78, Bull. Eur. Ass. Fish Pathol., 34(3) 2014
ȱȱěȱȱȱ¢ȱ ȱȱęȱȱ ȱȬ
T. Hongslo* and E. Jansson
National Veterinary Institute, Department of Animal Health and Antimicrobial Strategies, Uppsala, Sweden
Abstract ȱȱȱ¢ȱȱ ȱȱęȱȱŘŚȱ ȱȬǰȱȱȱŘŖŖŜȱȱ ŘŖŖŝǰȱȱȱȱȱȱȱȱȱęȱ ȱȱ ȱȬȱǯȱ ¢ȱȱȱŘŞȱǻŘřƖǼȱȱȱŗŘŖȱȱęȱ ȱȱȱȱ ȱȱ ȱȱȱȱȱȱ ȱȬȱǯȱȱȱȱȱȱ¢ȱ ȱ ȱ¡ȱȱȱȱ¢ȱȱȱȱęȱȱȱȱŘŚȱ ȱȬ ȱ¢ȱȱȱȱȱ£ȱȱȬȱȱȱȱȱŘŞȱȱ ęȱ ȱȱȱȱȱȱȱǯȱȱȱȱȱȱȱȱŗŖȱęȱȱ ȱȱȱŘŚȱȬȱȱȱȱȱȱȱȱŘŞȱȱęȱ ȱǰȱ ȱȱȱȱȱŗŜȱȱȱȱȱȱȱ ȱŗŜȱȱȱ ǯȱȱȱȱ¢ȱȱȱȱȱȱȱȱȱȬȱ was Mycobacterium marinumǰȱ ȱ ȱȱȱśŖƖȱȱȱǰȱ ȱ¢ȱM. fortuitum and M. peregrinumǰȱ ȱȱ ȱȱȱŘşƖȱȱȱǯȱȱȱȱȱ ęȱȱȱȱȱȱ¢ȱȱ ȱȱȱŘśȱǻŞşƖǼȱȱȱȱŘŞȱęȱ and that the most common mycobacteria species also detected here was M. marinum that occurred ȱŗśȱǻśŚƖǼȱȱȱęǯȱȱ¢ȱȱęȱȱȱȱęȱ ȱM. arupense, M. chelonae, M. Ěorentinum, M. fortuitum, M. gordonae and M. haemophilum. In summary, 8 species ȱ¢ȱ ȱęȱȱ ȱȱęȱȱ ȱȬǰȱȱȱ ȱȱȱȱȱȱȱȱęǰȱȱȱȱȱ£ǯ
Introduction ȱęȱȱȱȱȱȱȱȱ ¢ȱȱ ȱȱȱȱ¡ȱȱ ¢ȱȱ ǯȱ ǰȱȱęȱȱ ȱȱ¢ȱȱȬȱ- ȱȱ ȱǰȱȱ¢ȱ ȱȱȱęȱȱȬȱǻ £ǰȱ bacteria belonging to the genus Mycobacterium 2008; Pate et al., 2005; Wickins et al., 2011). A have been reported to cause serious disease ȱȱ¢ȱȱ ȱȱ ǻĴ ȱȱǯǰȱŘŖŖŖDzȱȱȱǯǰȱŘŖŖśǼǯȱ ęȱȱŘŚȱ ȱȬǰȱȱȱ Several studies have been published regarding ŘŖŖŜȱȱŘŖŖŝǰȱȱȱȱȱȱȱ ȱȱ¢ȱȱȬȱȱ ȱȱȱȱ ȱȱ ȱ ȱȱęȱȱȱęȱǰȱ Ȭȱȱǻ ȱǭȱ ǰȱŘŖŖşǼǯȱ¢ȱ wholesalers and private aquarists (Beran et al., thorough microscopic investigation 28 (23%) 2006; Lescenko et al., 2003; Novotny et al., 2010; ȱŗŘŖȱȱęȱ ȱȱȱȱ ȱ Prearo et al., 2004; Zanoni et al., 2008). However, ȱȱȱȱȱȱȱ
ȘȱȱȂȱȬDZȱǯȓǯȱ Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 79
