-acid base sequence in sensor, the ATHK1 osomo-sensor, and in a sample by measuring the rate at which the bacterial chemotaxis system mediated denatured nucleic acid in the unknown by the histidine kinase CheA. sample anneals to strands of a known nucleic acid with the same or similar receptor-mediated endocytosis The sequence to that being determined. process by which many ligands that bind to receptors on the cell surface enter reassociation of DNA Reannealing of into the cytosol. During receptor-medi- the complementary strands of DNA after ated endocytosis, the plasma membrane the paired strands have been separated by undergoes invagination in the region heat or strong acid or alkalai. surrounding a receptor that has bound a ligand to form a vesicle (an endosome) RecA A bacterial protein that is respon- that eventually separates from the plasma sible for the major steps in recombination membrane and migrates into the cytosol. following the introduction of strand nicks by RecBCD: strand invasion, branch recessive A form of a gene whose migration, and formation of the Holliday effect on the phenotype of an organism is structure. The RecA protein also plays a masked by an alternate (dominant) form role in DNA repair by regulation of the of the gene. SOS response following DNA damage. recessive allele The term for a reces- RecBCD A bacterial enzyme that medi- sive gene on a chromosome. ates certain critical events in the process of recombination including DNA strand reciprocal translocation An exchange unwinding (helicase activity) and the cre- of material between chromosomes, usu- ation of single-stranded nicks at special- ally by breakage of each of the partici- ized sites (chi sequences). pating chromosomes at a specifi c site. A translocation involves movement of a receptor A specialized cell surface mol- physical portion of a whole chromosome. ecule or complex of molecules that serves as a site of attachment for a specifi c effec- A DNA that has tor molecule (the ligand), for example, a recombinant DNA hormone. The receptor may also function become joined to another unrelated or to produce a biological response in the foreign segment of DNA. cell to which the ligand is bound via its receptor. recombinant proteins Proteins produced by cloning technology, usually by splicing the receptor His kinase A type of signal- DNA sequence for the protein into a vector, transduction system found in plants transferring that vector into a host organism, and bacteria that transmits signals from usually a bacterium or a yeast, and harvest- membrane receptors by causing a phos- ing the protein after growth of the host. phate group to be transferred to a histi- dine residue on a transduction protein. recombinase An enzyme that catalyzes In these systems the phosphate is usually the joining of immunoglobulin gene seg- rapidly transferred from the histidine to ments during the recombination event an aspartate residue on another protein involved in immunoglobulin gene switching. (his-to-asp phosphorelay). This type of signaling is involved in the sensing of recombination The process by which certain environmental stimuli such as the DNA from a gene on a large genetic unit; presence of phytohormones, in Arabidop- for example, a chromosome becomes sis thaliana. Histidine kinase signaling exchanged with the corresponding DNA is also involved in the ETR1 family of on a complementary genetic unit such as ethylene receptors, the CKI1 cytokinin- another chromosome that is an allele.
203 干细胞之家www.stemcell8.cn ←点击进入
recombinational repair
by the symbol Eo′, a number that represents the extent to which the atom or molecule in question donates or accepts electrons to or from hydrogen as a standard reference.
redundancy Existing in more than one copy, for example, in repetitive DNA.
refractory phase A period of time required after emission of a nerve impulse for regeneration of the ability of a neuron to emit a new nerve impulse.
Refsum disease An autosomal reces- sive genetic disease that is one of the Recombination leukodystrophies, characterized by dam- age to the white matter of the brain and impaired movement. The disease is caused recombinational repair A mechanism by a lack of the enzyme that breaks down for repairing thymine dimers based on phytanic acid, which as a result causes recombining an undamaged piece of DNA toxic levels of phytanic acid to build up in from the undamaged strand into the dam- the brain, blood, and other tissues. The aged region during DNA replication. symptoms include increasing night blind- ness, loss of the sense of smell (anosmia), reconstituted viral envelopes (RVEs) and over time, deafness, ataxia, periph- Viral envelopes whose contents have eral neuropathy, and cardiac arrhythmias. been removed or replaced with other sub- Refsum disease can result from mutations stances. RVEs are made by a two-step in any of three genes: phytanoyl-CoA process in which the whole virus is fi rst hydroxylase (PAHX or PHYH, chromo- completely disassembled and then the somal location 10pter-p11.2) or the gene- components of the envelope portion are encoding peroxisome biogenesis factor, allowed to reassemble. RVEs are used to peroxin-7 (PEX7, gene map locus 6q22- deliver substances of biological interest to q24). various types of animal cells. See deliv- ery system and fusogenic vesicles. regeneration The ability to grow an organ, a structure, or a whole organism recoverin A small (23 kDa) calcium- from one or a few cells. binding protein found mainly in the pho- toreceptors of the vertebrate retina. Recov- regulatory enzyme An enzyme that is erin plays a role in regulating the process part of a biochemical pathway, usually of phototransduction by binding to rho- the fi rst enzyme in the series, and that dopsin kinase (GRK1), which prevents serves as a regulator of the chemical reac- the inhibition of rhodopsin through phos- tions in the pathway by either speeding phorylation. This in turn prolongs the light up or slowing down the chemical reaction response. There is one mammalian gene it controls in response to some environ- (rcv1; gene map locus 17p13.1) and there mental condition(s). are orthologues of recoverin present in the photoreceptors of most vertebrate species, regulatory gene A gene whose product beginning with amphibians. controls the expression of another gene or genes. The repressor proteins of the lac redox potential A measure of the affi n- operon and the lambda bacteriophage cI ity that an atom or a molecule has for elec- regions are examples of regulatory gene trons. The redox potential is usually given products. See lac repressor protein.
204 干细胞之家www.stemcell8.cn ←点击进入
replication eye
regulatory sequence A nucleic-acid including tumor necrosis factor, interleukin sequence that serves as a site at which 1, T-cell activation signals, bacterial endo- the protein product of a regulatory gene toxins, viral-transforming proteins, growth attaches; attachment of a regulatory factors, and reactive oxygen species induce protein to a regulatory sequence is the phosphorylation of NFkB, which leads to mechanism by which a regulatory gene its translocation into the nucleus where IkB controls the expression of another gene. is degraded. In the nucleus NFkB acts as a See enhancers and silencers. transcription factor for genes encoding cyto- kines, cytokine receptors, cell adhesion mol- regulon A set of spatially separated ecules, proteins involved in coagulation, and genes under the control of a single repres- genes involved in cell growth control. NFkB sor-operator system. See operator. is also believed to be an important transcrip- tional regulator for HIV. rel is located on relaxed The state of a large molecule, chromosome 2p13-p12. for example, a long DNA molecule or a protein, being in a loose conformation or renaturation The process of a molecule loosely folded over on itself. Change in assuming its native shape or conforma- biological activity is often related to the tion after disruption of the native state, degree of twisting, folding, or compres- for example, the reassociation of DNA. sion of a molecule. reovirus A group of RNA containing relaxin A peptide hormone produced by viruses that infect both the gut and respira- the corpora lutea of ovaries during preg- tory tracts, usually without causing observ- nancy. The hormone causes softening of able disease. The name is an acronym the cervix and plays a role in regulating derived from respiratory enteric orphan. contractions during the birth process. The relaxin family is a member of the insulin repair synthesis Synthesis of new DNA superfamily and contains seven peptides: to replace a defective segment that has relaxins 1, 2, and 3, and the insulin-like been removed; repair synthesis usually (INSL) peptides INSL3, INSL4, INSL5, involves creating a complementary DNA and INSL6. The relaxins are now believed strand from the remaining, nondefective to be involved in a variety of functions DNA strand. See excision repair. other than parturition. These putative functions include regulation of pituitary repetitive DNA A class of eukaryotic hormone secretion, renal vasodilatation, DNA sequences that are present in many, enhancement of coronary fl ow, and pro- sometimes thousands or millions, of copies motion of nitric oxide biosynthesis that throughout the genome. See Alu elements. may affect smooth muscle function. replacement sites DNA nucleotide bases release factor A protein that causes the that, when changed, for example, by process of translation to terminate when a mutation, result in a change(s) in the termination signal on the mRNA is present. amino acid(s) that the DNA codes for.
rel oncogene The oncogene product car- replica plating A procedure by which ried by the avian reticuloendotheliosis virus bacterial colonies growing on one bac- strain T (v-rel); the cellular product relA is terial plate are reproduced on a second the p65 subunit of the NF-kappa B tran- bacterial plate in the exact relative posi- scription factor, a member of the rel/NF- tions to one another as they were in the kappa B family of transcription factors; original plate. these transcription factors are critical media- tors of immune and infl ammatory responses. replication eye The opening cre- In most cells NFkB is associated with IkB, ated between DNA strands as a result of an inhibitory protein. A number of stimuli, unwinding of the DNA helix during the
205 干细胞之家www.stemcell8.cn ←点击进入
rel oncogene
membrane cytoplasm
rel (p65) I k B
p65-p50 dimer
nucleus
phophorylation of IkB releases p65-p50 dimer
I k B P
translocation of p65-p50 dimer to nucleus
activation of transcription
nucleus
206 干细胞之家www.stemcell8.cn ←点击进入
response coeffi cient
replisome includes DNA polymerase, pri- mase, DNA ligase, DNA helicase, single- strand binding (SSB) protein, and topoi- somerase.
reporter gene A gene whose expres- sion is linked to the expression of another gene or biochemical process.
repressible enzyme An enzyme whose expression is governed by repression of gene transcription.
repressor protein A regulatory protein that exerts control over gene expression by binding to a regulatory sequence and thereby preventing transcription of the gene.
reptation The process by which a Replication fork nucleic acid strand is threaded through the pores in an agarose gel matrix in a process of DNA replication (replication “headfi rst” fashion during pulsed fi eld- forks). gel electrophoresis.
replication fork The portion of the resolvase An enzyme that catalyzes partially replicated DNA consisting of the the site-specifi c recombination event that separated DNA strands plus the newly syn- results in the integration of some trans- thesized copies. See antiparallel, lag- posable elements. Resolvase is coded for ging strand, and Okazaki fragment. by a gene on a transposable element.
replication of DNA The process in resorufi n--D-galactopyranoside (RG) which DNA is copied by using each A synthetic substrate for the enzyme, beta- of the strands as a template for a new galactosidase, the product of the lacZ strand. Because with each round of DNA gene that produces a fl uorescent pro- synthesis the new DNA consists of one duct in the presence of the enzyme. RG is newly synthesized strand and one paren- used to detect the expression of the lacZ tal strand, the process of DNA replica- gene in individual cells by fl uorescence- tion is called semiconservative. See DNA activated cell sort-ing (FACS). polymerase(s).
replication origin A sequence of nu- respiration The oxygen-dependent pro- cleotide bases that provides a signal for cess of generating energy in the form of ATP the start of DNA replication. from sugars. See electron transport.
replicon The exact site on the DNA at response coeffi cient A number that which replication is actively taking place. gives a measure of how the rate of fl ow th- See replication origin. rough a given biochemical pathway chan- ges as a result of some outside infl uence replicon fusion The meeting of two such as a hormone or change in the con- replicons approaching each other from centration of an ion. The response coef- opposite ends of replicating DNA. fi cient (R) is made up of two components: the sensitivity of the pathway to the en- replisome The complex of factors that zyme (C) and the sensitivity of the enzyme are active at a DNA replication fork. The to the outside infl uence (ε), R = C·ε. If
207 干细胞之家www.stemcell8.cn ←点击进入
resting potential
response coeffi cients are known for each foreign antibody-agglutinated antigens enzyme in the pathway, then it is possible from the bloodstream. to predict how the rate of fl ow through the pathway will be affected by a particu- retinoblastoma A cancer of the cells lar outside infl uence. of the retina that occurs in small chil- dren. Retinoblastoma was one of the fi rst resting potential The electrical poten- cancers that was shown to run in families tial across the membrane of a neuron in (familial retinoblastoma) and was there- between nerve impulses. fore genetic in origin. See Rb.
restriction endonuclease (restriction retinoic acid receptors (RAR, RXR) enzyme) An enzyme, produced by bac- Transcription factors that are activated teria, that cleaves DNA at a place defi ned by binding to retinoids in the cytosol. by a specifi c sequence of nucleotide bases. The activated factors are responsible for inducing the expression of genes seen in restriction fragments The DNA frag- retinoid-treated cells. There are two types ments that are produced by cleavage of of retinoid receptors, RAR and RXR, DNA by a restriction endonuclease. which bind the trans form of retinoic acid and the cis form, respectively; each type of restriction mapping A technique of receptor has α, β, and γ isoforms. Because mapping DNA by determining the location they serve a function in the nucleus (tran- of sites for different restriction enzymes. scription), RAR and RXR are referred to as nuclear receptors similar to receptors restriction site The nucleotide base for thyroid hormone, vitamin D3, and sequence on DNA that specifi es the site steroids. Retinoic acid receptors play an where a given restriction endonuclease important role in the growth and differen- will cleave. tiation of epithelial tissues, the generation of new blood cells (hematopoiesis), and in reticulo-endothelial system (RES) All central nervous system development. The the phagocytic cells of the body except the RARα gene is a common target in chro- circulating leukocytes. Cells of the RES mosomal translocations in acute promy- remove particulate matter, for example, elocytic leukemia (APL).
Computer-generated restriction map
208 干细胞之家www.stemcell8.cn ←点击进入
reverse transcriptase
retrograde transport The process by acronym derived from reverse transcriptase which materials move from the plasma = retravirus, which later became retrovirus. membrane to lysosomes or to the Golgi apparatus and then to the endoplasmic retrovirus vector A genetically engi- reticulum; the direction of transport is neered DNA for cloning recombinant opposite from that taken by newly syn- DNA that utilizes certain control ele- thesized membrane proteins (anterograde ments from retroviruses. transport). Retrograde transport is part of the process by which “worn-out” mem- reverse genetics The term used to brane components are recycled. This pro- describe the type of genetic analysis in cess is particularly evident in nerve cells, which the structure of a gene is deter- where parts of membranes from synaptic mined from the protein that it codes for. vessels move along the axon toward the In the more common type of analysis, the cell body for lysosomal degradation and protein structure is determined from the recycling. Various toxins, such as ricin, structure of its corresponding gene. pertussis toxin, and tetanus toxin, make use of the retrograde transport system for reverse mutation A mutation that reverses their delivery to intracellular targets. the effects of a previous mutation. The reverse mutation may or may not be localized near retroposon A type of transposon that has or at the site of the mutation whose effects it suppresses. See suppressor mutation. a structure similar to a retroviral genome in that it contains LTR-like sequences fl ank- reverse transcriptase The enzyme, ing a coding region and it replicates via made and used by retroviruses during an RNA intermediate that is reverse tran- their life cycle, that catalyzes the synthesis scribed into a double-stranded form that of DNA copied from an RNA template. integrates into the genomic DNA. The enzyme is widely used in genetic engi- neering and molecular biology to make so- retrovirus A class of viruses characterized called complementary DNA (cDNA) from by having an RNA genome and carrying various RNAs so that base sequences in the enzyme reverse transcriptase within the RNA can be cloned and manipulated by virus capsid. The name was originally an recombinant DNA technology.
Retrovirus
209 干细胞之家www.stemcell8.cn ←点击进入
rectoreverse transcription
Retrovirus life cycle
reverse transcription The term that The presence of the Rh factor in a fetus describes the action of the enzyme, whose mother is Rh– may provoke a life- reverse transcriptase. threatening agglutination of the fetal blood cells. The term is named for the rhesus rhesus blood groups Classifi cation of monkey, the organism that was used to blood cells according to whether or not demonstrate the presence of the antigen. they react with antibodies to the blood There are at least 30 distinct subtypes of cells of rhesus monkeys. Rh factor.
rheumatoid factors Certain antibod- rhinovirus A picornavirus that infects ies (IgM) present in the blood of some the nasal cavity and causes many of the individuals with rheumatoid arthritis that symptoms of the common cold, particu- react against other antibodies. Since it was larly the nasal symptomatology. discovered that different rheumatoid fac- tors are specifi c for only certain subgroups rhizobium A leguminous plant that is of antibodies, rheumatoid factors became a rich source of nitrogen-fi xing bacteria a means of classifying an individual’s anti- that live in large nodules attached to the bodies into subclasses (allotypes). plant roots.
Rh factor An antigenic substance on rho factor A small bacterial protein the surface of the blood cells of any indi- that is responsible for causing tran- vidual that carries the Rh trait (Rh+). scription to terminate when a ribosome
210 干细胞之家www.stemcell8.cn ←点击进入
rifampicinverso
encounters an appropriate termination ribosome A small organelle in the cyto- signal on the mRNA. plasm that is the site where protein syn- thesis takes place. Ribosomes are made
ribofl avin Vitamin B2; an important up of two subunits. The subunits are cofactor for enzymes involved in the assembled together with a strand of mes- metabolism of sugars for ATP produc- senger RNA to begin protein synthesis. tion. Ribofl avin acts to transport elec- trons derived from the oxidation of sug- ribozyme An RNA with enzymatic ars in energy production. properties. The idea that RNAs could function as enzymes was fi rst suggested by Carl Woese, Francis Crick, and Leslie ribonuclease A class of enzymes that Orgel in 1967. Thomas Cech described breaks down RNA by breaking the bonds the fi rst ribozyme, a self-splicing RNA between the phosphate and the ribose in Tetrahymena thermophila. The bacte- molecules in the RNA backbone. rial 23S ribosomal RNA has also been shown to be a ribozyme that catalyzes the ribonucleic acid See RNA. peptidyl transferase step in the process of protein synthesis. Synthetic ribozymes ribonucleotide A molecule consisting are being studied as possibly better alter- of ribose that is bound to phosphate and natives to protein enzymes. In 1989 the with a purine or pyrimidine base attached Nobel Prize in chemistry was awarded to to the ribose molecule. Ribonucleotides Thomas R. Cech and Sydney Altman for are the building blocks of ribonucleic acid their discovery of catalytic RNAs. (RNA). ricin A potent, poisonous protein de- ribose A fi ve-carbon sugar normally in rived from the beans of the castor plant, a ring conformation; the sugar used in R. communis, from which castor oil is ribonucleotides. See carbohydrate. derived. Its lethality and ease of extrac- tion make ricin an attractive choice as a ribosomal protein Any one of many biological warfare agent. Ricin is com- proteins that, together with a strand of posed of two hemagglutinins and two RNA, form a ribosomal subunit. toxins (RCL III and RCL IV) that are dimers of approximately 66 kDa. The ribosomal RNA (rRNA) A long toxins are composed of an A and B chain. strand of RNA that, together with ribo- The B chain mediates entry of the toxins somal proteins, is a component of a ribo- into the cells after binding to the cell sur- somal subunit. In eukaryotic cells there face glycoproteins. The A chain acts to are two rRNAs denoted as 18s (found block protein synthesis by attaching to in the small ribosome subunit) and 28s the 60S ribosomal subunit and blocking (found in the large subunit). rRNA plays the binding of elongation factor-2, which a role in binding mRNA in the process of results in cell death. translation. Rickettsia Small bacteria which, unlike most other bacteria, are obligate parasites that live within, instead of outside of, the cells of the infected host. Rickettsia are the agents that cause typhus fever and Rocky Mountain spotted fever.
rifampicin An antibiotic that blocks transcription by inhibiting the action of RNA polymerase in bacteria, specifi cally by inhibiting the initiation of the process Ribose of transciption.
