DOCSLIB.ORG

Occurrence of Different Species of Mycobacteria in Aquarium Fish from Swedish Pet-Shops

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Occurrence of Different Species of Mycobacteria in Aquarium Fish from Swedish Pet-Shops 78, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 ȱȱěȱȱȱ¢ȱ ȱȱęȱȱ ȱȬ T. Hongslo* and E. Jansson National Veterinary Institute, Department of Animal Health and Antimicrobial Strategies, Uppsala, Sweden Abstract ȱȱȱ¢ȱȱ ȱȱęȱȱŘŚȱ ȱȬǰȱȱȱŘŖŖŜȱȱ ŘŖŖŝǰȱȱȱȱȱȱȱȱȱęȱ ȱȱ ȱȬȱǯȱ ¢ȱȱȱŘŞȱǻŘřƖǼȱȱȱŗŘŖȱȱęȱ ȱȱȱȱ ȱȱ ȱȱȱȱȱȱ ȱȬȱǯȱȱȱȱȱȱ¢ȱ ȱ ȱ¡ȱȱȱȱ¢ȱȱȱȱęȱȱȱȱŘŚȱ ȱȬ ȱ¢ȱȱȱȱȱ£ȱȱȬȱȱȱȱȱŘŞȱȱ ęȱ ȱȱȱȱȱȱȱǯȱȱȱȱȱȱȱȱŗŖȱęȱȱ ȱȱȱŘŚȱȬȱȱȱȱȱȱȱȱŘŞȱȱęȱ ȱǰȱ ȱȱȱȱȱŗŜȱȱȱȱȱȱȱ ȱŗŜȱȱȱ ǯȱȱȱȱ¢ȱȱȱȱȱȱȱȱȱȬȱ was Mycobacterium marinumǰȱ ȱ ȱȱȱśŖƖȱȱȱǰȱ ȱ¢ȱM. fortuitum and M. peregrinumǰȱ ȱȱ ȱȱȱŘşƖȱȱȱǯȱȱȱȱȱ ęȱȱȱȱȱȱ¢ȱȱ ȱȱȱŘśȱǻŞşƖǼȱȱȱȱŘŞȱęȱ and that the most common mycobacteria species also detected here was M. marinum that occurred ȱŗśȱǻśŚƖǼȱȱȱęǯȱȱ¢ȱȱęȱȱȱȱęȱ ȱM. arupense, M. chelonae, M. Ěorentinum, M. fortuitum, M. gordonae and M. haemophilum. In summary, 8 species ȱ¢ȱ ȱęȱȱ ȱȱęȱȱ ȱȬǰȱȱȱ ȱȱȱȱȱȱȱȱęǰȱȱȱȱȱ£ǯ Introduction ȱęȱȱȱȱȱȱȱȱ ¢ȱȱ ȱȱȱȱ¡ȱȱ ¢ȱȱ ǯȱ ǰȱȱęȱȱ ȱȱ¢ȱȱȬȱ- ȱȱ ȱǰȱȱ¢ȱ ȱȱȱęȱȱȬȱǻ £ǰȱ bacteria belonging to the genus Mycobacterium 2008; Pate et al., 2005; Wickins et al., 2011). A have been reported to cause serious disease ȱȱ¢ȱȱ ȱȱ ǻĴ ȱȱǯǰȱŘŖŖŖDzȱȱȱǯǰȱŘŖŖśǼǯȱ ęȱȱŘŚȱ ȱȬǰȱȱȱ Several studies have been published regarding ŘŖŖŜȱȱŘŖŖŝǰȱȱȱȱȱȱȱ ȱȱ¢ȱȱȬȱȱ ȱȱȱȱ ȱȱ ȱ ȱȱęȱȱȱęȱǰȱ Ȭȱȱǻ ȱǭȱ ǰȱŘŖŖşǼǯȱ¢ȱ wholesalers and private aquarists (Beran et al., thorough microscopic investigation 28 (23%) 2006; Lescenko et al., 2003; Novotny et al., 2010; ȱŗŘŖȱȱęȱ ȱȱȱȱ ȱ Prearo et al., 2004; Zanoni et al., 2008). However, ȱȱȱȱȱȱȱ ȘȱȱȂȱȬDZȱǯȓǯȱ Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 79 ȱȬȱǯȱȱȱȱȱȱ ǰȱȱȱ ȱȬȱȱȱ ¢ȱ ȱȱ¡ȱȱȱȱ¢- were chosen according to colony morphology ȱȱȱȱęȱȱȱȱ ȱǯȱȱȬȱȱ- 24 Swedish pet-shops previously studied and ȱ ȱȬȱȱ£ȱȱȬŘŖǚȱ ȱȱ£ȱȱȬȱȱȱ ȱ¢ǯȱȱȬȱȱ ȱȱ ȱȱŘŞȱȱęȱ ȱȱȱȱȱ £ȱȱśŖŖȱΐȱȱěȱǻ ȱŞǼǰȱȱ ȱȱǰȱȱȱȱȱ ȱ¢ȱǻǰȱ ǰȱ ¢Ǽȱȱ and/ or molecular genetic techniques. 200 μL 0.1 mm Zirconia/ Silica beads (Bio Spec ȱ ǯǰȱǰȱ ǰȱǼǰȱ ȱ Materials and methods by DNA extraction with the Biorobot EZ1 robot ȱȱȱȱȱ¢ȱ ǻǰȱ ǰȱ ¢Ǽǯȱǰȱȱ ȱȱȱ¢ȱȱȱȱ ŗŜȱȱȱ ȱęȱȱȱ 24 Swedish pet-shops, one pooled sample con- DNA with selected primers and sequenced as ȱȱȱȱȱŗŖȱ ȱ previously described (Johansson et al., 2006). ęȱǻǯǯȱȱęȱȱŗŖȱěȱǼȱ The consensus sequence was matched using ȱȱȱȱȬȱǻ ȱǭȱ ǰȱ ȱȱ ȱǻĴDZȦȦ ǯǯǯ 2009) was investigated. Fish had primarily been ǯȦǼȱȱȱǻĴDZȦȦǯǯǯȦǼȱ ȱȱȱȱȱǰȱ- ȱȱ ȱȱȱǰȱ- ȱęȱȱȱ¢ȱǯȱȱ spectively. 24 pooled samples had been homogenized ȱȂȱȱȱȱ- ȱȱȬȱȱȱȱȱ ȱ ȱŗŖƖȱȱȱ ȱ- ȱȱ£ȱǻȬŘŖǚǼȱŘŞȱ ȱ tibiotics and the received sediments had been ȱęȱȱȱȱǰȱ- ȱȱȬŝŖǚȱȱȱȱȱ¢ǯȱȱȱ ȱȱȱȱ¢ǰȱǰȱȱ ȱȱȱȱȱȬȱǰȱ ȱǰȱȱȱ ȱȱȱęȱ ȱ the sediments were treated with N-acetyl-L- £ȱȱŗŞŖȱΐȱȱěȱǻǰȱ ¢Ȭȱ¢¡ȱȱȱ Hilden, Germany), using a BeadBeater (MP (Clinical and Laboratory Standards Institute, Biomedicals Fastprep24) and 100 μL 0.1 mm ŘŖŖŞǼǯȱȱȱȱŘŚȱȱ ȱȱ Zirconia/ Silica beads (Bio Spec Products Inc., ȱȱȱȱ ȱDZȱã Ȭ Bartlesville, OK, USA). DNA was extracted Jensen supplemented with glycerol (7.5 mL/ L), ȱ£ȱęȱǰȱȱ ȱ ã Ȭ ȱȱ ȱȱ ȱȱȱȱȱȂȱ- (1.5 g/ L) and galactose (40 g/ L), Middlebrook ǯȱ ȱęȱȱȱȱȱ ŝ ŗŖȱ ȱȱȱǰȱ¡ȱȱ was detected in homogenized tissue samples catalase enrichment and Stonebrink (Clinical (n=10), tissue samples were also cultivated on and Laboratory Standards Institute, 2008). The the media described above (Clinical and Labora- cultivation tubes were incubated at 20°C, 30°C tory Standards Institute, 2008) and on an addi- ȱřŝǚȱǻȱȱŘŚ¡Ś¡řȱǼȱȱ ȱȱ tional 7H10 Middlebrook media with oleic acid, ȱ¡ȱ ¢ȱȱȱȱȱ albumin, dextrose and catalase enrichment and Ȭȱǯȱ ȱȱȱȱŘŚȱȱ 60 μM hemin supplement (Dawson and Jennis, 80, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 1980; Vadney and Hawkins, 1985; Whipps et ȱ ȱȱȱŗŖȱǻŚŘƖǼȱȱȱȬǯȱ ǯǰȱŘŖŖŝǼǰȱ ȱ¢ȱȱ¡ȱȱ ȱȱȱ¢ȱȱȱ selected bacterial colonies. in the pet-shops was M. marinum, which was ȱȱśŖƖȱȱȱȬǰȱ ȱ¢ȱM. ȱȱȱ ȱęȱȱȱ fortuitum and M. peregrinum, which both were ȱȱŗŜȱȱȱȱȱȱŗǯȱȱ ȱȱŘşƖȱȱȱȬǯȱȱȱ ȱȱ ȱȱȱȱȱȱ species were M. gordonae and M. chelonae, which ȱŗŖȱΐȱȱȱşŜȬ¢ȱȱȱȱ ȱȱȱŘŗƖȱȱŗřƖȱȱȱȬǰȱ (Sarstedt, Numbrecht, Germany) on a GeneAmp respectively. When comparing the occurrence PCR System 2700 (Applied Biosystems, Foster ȱ¢ȱȱȱȬȱȱ ¢ǰȱǼǯȱȱȱȱŗŜȱȱȱ ȱȱęȱȱȱȱǻƽŗŘǼȱ was made with BigDyeTerminator v3.1 (Applied with that in pet-shops selling only aquarium ¢ǰȱȱ¢ǰȱǼǯȱ¢ȱȱȱ ęȱǻƽŗŘǼȱǻȱŘǼǰȱȱę¢ȱě- ȱȱ ȱȱ ȱřŝřŖȱȱ- ȱ ȱǰȱȱȱȱȱ¢ȱ lection v3. Consensus sequences were obtained ȱ¢ȱȱȱȱȬȱǻȱ ¢ȱȱȱ ȱȱȱȱ not shown). using CodonCode Aligner 3.631. Editing and ȱȱȱ ȱȱ ȱ ȱ¢ȱȱȱȱȱŘŞȱ- giŇ57116681:1471846-1473382 M. tuberculosis ȱęȱ ȱȱȱȱȱ ȱȱǯȱȱȱȱ ȱȬȱȱȱȱȱȱřǯȱȱ ȱȱȱȱȱȱǻĴDZȦȦ ȱȱȱȱȱ ǯǯǯȦǼȱȱȱ ȱǯ ¢ȱȱȱȱȱŘŘȱǻŝşƖǼȱȱ ȱŘŞȱęȱȱȱȱȱ¢ȱ Results ȱȱřȱǻŗŗƖǼȱȱȱęǯȱ ȱřȱǻŗŗƖǼȱȱȱŘŞȱ ȱȱȱ¢ȱ ȱęȱȱ ęǰȱȱ¢ȱȱȱȱǯ ȱęȱȱȱŘŚȱ ȱȬȱ ȱȱȱŘŞȱęȱ ȱȱȱȱ (Table 2). One mycobacteria species was de- ȱ ȱȬȱȱ ȱȱ- ȱȱȱȱŗŚȱǻśŞƖǼȱȱȱŘŚȱȬȱȱ ȱȱ¢ȱȱȱȱȱǻȱřDZȱ Table 1.ȱȱȱȱȱȱȱȱȱŗŜȱȱȱȱMycobacteria spp. Designation Positiona Sequence Application (direction) Forward 4 - 25 GCGGCGTGCTTAACACATGCAA PCR/Sequencing Reverse 1476 - 1452 TTCCGGTACGGCTACCTTGTTACGA PCR/Sequencing Forward 503 - 526 TGTCCGGAATTACTGGGCGTAAAG Sequencing Forward 1131 - 1153 AAGGTGGGGATGACGTCAAGTCA Sequencing Reverse 523 - 500 TACGCCCAGTAATTCCGGACAACG Sequencing Reverse 990 - 968 AGGCCACAAGGGAACGCCTATCT Sequencing aPrimer design and positions according to the Mycobacterium ulcerans 16S rRNA gene sequence Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 81 Table 2.ȱ ęȱ¢ȱȱȱȱ aŗȬŗŘȱƽȱȬȱȱȱȱęȱȱ ȱ ȱ ȱ ęȱ ȱ ŘŚȱ ȱ Ȭ other animals; 13-24 = pet-shops selling only shops. ȱęǯ bȱȱȱȱ ȱǻĴDZȦȦ Mycobacteria Sequenced www.ncbi.nlm.nih.gov/) and RDP Pet-shopa ȱŗŖȱǻĴDZȦȦǯǯǯȦǼȱȱȱ species bases (n)b ȱȱȱǯ M. chelonae 1420 c 1 Matched using only the database RDP release 10 M. marinum 1435 ǻĴDZȦȦǯǯǯȦǼȱ M. fortuitum 1422 2 ȱ ȱǯ M. marinum 1435 3 M. chelonae 1420 M. gordonae 1434 4 ęȱȱśǰȱŜǰȱŗśȱȱŘŘǼǯȱ ǰȱȱȱȱȱ M. peregrinum 1422 ŘŚȱęǰȱŗřȱǻśŚƖǼȱ ȱ¢ȱȱ 5 M. peregrinum 1422 that were in accordance with the mycobacteria M. fortuitum 1422 6 ȱȱȱȱȱȱǻȱřǼǯ M. gordonae 1434 M. fortuitum 1343c 7 M. peregrinum 1422 Discussion 8 M. fortuitum 1422 This