211 干细胞之家www.stemcell8.cn ←点击进入
rectoR loops siRNA
dicer enzyme
double-stranded RNA
small degraded RNA fragments
RISC silencing complex
mRNA with homologous segment
degraded mRNA
R loops R loops are the segments of RNA Ribonucleic acid. A polymer of DNA-representing introns that are seen ribonucleotides, the purine and pyrimi- as single-stranded loops in electron dine base sequence that generally is micrographs of heteroduplexes between a complementary to a DNA base sequence. eukaryotic mRNA and the genomic DNA There are four major classes of RNA that from which the mRNA was transcribed. perform different functions in the pro-
212 干细胞之家www.stemcell8.cn ←点击进入
rRNAverso
cess of protein synthesis: messenger RNA strands that are shortened into functional (mRNA), transfer RNA (tRNA), ribo- tRNAs. somal RNA (rRNA), and small nuclear RNA (snRNA). RNase H An enzyme that cuts RNA chains from within the chain, creating RNA-DNA hybrid(s) A double- nicks in the phosphodiester backbone. stranded hybrid molecule in which RNA This enzyme is used during production is based paired with a complementary of cDNA. After the fi rst strand of DNA is strand of DNA. made from the RNA template, Rnase H is used to nick the template to create primer RNA interference (RNAi) An experi- ends for second DNA strand synthesis. mental technique for silencing expression of a specifi c gene(s) through the use of RNA tumor virus A subclass of retro- small double-stranded RNA (dsRNA) to viruses that produces cancers by activa- specifi cally target an homologous mRNA. tion of oncogenes. In this technique dsRNA, which is intro- duced into a cell, is cleaved into small (ca. RNP Ribonucleoprotein. 23 bp) fragments by an enzyme called Dicer. The small RNAs (called short ros oncogene An oncogene that is interfering RNAs; siRNAs) are “trig- found in a stain of avian sarcoma virus ger” molecules for the siRNA-Dicer com- and that is associated with sarcoma plex to recruit other factors to form an tumors in birds. The name is an acronym RNA-induced silencing complex (RISC). derived from Rochester 2 sarcoma virus. The siRNAs in the RISC can base pair with mRNAs that have complementary Rot In the annealing of RNA to DNA, a sequences which are then also cleaved variable equal to the molar concentration and degraded by RISC. of the RNA multiplied by time allowed for RNA-DNA annealing. Rot values are RNA maturase An enzyme involved generally used in plots of the annealing of in the splicing of transcripts in the yeast RNA to complementary DNA sequences. mitochodial cytochrome b gene. The See Cot value. RNA maturase gene is unusual in that part of the gene is found in an intron of rotavirus A class of RNA-containing the cytochrome b gene itself. viruses that infects the intestinal tract and is responsible for epidemic gastroen- RNA polymerases The class of enzymes teritis and infantile diarrhea. that catalyzes the synthesis of a strand of RNA using DNA as a template to guide rough ER Endoplasmic reticulum cov- the assembly of ribonucleotides so that the ered with attached ribosomes. Proteins order of the purine and pyrimidine bases synthesized by the ribosomes on the in the DNA template is precisely copied, in rough ER are destined to be transported complementary fashion, in the newly syn- out of the cell via vesicles that are derived thesized RNA. from the endoplasmic reticulum.
RNA secondary structure The hairpin Rous sarcoma virus (RSV) A retro- folding of an RNA molecule caused by virus that produces sarcoma tumors in internal base pairing of complementary chickens. RSV, discovered and named for stretches of purine and pyrimidine bases. Peyton Rous, was the fi rst RNA tumor virus discovered. RNase D An exonuclease that removes nucleotides from the 3′ end of an RNA rRNA Abbreviation for ribosomal RNA, in one-at-a-time fashion. RNase D is the RNA strands that are, together with involved in the maturation of tRNAs the ribosomal proteins, the basic compo- that are synthesized in large precursor nents of ribosomes. In eukaryotic cells
213 干细胞之家www.stemcell8.cn ←点击进入
rectoRTK
RTK
there are two major rRNAs denoted as rubella An RNA-containing virus (toga- 18s (found in the small ribosome subunit) virus) responsible for German measles. and 28s (found in the large subunit). rumen bacteria Bacteria that live in RTK Receptor tyrosine kinase; a class the rumen of ruminant animals such as of transmembrane proteins whose extra- cows. The rumen bacteria utilize urea cellular domain functions as a cell sur- that would otherwise be excreted to make face receptor; the cytosolic domain acts amino acids, that are then returned to the as a tyrosine kinase. Binding of a ligand circulatory system of the animal. to the receptor domain initiates the pro- cess of signal transduction by activating Runting syndrome A pathological the tyrosine kinase domain that, in turn, condition, characterized by skin lesions, brings about a cascade of subsequent pro- diarrhea, and death, that results when the tein phosphorylations, ultimately lead- lymphocytes from a mature animal are ing to induction of transcription of genes placed in and then attack the tissues of a involved in cell-growth regulation. newborn.
214 干细胞之家www.stemcell8.cn ←点击进入
AS
S1 nuclease An enzyme that catalyzes for typhoid fever and a number of wide- the breakdown of any single-stranded (or ranging intestinal disorders. single-stranded region of a) nucleic acid. saltatory movement The directed S1 nuclease mapping A technique of movements of organelles in the cell cyto- determining where, on a segment of DNA, plasm. This type of movement is thought the precise location of the sequences from to be controlled by microtubules. which a given RNA is transcribed. saltatory replication Replication of a S-100 (calgranulin) Pro-infl ammatory DNA sequence that produce extra copies of cytokines expressed by types of leukocytes the sequence along the same DNA strand. called monocytes and granulocytes under This type of process is believed to have been conditions of chronic infl ammation; ele- responsible for the highly repeated, tandemly vated levels of calgranulins are found in arrayed sequences seen in satellite DNA. patients with cystic fi brosis. The calgranu- lins are calcium-binding proteins that con- salting out The phenomenon of causing sist of at least two different polypeptides, dissolved proteins or nucleic acids to precip- designated A and B, coded for by genes itate out of solution by the addition of salts. on human chromosome 1q12-q21. A cell- surface receptor for S100A12, known salt stabilization A phenomenon whereby as RAGE, interacts with a factor called slow denaturation of proteins and nucleic ENRAGE (extracellular newly identifi ed acids in aqueous solution is prevented by the RAGE-binding protein) in endothelium, addition of salts. mononuclear phagocytes, and lympho- cytes and triggers the generation of key Sanger, Frederick (b. 1918) Discov- pro-infl ammatory mediators. erer of the fi rst means by which the amino acid sequence of a polypeptide could by saccharide The biochemical term for a determined. Sanger is famous for the dis- sugar. covery of the amino acid sequence of insu- lin in 1954; he was awarded the Nobel Saccharomyces cerevisiae A yeast Prize in chemistry in 1956. that is widely used as a vehicle for cloning extremely large segments of foreign DNA Sanger method A method for deter- (see yeast artifi cial chromosome) mining the sequence of a polypeptide and for molecular studies on many ani- based on determination of the identity of mal genes that have homologues in yeast. the terminal amino acids of small sub- fragments of the original polypeptide. saline A solution of sodium chloride at a concentration exactly equivalent (eight Sanger (dideoxy) sequencing A tech- grams per liter; 0.8 percent) to that found nique for determining the sequence of a seg- in bodily fl uids. ment of DNA that utilizes synthetic nucleo- tides (dideoxy nucleotides) to create small Salmonella A group of Gram-negative, polynucleotides representing small subfrag- rod-shaped bacteria that is responsible ments of the DNA that are to be sequenced
215 干细胞之家www.stemcell8.cn ←点击进入
rectosaprotroph
but that can be made to terminate specifi - of the trematode worms of the genus cally at any one of the four purine or pyrim- Schistosoma. Schistosomaiasis is endemic idine bases. See dideoxy sequencing. in the populations of Africa, the Middle East, and South America. saprotroph An organism that obtains nourishment from nonliving matter. schizonte A subgroup of protozoa (spo- rozoa) that reproduces asexually. Plasmo- sarcoma-derived growth factor (SGF) dium is a schizonte that causes malaria. A growth factor secreted by cells infected with murine sarcoma virus, an RNA Schwann cells A type of brain cell tumor virus. Because noninfected cells that encompasses the axon of a neu- treated with SGF undergo changes gener- ron, thereby forming a sheath of myelin ally characteristic of cells transformed into around the axon. The myelin sheath is a cancerous state, sarcoma derived growth essential for proper transmission of nerve factor is now referred to as transforming impulses between neurons. Multiple growth factor (TGF). sclerosis is an example of a disease that induces loss of muscle control by causing sarcoplasmic reticulum A membranous demyelination of the axon. structure that surrounds the myofi brils in muscle tissue. The sarcoplasmic contains scintillation counter A sensitive device calcium pumps that regulate the level of for detecting single emissions of particles ++ calcium ion (Ca ) in muscle tissue. produced by radioactive decay.
sarcosine A component of the antibiotic, screen A method developed to detect and/ actinomycin D, an inhibitor of transcription. or select a recombinant protein, mutant, inter- Chemically, sarcosine is N-methyl glycine. acting protein, drug, hybridoma, and so on.
satellite DNA A type of DNA made up SDS Sodium dodecyl sulfate; a detergent mostly of repeated sequences that are not widely used to dissociate biological mate- transcribed into RNA and that are found rials into their component molecules. near the chromosome centromere. SDS-polyacrylamide-gel electropho- satellite RNAs See virusoids. resis (PAGE) A variation of the poly- acrylamide-gel electrophoresis technique scanning electron microscopy (SEM) A in which SDS is dissolved in the poly- variation of electron microscopy in which the acrylamide gel. This type of gel is widely specimen is given a thin coat of metal so that the electron beam can be used to visualize used to separate proteins in mixture from details of the cell surface as opposed to inter- one another on the basis of size. nal structures. secondary culture The cell culture that scatter plot A graph that shows the is derived from the original outgrowth of relationship between two variables as a cells derived directly from a tissue speci- set of data points. men (i.e., the primary culture).
Schiff’s reagent A chemical (fuchsin secondary structure The manner in leucosulfonate) used in the periodic-acid which a linear polypeptide is folded, tw- Schiff (PAS) stain that is used to identify isted, or otherwise bent. The most common the presence of certain infecting microor- types of secondary structure are the alpha- ganisms; for example, fungi. helix and the pleated-sheet structures.
schistosomiasis A group of diseases second-order kinetics (bimolecular whose symptoms range from dermatitis kinetics) A term describing the rate at to cirrhosis of the liver. The symptoms which a chemical reaction involving two are caused by parasitic infection by one reacting molecules occurs.
216 干细胞之家www.stemcell8.cn ←点击进入
Sendai versovirus
secretion The ability of the host cells that ture of oligonucleotides is passed through produce recombinant proteins products to a column containing a matrix to which release the products extracellularly. Large- the target molecule (for example, ATP) scale production of recombinant proteins is attached. Oligonucleotides that bind to requires the secretion of the product into the target will be retained on the column, the culture medium for easy harvesting. while nonbonding oligonucleotides will Vectors have been developed that fuse wash through the column. The retained recombinant DNA protein products with oligonucleotides can be eluted and ampli- sequences that will direct the proteins to the fi ed and passed through the column again surface of the host cells. In addition, bacte- in order to select oligonucleotides with rial hosts are being developed that more stronger binding affi nities to the target. This is repeated multiple times to select a easily secrete proteins than E. coli hosts. few candidate oligonucleotides with very high binding affi nities to the target. segment polarity mutants Mutants of the fruit fl y, Drosophila melanogaster, in which one of the halves of each segment self-assembly The spontaneous, unas- (the P compartment) is replaced by the sisted assembly of the components of a other half (the A compartment) so that complex structure, for example, the pro- each segment contains two mirror images tein viral coat of tobacco mosaic virus. of one of the normal halves. self-protein Any protein that, as the segments, segmentation A pattern result of immunological screening in early that develops in the embryo of the fruit life, is determined to be “self” and there- fl y, Drosophila melanogaster, which is fore not recognized as a foreign antigen that defi ned by indentations giving the embryo would be attacked by the immune system. the appearance of stacked disks with Certain illnesses, referred to as autoimmune each disk representing a segment. Vari- diseases, result from a failure of the immune ous structures of the adult such as legs, system to recognize self-proteins. antennae, wings, and eyes develop from specifi c segments. Each segment consists self-tolerance The lack of an immune of two halves: the A (anterior) compart- response to a self-protein. ment and the P (posterior) compartment. semiconservative replication The mode selection The ability to detect a recom- of DNA replication in which each of binant protein, mutant, interacting protein, the original parental DNA strands is hybridoma, and so on. Selection techniques based paired with one newly synthesized may make use of selective medium or spe- daughter strand. Experiments performed cifi c markers on cells to be detected. by Matthew Meselson and Franklin Stahl in the mid-1950s demonstrated that selective medium A growth medium DNA replication was semiconservative as that, either by the inclusion of a toxic opposed to conservative. This fi nding laid substance or by the lack of an essential the foundation for future experiments nutrient, promotes the growth of only cer- that ultimately elucidated the molecular tain variant organisms in a population, for details of the process of DNA replication. example, the growth of penicillin-resistant bacteria on a nutrient agar that contains semidiscontinuous replication DNA penicillin. See synthetic medium. replication involving the synthesis of many small fragments that occurs on the lagging SELEX Systematic evolution of ligands strand of double-stranded DNA in the by exponential enrichment; an iterative form of Okazaki fragments. technique for selecting oligonucleotides that bind to certain target molecules Sendai virus A member of the para- from a mixture of random oligonucle- myxo viruses that is used to induce cell otides. In the SELEX technique, a mix- fusion, a technique for creating hybrid
217 干细胞之家www.stemcell8.cn ←点击进入
rectosensitization
cells (heterokaryons) for the study of matography. This composite improves genetics in cultured cells. on the traditional gel fi ltration materials based upon cross-linked dextran (see Sep- sensitization A lowering of the thresh- hadex) or polyacrylamide (see biogel), old for a nerve impulse to be generated as a in that it is a more rigid gel type, which result of strong and repeated stimulation of allows for higher fl ow rates and is better a neuron by another neuron. Sensitization suited to large-scale chromatography. results from the tendency of some neurons to trigger an action potential if stimulated Sephadex A polysaccharide-derived gel by weaker-than-normal nerve impulses or (formed by cross-linking of dextran with shorter-than-normal refractory phases strands). Filtration of mixtures of biologi- if action potentials have been triggered in cal molecules through Sephadex gels in that neuron in the recent past. columns is a widely used procedure for separation of molecules based on size. See Sephacryl A composite matrix of poly- gel-exclusion chromatography and acrylamide and dextran for column chro- gel fi ltration.
Sequencing by the dideoxy technique
218 干细胞之家www.stemcell8.cn ←点击进入
serotoninverso
Sepharose A form of agarose as small serine proteases A family of proteo- beads used in column chromatography for lytic enzymes named for the fact that they size separation of biomolecules similar to always employ a serine residue in the cata- Sephadex and also a matrix for attaching lytic site that is involved in the cleavage antibodies and other ligands for various of a peptide bond at a specifi c site in a types of affi nity chromatography. polypeptide or protein. In mammals ser- ine proteases are particularly important in sequenator A device for carrying out digestion, blood clotting, and the activa- the automated sequencing of peptides by tion of factors in the complement system. the Edman procedure.
sequence A term for the linear or end-to- serodiagnostics A diagnosis based on end arrangement of biomolecules in a long the indirect evidence provided by serol- polymeric molecule. Most often used to ogy indicative of a disease state or that denote the order of purine and pyrimidine an individual has been previously exposed bases along the length of a nucleic acid, for to a pathogenic organism, for example, example, AAGCTTCG . . . , where A=aden- tuberculosis. ine, C=cytosine, G=guanine, T=thymine. serologic reactions Any of several sequence conservation The tendency reactions based on the presence of spe- of certain DNA sequences to resist change cifi c antibodies in the blood serum. These in the course of evolution and therefore to reactions generally fall into three cat- be similar in dissimilar organisms. egories: bacteriolysis, precipitation, and agglutination. sequence homology The degree of similarity between two nucleic acids as serology A type of laboratory analysis represented by the percentage of bases on based on the presence or absence of spe- one nucleic acid strand that match bases cifi c antibodies in the blood serum. on the other nucleic acid strand when the two are aligned. seropositive (seronegative) The fi nd- sequencing The process of determin- ing, in a diagnostic test, that reactive ing the sequence of a polymeric biomol- antibodies to a given agent are (seroposi- ecule, for example, a nucleic acid or the tive) or are not (seronegative) present in a amino acid sequence in a polypeptide, the sample of blood serum. sequence of sugars in a polysacharride, and so on. See dideoxy sequencing. serotonin A monoamine neurotrans- mitter made from the amino acid tryp- SERCA pumps Sarcoplasmic and endo- tophan that regulates mood. A number plasmic reticulum calcium ATPase; special- of antidepressant drugs such as Prozac, ++ ized pumps that transport Ca ions from Paxil, and Zoloft (selective serotonin the cytosol into the lumens of the endoplas- reuptake inhibitors; SSRIs) act by inhibit- mic reticulum and sarcoplasmic reticulum. ing the reuptake of serotonin released at In skeletal muscle sequestration of calcium the synapse, which enhances the stimula- is a mechanism for regulating muscle con- tory effects of serotonin on mood. traction; high cytosolic levels of calcium stimulate muscle contraction while low lev- els result in relaxation. In humans there are three SERCA genes that code for as many as 10 isoforms by alternative splicing.
serine An amino acid that, because it contains an hydroxyl group, can serve as a site for phosphorylation when serine is part of a protein. Serotonin
219 干细胞之家www.stemcell8.cn ←点击进入
rectoserum
serum The liquid part of blood from (TDF), which initiates sex determination in which the blood cells have been removed males. Mutations in SRY give rise to XY by clotting. females with a condition called gonadal dysgenesis (Swyer syndrome), in which serum albumin One of the most abun- there is gonadal degeneration leaving only dant proteins in blood (albumin con- “streak gonads” of fi brous tissue and ovar- stiutes about 50 percent of the plasma ian stroma. In these patients there is no protein). Albumin has at least two main development of secondary sexual character- functions: (1) to regulate water content istics at puberty. Part of the Y chromosome of the tissues and (2) as a carrier of fatty containing SRY can also translocate to the acids in the blood stream. X chromosome, which causes a condition known as XX male syndrome. serum globulins A group of abundant blood proteins with wide-ranging func- SH2, SH3 domains Domains of tions. The globulins are divided into the GRB2 protein that function to three categories: alpha, beta, and gamma. mediate binding reactions of the signal- Gamma globulins are the category that transduction protein, GRB2. The SH2 includes all the serum antibodies; the domain of GRB2 binds to the phosphory- alpha and beta globulins form essen- latred tyrosine residues on the cytoplas- tial complexes with various substances, mic domains of receptor tyrosine kinases for example, lipids (these complexes are and the SH3 domains bind to the protein, known as lipoproteins), carbohydrates SOS. The SH prefi x stands for Src Homol- (mucoproteins and glycoproteins), iron ogy because of their homology to the src (transferrin), and copper (ceruloplasmin). oncoprotein of rous sarcoma virus.
severe combined immunodefi ciency shadowing The process of coating A group of inherited disorders (SCID) a specimen with a thin layer of metal, in which an individual lacks an immune such as platinum or palladium, by heat response due to a lack of infection-fi ghting evaporation under a vacuum. Shadowing lymphocytes. SCID is known in the pop- is necessary to view surface detail of the ular media as the “bubble boy disease,” specimen under an electron microscope. for David Vetter, a boy with SCID who lived in a germ-free plastic bubble in the shaker mutation A mutation in a K+ 1970s. There are several forms of SCID. channel in Drosophila that causes fl ies One form is X-linked and so is most com- carrying the mutation to shake uncontrol- mon in males. In another form the condi- lably under anesthesia. The K+ channel tion is caused by a defi ciency of the enzyme adenosine deaminase (ADA). SCID mice was cloned from shaker mutants, and this allowed critical experiments to be carried are widely used in research to carry tissue + xenografts from other animals, including out on how K channels function in the humans, because their weakened immune generation of action potentials. systems allow the tissue to grow without being rejected. In this way the tissue can shikimate pathway A major biochem- be studied while it is growing in an animal. ical pathway by which all the “aromatic” See ADA. amino acids (tyrosine, phenylalanine, and tryptophan) are synthesized from one sex chromosome See X chromosome. parent chemical, shikimate.
sex-determining region Y (SRY) A Shine-Delgarno sequences Special region on the Y chromosome (gene map sequences present on the 5′ region of locus Yp11.3) that is responsible for devel- each gene in a prokaryotic cell that are opment of the testis. SRY encodes a tran- rich in the bases adenine and guanine and scription factor of the high mobility group that help to align the ribosome on the (HMG)-box family of DNA-binding pro- mRNA so that translation can begin at teins called the testis-determining factor the proper start site.