study demonstrated that the most common M. marinum 1435 ȱȱ¢ȱȱ ȱȬȱȱ 9 M. peregrinum 1422 2006-2007 was M. marinum, which was detected 10 M. marinum 1435 ȱśŖƖȱȱȱȱȱȱȱŘŚȱȬ ȱǰȱ ȱ¢ȱM. fortuitum 11 M. gordonae 1434 and M. peregrinumȱ ȱ ȱȱȱȱ M. gordonae 1356c 12 M. marinum 1319c ŘşƖȱȱȱȱǯȱ ȱȱŘŞȱ- ȱęȱȱȱŗŞȱȱȱȬǰȱȱ 13 M. peregrinum 1332c most common mycobacteria species was also 14 M. marinum 1435 M. marinumȱȱȱŗśȱǻśŚƖǼȱȱȱęǰȱ M. chelonae 1420 15 ȱ¢ȱM. peregrinum in 3 (11%) and M. M. marinum 1435 fortuitum ȱŘȱǻŝƖǼȱȱȱęǯȱȱęȱ 16 M. gordonae 1434 are important as all three mycobacteria species 17 M. marinum 1435 ȱ ȱȱȱȱȱęȱǻ ěȱȱǯǰȱ ŘŖŖŝDzȱĴ ȱȱǯǰȱŘŖŖŖǼȱȱȱ ȱ 18 M. marinum 1435 ȱȱȱȱȱǻ ȱǭȱǰȱ 19 M. peregrinum 1422 2000; Kamijo et al., 2012; Kothavade et al., 2013). The species M. chelonae, M. Ěorentinum and M. 20 M. fortuitum 1422 gordonae have also been reported to be patho- M. marinum 1435 21 ȱȱȱęȱȱ ȱȱȱǻȱȱ M. peregrinum 1422 M. fortuitum 1422 ǯǰȱŘŖŗŗDzȱ¢ȱȱǯǰȱŘŖŖŖDzȱ ȱȱǯǰȱ 22 M. marinum 1435 2013; Pourahmad et al., 2008; Sakai et al., 2005; 23 M. marinum 1435 ȱȱǯǰȱŘŖŖśǼǰȱȱȱȱ¢ȱ in this study. M. arupense was detected in 1 (4%) 24 M. fortuitum 1422 ȱȱŘŞȱęȱȱȱȱȱȱȱȱȱȱ 82, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 Table 3.ȱ¢ȱȱęȱȱȱŘŞȱȱęȱ ȱȱȱȱȱ ȱ Ȭȱǯ Mycobacteria Sequenced Matchb Noa Fish group Fish species species bases (n) (%) Platy 1c [23] Live bearers M. marinum 1379 99.7 (Xiphophorus maculatus) Cherry barb 2e [3] Cyprinids M. marinum 1360 100 (Puntius tiĴeya) Cherry barb 3 [8] Cyprinids M. marinum 1383 99.9 (Puntius tiĴeya) ȱę 4c [18] Cyprinids M. marinum 1332 99.9 (Carassius auratus auratus) ȱę M. gordonae 1350 100 5e [–] Cyprinids (Carassius auratus auratus) M. peregrinum 1251 100 ȱę 6e [–] Cyprinids M. fortuitum 1320 100 (Carassius auratus auratus) Tiger barb No mycobacteria 7e [4] Cyprinids - - (Puntius tetrazona) Cosby gourami M. arupense 1334 100 8d,e [7] ¢ȱę (Trichogaster trichopterus) M. peregrinum 1336 100 ȱ 9 [8] ¢ȱę M. marinum 1384 99.9 (Colisa lalia) Honey gourami 10c,e [10] ¢ȱę M. marinum 1351 99.7 (Colisa chuna) ȱęȱę 11c [22] ¢ȱę M. marinum 1390 99.4 (eĴa splendens) ȱęȱę 12c [23] ¢ȱę M. marinum 1339 99.9 (eĴa splendens) Snakeskin gourami M. fortuitum 1311 100 13e [16] ¢ȱę (Trichogaster pectoralis) M. peregrinum 1332 99.9 Thick-lipped gourami 14 [13] ¢ȱę M. marinum 1362 99.3 (Colisa labiosus) ę No mycobacteria 15e [–] Cichlids -- (Pterophyllum scalare) Labidochromis yellow 16e [11] Cichlids M. chelonae 1334 100 (Labidochromis caeruleus) Rainbow krib 17c [14] Cichlids M. marinum 1375 99.9 (Pelvicachromis pulcher) Black tetra No mycobacteria 18e [6] Tetras -- ( ymnocorymbus terneĵi) Cardinal tetra 19c,e [6] Tetras M. gordonae 1324 100 (Paracheirodon axelrodi) Colombian tetra 20c [1] Tetras M. marinum 1384 99.6 (Hyphessobrycon columbianus) Colombian tetra 21c [18] Tetras M. marinum 1393 99.2 (Hyphessobrycon columbianus) Ȃȱȱ 22 [–] Tetras M. haemophilum 1374 98.9 (Boehlkea fredcochui) Glowlight tetra 23c [1] Tetras M. chelonae 1371 99.8 (Hemigrammus erythrozonus) Glowlight tetra 24c [17] Tetras M. marinum 1362 99.9 (Hemigrammus erythrozonus) Glowlight