220 干细胞之家www.stemcell8.cn ←点击进入
silencersverso
short-tandem repeat (STR) Sequences sigma factor A small protein that of DNA consisting of a core repeat of forms a complex with the RNA poly- three to four bases, with an overall length merase enzyme in prokaryotic cells. The of a few hundred bases. Such STR are formation of sigma factor–RNA poly- used as markers in DNA profi ling tech- merase is essential for the accurate intia- niques because they are easily amplifi - tion of transcription in bacteria. able, and STRs that differ from each other by one repeat unit can be easily signal peptidase An enzyme that resolved from each other on high-resolu- catalyzes the cleavage of the signal pep- tion sequencing gels. tide immediately after the polypeptide is inserted into the endoplasmic reticulum. shotgun-cloning method A technique of cloning a DNA sequence of interest signal-recognition particle (SRP) A based on mass ligation of a heterogeneous ribonucleoprotein comprised of six poly- mixture of DNA fragments into a vector; peptides and a small (7S) RNA molecule the vector carrying the DNA of interest that mediates the binding of a signal is then selected from mixture of cloned sequence on a preprotein to its appropri- DNA fragments. This technique is useful ate membrane receptor. when the DNA of interest is represented in low abundance or is diffi cult to purify. signal sequence A special sequence of amino acids on the amino terminal end shuttle vector A vector genetically of polypeptides that are destined to be engineered to permit the growth and/or exported from a eukaryotic cell. If the expression of recombinant DNAs in both signal sequence is present, then the pro- prokaryotic and eukaryotic cells tein bearing that sequence is transferred into the endoplasmic reticulum where it sialic acid A modifi ed sugar found in is further processed for export. the lipids of the membranes of neural cells that are part of the receptor for neu- signal transduction A process in which rotransmitters. a substance binds to a receptor on the out- side of a cell that then transmits a signal to sialophorin (SPN) A major sialoglyco- induce a metabolic reaction. The chemical protein found on the surface of human T that acts as the signal is called a second lymphocytes, monocytes, granulocytes, and messenger, the fi rst messenger being the some B lymphocytes that is important for substance that bound to the receptor but immune function. Sialophorin is a compo- cannot itself enter the cell to induce the nent of a receptor-ligand complex involved metabolism. (See fi gure on next page.) in activation of T cells. The sialophorin gene is at gene map locus 16p11.2. signature sequence A segment of a par- ticular protein, generally between 10 and sickle-cell anemia A genetic condition 50 amino acid residues, that is found only involving a point mutation in the beta chain in one taxonomic group of organisms and of the hemoglobin protein that results in not in others. For example, the elongation a loss of ability to carry oxygen from the factor EF-Tu contains a 12 amino acid lungs to the tissues of the body. The dis- sequence near the amino terminal end that ease derives its name from the fact that red is found in archaebacteria and eukaryotes blood cells carrying the mutant hemoglobin but not in other types of bacteria. Signa- assume an elongated sickle shape. ture sequences have been subcategorized as superfamily signatures and motifs. sickle-cell disease The pathological condition caused by sickle-cell anemia silencers Certain nucleotide sequences that is characterized by an inability to that act to suppress the activity of a pro- handle exertion. moter. Silencers may act at distances
221 干细胞之家www.stemcell8.cn ←点击进入
rectosilent mutation
Schematic representation of the ras-dependent signal-transduction pathway. A membrane-bound receptor tyrosinase (TRK) becomes activated by ligand binding to its extracellular domain, and tyrosine residues on the cytosolic side of the membrane undergo autophosphorylation. An activated ras bound to GTP then binds to cytosolic raf, which then becomes activated. The raf C terminus is a protein kinase with dual specifi city (serine/threonine) that acts to phosphorylate and thereby activate MEK, a MAP-kinase kinase (MAPKK). MEK, which is itself a dual-specifi city kinase, activates MAP kinase (MAPK) via phosphorylation. Activation of MAPK leads to phos- phorylation of a variety of transcription factors, including the AP1/jun complex, fos, and others, which results in gene transcription. greater than one kilobase away from the or because the effect of the mutation is promoter sequences on which they act. masked.
silent mutation A mutation whose silent sites DNA nucleotide bases that, effect is not manifest either because it when changed (for example, by muta- occurs in a nonessential region of DNA tion), do not result in any change in the
222 干细胞之家www.stemcell8.cn ←点击进入
Smadsverso
amino acids in the polypeptide coded for site-specifi c drug delivery A tech- by the DNA. nique for targeting drugs to certain tis- sues. Various strategies may be employed simian virus 40 A small DNA virus to accomplish this, for example, chemical accidentally discovered as a contaminant linkage of antibodies to the drug mol- in cultured African green monkey kidney ecule or attachment of the drug molecule cells that are used to grow polio virus for to a ligand that is specifi c for a cell sur- vaccine development. The virus was later face receptor. See fusogenic vesicles. found to be oncogenic in mice although not in humans or in its natural host. site-specifi c recombination Recombi- nation between two DNAs that occurs at simple sequence DNA DNA sequences a specifi c site on each DNA. Site-specifi c that are extremely highly repeated th- recombination is exemplifi ed by integra- roughout the genome of an organism. tion of lambda bacteriophage DNA in These highly repeated sequences that are which recombination takes place at a site generally very short in length are referred designated as attP on the bacteriophage to as simple sequences. DNA and the corresponding site (desig- nated attB) on the bacterial host DNA. sindbis virus A member of the family of A math- RNA-containing togaviruses (alpha virus Skatchard analysis (plot) ematical method for estimating both the group). Infection in humans and other number of receptors for a certain ligand mammals is via mosquitoes where varying and the affi nity of the ligand for its recep- degrees of encephalopathy are produced. tor from a plot of the amount of unbound ligand versus (bound ligand)/(free ligand). single-locus probes (SLP) A tech- nique used in DNA profi ling in which skeletal muscle The relatively more- the DNA from an individual, blotted to a striated muscle tissue associated with membrane (see Southern blot hybrid- voluntary movement, for example, in the ization) is mixed with a probe in a series movement of the limbs. of sequential tests that will detect a single sequence. Usually, only two bands are ski oncogene The oncogene carried by detected at each stage of the test. a strain of avian sarcoma virus, it derives it name from Sloan-Kettering Institute, sis oncogene An oncogene that is where it was discovered. The oncogene found in simian sarcoma virus and that is was identifi ed on the basis of its ability to associated with sarcoma tumors in both transform cultured cells to a cancer-like monkeys and cats. The name is an acro- state. ski has subsequently been shown to nym derived from simian sarcoma. The cause non-muscle cells to differentiate into sis oncogene protein is virtually identical skeletal muscle. The proteins encoded to one of the subunits of platelet-derived by ski regulate transcription of genes by growth factor (PDGF). forming complexes with various tran- scription factors, including NF-I, Smad2, sister-chromatid exchange The ex - and Smad3. The ski proto-oncogene change of material between the two (c-ski) gene map locus is 1q22-q24. daughter strands of a replicated chromo- some (i.e., chromatids) during meiosis; Smads Signal transduction elements recombination occurring at the chromo- associated with signaling by TGF recep- somal level. tors. Binding of members of the TGF fam- ily of growth factors to their receptors site-directed mutagenesis The tech- causes Smads on the cytosolic side of the nique by which specifi c bases on a seg- membrane to become activated by phos- ment of DNA are experimentally altered. phorylation. Activated Smads form dimers
223 干细胞之家www.stemcell8.cn ←点击进入
rectoSMC proteins
that migrate into the cell nucleus, where fusion of a transport vesicle with the they activate transcription of certain tar- Golgi. get genes. Smads fall into classes: R-Smads (those activated by phosphorylation by SNARES A family of proteins that the kinase domains of receptors), I-Smads mediate the fusion of synaptic vesicles (inhibitory), and Co-Smads. The R-Smads with the synaptic membrane during the are comprised of Smads 1, 2, 3, 5, and 8. process of neurotransmitter release. The Smads 2 and 3 are involved in signaling SNARES present on the surface of the via the TGF-β family, and Smads 1, 5, and synaptic vesicle are called v-SNARES, and 8 respond signaling via the BMP subfam- those on the cell membrane are called t- ily of growth factors. Smad4 is a co-Smad. SNARES. During synaptic fusion, the The R-Smads and Co-Smads contain v-SNARES and t-SNARES bind to one two conserved structural domains: MH1 another together with a protein called (MAD Homology domain) and MH2. SNAP25 to initiate the fusion process that Phosphorylated R-Smads form complexes with the Co-Smad, Smad4. The MH1 releases neurotransmitter. The SNARE- domain of the R-Smads is responsible for SNAP25 complex is targeted by the toxin the DNA-binding activity of the complex, of the bacterium Clostridium botulinum. while the MH2 domain is involved in interaction with the receptor. snRNA Small nuclear RNA; a very short piece of RNA that complexes with a set SMC proteins Structural maintenance of proteins (snRNPs) to form a structure of chromosomes; a family of proteins that whose function is to clip out loops in other are involved in chromosome condensation, RNAs, particularly for splicing of RNAs sister-chromatid cohesion, DNA repair, that are destined to become mRNAs and recombination. There are six core SMCs in eukaryotes (SMC1–SMC6) that sodium-potassium pump A special- form functional complexes with other pro- ized transmembrane protein that pumps teins. The cohesin complex contains SMC1 sodium ions out of the interior of the and SMC3 (together with cohesin proteins cell and at the same time pumps potas- Scc1 and Scc3), which is needed for sister- sium ions into the cell. Although sodium- chromatid cohesion during mitosis. The potassium pumps are found in a variety SMC1 and SMC3 also forms a complex of cell types, they especially abundant in with DNA polymerase ε and ligase III that nerve cells where they serve to establish mediate recombination. SMC2 and SMC4 an electric potential across the membrane are components of the condensin complex, that is the basis of nerve impulse transmis- which functions in the process of chromo- sion. some condensation during mitosis. The func- tions of SMC5 and SMC6 are not known, although SMC is believed to be involved in soma A term for the entire body of an recombination-based DNA repair processes. organism without reproductive cells.
smooth ER The endoplasmic reticulum somatic cell A nonreproductive cell; any that is not bound to ribosomes. cell that does not generate either sperm or egg. smooth muscle The relatively less stri- ated (i.e, smooth) muscle associated with somatic cell hybrid The product involutary movement, for example, the formed by somatic cell hybridization. heart muscle. somatic cell hybridization Combin- SNAP Soluble NSF attachment pro- ing the genetic material of two cells by teins; cytosolic proteins that are required cell fusion, such as that induced by Sen- for NSF to bind the membrane of a Golgi dai virus or polyethylene glycol (PEG). vesicle and are therefore necessary for See cell fusion.
224 干细胞之家www.stemcell8.cn ←点击进入
spectrinverso
somatic cell therapy A gene therapy Southern blot hybridization In a based on the introduction of new genetic complex mixture of DNA fragments material or the alteration of existing separated by size on an agarose gel, a genetic material in cells other than those technique for identifi cation of a DNA that give rise to either sperm or egg, for fragment(s) by fi rst transferring the DNA example, the introduction of insulin fragments from the agarose gel to a spe- genes into pancreatic cells. cial membrane and then hybridizing the DNA fragments to a specifi c probe. somatic mutation Any mutation not affecting the reproductive cells. This type spacer DNA Stretches of nontranscribed of mutation usually affects a particular DNA that separate transcribed regions of tissue type and is not passed down to DNA and that code for ribosomal RNAs. offspring in the form of a transmissible genetic defect. species Different forms of an organism among the members of a genus that are somatomedin A polypeptide hormone, incapable of producing offspring by inter- produced in the liver, that induces growth breeding. of bone and muscle.
somatostatin A polypeptide hormone, specifi c activity The activity of a sub- produced by the hypothalamus, that helps stance that is present in some given amount to regulate to blood sugar levels by inhib- of that substance, as defi ned for that sub- iting the release of glucogon and insulin stance by convention. For example: by the pancreas. • units of enzyme activity per micro- gram of protein somatotropin A polypeptide hormone, • units of hormone activity per milliliter produced in the anterior pituitary, that sim- of solution ulates the liver to secrete somatomedin-1. • disintegrations per minute per mole of radiolabeled amino acid sorbitol An alcohol derived from glu- cose. In diabetes, sorbitol accumulates in specifi city factors Proteins that act to the eye, the kidney, and the other tissues; alter the specifi city of RNA polymerase to this leads to osmotic swelling and even- recognize a given promoter or a set of pro- tual damage of critical cells such as the moters, by making it more or less likely optic nerve. for the polymerase to bind to them. For example, vaccinia virus contains a protein SOS repair system A system of at least that causes RNA polymerase to recognize 15 different proteins that work to repair the viral promoter and begin transcription severe DNA damage in bacteria; the system of the viral genes. appears to be induced by the presence of an excessive amount of single-stranded DNA spectrin A fi lamentous protein that as might be generated by DNA damage. comprises a cytoskeletal network that is SOS response In bacteria, the induc- attached to the cytosolic side of the plasma tion of various proteins involved in DNA membrane in erythrocytes. The spectrin repair (such as the UvrA and UvrB pro- cytoskeleton largely accounts for the mem- teins) and DNA synthesis (DNA poly- brane rigidity that prevents deformity of merase III, UmuC, UmuD, and RecA) in red blood cells during their passage through response to the presence of high levels of the small vascular openings of capillaries. DNA damage as might occur following Spectrin also functions to anchor certain exposure to a mutagenic agent. membrane-associated structural elements such as glyophorin and the membrane Southern, E. M. (b. 1918) The discoverer channel for chloride-bicarbonate exchange. of the Southern-DNA-blot-hybridization technique.
225 干细胞之家www.stemcell8.cn ←点击进入
rectospermatids
spermatids Immature sperm cells hav- • SMA type III (Kugelberg-Welander ing the haploid number of chromosomes disease), onset of symptoms between but lacking the morphological features of two and 17 years of age sperm, for example, the elongated acro- some-bearing head and the tail assembly The disease is caused by mutations in two that make spermi motile. genes located on chromosome 5q13, SMN1 and SMN2 (SMN stands for survival of spermatocytes Cells representing stages motor neuron). These genes code for pro- in the formation of sperm: Primary sper- teins involved in RNA splicing. Over 90 matocytes are cells containing the diploid percent of SMA cases lack part of, or all of, number of chromosomes but which, after both copies of SMN1. A small percentage dividing, form secondary spermatocytes of SMA patients are missing one copy of that contain the haploid number of chro- the SMN1 gene and have small mutations mosomes. The secondary spermatocytes in the remaining copy. differentiate to form spermatids. spindle apparatus The bundles of sperm cells (spermatozoa) The mature microtubules that are attached at one end cells derived from the male reproductive to the centromere of chromosome and at cells (gametes) that is produced by meiosis. the other to the centriole and are respon- sible for the movements that lead to seg- SPF S-phase promoting factor; in yeast, regation of the chromosomes during cell a family of complexes between the cyclin- division. See mitotic apparatus. dependent kinase, cdc28, and G1 cyclins spleen A large, ductless organ in the that mediate the transit through the S upper-left portion of the stomach; it plays phase of the cell cycle. a role in the maturation and differentia- tion of the antibody-forming blood cells. S phase A part of the cell cycle dur- ing which the total complement of a cell’s splice, splicing A joining together of DNA is replicated. separated sections of an RNA molecule to generate new RNAs. In the process sphingolipid A type of membrane by which mRNAs are created from long lipid derived from the compound, sphin- RNA precursors in the nucleus, sections of gosine. Sphingolipids are subdivided RNA that represent introns are spliced out into sphingomyelins, gangliosides, and so that segments representing exons are cerebrosides, all of which are important joined together. Splicing is part of the pro- components of the brain cell membranes. cess of RNA processing that takes place in Altered metabolism of sphingolipids is the nucleus. See spliceosome and splic- the cause of the genetic syndrome, Tay- ing junction. Sachs disease. spliceosome A complex that mediates spinal muscular atrophy (SMA) A the splicing of an RNA molecule during genetic neurodegenerative disease affect- mRNA formation. The spliceosome con- ing motor neurons and characterized by tains the RNA precursor in which the ends wasting of the skeletal muscles. SMA is of the regions that will be joined together caused by progressive degeneration of the are held in place by small ribonucleopro- anterior horns of the spinal cord. There tein particles (snRNPs). are several types of SMA: splicing junction The site on a spliced RNA where the ends of the spliced RNA • SMA type I (Werdnig-Hoffmann segments meet. disease) manifest in utero or in neo- nates spontaneous mutation A change in a • SMA type II, onset of symptoms nucleotide base in the DNA that occurs between three and 15 months of age during the normal process of DNA rep-
226 干细胞之家www.stemcell8.cn ←点击进入
RNA transcript splicing
Spliceosome
227 干细胞之家www.stemcell8.cn ←点击进入
rectosrc
lication and without the action of muta- START A point in the G1 phase of the genic agents. yeast cell cycle that represents the com- mitment of the cell to transit into S phase. src The oncogene that is carried by the See CLN1, CLN2, CLN3. Rous sarcoma virus that produces sarco- mas in birds. The product of the src gene STAT Signal transducers and activators is a phosphorylated protein denoted as of transcription; a class of transcription fac- pp60. The src protein is a tyrosine kinase tors that constitute one of the main compo- and is believed to cause transformation nents of the JAK/STAT signaling pathway. as a result of its ability to carry out phos- STATS are activated by phosphorylation phorylation of critical proteins. catalyzed by JAKs. Once activated, STATS dimerize and move into the nucleus, where SSCP Single strand conformation poly- they bind to specifi c sequences in the pro- morphism; an analytical technique for moters of target genes whose transcription determining the presence of changes in is subsequently induced. nucleic acid primary structure by observ- ing the rate of migration of nucleic acid statins A class of drugs that lower the fragments in a gel where the nucleic acids levels of cholesterol in the blood by inhib- are kept in a denatured state by chemicals iting the pathway by which cholesterol is such as urea or formamide. This technique synthesized in the liver. The statins have is highly sensitive to changes in nucleotide structures similar to mevolonate, the nor- sequence and is frequently used to analyze mal substrate of the enzyme HMG-CoA genes for the presence of small mutations. reductase, which controls the key step in cholesterol biosynthesis. The statins staggered cut A term applied to the type therefore inhibit cholesterol biosynthe- of cleavage of DNA molecules produced sis by serving as competitive inhibitors of by most restriction enzymes in which one HMG-CoA reductase. Zocor, Pravacol, end (usually the 5′ end) protrudes past the Mevacor and other pharmaceutical statins cut end of the other strand. are chemically modifi ed versions of statins that were originally derived from fungi. standard deviation A statistical value given by the square root of the variance of stationary phase The point at which, a set of experimental values. This quantity in a bacterial culture, the cells become is a measure of the average amount each so numerous that the nutrient sup- experimental value or observation in a ply is exhausted and growth ceases. See series differs from the mean of that series. growth phases.