tetra 25c [21] Tetras M. marinum 1380 99.5 (Hemigrammus erythrozonus) Swegles tetra 26 [2] Tetras M. Ěorentinum 1366 97.4 (Hyphessobrycon sweglesi) ȱ ȱę 27c [12] ȱę M. marinum 1383 99.9 (Glossolepis incisus) Peacook gudgeon 28 [23] ȱę M. haemophilum 1374 99.0 (Tateurdina ocellicauda) Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 83 aThe pet-shop number is given in square brackets [ ] and is the same as in Table 2. The square brackets ȱȱǽȮǾȱȱȱęȱȱȱȱȱȱǯ bMatched by the database RDP release 10 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯ c ȱȱ ȱ¢ȱȱȱȱȱȱǯ dPartly ȱȱ ȱ¢ȱȱȱȱȱȱǯ eCultivated. Matched by the database RDP release 11 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯȱ ȱȱęȱȱȱȱ¢ȱ
Load more

Recommended publications
  • §4-71-6.5 LIST of CONDITIONALLY APPROVED ANIMALS November
    §4-71-6.5 LIST OF CONDITIONALLY APPROVED ANIMALS November 28, 2006 SCIENTIFIC NAME COMMON NAME INVERTEBRATES PHYLUM Annelida CLASS Oligochaeta ORDER Plesiopora FAMILY Tubificidae Tubifex (all species in genus) worm, tubifex PHYLUM Arthropoda CLASS Crustacea ORDER Anostraca FAMILY Artemiidae Artemia (all species in genus) shrimp, brine ORDER Cladocera FAMILY Daphnidae Daphnia (all species in genus) flea, water ORDER Decapoda FAMILY Atelecyclidae Erimacrus isenbeckii crab, horsehair FAMILY Cancridae Cancer antennarius crab, California rock Cancer anthonyi crab, yellowstone Cancer borealis crab, Jonah Cancer magister crab, dungeness Cancer productus crab, rock (red) FAMILY Geryonidae Geryon affinis crab, golden FAMILY Lithodidae Paralithodes camtschatica crab, Alaskan king FAMILY Majidae Chionocetes bairdi crab, snow Chionocetes opilio crab, snow 1 CONDITIONAL ANIMAL LIST §4-71-6.5 SCIENTIFIC NAME COMMON NAME Chionocetes tanneri crab, snow FAMILY Nephropidae Homarus (all species in genus) lobster, true FAMILY Palaemonidae Macrobrachium lar shrimp, freshwater Macrobrachium rosenbergi prawn, giant long-legged FAMILY Palinuridae Jasus (all species in genus) crayfish, saltwater; lobster Panulirus argus lobster, Atlantic spiny Panulirus longipes femoristriga crayfish, saltwater Panulirus pencillatus lobster, spiny FAMILY Portunidae Callinectes sapidus crab, blue Scylla serrata crab, Samoan; serrate, swimming FAMILY Raninidae Ranina ranina crab, spanner; red frog, Hawaiian CLASS Insecta ORDER Coleoptera FAMILY Tenebrionidae Tenebrio molitor mealworm,
    [Show full text]
  • The AQUATIC DESIGN CENTRE
    The AQUATIC DESIGN CENTRE ltd 26 Zennor Road Trade Park, Balham, SW12 0PS Ph: 020 7580 6764 [email protected] PLEASE CALL TO CHECK AVAILABILITY ON DAY Complete Freshwater Livestock (2019) Livebearers Common Name In Stock Y/N Limia melanogaster Y Poecilia latipinna Dalmatian Molly Y Poecilia latipinna Silver Lyre Tail Molly Y Poecilia reticulata Male Guppy Asst Colours Y Poecilia reticulata Red Cap, Cobra, Elephant Ear Guppy Y Poecilia reticulata Female Guppy Y Poecilia sphenops Molly: Black, Canary, Silver, Marble. y Poecilia velifera Sailfin Molly Y Poecilia wingei Endler's Guppy Y Xiphophorus hellerii Swordtail: Pineapple,Red, Green, Black, Lyre