standard transformed constants The physical constants that, by international HO convention, are used in biochemical cal- CCO¯ culations to represent “standard” con- HO HO ditions in biological systems. The main O HC standard transformed constants are: 3 [H+]=10-7M (pH 7.0), T=298°K (25°C), ++ 1 mM Mg , 55.5M H2O, 1 atmosphere O pressure, and 1M concentrations of all other products and reactants. HC 3 starch A complex polysaccharide used by plants as a means of storing glucose. Starch consists of long polymers of glu- CH 3 cose that are joined to one another to form a compact, branched macromol- ecule similar to glycogen. Zocor
228 干细胞之家www.stemcell8.cn ←点击进入
stereoisomerverso
STE genes A family of genes whose potent, that is, have the capability to give products function as part of a signal- rise to all the different cell types character- transduction cascade to mediate mating in istic of the different body tissues. Modern yeast; the STE designation is derived from stem-cell research focuses on identifying the word sterile to indicate the fact that the signals that can cause stem cells to dif- mutations in these genes result in sterility ferentiate into a particular cell type. If such in yeast. STE2 and STE3 are receptors for signals can be found, it is believed that mating pheromones in the α and a mating stem cells can then be used to replace dam- types, respectively. Other STE proteins are aged tissues seen in a number of conditions components of G proteins or function as such as Alzheimer’s disease, Parkinson’s protein kinases. STE12 is a transcription disease, spinal cord injuries, and others. factor. See KSS1, FUS3. stem-loop structure A structure form- stem cell Any cell that, in a tissue, is ed by nucleic acids, but particularly itself immature but gives rise, through cell RNAs, in which a segment of the division, to cells that become the mature nucleic acid strand base pairs with a dis- form of the cells that characterize the tant complementary sequence; the base- tissue. The marrow in bone is a classic paired sequences form the “stem” and the example of stem cells that give rise to the sequences intervening between the base- mature differentiated blood cells, includ- paired regions form the “loop.” ing red blood cells, macrophages, and the antibody-producing cells of the immune stereoisomer A form of a molecule system. However, only the completely involving different arrangements of atoms undifferentiated stem cells derived from or molecules around a central atom, usually embryos (embryonic stem cells) are toti- carbon in biomolecules. Stereoisomers are
Stereoisomer
229 干细胞之家www.stemcell8.cn ←点击进入
rectosterile
also referred to as optical isomers because effects of the nerve impulse from another crystals of stereoisomers cause polarized neuron. light to slant in ways that are characteristic for each stereoisomer. See dextrorota- stock culture A culture of cells that tory isomer and levorotatory isomer. serves as a common source of cells for experimental purposes. sterile Completely free of living material. stop codon A sequence of three nucle- sterilization The process by which otide bases that do not represent the code objects or liquids are made sterile, usu- for an amino acid but serve as signals for ally for the purpose of preventing disease, the termination of translation by the ribo- infection, or contamination. Common some. There are three RNA stop codons: methods of sterilization include heating UAA, UGA, and UAG. to temperatures above 125°C and pro- For preproteins longed exposure to ultraviolet light. stop-transfer signal that are to be inserted into, but not com- steroid A class of potent hormones pletely through, a membrane, a stop- derived from cholesterol. Cortisone and transfer signal is a group of amino acids the sex hormones, estrogen and testoster- on the polypeptide that serves as a signal one, are examples of steroid hormones. to stop its movement at a time when the polypeptide is properly positioned in the sticky ends The single-stranded ends of membrane. any two nucleic acids whose nucleotide base sequences are complementary to one strand displacement A variant of the another. normal mechanism of DNA replication in which replication of one of the DNA stimulatory neuron A neuron that, strands proceeds from opposite ends of a when stimulated, functions to enhance the linear DNA molecule.
Strand displacement
230 干细胞之家www.stemcell8.cn ←点击进入
stress-activated kinasesverso
cellular stress
MEKK1
SEK1 or MKK7
SAPK
jnk
nuclear translocation
jnk c-jun
(gene transcription)
Stress-activated kinases
streptolydigin An antibiotic that inhibits 90 percent of the clinically useful antibi- the action of bacterial RNA polymerase. otics. Streptolydigin binds to the beta-subunit of the polymerase and stops chain elongation streptomycin An antibiotic derived from after the addition of three or four nucleo- molds that exerts its antibacterial effect by tides. causing bacterial ribosomes to misread the codons on the mRNA, particularly with streptomycetes A funguslike bacte- respect to the pyrimidines U and C where rium found in soil. In addition to strepto- one is usually mistaken for the other. mycin, various isolates of streptomycetes have yielded more than 500 compounds stress-activated kinases (SAPKs) A of therapeutic value, including more than family of protein kinases involved in sig-
231 干细胞之家www.stemcell8.cn ←点击进入
rectostress fi bers
naling that are activated by a variety of stroma 1. The space between the grana environmental stressors such as ultravio- and the chloroplast membrane that con- let irradiation, toxic chemicals, oxida- tains some of the enzymes of the dark tive conditions, hypoxia and anoxia, heat reaction in photosynthesis as well as the shock, inhibitors of protein synthesis, chloroplast RNA and DNA. and infl ammatory cytokines. Activated 2. The connective tissue underlying the epi- SAPKs bind to, and phosphorylate, the thelial cell layer, for example, in skin, the N-terminal domain of the c-jun transcrip- digestive tract, and the airways in lung. tion factor, which subsequently translo- cates to the nucleus, where it upregulates structural gene A gene in an operon the expression of genes involved in vari- that codes for the functional protein that ous stress responses. The SAPKs are acti- is essential to the metabolism of the bacte- vated by the upstream factors SEK1 and rial cell, for example, an enzyme, as dis- MKK7. There are three SAPK genes: α, tinguished from the genes for a repressor β, and γ that code for 8–10 isoforms by alternative splicing mechanisms. protein that controls the expression of a structural gene. stress fi bers The fi brillar arrays that are seen on the surface of a cell that is ori- STS Sequence tagged site; a means of ented parallel to the direction in which a cataloguing sequence data by record- cell is moving. Stress fi bers appear to be ing only that part of the whole sequence directly related to cell movement in that necessary to create primers that can be they are known to coincide with the actin used to amplify the entire sequence from fi laments. a DNA sample by the polymerase chain reaction (PCR). stress proteins Proteins encoded by heat-shock genes and expressed when the stuffer region That part of the lambda cell undergoes stress conditions, such as phage that can be replaced by foreign a rise in temperature or exposure to cer- DNA and still reproduce so that the tain chemicals. Many of these proteins phage can be used as a cloning vector. are chaperons that aid in maintaining the structure of the protein under conditions subcutaneous Just underneath the skin; of denaturation. as in subcutaneous injections.
stringency The conditions of tem- substrate Any one of the reacting chem- perature and ionic strength used dur- icals in an enzyme-catalyzed reaction. ing nucleic acid hybridization methods, for example, northerns or Southerns, to ensure proper binding of the probe to its substrate analogue A chemical that is target. Low stringency conditions allows similar in form to a particular substrate for the probe to bind with less specifi c- but that does not participate in the chem- ity to targets; high stringency conditions ical reaction of the substrate. Substrate only will permit very specifi c binding of analogues used for various purposes such probe to its target. as inhibition of certain enzyme systems or for studying the mechanism of enzyme stringent response A bacterial response action. See competitive inhibition. to conditions of nutritional deprivation in which expression of nonessential genes is substrate channeling The direct trans- shut down. A stringent response involves fer of intermediates from one enzyme a rapid downregulating of certain bacte- to the next in multienzyme complexes. For rial biosynthetic pathways (e.g., synthesis example, the pyruvate dehydrogenase com- of ribosomal and transfer RNAs) when plex processes pyruvate into acetyl CoA by the amino acid supply becomes limited. a series of enzymatic reactions catalyzed by See alarmones. fi ve separate enzymes in a large complex.
232 干细胞之家www.stemcell8.cn ←点击进入
sugarverso
The products of each reaction become sub- sucrose-density centrifugation A tech- strates for the next, and these products/ nique that separates molecules in a mix- substrates are passed through the complex ture according to their density by using by substrate channeling. suffi ciently high centrifugal force to cause the molecules to migrate through a solu- subtilisin An proteolytic enzyme (pro- tion of sucrose. In density-gradient separa- tease) produced by the soil bacterium tion, the sucrose solution increases in den- Bacillus amyloliquefaciens. sity the farther the molecules travel. subunit One part of a complex biologi- sudden-correction model The model cal molecule such as an enzyme or ribo- some. The subunits combined together that proposes that in gene clusters in which constitute the biologically active molecule. there are multiple copies of a gene (e.g., the genes coding for ribosomal RNA), subunit vaccine A vaccine created in the the entire gene cluster is replaced “every lab using recombinant DNA technology, so often” by a process that replicates the in which a portion of the entire virus or entire gene cluster from just one or a few bacterium is presented as an epitope. This copies. The sudden-correction model is method was used in the production of a vac- actually an error-correcting mechanism cine against hepatitis B virus (HBV), a virus that accounts for why mutational errors in that cannot be cultured in the laboratory. some of the gene copies do not accumulate over time. sucrose A disaccharide consisting of one molecule of fructose linked to one sugar Any compound that conforms to molecule of glucose. Common table sugar the general molecular formula Cn.(H2O)n, is sucrose. where n is any number between 3 and 7
Sugar
233 干细胞之家www.stemcell8.cn ←点击进入
rectosupercoiled DNA
nucleic acids vary with secondary structure, single-strand temperature, and salt concentration. nicks SW1/SNF A large complex of 10 pro- teins that acts as a transcriptional acti- vator by indirect mechanism involving chromatin remodeling. The SW1/SNF complex uses energy from ATP derived Supercoiled DNA from the ATPase activity of SW12 sub- unit to produce changes in chroma- tin structure, which include changes in and where the carbon atoms are linked nucleosome structure and positioning together in a chain. See carbohydrate. such that transcriptional activators that act by binding to DNA can have access to supercoiled DNA A circular double- their recognition sequences. stranded DNA molecule is itself twisted into a compact knot. This is the replicative form symbiosis A state of two or more or- of many viral DNAs in their host cells. ganisms living in permanent close proxim- ity for the mutual purpose of supplying suppressor gene Any gene that acts to some essential nutrient or life function to suppress the effects of mutation. one another. suppressor mutation Any mutation that suppresses the effects of a previous muta- synapse The specialized junction be- tion; for example, a mutation that sup- tween the tip of the axon from a neuron presses the effects of frame shift mutation and the dendrite of an adjacent neuron. by reinstating the proper reading frame. The transmission of nerve impulses from one neuron to the next is carried out by suppressor T cell A type of T lympho- neurotransmitters that cross the synapse. cyte that suppresses the antigenic response of antibody-forming B cells; that is, it synapsis A stage in the recombina- inhibits the formation of antibody to a tion process mediated by the RecA pro- particular antigen. tein in which the RecA protein forms a complex with the single-stranded and suppressor tRNA A mutation in a double-stranded DNAs that will then transfer RNA that suppresses the effect align with each other before undergoing of a previous mutation in a gene. The sup- recombination. pressor mutation allows the suppressor tRNA to read the fi rst mutation correctly, synaptic cleft The space intervening thereby ensuring the process of transla- between the axon and dendrite mem- tion. See amber suppressor. branes in a synapse.
surfactant Any agent that lowers the synaptic vesicle A membrane-enclosed surface tension of water. Soaps and deter- vesicle that carries the neurotrans- gents are the most common surfactants. mitters to the synapse where they are released by fusion of the synaptic vesi- SV40 Simian virus 40. cle membrane with the membrane at the axon terminus. Svedberg unit A measure of molecular size based on the rate of sedimentation of a synaptonemal complex The struc- molecule in a centrifugal fi eld. The Svedberg ture that joins chromosome pairs when unit is designated as s and is not directly homologous chromosomes align during proportional to size; for example s values of the process of meiosis.
234 干细胞之家www.stemcell8.cn ←点击进入
neurotransmitter vesicles
v-SNARE
SNAP25 t-SNARE
synaptic membrane
complex of v-SNARE, t-SNARE, and SNAP25
membrane fusion
Synaptic vesicle fusion
235 干细胞之家www.stemcell8.cn ←点击进入
rectosynaptophysin
synaptophysin A polypeptide located present on one chromosome are said to in a transmembrane fashion in the mem- be syntenic. The concept of synteny has brane of a synaptic vesicle that is thought been extended to include the organiza- to mediate the fusion process between tion of the genetic loci on a chromosome, the synaptic vesicle membrane and the and this has been used to create synteny plasma membrane at the axon terminal. maps that compare the arrangements of homologous genes on chromosomes from synchronous culture A cell culture different species. in which all cells are simultaneously at the same phase of the cell cycle. Experi- synthesis The process of creating a new mentally, synchronization of cells can be substance from precursor molecules. Bio- achieved by techniques that transiently synthesis is the process by which living but specifi cally block in one phase of the cells create new biomolecules, whereas cell cycle, for example, mitosis leading to the term synthesis is generally applied to accumulation of cells at the block; syn- processes used in the laboratory for cre- chronous growth ensues when the block ating biomolecules. is released. synthetic medium Solutions of nutri- syncitium A multinucleated cytoplasm ents are created for the purposes of grow- such as occurs when cells are fused by ing cells of various types in culture. Most treatment with polyethylene glycol or Sen- synthetic media formulations attempt to dai virus. recapitulate the natural nutrient environ- ment for the cell type being cultured as syndrome A set of characteristics that nearly as possible. are usually associated with the same cause. For example, genetic diseases synthetic peptides The creation of caused by a single mutation can result in peptides in the laboratory, using tech- a number of different phenotypes. niques of organic chemistry to link amino acids together according to some synergism Facilitation of a response by prescribed sequence so that a peptide multiple stimuli such that the magnitude of of any given primary structure can be the response is greater than the sum of the synthesized. individual stimuli. The principle of syner- gism is often exemplifi ed by the facilitation syntrophism Cross-feeding by organ- of a nerve impulse when a single neuron is isms sharing a common growth medium, stimulated by several excitatory neurons. for example, bacterial colonies whose growth is dependent on a factor or fac- syntaxin A transmembrane protein tors secreted by a neighboring bacterial located in the active zone of the plasma colony on a common agar plate. membrane at the axon terminal that is believed to mediate the docking process syphilis A venereal disease caused by between the synaptic vesicle and the the spirochete Treponema pallidum. If left plasma membrane. The docking process untreated, the disease may cause blindness involves anchoring the synaptic vesicle and neuological symptoms, including a in close enough proximity to the plasma syndrome characterized by a loss of motor membrane to allow fusion to occur. Dur- control known as general paresis. ing this process, syntaxin is thought to bind to synaptobrevin, a transmembrane systemic lupus erythematosis An protein located in the synaptic vesicle autoimmune disease of the connective tis- membrane. sue that is characterized by a reddish skin rash (erythema) and a wide variety of synteny The state of two or more conditions related to internal organ mal- genetic loci being present on the same function. Antibodies to a wide variety of chromosome. All the genetic loci that are self antigens are seen.