Y Xiphophorus hellerii Kohaku Swordtail, Koi, HiFin Xiphophorus maculatus Platy: wagtail,blue,red, sunset, variatus Y Tetras Common Name Aphyocarax paraguayemsis White Tip Tetra Aphyocharax anisitsi Bloodfin Tetra Y Arnoldichthys spilopterus Red Eye Tetra Y Axelrodia riesei Ruby Tetra Bathyaethiops greeni Red Back Congo Tetra Y Boehlkea fredcochui Blue King Tetra Copella meinkeni Spotted Splashing Tetra Crenuchus spilurus Sailfin Characin y Gymnocorymbus ternetzi Black Widow Tetra Y Hasemania nana Silver Tipped Tetra y Hemigrammus erythrozonus Glowlight Tetra y Hemigrammus ocelifer Beacon Tetra y Hemigrammus pulcher Pretty Tetra y Hemigrammus rhodostomus Diamond Back Rummy Nose y Hemigrammus rhodostomus Rummy nose Tetra y Hemigrammus rubrostriatus Hemigrammus vorderwimkieri Platinum Tetra y Hyphessobrycon amandae Ember Tetra y Hyphessobrycon amapaensis Amapa Tetra Y Hyphessobrycon bentosi
    [Show full text]
  • Mycobacterium Arupense Among the Isolates of Non-Tuberculous Mycobacteria from Human, Animal and Environmental Samples
    Veterinarni Medicina, 55, 2010 (8): 369–376 Original Paper Mycobacterium arupense among the isolates of non-tuberculous mycobacteria from human, animal and environmental samples M. Slany1, J. Svobodova2, A. Ettlova3, I. Slana1, V. Mrlik1, I. Pavlik1 1Veterinary Research Institute, Brno, Czech Republic 2Regional Institute of Public Health, Brno, Czech Republic 3BioPlus, s.r.o., Brno, Czech Republic ABSTRACT: Mycobacterium arupense is a non-tuberculous, potentially pathogenic species rarely isolated from humans. The aim of the study was to ascertain the spectrum of non-tuberculous mycobacteria within 271 sequenced mycobacterial isolates not belonging to M. tuberculosis and M. avium complexes. Isolates were collected between 2004 and 2009 in the Czech Republic and were examined within the framework of ecological studies carried out in animal populations infected with mycobacteria. A total of thirty-three mycobacterial species were identified. This report describes the isolation of M. arupense from the sputum of three human patients and seven different animal and environmental samples collected in the last six years in the Czech Republic: one isolate from leftover refrigerated organic dog food, two isolates from urine and clay collected from an okapi (Okapia johnstoni) and antelope bongo (Tragelaphus eurycerus) enclosure in a zoological garden, one isolate from the soil in an eagle’s nest (Haliaeetus albicilla) band two isolates from two common vole (Microtus arvalis) livers from one cattle farm. All isolates were identified by biochemical tests, morphology and 16S rDNA sequencing. Also, retrospective screening for M. arupense occurrence within the collected isolates is presented. Keywords: 16S rDNA sequencing; non-tuberculous mycobacteria; ecology Non-tuberculous mycobacteria (NTM) are ubiq- According to the commonly used Runyon clas- uitous in the environment and are responsible for sification scheme, NTM are categorized by growth several diseases in humans and/or animals known rate and pigmentation.