236 干细胞之家www.stemcell8.cn ←点击进入
AT
T4 RNA ligase An enzyme, isolated tamoxifen An anticancer drug specifi c from bacterial cells infected with the for breast cancer that acts as an antagonist bacteriophage, T4, that catalyzes the for- of the estrogen receptor in low-grade can- mation of a covalent bond between the cers whose growth is estrogen-dependent. phosphate group on the 5′ end of either single-stranded DNA or RNA and the 3′ hydroxyl end of either single-stranded DNA or RNA. CH3
T7 promoter A sequence that forms N the promoter for transcription of the CH O genes of the T7 bacteriophage. The T7 3 promoter is widely used in synthetic clon- ing vectors where expression of recombi- nant DNAs is desired.
tachykinin A group of biologically active amidated neuropeptides that excite neurons and are potent vasodilatators and cause contraction of many smooth muscles. The tachykinins are found in both vertebrates and invertebrates. There are three tachyki- CH nins in humans that are encoded by two 3 genes. They are made in the form of pre- cursor peptides that are enzymatically con- Tamoxifen verted to their mature forms, all of which are between 10 and 12 residues long and share a common carboxy-terminal sequence: tandem In general a group of objects Phe-X-Gly-Leu-Met-NH2. One of the pre- arrayed in a line, one next to the other. cursor peptides contains both substance P As applied to molecular genetics, the and neurokinin A, while the other encodes a term refers to genes arranged in tan- precursor that contains only neurokinin B. dem along a stretch of DNA. A number of viral and cellular genes (e.g., rRNA TAFs TBP associated factors; a set of at genes) that undergo amplifi cation are least eight proteins that assembles onto the tandemly arrayed. DNA-bound TATA Binding Protein (TBP) to form the general transcription factor T antigen(s) The products of the early TFIID. TFIID binding to the TATA box genes of the papova viruses. In normal in eukaryotic promoters is the fi rst event hosts, the T antigen(s) function to stimu- required for subsequent assembly of other late viral DNA replication and to regulate transcription factors and RNA polymerase expression of the viral genes. However, in II to form the fully functional transcription host cells that do not support virus rep- complex that initiates transcription. lication, the T antigens are known to be
237 干细胞之家www.stemcell8.cn ←点击进入
rectoTaq polymerase
responsible for transformation of the cells for so-called cell-mediated immunity, the to a cancerous phenotype. immune function directed toward detect- ing and destroying foreign cells rather Taq polymerase A DNA polymerase than foreign proteins. isolated from the thermophilic bacterium Thermus acquaticus. T-DNA A term for the Ti plasmid car- ried by Agrobacterium, a parasite that tariquidar (XR9576) An experimen- induces various plant tumors. The tumors tal drug used to inhibit the ability of are a direct result of expression of the cancer cells to become resistant to che- genes carried by Ti in the plant cells. motherapeutic agents (multidrug resis- tance). Tariquidar acts by binding to a teichoic acid A long polymer of glyc- membrane glycoprotein known as P-gp erol or ribitol molecules linked together by (P-glycoprotein pump), a transmembrane phosphate groups. Teichoic acid is a struc- protein that acts to pump administered tural component of the outer cell wall of anticancer drugs out of the tumor cell. Gram-positive bacteria. See Gram stain. The binding of tariquidar blocks the ability of P-gp to act as a pump, thereby telomere(s) Special tandemly arranged, allowing the chemotherapeutic agent to guanine-rich, repeated sequences that be retained in the cell. prevent loss of DNA at the end of a DNA strand during chromosome replication tastin A cytoplasmic cell-adhesion mol- and so are required for faithful replica- ecule that, in combination with bystin, tion of the DNA in a chromosome. forms part of the machinery that medi- ates the process by which the embryo telomeric sequences Special sequences attaches to the wall of the uterus. on the ends of DNA strands that are required for synthesis of the terminal seg- TATA box Another name for the Prib- ments of the lagging strand. Telomeric now box. sequences are present on the ends of chro- mosomes (the telomeric region) and are tautomerism The rapid and continual used in the construction of yeast artifi cial transition between different forms of a mole- chromosomes (YACs). cule based on delocalization of an electron(s) on different atoms of the molecule. telophase The stage of mitosis in which the new cell membrane that divides the taxol A plant alkaloid that stabilizes daughter cells forms (the cell plate) and chro- microtubules, thereby freezing cells in mosomes reform into diffuse chromatin. mitosis. Because cancer cells are rapidly dividing cells, taxol is currently being temperate phage A bacteriophage that used as a chemotherapeutic agent. is capable of establishing lysogeny in a host rather than undergoing a normal taxonomy The science of classifi cation. lytic cycle.
Tay-Sachs disease A hereditary dis- temperature-sensitive mutant (Ts ease in which accumulation of a certain mutant) Any organism that expresses a type of sphingolipid accumulates in the function with a temperature dependence, for brain and the spleen, leading to degenera- example, bacteriophages that establish lysog- tion of the nervous system and death at eny at one temperature but not at another. an early age. template In general a pattern for cre- T cell A lymphocyte named for the thy- ating a copy of something; nucleic acid mus (i.e., thymus cell) where the majority strand whose sequence is used to create a of T cells mature. T cells are responsible complementary nucleic acid copy.
238 干细胞之家www.stemcell8.cn ←点击进入
versoTGF
Terminal redundancy
teratoma A type of tumor derived from ternary initiation complex A three- a developing embryo. part complex that is necessary to start the process of translation. The ternary terminal redundancy During the replica- initiation complex consists of met- tion of bacteriophage T4, slighty more than tRNA, GTP, and an initiation factor one genome equivalent is cut from a long, (eIF2). linear DNA that represents T4 genomes repeated in an end-to-end head-to-tail tertiary structure The overall, three- fashion. This leads to the packaging of T4 dimensional folding of a polypeptide; the genomes in which the ends are repeated. folding, twisting, or conformation of the secondary structure of the polypeptide. terminal transferase An enzyme that catalyzes the addition of an unspecifi ed testosterone The steroid hormone pro- number of deoxyribonucleotides from duced by the testes that regulates sperm deoxyribonucleotide triphosphates (dNTPs) production and male sexual behavior. to a free 3′ hydroxyl end of double- or single-stranded DNA: tetanus A syndrome caused by infec- terminal tion by the anaerobic bacterium, Clos- transferase tridium tetani. The disease symptoms +dNTPs (uncontrollable muscle spasms) are due to 3′OH—5′ ------> NNNNNNNNNNN—5′ the presence of a potent neurotoxin pro- Terminal transferase catalyzes the addi- duced by the bacterium. tion of long polymeric chains of whichever nucleotide whose triphosphate (dATP, tetracycline A broad spectrum (both dCTP, dGTP, or TTP) is used as a sub- Gram-positive and Gram-negative) antibi- strate. The addition of long nucleotide tails otic produced by Streptomyces venezuelae. to DNA fragments is a tool for cloning DNA fragments into vectors for which no TGF See transforming growth convenient restriction enzyme sites exist. factor.
239 干细胞之家www.stemcell8.cn ←点击进入
rectothalassemia
thalassemia A disease that results from term is usually applied to genes and/or a mutation, often a deletion of DNA their products whose activity is rapidly within the gene, that causes a reduction increased when the temperature rises by or complete loss of expression of one or several degrees higher than optimal for both of the globin proteins (alpha or beta), the growth of the organism. resulting in gross defects in hemoglobin function that may be fatal. The thalas- thermophile An organism that thrives semias are examples of genetic disease at high temperature. brought about by uneven crossing over. theta structure The term used to thalassemia,  A type of thalassemia describe the structure formed when a cir- cular, double-stranded DNA molecule is affecting the biosynthesis of the β globin engaged in replication proceeding in both chain of hemoglobin. Some β thalasse- clockwise and counterclockwise direc- mias have been found to be due to defects tions from the same starting point. in gene regulation such as RNA process- ing in the nucleus and so have provided thiamine Also known as vitamin B1. important insights into mechanisms of An important cofactor for the reactions – the control of gene expression. involved in the O2 dependent oxidation of sugars (respiration) in energy (ATP) thermogenin (uncoupling protein) A production. protein that forms a channel in the inner mitochondrial membrane for the passage thiazolidinediones A class of drugs of protons from the cytosolic side of the that lowers the levels of fatty acids in the membrane into the mitochondrial matrix. blood. Thiazolidinediones act by binding Because the path of proton fl ow using to and activating PPARγ, which, in fat tis- this channel bypasses the FoF1 ATPase, sue, leads to the induction of the enzyme energy from the oxidation of fats and phosphoenolpyruvate carboxykinase. This sugars is released in the form of heat that in turn diverts pyruvate away from fatty is used to raise body temperature. acid synthesis.
thermo-inducible Stimulated by heat. thin-layer chomatography A sensitive In the context of molecular genetics, the analytical technique for separating mol-
Theta structure
240 干细胞之家www.stemcell8.cn ←点击进入
thymosinverso
ecules on the basis of their differing solu- light-reacting pigments and other compo- bility in various solvents. The sensitivity nents of the light reaction in photosyn- of the technique derives from running the thesis; these components are contained in sample on a thin, inert matrix to maintain the membrane of the thylakoid disk. the sample in a concentrated form. thymectomy Removal of the thymus by thiol The sulfur containing analog of surgery. A procedure frequently performed an alcohol (–OH) group. for the purpose of rendering an animal unable to mount an immune response to thiostrepton An antibiotic that acts by foreign cells, for example, tissue grafts or blocking a critical step (translocation) in lymphocytes from another animal. protein synthesis (i.e., translation) by bind- ing to the large subunit of the ribosome. thymic nurse cells (TNC) Cells that engulf developing T lymphocyes to edu- 6-thioguanine A purine derivative cate the lymphocytes. Once the T cells that is acted on by the enzyme hypoxan- are released from the TNC, they possess thine-guanine phosphoribosyl transfer- the appropriate receptors to interact with ase (HGPRT) to form a toxic compound. foreign cells that invade the body. For this reason, 6-thioguanine is used to select cells that contain low levels of thymidine A pyrimidine base attached HGPRT. See HAT selection. to the deoxyribose sugar in deoxyribo- nucleotides. 1-thiouridine An unusual pyrimi- dine base that is found only in tRNA. thymidine kinase An enzyme that Thiouridine is derived from uridine by catalyzes the major step in the formation the replacement of an oxygen atom with of TTP from thymine. Because this path- sulfur. See transfer RNA. way is the only means by which thymine or thymine analogs can enter into nucleic threonine An amino acid that, like serine acids, manipulation of this enzymatic and tyrosine, contains an –OH group on its step provides an important experimental side chain. For this reason, threonine serves tool for studying gene action by the incor- as a site of phosphorylation in proteins. poration of modifi ed bases into DNA.
thrombin In the blood-clotting path- thymidine triphosphate (TTP) The way, the enzyme that produces fi brin thymine-containing nucleotide precursor from fi brinogen by cleavage of a portion of DNA. of the fi brinogen molecule. Fibrin polym- erizes to form a clot. thymine One of the nitrogenous bases found in nucleic acids. Thymine is a thromboxanes A class of eicosanoids pyrimidine that forms hydrogen bonds produced in platelets that cause platelet with the purine adenine. aggregation during blood clotting and help reduce blood fl ow at the site of a clot. thymine dimers A type of muta- tion in which adjacent thymine bases in Thy 1 A protein on the surface of T a DNA strand are covalently linked to cells with homology to a portion of the one another, causing the two bases to be Fc region of immunoglobulins. Like other read as a single base during DNA replica- such T-cell membrane proteins, Thy-1 is tion or transcription. Thymine dimers are believed to play a role in the recognition largely caused by exposure of tissue to of foreign antigens. ultraviolet light. See ultraviolet repair.
thylakoid disk A membrane-enclosed, thymosin A mixture of small natu- coin-shaped structure that contains the rally occurring peptides that acts to
241 干细胞之家www.stemcell8.cn ←点击进入
rectothymus
promote the appearance of the T-cell tissue plasminogen activator (tPA) An surface proteins that are seen in mature enzyme that catalyzes the cleavage of the T cells, for example, Thy 1. Thymosin blood protein plasminogen to the active is thought to mimic the effects of the form of the blood-clotting protein, plas- hormone(s) that normally induce matu- min. tPA has recently been used as a thera- ration of prothymocytes. peutic agent for destroying blood clots in the blood vessels. The tPA gene has been thymus A structure comprised of lym- cloned, and the protein has been synthe- phatic tissue located in the upper portion sized in large quantities using recombinant of the chest cavity in mammals. Some of DNA techniques so that it may fi nd wide- the immature lymphocytes from the bone spread therapeutic use as a preventative marrow migrate to the thymus where they agent for heart attack and stroke. develop into the mature lymphocytes that are responsible for cellular immunity. In titer The concentration of live virus in a mammals, the thymus is present in young fl uid; the number of plaque-forming units animals but decreases in size or disap- (PFU) or focus-forming units (FFU) per pears in adults. unit volume of fl uid, for example, PFU per milliliter. thyroxine (T4) One of two major hor- mones secreted by the thyroid gland in titration The process of determining the response to thyrotropin, a pituitary hor- concentrations of substances experimen- mone. Thyroxine is made from iodinated tally by adding known amounts of chemical tyrosine and has the effect of raising the antagonists to the solution until the effects basal metabolic rate, an indicator of the of the target substance are neutralized. oxygen-dependent oxidation of sugars. T-loop 1. A specialized structure for tight junction A structure in which protecting the single-stranded 3´ end of the cell membranes of neighboring epi- telomeres. In a T-loop the end of the telo- thelial cells are brought into extremely mere is folded back so that the single- close contact, preventing the seepage of stranded end is base paired with com- even small molecules through the space plementary sequences in the preceding between cells. Tight junctions are partic- double-stranded region. The loop is held ularly evident between the epithelial cells in place by the proteins TRF1 and TRF2. lining the gut where they function as a 2. A control region of the cyclin depen- barrier against unregulated diffusion of dent kinase cdk7, where phosphorylation substances into the bloodstream from the of critical serine and threonine residues digestive tract. occurs. After activation of cdk7 as a result of the phosphorylation, the kinase Ti plasmid See Agrobacterium and forms a complex with cyclin H. crown gall plasmid. Tn5 A type of insertion sequence that tissue culture The general technique carries the gene for resistance to the anti- of keeping tissues and/or cells derived biotic kanamycin. See transposon. from tissues alive outside the organism from which they were derived by creating Tn10 A type of insertion sequence that an artifi cial environment that provides carries the gene for resistance to the anti- the essential aspects of the natural set- biotic tetracycline. See transposon. ting. The development of sophisticated tissue culture systems has been a major tobacco mosaic virus (TMV) A factor in recent advances in biomedicine large, fi lamentous, RNA-containing plant because tissue culture permits organ-spe- virus. TMV was one of the fi rst viruses to cifi c cells to be studied and manipulated be studied in detail; among the fi ndings in an experimental environment. derived from studies on TMV was the
242 干细胞之家www.stemcell8.cn ←点击进入
versotrans
spontaneous assembly of the viral coat cin, campothecin (topoisomerase I inhibi- from its component subunits. tors), aurintricarboxylatic acid (ATA), amsacrine hydrochloride, chromomycin, Tonegawa, Susumu (b. 1939) An ellipticine, etoposide, novobiocin, sobu- immunologist who discovered the process zoxane (topoisomerase II), and netropsin by which antibody-producing cells of the (topoisonerases I and II). immune system rearrange segments of the antibody genes (translocation of the vari- topoisomers Alternative forms of a cir- able and constant regions of the immuno- cular DNA that differ from one another globulin genes) to create novel antibody- only in terms of linking number. Changes encoding genes. This discovery showed how in linking number result from the action the wide range of antibodies present in the of topoisomerase enzymes. adult immune system were derived during the process of immune cell differentiation. totipotent The concept that a particu- lar cell (e.g., the fertilized egg) has the tonofi lament A fi lament type that is capability to generate or differentiate into characteristic of epithelial cells. Tonofi la- any cell type in the body of an organism. ments are approximately 8–10 nanome- Because the DNA in all cells of the body ters in diameter by transmission electron was believed to be essentially equivalent, microscopy and terminate as fi lament the concept of totipotency was originally bundles at cell junctions that are char- thought to apply even to specialized cells acteristic of epithelial cells known as of a highly differentiated structure such desmosomes. Tonofi laments have been as the eye, but modern understanding of shown to be identical to keratin fi laments the fl uidity of the genome now suggests that, in many cases, differentiation is that make up the intermediate fi lament accompanied by alterations in the DNA. network that is characteristic of epithelial cells. See intermediate fi lament. toxin A chemical poison secreted by one organism for purposes of defense against topoisomerase A class of enzymes a competing organism. Because toxins that catalyzes the relaxation of super- normally target highly specifi c cell/organ coiled DNA by creating transient nicks systems, many toxins have been used in the DNA strands that permit tightly to gain insight into normal biochemical wound DNA to uncoil. Type I topoisom- mechanisms; for example, tetrodotoxin, erases cause breaks in only one of the a toxin secreted by the puffer fi sh, spe- DNA strands, while type II topoisomer- cifi cally paralyzes the sodium transport ases (also known as DNA gyrase) nick channel in nerves and has been used to both strands. DNA gyrases are involved study ion transport in the neural system. in the process of DNA replication, which requires the unwinding of the DNA helix. TPA A plant-derived phorbol ester (12- O-tetradecanoylphorbol-13-acetate) that is topoisomerase inhibitors A class of a potent tumor promoter. TPA appears to drugs that acts as anticancer agents by exert its tumor promoting activity by activat- inhibiting the activity of topoisomerase ing protein kinase C in the cell membrane. enzymes. The inhibition of topoisomer- ase activity blocks DNA replication and trans In general, on the opposite side of the ability to cause cell-cycle arrest at or across from. In organic chemistry, the the G2/M interface, which is lethal to term refers to a molecular confi guration actively dividing cells. Two isoforms of where groups are on the opposite side of topoisomerases exist, I and II, and anti- a chemical bond from one another. In cancer drugs that act as topoisomerase molecular genetics, the term is used to inhibitors are classifi ed according to the indicate changes in expression of a par- isoform that they inhibit. Some examples ticular gene that are caused by an agent include apigenin, kaempferol, rebeccamy- located on different DNA molecules, such
243 干细胞之家www.stemcell8.cn ←点击进入
rectotrans acting
as changes in gene expression caused by therefore, proteins to enter into the same an agent acting on the gene from a dis- biochemical pathway by which sugars are tance (e.g., a hormone). oxidized for energy (i.e., ATP) produc- tion. See transaminase. trans acting Pertaining to a genetic element exerting an effect on a target transcellular transport A mechanism that is located on a physically separate for carrying certain substances from one unit. For example, a gene coding for a side of a cell to the other. This type of regulatory protein is said to be trans transport is the means by which sub- acting with respect to the genes it con- stances (for example, glucose) move trols because the target genes may be across the epithelial cells that line the located on DNA strands or even chro- intestinal tract to the bloodstream. mosomes at some distance from the reg- ulatory gene. transcription The process of making an RNA complementary to a strand of transamination A type of biochemi- DNA. In transcription, an RNA poly- cal reaction that allows amino acids and, merase, using the order of nucleotide
Initiation of transcription in eukaryotics
DNA TATA
TFIIA TFIID TBP
TFIIB TFIIF
RNA polymerase
TFIIE
TFIIH
TFIID TFIIF TFIIA TFIIB TBP RNA polymerase
TFIIH TFIIE
244 干细胞之家www.stemcell8.cn ←点击进入
transforming growth factorverso
bases present in the DNA template as a of methyl groups from one molecule to guide, assembles nucleotides from the another. four ribonucleotides (ATP, CTP, GTP, and UTP) to create the RNA strand. transferrin A plasma protein that car- ries iron in the blood. Transferrin trans- transcription factor A protein or hor- fers the bound iron to the appropriate mone that binds to a certain sequence cells via a special cell surface receptor. on the regulatory region of a gene at the promoter or the enhancer and either transfer RNA (tRNA) A type of turns on transcription, enhances tran- RNA that recognizes the codon on the scription (up-regulation), or inhibits tran- mRNA during the process of transla- scription (down-regulation). tion and brings the proper amino acid (attached to it) into close proximity to transducin An alternative term for G the end of the peptide chain being synthe- protein. sized so that the amino acid can be added to the peptide chain. The tRNA molecule transducing phage A bacteriophage is folded so that a group of three nucleo- tides complementary to the codon in the that, during its normal replicative cycle, middle of the molecule (the anticodon) occasionally packages some of the DNA is exposed, while the end of the tRNA from the host into the bacteriophage head, is used for attachment of the amino acid along with the normal bacteriophage that corresponds to the codon. See adap- DNA. The DNA so packaged can then be tor molecules. carried from the previous host and intro- duced into a new host that is infected by transformation, cancerous or neo- the transducing bacteriophage. plastic The process by which a normal cell comes to attain the characteristics The term for the process transduction of a cancerous cell. Because the actual of carrying sections of DNA from one transformation process cannot be direct- bacterial cell to another by a transducing ly observed, steps in the process are bacteriophage. inferred by the expression of certain properties that cells taken from tumors transfection The technique of intro- exhibit when grown in culture (e.g., the ducing DNA into eukaryotic cells. ability to grow without being attached to Transfection is the process homologous a solid surface and lowered dependence to transformation in bacteria. Trans- of growth on serum). fection encompasses a number of tech- niques that utilize different principles transformation, DNA The process of to introduce the DNA including electro- introducing foreign DNA into bacteria. poration and precipitation by calcium See competence. phosphate. transforming growth factor (TGF) transfer factor An as yet unidentifi ed Any of a group of proteins secreted by factor extracted from living T cells that, transformed cells that can stimulate the when taken from one human and injected growth of normal cells. Transforming into another, induces some of the cell- growth factor alpha (TGFα or TGF-A) mediated immunity that was present in binds the epidermal growth factor recep- the donor. tor (EGFR) and stimulates the growth of endothelial cells. TGFα is produced transferase A class of enzymes that by macrophages and keratinocytes and catalyzes the transfer of a chemical is secreted at high levels by some human group from one substrate to another, for tumors. Transforming growth factor beta example, methyl transferases for transfer (TGFβ or TGF-B) has two subtypes β1 and
245 干细胞之家www.stemcell8.cn ←点击进入
rectotransgenic animal
β2 and is found in hematopoietic (blood- family. Overexpression of TGF can bring forming) tissue and initiates a signaling about renal fi brosis, leading to end-stage pathway that suppresses the early develop- renal disease as well as diabetes. Certain ment of cancer cells. Bone morphogenetic types of TGF beta-receptor antagonists proteins (BMP) are members of the TGFβ have been found to be effective in halt- ing renal fi brosis. See sarcoma growth factor.