    [Show full text]
  • Brief Communication
    BRIEF COMMUNICATION http://dx.doi.org/10.1590/S1678-9946201860006 Nontuberculous mycobacteria in milk from positive cows in the intradermal comparative cervical tuberculin test: implications for human tuberculosis infections Carmen Alicia Daza Bolaños1, Marília Masello Junqueira Franco1, Antonio Francisco Souza Filho2, Cássia Yumi Ikuta2, Edith Mariela Burbano-Rosero3, José Soares Ferreira Neto2, Marcos Bryan Heinemann2, Rodrigo Garcia Motta4, Carolina Lechinski de Paula1, Amanda Bonalume Cordeiro de Morais1, Simony Trevizan Guerra1, Ana Carolina Alves1, Fernando José Paganini Listoni1, Márcio Garcia Ribeiro1 ABSTRACT Although the tuberculin test represents the main in vivo diagnostic method used in the control and eradication of bovine tuberculosis, few studies have focused on the identification of mycobacteria in the milk from cows positive to the tuberculin test. The aim of this study was to identify Mycobacterium species in milk samples from cows positive to the comparative intradermal test. Milk samples from 142 cows positive to the comparative intradermal test carried out in 4,766 animals were aseptically collected, cultivated on Lowenstein-Jensen and Stonebrink media and incubated for up to 90 days. Colonies compatible with mycobacteria were stained by Ziehl-Neelsen to detect acid-fast bacilli, while to confirm the Mycobacterium genus, conventional PCR was performed. Fourteen mycobacterial strains were isolated from 12 cows (8.4%). The hsp65 gene sequencing identified M. engbaekii (n=5), M. arupense 1Universidade Estadual Paulista,
    [Show full text]
  • Zoo Keeper Information
    ZOO KEEPER INFORMATION Auckland Zoo and its role in Conservation and Captive Breeding Programmes Revised by Kirsty Chalmers Registrar 2006 CONTENTS Introduction 3 Auckland Zoo vision, mission and strategic intent 4 The role of modern zoos 5 Issues with captive breeding programmes 6 Overcoming captive breeding problems 7 Assessing degrees of risk 8 IUCN threatened species categories 10 Trade in endangered species 12 CITES 12 The World Zoo and Aquarium Conservation Strategy 13 International Species Information System (ISIS) 15 Animal Records Keeping System (ARKS) 15 Auckland Zoo’s records 17 Identification of animals 17 What should go on daily reports? 18 Zoological Information Management System (ZIMS) 19 Studbooks and SPARKS 20 Species co-ordinators and taxon advisory groups 20 ARAZPA 21 Australasian Species Management Program (ASMP) 21 Animal transfers 22 Some useful acronyms 24 Some useful references 25 Appendices 26 Zoo Keeper Information 2006 2 INTRODUCTION The intention of this manual is to give a basic overview of the general operating environment of zoos, and some of Auckland Zoo’s internal procedures and external relationships, in particular those that have an impact on species management and husbandry. The manual is designed to be of benefit to all keepers, to offer a better understanding of the importance of captive animal husbandry and species management on a national and international level. Zoo Keeper Information 2006 3 AUCKLAND ZOO VISION Auckland Zoo will be globally acknowledged as an outstanding, progressive zoological park. AUCKLAND ZOO MISSION To focus the Zoo’s resources to benefit conservation and provide exciting visitor experiences which inspire and empower people to take positive action for wildlife and the environment.
    [Show full text]
  • View of Results 1SGN the Overall Results of the Two Methods Are Summarized in M
    BMC Microbiology BioMed Central Research article Open Access Reliable identification of mycobacterial species by PCR-restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns Erica Chimara1, Lucilaine Ferrazoli1, Suely Yoko Misuka Ueky1, Maria Conceição Martins1, Alan Mitchel Durham2, Robert D Arbeit3 and Sylvia Cardoso Leão*4 Address: 1Instituto Adolfo Lutz, São Paulo, Brazil, 2Instituto de Matemática e Estatística, Universidade de São Paulo, São Paulo, Brazil, 3Tufts University School of Medicine, Division of Geographic Medicine and Infectious Diseases, Boston, Massachusetts, USA and 4Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, São Paulo, Brazil Email: Erica Chimara - [email protected]; Lucilaine Ferrazoli - [email protected]; Suely Yoko Misuka Ueky - [email protected]; Maria Conceição Martins - [email protected]; Alan Mitchel Durham - [email protected]; Robert D Arbeit - [email protected]; Sylvia Cardoso Leão* - [email protected] * Corresponding author Published: 20 March 2008 Received: 17 October 2007 Accepted: 20 March 2008 BMC Microbiology 2008, 8:48 doi:10.1186/1471-2180-8-48 This article is available from: http://www.biomedcentral.com/1471-2180/8/48 © 2008 Chimara et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Identification of nontuberculous mycobacteria (NTM) based on phenotypic tests is time-consuming, labor-intensive, expensive and often provides erroneous or inconclusive results.
    [Show full text]
  • Aquatic Design Centre
    AQUATIC DESIGN CENTRE Tropical Fish List (March 2017) Scientific Name Common Name Ancistrus cf. cirrhosus Albino Bristlenose Catfish Y Ancistrus cf. cirrhosus Red Bristlenose Cat Y Ancistrus cirrhosus Bristlenose Catfish Y Ancistrus dolichopterus Super Gold Ancistrus Y Ancistrus sp. Gold XL Y Aphyocharax rathbuni Rathbuni tetra Y Aphyosemion/Fundulopanchax gardneri Blue Lyretail/blue Gardneri Killi Y Aplocheilichthys normani Lampeye Killifish/Normans Lampeye Y Axelrodia riesei Ruby Tetra Y Badis badis Neon Blue Perch Y Badis badis Blue Perch Y Barbus conchonius Rosy Barb Y Barbus semifasciolatus Gold Barb Y Barbus tetrazonia Tiger Barb Y Barbus tetrazonia Green Tiger Barb Y Barbus tetrazonia Albino Tiger Barb Y Barbus titteya Cherry Barb Y Bedotia geayi Madagascar Rainbow Y Betta Brownorum Y Betta brownorum Y Betta splendens Veil Tail Male - Siamese fighting fish Y Betta splendens Female - Siamese fighting fish Y Betta splendens Over Halfmoon Y Betta splendens Plakat Y Betta splendens Solid Betta splendens Combtail Y Betta splendens Double Tail Betta splendens Super Delta Y Betta splendens Spade Tail Y Betta splendens Round Tail Boehlkea fredcochui Cochu's Blue tetra Y Boraras brigittae Chilli/Mosquito Rasbora Y Botia histrionica Burmese Loach Y Botia Striata Zebra Loach Y Brachydanio albolineatus Pearl Danio Y Brachydanio kyathit Fire Ring Danio Y Brachydanio rerio Zebra Danio Y Brachydanio sp. Hikari Danio Y Brevibora dorsiocellata Eyespot Rasbora Y Cardisoma armatum Rainbow Crab Y Carinotetraodon travancoricus Freshwater Puffer Y Celestichthys
    [Show full text]
  • Frequency and Clinical Implications of the Isolation of Rare Nontuberculous Mycobacteria
    Kim et al. BMC Infectious Diseases (2015) 15:9 DOI 10.1186/s12879-014-0741-7 RESEARCH ARTICLE Open Access Frequency and clinical implications of the isolation of rare nontuberculous mycobacteria Junghyun Kim1, Moon-Woo Seong2, Eui-Chong Kim2, Sung Koo Han1 and Jae-Joon Yim1* Abstract Background: To date, more than 125 species of nontuberculous mycobacteria (NTM) have been identified. In this study, we investigated the frequency and clinical implication of the rarely isolated NTM from respiratory specimens. Methods: Patients with NTM isolated from their respiratory specimens between July 1, 2010 and June 31, 2012 were screened for inclusion. Rare NTM were defined as those NTM not falling within the group of eight NTM species commonly identified at our institution: Mycobacterium avium, M. intracellulare, M. abscessus, M. massiliense, M. fortuitum, M. kansasii, M. gordonae, and M. peregrinum. Clinical, radiographic and microbiological data from patients with rare NTM were reviewed and analyzed. Results: During the study period, 73 rare NTM were isolated from the respiratory specimens of 68 patients. Among these, M. conceptionense was the most common (nine patients, 12.3%). The median age of the 68 patients with rare NTM was 68 years, while 39 of the patients were male. Rare NTM were isolated only once in majority of patient (64 patients, 94.1%). Among the four patients from whom rare NTM were isolated two or more times, only two showed radiographic aggravation caused by rare NTM during the follow-up period. Conclusions: Most of the rarely identified NTM species were isolated from respiratory specimens only once per patient, without concomitant clinical aggravation.
    [Show full text]
  • Non-Tuberculous Mycobacteria: Epidemiological Pattern in a Reference Laboratory and Risk Factors Associated with Pulmonary Disease
    Epidemiol. Infect. (2017), 145, 515–522. © Cambridge University Press 2016 doi:10.1017/S0950268816002521 Non-tuberculous mycobacteria: epidemiological pattern in a reference laboratory and risk factors associated with pulmonary disease J. MENCARINI1,C.CRESCI2, M. T. SIMONETTI3,C.TRUPPA1, G. CAMICIOTTOLI2,4,M.L.FRILLI4,P.G.ROGASI5,S.VELOCI1, 2,4 3,6,7 1,5 M. PISTOLESI ,G.M.ROSSOLINI ,A.BARTOLONI AND F. BARTALESI5* 1 Infectious Diseases Unit, Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy 2 Pneumology Unit, Careggi Hospital, Florence, Italy 3 Tuscany Regional Reference Centre for Mycobacteria, Microbiology and Virology Unit, Careggi Hospital, Florence, Italy 4 Section of Respiratory Medicine, Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy 5 Unit of Infectious and Tropical Diseases, Careggi Hospital, Florence, Italy 6 Section of Microbiology, Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy 7 Department of Medical Biotechnologies, University of Siena, Siena, Italy Received 8 April 2016; Final revision 7 October 2016; Accepted 9 October 2016; first published online 2 November 2016 SUMMARY The diseases caused by non-tuberculous mycobacteria (NTM), in both AIDS and non-AIDS populations, are increasingly recognized worldwide. Although the American Thoracic Society published the guidelines for diagnosis of NTM pulmonary disease (NTM-PD), the diagnosis is still difficult. In the first part of the study, we collected data on NTM isolates in the Mycobacteriology Laboratory of Careggi Hospital (Florence, Italy) and analysed the epidemiological data of NTM isolates. Then, to analyse the risk factors associated to NTM-PD, we studied the presence of ATS/IDSA criteria for NTM-PD in patients who had at least one positive respiratory sample for NTM and were admitted to the Infectious Disease Unit and the Section of Respiratory Medicine.
    [Show full text]
  • Hemigrammus Erythrozonus) Ecological Risk Screening Summary
    Glowlight Tetra (Hemigrammus erythrozonus) Ecological Risk Screening Summary U.S. Fish and Wildlife Service, January 2016 Revised, March 2018 Web Version, 7/30/2018 Photo: G. Valenzuela. Licensed under Creative Commons (CC-BY-2.0). Available: https://commons.wikimedia.org/wiki/File:Tetra_Glowlight_cropped.jpg. (March 2018). 1 Native Range and Status in the United States Native Range From Froese and Pauly (2018): “South America: Essequibo River.” 1 From Eschmeyer et al. (2018): “Essequibo River, Guyana.” Status in the United States This species has not been reported as introduced or established in the United States. Rixon et al. (2005) note H. erythrozonus is available for trade within the United States and Canada as part of the ornamental fish industry. Means of Introductions in the United States This species has not been reported as introduced or established in the United States. 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From ITIS (2018): “Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Actinopterygii Class Teleostei Superorder Ostariophysi Order Characiformes Family Characidae Genus Hemigrammus Species Hemigrammus erythrozonus Durbin, 1909” “Current Standing: valid” Size, Weight, and Age Range Eigenmann (1917) lists the size range of specimens as 21-33mm. From Froese and Pauly (2018): “Maximum length questionable [Lima et al 2003]. Maximum length reported to reach 4 cm TL [Mills and Vevers 1989].” Environment From Froese and Pauly (2018): “Freshwater; benthopelagic; pH range: 6.0 - 8.0; dH range: 5 - 12.” 2 Climate/Range From Froese and Pauly (2018): “Tropical; 24°C - 28°C [Riehl and Baensch; assumed to represent recommended aquarium water temperature]” Distribution Outside the United States Native From Froese and Pauly (2018): “South America: Essequibo River.” From Eschmeyer et al.