TGF transgenic animal A animal, typically a goat, a pig, a cow, or a horse, that has been modifi ed by introduction of a for- type II eign gene into its germline so that some receptor specifi c aspect of phenotype, such as pro- duction of a human protein in the milk or phophorylation of type I resistance to disease, is conferred on the receptor offspring.
transit peptide A preprotein destined for insertion into a mitochondrion. P translation The process of assembling amino acids together to form a polypep- tide; the sequence of amino acids is speci- fi ed by the codons on the mRNA being used as the template. Translation is car- ried out on ribosomes that carry sites for tRNAs carrying the appropriate amino P acids.
translational domain One of the two P major classes of binding sites on the ribo- Smad1 some. The factors that bind within the translational domain are directly involved Smad4 in the translation of mRNA into proteins. The translational domain contains bind- ing sites for peptidyl transferase, mRNA, P EF-TU, EF-G, and 5S RNA. See elonga- tion factors.
translocation 1. During translation the process of moving the tRNA carrying activation of the growing polypeptide chain from one transcription site on the ribosome to another to make room for an incoming tRNA carrying a P new amino acid. 2. In biochemistry the process of actively transporting a molecule across a mem- nucleus brane. 3. The breakage of a chromosome fol- lowed by subsequent rejoining of one of the pieces to another chromosome. See Transforming growth factor reciprocal translocation.
246 干细胞之家www.stemcell8.cn ←点击进入
transposonverso
transmembrane protein A protein that recombinant by conventional restriction is inserted into and spans the cell membrane enzyme technology. so that one end of the protein protrudes out of the cell (the extracellular domain) while transplant The removal of a tissue or the other end (the internal domain) remains portion of a tissue from its natural loca- in the interior of the cell. The two major tion and its placement in a new location, functions of transmembrane proteins are: either in the same organism or in some (1) to serve as channels for or transport- other organism. ers of specifi c molecules and (2) as devices for transmembane signaling. See integral transplantation antigens Certain pro- membrane protein. teins produced by the major histocompat- ibility locus that are found on the surface transmembrane signaling A signal of all cells in the animal and that are mechanism in which the binding of a spe- responsible for provoking rejection of tis- cifi c molecule (the ligand) to the extra- sue grafts. See major histocompatibil- cellular domain of a transmembrane ity complex. protein (the ligand-binding domain) causes a physical change in the inter- transport In biochemistry the process nal domain; this then sets in motion a of moving a molecule from one location series of chemical reactions, for example, to another, usually across a membrane. phosphorylation(s) of certain proteins The term implicitly indicates that expen- that then produces specifi c changes in diture of energy is required for the trans- the cell behavior. This is called signaling port. See active transport. because the ligand never actually enters the cell. See G protein(s). transport protein A transmembrane protein that mediates the transport of a molecule across a membrane. Transport transmission electron microscope proteins are often in the form of a chan- (TEM) A device that is similar in prin- nel spanning the membrane that allows ciple to a conventional microscope but molecules to pass through. See integral that uses an electron beam instead of membrane protein. light, and a magnetic fi eld instead of a glass lens to focus the beam on the speci- transposase An enzyme encoded by men. The image of the specimen is seen genes on a type of transposon, called an as a pattern of greater or less electron insertion sequence, that recognizes the intensity in the beam that emerges from terminal inverted repeat sequences and the specimen. The great advantage of catalyzes the events in the transposition. the electron microscope over the conven- tional light microcope is that, because transposition immunity A term used electrons have a much shorter wavelength to describe the observation that plasmids than photons, resolution of much fi ner containing one copy of a transposon detail is possible. (such as Tn3) are resistant to insertion by another copy of the transposon. transplacement vector A vector that is designed to transfer a defi ned segment transposon A mobile genetic element of DNA of interest to another vector found primarily in prokayotic cells that by recombination. Transplacement vec- carries genetic information from one tors are useful in situations where one site in the genome to another. Trans- wishes to introduce a DNA segment into posons may carry a variety of genes or a particularly large vector (e.g., baculo- other genetic units, but they always carry virus or a yeast artifi cial chromosome) the information needed to carry out the or another vector in which it is diffi cult transfer function, for example, short ter- to engineer a unique site for making the minal-inverted repeat sequences that are
247 干细胞之家www.stemcell8.cn ←点击进入
rectotransvection
Transposon
needed for insertion of the transposon trigger factor A bacterial protein into their target sites in the genome. which, by forming a complex with a pre- protein, holds the polypeptide in a spe- transvection The infl uence of the cifi c conformation necessary for its inser- synapsing of paired chromosomes on tion into the bacterial cell membrane. the expression of genes in the region of the synapse. The phenomenon was fi rst triglyceride A type of lipid formed from described in Drosophila melanogaster glycerol and fatty acids. Triglycerides are within the bithorax complex (BX-C). the major form of storage for fatty acids Transvection usually involves enhancers and are the main constituents of body fat. acting on genes on the opposite chromo- some (i.e., in trans) but can also involve trimethoprim A folate antagonist anti- silencers acting in trans. biotic with activity against both bacterial and parasitic infections. Trimethoprim trehalose A disaccharide of the sugar blocks the synthesis of folate, an essen- glucose. Trehalose is mainly found in tial nutrient, from para-amino benzoic insects where it is used as a source of acid (PABA). The effectiveness of trime- energy. thoprim depends upon the fact that mam- mals can obtain folate from food whereas tricarboxylic acid cycle A series of bacteria and lower eukaryotes must syn- reactions beginning with the formation thesize it de novo. of citric acid (also known as the citric acid cycle or Krebs cycle) by which the triplet In general any group of three. majority of the energy from the oxygen- In molecular genetics, the term generally dependent oxidation of glucose is derived. refers to the triplet of nucleotide bases The cycle consists of a critical series of that makes up the genetic code for an reactions in the oxidation of sugars in amino acid. See codon and wobble which CO2 and H2O and electrons to be hypothesis. used in electron transport are produced from the intermediate, acetyl-CoA. The triploidy The state of having one majority of CO2 produced in the body extra haploid set of chromosomes, that from muscular activity is generated via is, 3n, where n = the haploid chromo- this pathway. some number.
248 干细胞之家www.stemcell8.cn ←点击进入
tunicamycinverso
triskelion A subunit of the clathrin are critical regulators of cell growth that coat of coated pits. The triskelion is are believed to act as negative regulators named for its tripartite structure consist- of S6 kinase 1 (S6K1) and eukaryotic ing of three light and three heavy poly- initiation factor 4E binding protein 1 peptide chains. (4E-BP1).
Triton X-100 A nonionic detergent tubulins Two proteins (alpha and beta) used for the biochemical isolation of cell of about 55,000 daltons each that consti- membranes and nuclei. tute the subunit proteins of microtubules.
troponins A class of proteins that reg- tumor An abnormal growth of a tis- ulate muscle contraction by binding to sue. In benign tumors, the tissue growth tropomyosin and inhibiting of the inter- eventually stops and the tumor remains action between the actin and myosin fi la- confi ned to the site at which it began; ments. There are three troponin subunits in malignant tumors, growth is unlimited in the troponin complex that assembles and may take place at sites distal from onto tropomyosin fi laments: inhibitory the site of origin, known as metastases. (I), tropomyosin binding (T), and calcium binding (C). The inhibition of muscle tumorigenesis The process of tumor contraction by the I subunit is relieved by formation. Tumorigenesis is the end point calcium binding to the C subunit. in the process of transformation. A protease that cleaves poly- trypsin tumor necrosis factor (TNF) A factor peptides specifi cally after the amino acids originally isolated from serum and found arginine or lysine. to be produced by certain leukocytes (for example, macrophages) that appear to be tryptophan An amino acid containing selectively toxic to tumor cells. The gene an indole group in its side chain. Trypto- for TNF has been cloned and expressed phan is the precursor of the neurotrans- in quantities that are suffi cient for ongo- mitter, serotinin, in animals and the plant ing clinical studies of its effectiveness as hormone, indole acetic acid (IAA). an anticancer agent. TSH-releasing hormone (TRH) A short (three amino acids) polypeptide tumor promoter A chemical that, by hormone produced in the hypothalamus itself, does not cause tumors but that that stimulates the anterior portion of will induce the formation of tumors after the pituitary gland to secrete thyroid- exposure of a tissue to any of a class of stimulating hormone (TSH). other agents called tumor initiators.
tuberous sclerosis complex (TSC) tumor virus Any virus that induces the An inherited genetic disease of organ sys- formation of a tumor in the tissue that it tems, particularly the brain, skin, heart, infects. lungs, and kidneys. This can result in epilepsy, learning and behavioral dif- tunicamycin An antibiotic isolated from fi culties, skin and renal lesions; kidney Streptomyces lysosuperfi cus that inhibits complications can include cysts, polycys- the synthesis of N-linked glycoproteins. tic renal disease, and renal carcinoma. Tunicamycin is a structural analog of Tuberous sclerosis complex is caused UDP-N-acetylglucosamine (UDP-GlcNAc) by mutations in the tumor suppressors that acts as a competitive inhibitor of the hamartin (located on chromosome 9q34) critical reaction between UDP-GlcNAc and tuberin (located on chromosome and Dolichol phosphate, the fi rst step in 16p13.3) that are encoded by the genes the process of N-glycosylation. Tunica- TSC1 and TSC2. Hamartin and tuberin mycin is widely used as a research tool
249 干细胞之家www.stemcell8.cn ←点击进入
rectoturgor/turgor pressure
for studying the process of protein glyco- Tween 80 A nonionic detergent used sylation. for isolation of cell membranes and to reduce background signal interference in turgor/turgor pressure Water pres- immunoblotting. sure resulting from the diffusion of water into cells. The term is usually applied twin sectors If the process of transpo- to the rigidity of plant structures, for sition carried out by a transposon occurs example, leaves and stems resulting from just at the time of cell division such that osmotic pressure. only one daughter cell carries the trans- position, then the descendants of such Turner’s syndrome A genetic defect genotypically different daughter cells are in which the cells of the affl icted indi- called twin sectors. vidual contain one X chromosome but no Y chromosome. Although such indi- twisting number For a given double viduals have the outward appearance of helical DNA, a number representing the females, the sexual organs are incomplete total number of helical turns. The twist- or undeveloped. ing number is calculated as the total number of base pairs in the DNA under turnover number For an enzyme- consideration divided by the number of catalyzed reaction, the number of sub- base pairs per turn. strate molecules undergoing reaction per unit time. For example, in the reaction Ty 1 elements A type of transposon in catalyzed by carbonic anhydrase, yeast; Ty is an acronym for transposon CO2 + H2O → H2CO3, yeast. The Ty elements are about 6.3 kb the enzyme has a turnover number of long and contain genes similar to the gag 600,000 molecules of CO2 per second. and pol genes of retroviruses.
T vector A specialized vector, usually tyrosine An amino acid with a pheno- a plasmid, for cloning PCR products. lic group in its side chain. Tyrosine is a Because the polymerases used in the poly- precursor of adrenaline and the skin pig- merase chain reaction also possess ter- ment melanin. minal transferase activity, PCR products contain overhanging chains of polyadenyl- tyrosine kinase A type of enzyme ate residues on their 5′ termini. T vectors that catalyzes the transfer of a phosphate are linearized DNAs that contain comple- group (phosphorylation) to a tyrosine mentary thymidylate residues on their 5′ amino acid in a protein. The oncogenes termini that permit base pairing between activated by a number of retroviruses the T vector and the PCR product to be have been shown to be tyrosine kinases. cloned. See kinase.
250 干细胞之家www.stemcell8.cn ←点击进入
U
ubiquitin A protein originally discov- then recopies the region using the remain- ered in the nucleosomes of the fruit fl y, ing strand as a template. See excision Drosophila melanogaster, whose binding repair. to A- and B-type mitotic cyclins leads to their destruction at the end of mitosis. unequal crossing over A form of Ubiquitin binding to the cyclin allows it recombination in which a segment of to be proteolytically degraded by a multi- DNA from one chromosome is trans- protein proteosome complex. ferred to a position adjacent to its own allele on the homologous chromosome: ultracentrifugation Centrifugation at — -+ ------+-— speeds great enough to produce forces of X allele greater than 300,000 times the force of — -+ ------+-— gravity. The forces produced by ultracen- X′ allele trifugation are capable of separating mol- ↓ ecules of different sizes from one another. ↓ The ultracentrafuge was invented by the Swedish physical chemist Theodor Sved- X′ allele X allele berg in 1923. — -+ ------+ ------+-—
ultrafi ltration A technique using gas unicellular Composed of a single cell; pressure to drive samples through an for example, protozoa are unicellular ultrafi ne meshed fi lter for the fi ltration of organisms. particles smaller than bacteria. upstream activator sequences DNA sequences found in yeast that are similar ultrastructure Features of cell archi- to enhancer sequences in higher organ- tecture discerned in an electron micro- isms in that they can stimulate the tran- scope. scription of a gene from a long distance but only when they are located upstream ultraviolet radiation Light with a (i.e., in the 5′ direction) from the gene. wavelength in the range of about 200– 400 nanometers. Ultraviolet light is read- uracil A pyrimidine base used instead ily absorbed by tissue that is exposed to of thymine in ribonucleotides and RNA. it, for example, skin. Ultraviolet radia- tion produces numerous alterations in urea A compound derived from ammo- biomolecules, including mutations in nia and carbon dioxide. Ammonia pro- DNA, that are linked to tumorigenesis. duced from the breakdown of amino See thymine dimers. acids is excreted as urea in the urine.
ultraviolet repair A system used by uric acid A purine-like molecule formed bacteria to repair regions of DNA dam- as a degradative product of the purine aged by exposure to ultraviolet light. The nucleotides. Because uric acid is relatively ultraviolet repair system removes altered insoluble in body fl uids, overproduction nucleotides (e.g., thymine dimers) and of uric acid produces a condition known
251 干细胞之家www.stemcell8.cn ←点击进入
uridine
as gout, the accumulation of uric acid crystals in joints. Uric acid is the main vehicle for the elimination of ammonia by birds and reptiles.
uridine The nucleoside derivative of uracil, that is, uracil bonded to ribose.
uridine triphosphate (UTP) The triphosphate derivative of uridine; the uracil-containing molecule used in the synthesis of RNA. See nucleotide.
urokinase A protease, found in urine and blood, that has the same activity as plasminogen activator; urokinase is therefore used therapeutically to dissolve blood clots that may accumulate in the coronary arteries. Uridine
urotensin II See GPR14.