    [Show full text]
  • Aquatics Livestock List
    irhHollybush Nurseries Ltd Warstone Road Shareshill Wolverhampton WV10 7LX Tel: 01922 418050 Fax: 01922 701028 Email: [email protected] Website: www.hollybush-garden.com Follow us on our Facebook Page: Hollybush Pets & Aquatics AQUATICS LIVESTOCK LIST Species Scientific Name / Size Price POND FISH Goldfish 3-4” £2.99 each or 2 for £5.50 Goldfish 4-5” £5.99 each or 2 for £10.00 Shubunkin 3-4” £3.99 each or 2 for £7.00 Shubunkin 4-5” £6.99 each or 2 for £13.00 Shubunkin 5-6” £12.99 each or 2 for £22.00 Green / Golden Tench 5-6” £5.99 each English Koi (Mixed) 8-10” £69.99 each Japanese Koi 3-5” (Hirasawa Mix) £15.00 each Japanese Koi 3-5” (Longfin) £40.00 each Japanese Koi 12-15” (Yamazaki Mix) £300.00 each Japanese Koi 12-15” (Kase Mix) £300.00 each Japanese Koi 15-24” (Show Pool Mix) From £595.00 Long Nose Sturgeon 8-10” £39.99 each White Tip Sturgeon 5-6” £24.99 each Diamond Sturgeon 8-10” £49.99 each Golden Sterlets 10-12” £89.99 each True Albino Sterlets 20-25” £249.00 each COLDWATER & TEMPERATE FISH Assorted Fantails Carassius auratus From £3.99 each Pearlscales Carassius auratus £8.99 each Black Moors Carassius auratus £4.95 each Ryukin Carassius auratus From £8.99 each Weather Loach Misgurnus angullicaudatus £5.95 each White Cloud Mountain Minnows Tanichithys albonubes £2.50 each or 4 for £9.00 Assorted Danio Danio sp. £1.95 each or 4 for £7.00 LIVEBEARERS Assorted Male Guppy Poecilia reticulata £2.50 each or 4 for £9.00 Assorted Female Guppy Poecilia reticulata £2.50 each or 4 for £9.00 Assorted Endler Guppy Poecilia wingei £2.50 each or 4 for £9.00 “Black Fire” Endler Guppy Poecilia wingei £5.95 each or 4 for £20.00 “Yellow Tiger” Endler Guppy Poecilia wingei £5.95 each or 4 for £20.00 “Santa Maria” Endler Guppy Poecilia wingei £5.95 each or 4 for £20.00 “Japan Blue Double-Sword” Endlers Poecilia wingei £4.99 each or 4 for £18.00 Assorted Swordtail Xiphophorus hellerii £2.95 each or 2 for £5.50 “Kohaku” Swordtail Xiphophorus helleri £12.95 each or 2 for £22.00 Assorted Platy Xiphophorus sp.
    [Show full text]
  • Tetras and Danios Animal Welfare Regulations Licence Number: LN/000015406
    Tetras and Danios Animal Welfare Regulations Licence Number: LN/000015406 Please Note: Livestock lists are correct at time of publishing and availability is subject to change Updated: 17-09-2021 Common Name Scientific Name Size Price Stock Status Tetras & Characins Congo Tetra Phenacogrammus interruptus £2.95 each Available Black Line Tetra Moenkhausia costae £3.95 each Available Black Widow Tetra Gymnocorymbus ternetzi 2-3cm £2.75 each Available Bleeding Heart Tetra Hyphessobrycon erythrostigma £9.95 each Available Buenos Aires Tetra Hyphessobrycon anisitsi £2.75 each Available Cardinal Tetra Paracheirodon axelrodi £2.95 each Available Columbian Redfin Hyphessobrycon columbianus £2.75 each Available Ember Tetra Hyphessobrycon amandae £2.75 each Available 1 / 5 Common Name Scientific Name Size Price Stock Status Tetras & Characins Glowlight Tetra Hemigrammus erythrozonus 2-3cm £2.75 each Available Golden Pencil Tetra Nannostomus beckfordi £2.95 Available Kitty Tetra Hyphessobrycon heliacus 2-3cm £2.75 each Available Neon Tetra paracheirodon innesi £2.75 each Available Penguin Tetra thayeria boehlkei £2.75 each Available Red Eye Tetra Moenkhausia sanctaefilomenae 1-2cm £2.75 each Available Red Flame Tetra Hyphessobrycon flammeus £2.95 each Available Rosy Tetra Hyphessobrycon rosaceus £2.95 each Available Rummy Nose Tetra Hemigrammus rhodostomus £2.75 each Available 2 / 5 Common Name Scientific Name Size Price Stock Status Tetras & Characins Silvertip Tetra Hasemania nana 2-3cm £2.75 each Available X-ray Tetra Pristella maxillaris £2.75 each Available Danios Pearl Danio danio albolineatus £2.95 Available Celestial Pearl Danio Danio margaritatus £5.95 each Available Giant Danio Devario aequipinnatus £3.25 each Available Glowlight Danio Danio choprai £2.75 each Available Golden Danio Danio rerio £2.95 each Available Longfin Leopard Danio Danio rerio £2.75 each Available Orange Finned Danio Danio kaythit £2.95 each Available 3 / 5 Common Name Scientific Name Size Price Stock Status Tetras & Characins Zebra Danio Danio rerio £3.25 each Available Misc Brycon sp.
    [Show full text]