252 干细胞之家www.stemcell8.cn ←点击进入
V
-2 vaccination The capacity of a vaccine vanadate (HVO4 ) A compound of to induce an immune response to a patho- vanadium that, in biological systems, genic organism in an individual usually functions as an analog of phosphate, by multiple, direct injection of the vac- which inhibits the action of transporters cine at a body site favorable for exposure known as P-type ATPases. to the immune system. Vaccination is a prophylactic procedure that is generally Van der Waals forces Weak electro- ineffective in treating disease after onset. static forces between nonpolar hydrocar- bon molecules such as those that make vaccine A preparation, derived from up paraffi ns and the lipids in membranes. inactivated or attenuated pathogenic Van der Waals forces are primarily organisms, that is used for vaccination. responsible for the aggregation of waxy, oily, or fatty substances in water. vaccinia virus A member of the poxvi- ruses that causes cytopathic destruction of variable region The terminal portion epithelial cells (pocks); vaccinia is the agent of an antibody molecule that contains the responsible for cowpox. Vaccinia virus is site that binds the antigen that the immu- closely related to variola virus that causes noglobulin carries specifi city for. The smallpox in humans. Vaccinia is easily variable nature of this region is a refl ec- grown in tissue-cultured cells for purposes of tion of the large number of antigens for creating vaccines. For this reason, vaccinia is which specifi c antibodies can be made. being researched as a vector for expressing recombinant DNA for other pathogens with variable surface glycoprotein (VSG) a view toward using this as a system for cre- The major component of the cell surface ating vaccines to other agents. of the trypanosome parasite, such as the sleeping-sickness-producing parasites that vacuole A membrane-enclosed cyto- are carried by the tsetse fl y. The VSGs, plasmic organelle generally arising from which are the only antigenic molecule on phagocytosis and often containing en- the trypanosome surface, change through- zymes involved in degradation of biologic out the development of the organism. material, for example, proteases. These rapid changes in the VSG allows the organism to evade the immune system valine An amino acid with an isopropyl of the host. The VSGs are coded for by group as its side chain; valine belongs to a large family of genes, and the expres- the group of nonpolar amino acids. sion of different VSGs at various stages of development is due to the activation of valinomycin An antibiotic composed different VSG genes from this gene family. of lactate, hydroxyisovalerate, and the amino acid, valine, joined together in a vascular endothelial growth factor ring confi guration that carries a potassium (VEGF) A family of growth factors pro- ion in its center. In this way, valinomycin duced by cells at the site of a wound and acts as a vehicle for transporting potas- by some tumors that stimulates the process sium through the cell membrane, thereby of angiogenesis. The mammalian VEGF destroying the delicately balanced ion con- family consists of fi ve members—VEGF, centration in the cell. See ionophore. VEGF-B, VEGF-C, VEGF-D, and placenta
253 干细胞之家www.stemcell8.cn ←点击进入
vasoactive intestinal peptide
growth factor (PlGF)—that are all encoded cells that line the gut and the discharge of by separate genes. New anticancer drugs, neurotransmitters into the synaptic cleft. such as Avastin, target VEGF or its receptor as a means of starving tumors by depriv- Venter, J. Craig (b. 1946) Founder of ing them of blood supply from new blood The Institute for Genomic Research (TIGR) vessel growth induced by tumor-derived who, backed by venture capital, competed VEGF. with the NIH-backed Human Genome Project in sequencing the entire human vasoactive intestinal peptide (VIP) A genome. Venter is known for employing neuropeptide hormone that is found an innovative “shotgun” approach that uti- to have effects on the immune system, lized robotic sequencing of short genomic including anti-infl ammatory effects, inhi- fragments and advanced computer algo- bition of cytokine production, and inhi- rithms to assemble the sequence data. bition of macrophage functions such as chemotaxis and phagocytosis. VIP has veratridine A powerful neurotoxin, been found to exert some of these effects derived from the lily Schoenocaulon offi - via a cAMP-mediated signal transduction cinalis, that is used to study nerve func- system. tion. Veratridine interferes with the action of sodium channels such that sodium ions vasopressin A polypeptide hormone, can pass freely into the neuron. produced by the posterior part of the pituitary gland, that causes an increase very short patch repair (VSPR) The in blood pressure but also decreases the type of excision repair that involves mis- fl ow of urine. Previously known as antid- matches between single bases. iuretic hormone. vimentin A protein comprising one of vav-1 oncogene A rho-type guanine the subclasses of intermediate fi laments nucleotide exchange factor (GEF) of the that make up a tissue-specifi c cytoskeleton Dbl family. vav-1 plays a role in develop- in mammalian cells. Vimentin fi laments ment and activation of T and B cells. vav- are characteristically found in cells of 1 is the binding partner of the HIV-1 nef mesenchymal origin such as fi broblasts. proteins. The vav-1/nef complex causes cytoskeletal rearrangements, activates the vinblastine An antitumor drug isolated JNK/SAPK signaling cascade, and upreg- from the Madagascar periwinkle plant ulates HIV transcription and replication. (Vinca rosea). Vinblastine acts to cause The vav gene map locus is 19p13.2 depolymerization of microtubules by binding to the tubulin protein subunits. vector Any DNA that can propagate itself rapidly in a host and can also main- vincristine An antitumor drug isolated tain this capability after insertion of from the Madagascar periwinkle plant foreign DNA into the vector. Although (Vinca rosea); a chemical variant of vin- there are many types of vectors, the most blastine that acts to cause depolymeriza- common ones are derived from bacterial tion in the same manner as vinblastine. plasmids or the DNAs of both bacterial See vinblastine. and animal viruses. Most vectors in use today have been subjected to genetic engi- vinculin A component of the adhesion neering for specifi c purposes such as the plaque that, together with alpha-actinin, expression of foreign proteins in bacteria attaches to both the terminus of a stress or animal cells (expression vectors). fi ber and a transmembrane integrin mol- ecule to form an adapter complex that vectorial discharge Secretion of a sub- connects the integrin to the stress fi ber. stance by a cell at only one location or The phosphorylation of tyrosine residues area on the cell surface. Examples of vec- in vinculin in transformed cells is believed torial discharge include the secretion of to play a role in the altered cell-substrate mucin at the apical surface of epithelial interactions that is seen in transformed
254 干细胞之家www.stemcell8.cn ←点击进入
von Willebrand disease
cells grown in tissue culture. See extra- ment, visual purple, and also has profound cellular matrix. effects on the differentiation of epithelial including anticancer effects. Derivatives of viomycin An antibiotic that acts by vitamin A have been used as therapeutic blocking a critical step in protein synthesis agents for a variety of skin conditions such (translocation), thereby causing the synthe- as icthyosis, acne, and wrinkling. sis of a polypeptide to be blocked before completion. Viomycin is itself a peptide vitamin B12 A ring-shaped, cobalt-con- that binds to either the large or the small taining molecule also known as cobala- ribosomal subunit to block translocation. mine. Vitamin B12 is an essential cofac- tor for the entry of certain amino acids virion A complete virus particle that and fatty acids into the tricarboxylic acid includes the viral nucleic acid (either RNA cycle (Krebs cycle). or DNA) and, in some cases, enzyme mol- ecules enclosed in a protein capsid. vitamin B6 Any of various derivatives of pyridoxine (e.g., pyridoxal phosphate) viroid An unusual infectious agent that used as a cofactor in the transamination produces diseases in plants and consists reaction, the critical step by which amino only of a naked, circular strand of RNA. acids enter into the tricarboxylic acid cycle (Krebs cycle). virulent, virulence The property of rapid spread of a pathogenic agent (e.g., voltage-gated channel A specialized a virus or bacteria) through a susceptible type of transmembrane channel that opens population. only when there is an electrical potential of a certain value across the plasma mem- virus An agent that infects single cells brane (the threshold). Voltage-gated chan- but consists only of the components of the nels for ions are present on a variety of virion and does not possess the cellular cell types but are especially characteristic machinery required for its own replica- of neurons where they are responsible for tion. For this reason, viruses are, of neces- the generation of an action potential. sity, intracellular parasites that are not clearly classifi able as living organisms. von Willebrand disease (vWD) An inherited disorder in which blood fails to virusoids One of two classes of small clot properly. Symptoms of vWD include infectious RNA molecules in plants. bleeding from the gums, nose, and intes- Virusoids do not contain genes for their tinal lining and prolonged or excessive own replication or packaging but require bleeding from small cuts. vWD is caused a second, helper virus to accomplish these by mutations in a gene coding for a sub- functions. Virusoids are also referred to stance known as von Willebrand factor, as satellite RNAs. which causes platelets to stick to damaged blood vessels and which carries a clotting viscosity The property of resistance to factor, called factor VIII. There are three fl ow exhibited by a substance in a fl uid, types of von Willebrand disease: semisolid state. In biochemical solutions, viscosity is an indicator of a solution con- • type 1, in which lower levels than nor- taining large macromolecules. mal of von Willebrand factor are pres- ent in the blood vitamin An essential nutrient in the diets of mammals; any of a number of • type 2, in which a defective von Wil- organic molecules that generally function lebrand factor is made as cofactors for specifi c enzyme-catalyzed • type 3, in which von Willebrand fac- reactions involved in energy production. tor is virtually absent and there are very low levels of factor VIII vitamin A Any of the various chemical relatives of retinol (e.g., retinoic acid). Vita- The gene map locus for von Willebrand min A is the precursor of the visual pig- factor is 12p13.3.
255 干细胞之家www.stemcell8.cn ←点击进入
W
Waldenstrim’s macroglobulinemia western blot A technique for identi- A tumor of the lymphatic system charac- fying polypeptides that have been sepa- terized by oversecretion of IgM immuno- rated by polyacrylamide gel electropho- globins. Immunoglobulins derived from resis based on the reaction of specifi c this tumor were used to derive the pen- antibodies to the proteins after they are tameric structure of IgM-type immuno- transferred from the gel to an artifi cial globulins. membrane.
Warren, Robin J. (b. 1937) A path- Williams syndrome A rare congenital ologist who, in collaboration with Dr. disorder characterized by an “elfi nlike” Barry Marshall, a gastroenterologist facial appearance, cardiovascular and at the Royal Perth Hospital, discovered blood vessel problems, dental and kidney the bacterium Helicobacter pylori and abnormalities, and musculoskeletal prob- showed that the microbe was the main lems. Individuals with Williams syndrome cause of peptic ulcers. This stood in con- may show good language, music, and trast to prevailing dogma of the time that interpersonal skills, but their IQs are usu- ulcers were caused by stress. The discov- ally low. The genetic basis for the disease is a deletion on a segment of chromo- ery of the bacterium eventually led to a some 7 that includes the gene that codes cure for ulcers and earned Warren and for elastin and the enzyme LIM kinase. Marshall the Nobel Prize in physiology Elastin is a key component of connec- or medicine in 2005. tive tissue and the loss of elastin leads to the vascular disease seen in Williams syn- Watson, James D. (b. 1928) Along drome. LIM kinase is strongly expressed with Francis Crick, he demonstrated the in the brain, and its absence is believed double helical structure of DNA using the to account for neurodevelopmental brain technique of X-ray crystallography. This abnormalities. discovery showed that DNA had the req- uisite characteristics of a macromolecule Wilson’s disease A rare autosomal that could serve as the genetic material. recessive disorder affecting the transport Watson and Crick were awarded the of copper that results in toxic accumula- Nobel Prize in medicine in 1962. tion of copper in the liver and brain. In children liver disease is the most promi- Wernicke-Korsakoff syndrome A nent symptom, while neurological disease genetic disease caused by mutations in the is seen mostly in young adults. Wilson’s gene coding for the enzyme transketolase, disease is caused by mutations in a gene which is critical for the metabolism of pen- called ATP7B, a P-type ATPase trans- toses (fi ve-carbon sugars). The disorder is porter located in the Golgi network. The characterized by severe memory loss, con- gene map locus for ATP7B is 13q14.3. fusion, and partial paralysis. The disease- causing mutations result in lowered affi n- white matter That portion of the brain ity of the enzyme for thiamine, which is a consisting of myelinated nerve fi bers coenzyme for transketolases. (axons) serving to carry nerve impulses
256 干细胞之家www.stemcell8.cn ←点击进入
writhing number
from the gray matter of the brain that give triplets but that the second and third posi- it a characteristic white color. tions of the triplets will vary or “wobble,” with the third base of the triplet exhibiting wild-type gene The normal, nonmu- the most wobble. See codon. tated version of a gene. writhing number (W) A number wobble hypothesis The idea that, for representing the turning of the axis of a an amino acid for which there is more than supercoiled DNA: W = L – T, where L = one triplet in the genetic code, the fi rst base the linking number and T = the twisting will always be the same in the different number.
257 干细胞之家www.stemcell8.cn ←点击进入
AX
xanthine-guanine phosphoribosyl tr- inserted into the gene (thereby inactivat- ansferase (gpt) gene See HGPRT. ing the gene) by cloning can be detected by the color of the colony they produce. X chromosome One of the two sex See insertional inactivation. chromosomes. The sex of the fetus is determined from the sex chromosomes X-linked diseases Genetic diseases present in the fertilized egg: Two X chro- that are carried on one of the sex chro- mosomes in the fertilized egg will produce mosomes. a female, and one X chromosome and one Y chromosome will produce a male. X-ray crystallography A technique for deducing the physical dimensions of xenograft A graft from a foreign a molecule (sizes of the atoms, lengths of donor, for example, human skin grafted the bonds between them) by examining onto a mouse. how the path of an X-ray beam is altered as it passes through a crystallized sample xeroderma pigmentosum (XP) A of the molecule of interest. See X-ray family of autosomal recessive genetic diffraction. diseases in which excision-repair mecha- nisms are faulty. This illness results in X-ray diffraction A technique for increased sensitivity to sunlight and, in determining distances between atoms in particular, a much higher incidence of a molecule by analyzing the diffraction sunlight-induced cancers. At present nine pattern produced when an X-ray beam XP-related genetic loci all involved in the passes through molecules in a crystal- process of excision repair of pyrimidine lized form. dimers and other bulky groups have been identifi ed. XRCC1 X-ray Repair Cross Comple- menting; a protein that plays a role in X-gal A synthetic substrate for the excision repair of DNA following ion- enzyme beta-galactosidase that produces izing irradiation. The C-terminal end of a blue product when acted upon by the XRCC1 binds DNA ligase III and the N- enzyme. In vectors that carry the gene terminal end binds DNA polymerase β for beta galactosidase, growth of bacteria to form a repair complex after damaged that contain a recombinant DNA that is DNA is excised.
258 干细胞之家www.stemcell8.cn ←点击进入
AY
YAC See yeast artifi cial chromo- yeast two-hybrid system A method some. for determining whether two proteins form a complex in vivo using genetically Yalow, Rosalyn (b. 1921) Inventor of engineered DNAs. In this technique, two the radioimmunoassy (RIA) technique for DNA constructs (hybrids) are created: detection of minute quantities of protein (1) DNA coding for the DNA-binding using a specifi c radiolabeled antibody. By domain of a particular transcription fac- applying this technique to insulin she was tor fused to a DNA segment coding for able to demonstrate the existence of dia- one of the test proteins and (2) DNA cod- betic states that did not result from insulin ing for the activation domain of a partic- insuffi ciency. She was awarded the Nobel ular transcription factor fused to a DNA Prize in physiology and medicine for this segment coding for the other test protein. work in 1977. When the two constructs are transfected together into yeast cells, an active tran- Yanofsky, Charles (b. 1925) A bio- scription factor will be formed if, and chemist who studied the regulation of the only if, the two test proteins bind to one bacterial operon that governs the synthesis another; that is, a complex will be formed of the amino acid, tryptophan. His fi ndings that contains both the DNA-binding showed that the trp operon is regulated in domain and the activation domain. If the at least two ways: (1) via a special regula- promoter that is normally activated by tory protein termed the trp repressor and the transcription factor is itself fused to a (2) by a unique mechanism termed attenu- reporter gene, expression of the reporter ation. These were among the pioneering indicates that the test proteins do interact discoveries in the fi eld of gene regulation. (i.e., bind to one another) in vivo. yeast(s) A subclass of fungi whose mem- bers are single-celled. Yeasts display the yes oncogene A non-receptor cyto- major characteristics of higher cells including plasmic protein tyrosine kinase that is chromosomes, an endoplasmic reticulum, a member of the src family of tyrosine and sexual mating. Because they are among kinases. The human gene is the cellular the simplest eukaryotic cells with these char- homologue of the oncogene carried by acteristics, they are used as convenient and the Y73 avian sarcoma virus (Yamagu- easily manipulable model systems to study chi sarcoma virus) and is a proto-onco- the molecular genetics of eukaryotic cells. gene located on chromosome 18p11.32. c-yes is highly expressed in neurons, yeast artifi cial chromosome A type of spermatozoa, platelets, and epithelial vector that is used for cloning extremely cells and is believed to have a general large DNA fragments in yeast. The vec- role in growth control. Oncostatin M tor is constructed by combining those utilizes a signal transduction pathway elements of the yeast chromosome nec- in human endothelial cells involving the essary for chromosome replication with activation of the yes tyrosine kinase. yes the foreign DNA. The recombinant DNA also becomes activated after binding of created in this way can then be grown in colony stimulating factor (CSF) to its a yeast host for many generations. receptor.
259 干细胞之家www.stemcell8.cn ←点击进入
AZ
z-DNA A form of DNA in which the bacteriophages that became an important two strands are twisted around each tool in the mapping of bacterial genes. other in a left-handed helix as opposed to the right-handed helix found in the more zoo blot A Southern blot in which a common form (i.e., B-DNA). probe from a DNA that is suspected to represent a gene in one species is tested for Zellweger syndrome A rare, autoso- its relatedness to sequences in other spe- cies. If the probe is found to hybridize to mal recessive disorder that begins in utero DNAs from other species, then, because and is characterized by defective myelina- genes tend to be conserved in other spe- tion of nerve tracts, mental and growth cies, this suggests that the probe represents retardation, craniofacial malformations, a gene. See hydridization stringency glaucoma, seizures, cataracts, kidney cysts, and Southern blot hybridization. and cardiac complications. The disease is caused by a reduction in, or an absence zygotic-effect genes Genes that effect of, perioxisomes in the liver, kidney, and the segmentation pattern of the embryo of brain. Zellweger syndrome is caused by the fruit fl y, Drosophila melanogaster, that mutations in any of several different genes are derived from both the maternal and whose products are needed for peroxi- paternal parent as opposed to those that some formation, for example, peroxin-1 are active in the egg even before fertilization (PEX1), peroxin-2 (PEX2), peroxin-3 and so are referred to as maternal-effect (PEX3), peroxin-5 (PEX5), peroxin-6 genes. See segments, segmentation. (PEX6), peroxin-12 (PEX12), peroxin- 14 (PEX14), and peroxin-26 (PEX26). zymogen An inactive form of a proteo- The genetic loci map to chromosomes 1 lytic enzyme. The active enzyme is gen- (PEX14), 7q21 (PEX1), 8q (PEX2), 6q23 erated by the action of other proteolytic (PEX3), 12 (PEX5), and 6p (PEX6). enzymes via cleavage of the zymogen pep- tide at specifi c sites. The term is derived from the phrase: enzyme generating. For zinc fi nger A feature of many DNA example, the zymogen, chymotrypsino- binding transcription regulatory proteins gen, is cleaved by the protease, trypsin, to (transcription factors) in which a zinc generate the active enzyme, chymotrypsin. atom is bonded to four amino acids (gen- erally cysteine and histidine residues) so zyxin (ZYX) A component of adhesion as to hold the polypeptide in a loop which plaques that functions both as a regula- has been termed a fi nger. The fi nger is tor of actin fi lament assembly and as a necessary for the DNA-binding proper- component of the mitotic regulatory appa- ties of the protein. ratus. During mitosis cytoplasmic zyxin forms a complex with a factor called h- Zinder, Norton (b. 1928) A geneti- warts/LATS1 (the human homologue of a cist who studied recombination in bacteria Drosophila melanogaster tumor suppres- and bacteriophages. As a graduate student sor) on the mitotic apparatus. Complex in the laboratory of Joshua Lederberg, he formation between zyxin and h-warts/ carried out the critical experiments involv- LATS1 is regulated by phosphorylation of ing mutants of the Salmonella bacterium zyxin h-warts/LATS1 by Cdc2 kinase. The that led to the discovery of transduction by zyxin gene map locus is 7q34-q35.
260 干细胞之家www.stemcell8.cn ←点击进入
verso Appendixes
I. Acronyms (and Other Abbreviations)
II. The Chemical Elements
III. Periodic Table
IV. The Genetic Code
V. Purine and Pyrimidine Bases Found in Nucleic Acids
VI. Side Chains (R Groups) for Individual Amino Acids
VII. Bioinformatics Web Sites
VIII. Enzymes Used in Gene Cloning
261 干细胞之家www.stemcell8.cn ←点击进入
Appendixes I. Acronyms (and Other Abbreviations)
A adenine A ACP acyl carrier protein ACTH adrenocorticotrophic hormone ADP adenosine diphosphate AIDS acquired immunodefi ciency syndrome AMP adenosine monophosphate APC adenomatous polyposis coli APH aminoglycoside-3′-phosphotransferase araA arabinosyladenine araC arabinosylcytosine ARC AIDS-related complex ARS autonomously replicating sequences ATP adenosine triphosphate AZT 3′-azido-3′-deoxythymidine BAP benzylaminopurine BOD biochemical oxygen demand bp base pair 5-BU 5-Bromuracil C cytosine cAMP cyclic AMP CAP catabolite activator protein CAT chloramphenical acetyl transferase ccc DNA covalently closed circular DNA Ccrit critical dissolved oxygen concentration cdc cell-division cycle cDNA complementary DNA CF complement-fi xation CFT cystic fi brosis transmembrane conductance CFTR cystic fi brosis transmembrane conductance regulator CFU colony-forming unit cM centimorgan CML chronic myelogenous leukemia CMP cytidine monophosphate CNBr cyanogen bromide CoA/CoASH coenzyme A con A concanavalin A CRP catabolite repression protein CsCl cesium chloride ctDNA chloroplast DNA CTP cytidine triphosphate d deoxy DAG diacylglycerol dATP deoxyadenosine triphosphate dCTP deoxycytidine triphosphate dd dideoxy ddNTP dideoxyribonucleotide triphosphate dGTP deoxyguanosine triphosphate DHFR dihydrofolate reductase DMSO dimethyl sulfoxide
262 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso
DMT dimethoxytrityl DNA deoxyribonucleic acid (See also ctDNA, mtDNA.) DNase deoxyribonuclease dNTP deoxyribonucleotide triphosphate DP docking protein EBV Epstein-Barr virus ECM extracellular matrix E. coli Escherichia coli EDTA ethylenediaminetetraacetate EF elongation factor EGF epidermal growth factor ELC expression-linked copy ELISA enzyme-linked immunoabsorbent assay EMBL European Molecular Biology Lab EMS ethylmethane sulfonate ER endoplasmic reticulum erb erythroblastosis ERK extracellular receptor tyrosine kinase EST expressed sequence tags FACS fl ourescence-activated cell sorter f-actin fi lamentous actin FAD fl avin adenine dinucleotide FBJ Finkel, Biskis, and Jinkins (discoverers of the FBJ murine osteosarcoma virus) FCS fetal calf serum fes feline sarcoma FFU focus-forming unit FGP fl uorescent green protein FISH fl uoresence in situ hybridization 5-FU 5-fl uorouracil FMN fl avin mononucleotide FRA fos-related antigens FRAP fl uorescence recovery after photobleaching FSH follicle-stimulating hormone FSV feline sarcoma virus ftz fushi tarazu G guanine G actin globular actin GABA gamma amino butyric acid GAG glycosaminoglycan gal galactosidase GALT gut-associated lymphatic tissue GAP GTPase-activating proteins GC gas chromatography GDP guanosine diphosphate GEF guanine nucleotide exchange factor GFAP glial fi brillary acidic protein GH growth hormone GLC gas-liquid chromatography GMP guanosine monophosphate gpt guanine phosphoribosyl transferase GST Glutathione S-transferases GTP guanosine triphosphate
263 干细胞之家www.stemcell8.cn ←点击进入
rectoAppendixes
HAT hypoxanthine-aminopterin-thymine HCG human chorionic gonadotropin HDL high-density lipoproteins Hfr high-frequency recombination strain HGPRT hypoxanthine-guanine phosphoribosyl transferase HIV human immunodefi ciency virus HLA human leukocyte-associated antigens HLTV human T-cell leukemia virus HMG high-mobility group HN hemagglutinin-neuraminadase hnRNA heterogeneous nuclear RNA HPFH hereditary persistence of fetal hemoglobin HPLC high-performance liquid chromatography HPV human papilloma virus HRP horseradish peroxidase HSE heat-shock response element hsp heat-shock protein HSR homogeneously staining region HSV herpes simplex virus IAA indole acetic acid IDL intermediate-density lipoprotein IF initiation factor IL interleukin IMP inosine monophosphate IPTG isopropyl-β-D-thiogalactopyranoside IR infrared IS insertion sequence IUdR iododeoxyuridine j gene-joining gene KD diffusion coeffi cient/constant Ki-MuSV Kirsten sarcoma virus kM Michaelis-Menten constant LAV lympho adenopathy virus LDL low-density lipoprotein LH lutinizing hormone LINES long-period interspersed sequences LTR long terminal repeat MAPS microtubule-associated proteins MAR matrix attachment regions MAT mating-type locus MBP maltose binding protein MCP methyl-accepting chemotaxis protein mdr multidrug resistance 5MeC 5-methylcytosine MHC major histocompatibility complex MIF migration-inhibitory factor MMTV mouse mammary tumor virus MPF M-phase promoting factor mRNA messenger RNA mtDNA mitochondrial DNA MTOC microtubule organizing center MuLV murine leukemia virus MVR minisatellite variant repeat
264 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso
myb myeloblastosis myc myelocytomatosis NAD nicotamide adenine dinucleotide NADP nicotamide adenine dinucleotide phosphate NANA N-acetylneuraminic acid NBT nitro-blue tetrazolium N-CAM neural cell adhesion molecule NCBI National Center for Biotechnology Information NGF nerve growth factor NHGRI National Human Genome Research Institute NK cells natural killer cells NMR nuclear magnetic resonance NP40 nonidet P40 NTG neomycin, thymidine kinase, glucocerebroside oc open circle PAGE polyacrylamide gel electrophoresis PaPoVa papilloma, polyoma, and vacuolating viruses PAS periodic acid-Schiff stain PCR polymerase chain reaction PDGF platelet-derived growth factor PE phosphatidylethanolamine PEG polyethylene glycol PEP phosphoenol pyruvate PFU plaque-forming unit PITC phenyl isothiocyanate PKU phenylketonuria PML progressive multifocal leukoencephalopathy PMU polymorphonuclear leukocyte poly U polyuridylic acid PPLO pleuropneumonialike organisms PVP polyvinylpyrrolidone raf rat fi brosarcoma ras rat sarcoma RBC red blood cell RER rough endoplasmic reticulum RES reticuloendothelial system RFLP restriction fragment-length polymorphism RG resorufi n-β-D-galactopyranoside RNA ribonucleic acid (See also hnRNA, mRNA, rRNA, snRNA, tRNA.) RNP ribonucleoprotein ros Rochester 2 sarcoma rRNA ribosomal RNA RSV Rous sarcoma virus RTK receptor tyrosine kinase RVE reconstituted viral envelope SAM S-adenosylmethionine SAR scaffold attachment regions SDGF sarcoma-derived growth factor SDS sodium dodecyl sulfate SEM scanning electron microscopy sis simian sarcoma snRNA small nuclear RNA
265 干细胞之家www.stemcell8.cn ←点击进入
rectoAppendixes
SPF S-phase promoting factor SRP signal-recognition particle STR short tandem repeat STS sequence tagged site SV40 simian virus 40 T thymine, twisting number Taq Thermus aquaticus TB tuberculosis Tc cytoxic T cell TCA tricarboylic acid TEM transmission electron microscope TGF transforming growth factor TI tumor inducing TMV tobacco mosaic virus TNF tumor necrosis factor tPA tissue plasminogen activator TPA 12-O-tetradecanoylphorbol-13-acetate TRH TSH-releasing hormone tRNA transfer RNA TSH thyroid stimulating hormone Ts mutant temperature-sensitive mutant TTP thymidine triphosphate Ty transposon yeast U uracil UTP uridine triphosphate UV ultraviolet VLDL very low-density lipoprotein VSG variable-surface glycoprotein VSPR very short patch repair W writhing number XP xeroderma pigmentosum YAC yeast artifi cial chromosome
266 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso II. The Chemical Elements 34 14 47 11 38 16 73 43 52 65 81 90 69 50 22 74 92 23 54 70 39 30 40 112 115 114 113 111 Se Si Ag Na Sr S Ta Tc Te Tb Tl Th Tm Sn Ti W Uub Uup Uuq Uut Uuu U V Xe Yb Y Zn Zr selenium silicon silver sodium strontium sulfur tantalum technetium tellurium terbium thallium thorium thulium tin titanium tungsten ununbium ununpentium ununquadium ununtrium unununium uranium vanadium xenon ytterbium yttrium zinc zirconium a.n. = atomic number 7 8 42 60 10 93 28 41 76 46 15 78 94 84 19 59 61 91 88 86 75 45 37 44 62 21 102 104 106 Mo Nd Ne Np Ni Nb N No Os O Pd P Pt Pu Po K Pr Pm Pa Ra Rn Re Rh Rb Ru Rf Sm Sc Sg molybdenum neodymium neon neptunium nickel niobium nitrogen nobelium osmium oxygen palladium phosphorus platinum plutonium polonium potassium praseodymium promethium protactinium radium radon rhenium rhodium rubidium ruthenium rutherfordium samarium scandium seaborgium 9 2 1 3 68 63 87 64 31 32 79 72 67 49 53 77 26 36 57 82 71 12 25 80 100 108 103 109 101 Er Eu Fm F Fr Gd Ga Ge Au Hf Hs He Ho H In I Ir Fe Kr La Lr Pb Li Lu Mg Mn Mt Md Hg The Chemical Elements erbium europium fermium fluorine francium gadolinium gallium germanium gold hafnium hassium helium holmium hydrogen indium iodine iridium iron krypton lanthanum lawrencium lead lithium lutetium magnesium manganese meitnerium mendelevium mercury element symbol a.n. element symbol a.n. element symbol a.n. 4 5 6 89 13 95 51 18 33 85 56 97 83 35 48 20 98 58 55 17 24 27 29 96 66 99 107 110 105 Ac Al Am Sb Ar As At Ba Bk Be Bi Bh B Br Cd Ca Cf C Ce Cs Cl Cr Co Cu Cm Ds Db Dy Es actinium aluminum americium antimony argon arsenic astatine barium berkelium beryllium bismuth bohrium boron bromine cadmium calcium californium carbon cerium cesium chlorine chromium cobalt copper curium darmstadtium dubnium dysprosium einsteinium element symbol a.n.
267 干细胞之家www.stemcell8.cn ←点击进入
rectoAppendixes III. Periodic Table 2 Lr 71 10 18 36 54 86 Ar Kr Lu Xe Rn Ne He 103 (222) (260) 175.0 20.18 39.95 83.80 131.3 4.003 I F 9 Cl At 17 35 53 85 70 Br Yb No 102 (210) (259) 35.45 79.90 126.9 173.0 19.00 S 8 O Te 16 34 52 84 69 Se Po Tm Md 101 (210) (258) 32.07 78.96 127.6 168.9 16.00 7 P N Bi Er 15 33 51 83 68 As Sb Fm 100 115 (288) (257) 30.97 74.92 121.8 209.0 167.3 Uup 14.01 6 C Si Es 14 32 50 82 67 99 Sn Pb Ge Ho 114 (289) (252) Uuq 28.09 72.59 118.7 207.2 164.9 12.01 5 B Tl Al In Cf 66 98 13 31 49 81 Dy Ga 113 Uut (284) (251) 26.98 69.72 114.8 204.4 10.81 162.5 30 48 80 65 97 Tb Cd Zn Bk Hg 112 112.4 (285) (247) Uub 65.39 200.6 158.9 29 47 79 64 96 Cu Ag Au Gd Cm 111 107.9 (272) (247) 63.55 197.0 157.3 Uuu lements E Pt Ni 63 95 28 46 78 Eu Ds Pd 110 Am 106.4 (243) (271) 152.0 58.69 195.1 atomic number symbol atomic weight able of Ir 62 94 27 45 77 Co Pu Mt Rh Sm 109 102.9 (244) (266) 58.93 192.2 150.4 T 1 H 1.008 26 44 76 61 93 Fe Hs Os Ru Np 108 Pm 101.1 (145) (237) (265) 55.85 190.2 eriodic P U Tc 25 43 75 60 92 Re Bh Nd (98) Mn 107 (262) 54.94 186.2 144.2 238.0 W Cr Pr 24 42 74 59 91 Sg Pa Mo 106 95.94 (263) 52.00 183.9 140.9 231.0 V Ta 23 41 73 58 90 Th Ce Db Nb 105 92.91 (262) 50.94 180.9 140.1 232.0 Ti Zr Rf 22 40 72 57 89 Ac La Hf 104 91.22 (227) (261) 47.88 178.5 138.9 Numbers in parentheses are the Y Sc 21 39 atomic mass numbers of radioactive isotopes. 88.91 44.96 57-71* 89-103‡ series series ‡actinide *lanthanide 4 Sr 12 20 38 56 88 Ca Be Ra Ba Mg 87.62 (226) 24.31 40.08 137.3 9.012 1 3 K H Li Fr Cs 11 19 37 55 87 Rb Na (223) 22.99 39.10 85.47 132.9 1.008 6.941 The periodic table as it looks today.
268 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso IV. The Genetic Code
269 干细胞之家www.stemcell8.cn ←点击进入
rectoAppendixes V. Purine and Pyrimidine Bases Found in Nucleic Acids
Purines Pyrimidines
270 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso VI. Side Chains (R Groups) for Individual Amino Acids
271 干细胞之家www.stemcell8.cn ←点击进入
Appendixes
VII. Bioinformatics Web Sites
AlignACE Mitomap A Web site for identifying motifs by align- A database of variant human mitochon- ments of multiple sequences. The AlignACE drial genomes detailing known polymor- software can be downloaded. http://atlas. phisms and mutations and literature refer- med.harvard.edu/cgi-bin/alignace.pl. ences. http://www.mitomap.org. Accessed Accessed on September 12, 2005. on September 12, 2005.
The European Bioinformatics Institute National Center for Biotechnology Infor- Access to the EMBL nucleotide sequence, mation (NCBI) PDB protein, and microarray databases. A major bioinformatics Web site main- Searches of Medline literature database tained by the National Institutes of and patent abstracts. ClustalW for mul- Health. The NCBI is the repository of tiple sequence alignment and tools for the GenBank nucleotide and protein depicting protein three-dimensional struc- sequence database. This Web site also ture. http://www.ebi.ac.uk. Accessed on provides BLAST for alignment searches September 12, 2005. of the databases. There is a wide variety of useful tools for data analysis, such as ExPASy Proteomics Server ORF fi nder, Entrez Gene, Model Maker, The ExPASy (Expert Protein Analysis Sys- CD Search, Open Mass Spectrometry tem) proteomics server of the Swiss Insti- Search Algorithm, ProtEST, Cn3D, VAST tute of Bioinformatics (SIB) is devoted to Search, and CD Search. The NCBI also the analysis of protein sequences and pro- provides access to the PubMed database tein structure. This Web site also has tools of biomedical literature. http://www. for analysis of two-dimensional polyacryl- ncbi.nlm.nih.gov. Accessed on September aminde protein gels. Tools are available 12, 2005 for primary, secondary, and tertiary struc- ture analysis, including protein subfrag- National Human Genome Research Insti- ment mass prediction, and programs for tute modeling structures. Access to the Swiss Basic information on topics related to the Protein database. http://www.expasy.org. Human Genome Project, including eth- Accessed on September 12, 2005. ics and legal issues. Links to all major sequence databases. http://www.genome. The GENSCAN Web Server at MIT gov. Accessed on September 12, 2005. Scans large nucleotide sequences for vari- ous gene features such as exons and splice Online Analysis Tools sites in genomic DNA. http://genes.mit. This Web site contains a variety of tools edu/GENSCAN.html. Accessed on Sep- for carrying out sequence manipulations tember 12, 2005. and analyses, including alignments, DNA motifs, PCR primer design, phylogenetic MEME trees, restriction mapping, and open read- On the MEME Web site, searches of pro- ing frames and motifs. http://molbiol-tools. tein or DNA sequences can be carried ca/Restriction_endonuclease.htm. Accessed out for motifs that are present in differ- on September 12, 2005. ent sequences. MEME will analyze mul- tiple sequences for similarities among Pfam them. http://meme.sdsc.edu/meme/website/ A database of protein families derived meme.html. Accessed on September 12, from multiple sequence alignments. In 2005. the Pfam Web site, known protein struc-
272 干细胞之家www.stemcell8.cn ←点击进入
Appendixesverso
tures and domain architectures can be http://repeatmasker.genome.washington. viewed. Distribution of protein domains edu. Accessed on September 12, 2005. among species. Links to other databases. http://www.sanger.ac.uk/Software/Pfam. REPFIND Accessed on September 12, 2005. REPFIND fi nds clustered, exact repeats in nucleotide sequences. Output is in the Regulatory Sequence Analysis Tools form of a graphical display of the repeats Algorithms to scan genomes from vari- found. http://zlab.bu.edu/repfi nd. Accessed ous organisms for nucleotide pattern rep- on September 12, 2005. resenting putative regulatory sequences. http://rsat.ulb.ac.be/rsat. Accessed on Sep- Wadsworth Center tember 12, 2005. Run by the New York State Department of Health, the Wadsworth Center pro- The Repeat Masker Server at the Univer- vides news and information on health and sity of Washington. health-related research. Image analysis Web-based utility that scans DNA using SPIDER (System for Processing Image sequences for interspersed repeats (such as Data in Electron Microscopy and Related Alu and L1 elements) and low-complexity Fields). http://sfold.wadsworth.org/index.pl. short repeats (such as dinucleotide repeats). Accessed on September 12, 2005.
273 干细胞之家www.stemcell8.cn ←点击进入
Appendixes VIII. Enzymes Used in Gene Cloning
Enzyme Activity Applications
alkaline phosphatase removes 5´ terminal phos- dephosphorylation of vec- phates from the single- tors cleaved with a restric- stranded end of a DNA tion enzyme, to prevent strand ligation of the ends of the vector with itself, to increase the recovery of vectors with inserts
deoxyribonuclease I cleaves double or single • nick translation (DNase I) DNA strands by breaking • Dnase I footprinting phosphodiester bonds of the DNA backbone
DNA polymerase I copies a template DNA • preparation of labeled strand from an annealed DNA probes by nick primer translation • site-directed mutagenesis
exonuclease III cleavage of single nucleo- creation of nested dele- tides one at a time from the tions for sequencing 5´ end of double-stranded DNA, which has a non- phosphorylated 3´ end
Klenow enzyme a subfragment of DNA creation of blunt ends polymerase I lacking the for blunt-end cloning of 5→3´ exonuclease of the restriction fragments intact enzyme
polynucleotide kinase catalyzes the transfer of a end labeling of oligonu- the terminal phosphate cleatides to be used as group from ATP to the free probes 3´ end of a polynucleotide
Restriction enzyme(s) cleaves double-stranded standard “sticky end” DNA at sites defi ned by cloning for creation of specifi c palindromic nucle- recombinant DNAs otide sequences leaving “sticky” single-stranded ends
reverse transcriptase catalyzes the synthesis • cDNA cloning of DNA copied from an • generation of cDNA RNA template probes for microarray analyses • reverse transcription polymerase chain reac- tions (RT-PCR) 274 干细胞之家www.stemcell8.cn ←点击进入
Appendixes Enzymes Used in Gene Cloning, con'd
Enzyme Activity Applications
T4 DNA ligase catalyzes the formation • joining of vector and of a phosphodiester bond insert in most cloning pro- between 5´-phosphate cedures and 3´-hydroxyl ends of • site-directed mutagenesis two termini in double- stranded DNA
Taq polymerase a class of thermostabile polymerase chain reaction DNA polymerase(s)
terminal deoxynucleotide catalyzes the addition cloning of cDNAs and transferase of deoxyribonucleotides blunt-ended DNA frag- from deoxyribonucleotide ments triphophates (dNTPs) to a free 3´ hydroxyl end of double- or single-stranded DNA
275 干细胞之家www.stemcell8.cn ←点击进入