ȱȬȱǯȱȱȱȱȱȱ ǰȱȱȱ ȱȬȱȱȱ ¢ȱ ȱȱ¡ȱȱȱȱ¢- were chosen according to colony morphology ȱȱȱȱęȱȱȱȱ ȱǯȱȱȬȱȱ- 24 Swedish pet-shops previously studied and ȱ ȱȬȱȱ£ȱȱȬŘŖǚȱ ȱȱ£ȱȱȬȱȱȱ ȱ¢ǯȱȱȬȱȱ ȱȱ ȱȱŘŞȱȱęȱ ȱȱȱȱȱ £ȱȱśŖŖȱΐȱȱěȱǻ ȱŞǼǰȱȱ ȱȱǰȱȱȱȱȱ ȱ¢ȱǻǰȱ ǰȱ ¢Ǽȱȱ and/ or molecular genetic techniques. 200 μL 0.1 mm Zirconia/ Silica beads (Bio Spec ȱ ǯǰȱǰȱ ǰȱǼǰȱ ȱ Materials and methods by DNA extraction with the Biorobot EZ1 robot ȱȱȱȱȱ¢ȱ ǻǰȱ ǰȱ ¢Ǽǯȱǰȱȱ ȱȱȱ¢ȱȱȱȱ ŗŜȱȱȱ ȱęȱȱȱ 24 Swedish pet-shops, one pooled sample con- DNA with selected primers and sequenced as ȱȱȱȱȱŗŖȱ ȱ previously described (Johansson et al., 2006). ęȱǻǯǯȱȱęȱȱŗŖȱěȱǼȱ The consensus sequence was matched using ȱȱȱȱȬȱǻ ȱǭȱ ǰȱ ȱȱ ȱǻĴDZȦȦ ǯǯǯ 2009) was investigated. Fish had primarily been ǯȦǼȱȱȱǻĴDZȦȦǯǯǯȦǼȱ ȱȱȱȱȱǰȱ- ȱȱ ȱȱȱǰȱ- ȱęȱȱȱ¢ȱǯȱȱ spectively. 24 pooled samples had been homogenized ȱȂȱȱȱȱ- ȱȱȬȱȱȱȱȱ ȱ ȱŗŖƖȱȱȱ ȱ- ȱȱ£ȱǻȬŘŖǚǼȱŘŞȱ ȱ tibiotics and the received sediments had been ȱęȱȱȱȱǰȱ- ȱȱȬŝŖǚȱȱȱȱȱ¢ǯȱȱȱ ȱȱȱȱ¢ǰȱǰȱȱ ȱȱȱȱȱȬȱǰȱ ȱǰȱȱȱ ȱȱȱęȱ ȱ the sediments were treated with N-acetyl-L- £ȱȱŗŞŖȱΐȱȱěȱǻǰȱ ¢Ȭȱ¢¡ȱȱȱ Hilden, Germany), using a BeadBeater (MP (Clinical and Laboratory Standards Institute, Biomedicals Fastprep24) and 100 μL 0.1 mm ŘŖŖŞǼǯȱȱȱȱŘŚȱȱ ȱȱ Zirconia/ Silica beads (Bio Spec Products Inc., ȱȱȱȱ ȱDZȱã Ȭ Bartlesville, OK, USA). DNA was extracted Jensen supplemented with glycerol (7.5 mL/ L), ȱ£ȱęȱǰȱȱ ȱ ã Ȭ ȱȱ ȱȱ ȱȱȱȱȱȂȱ- (1.5 g/ L) and galactose (40 g/ L), Middlebrook ǯȱ ȱęȱȱȱȱȱ ŝ ŗŖȱ ȱȱȱǰȱ¡ȱȱ was detected in homogenized tissue samples catalase enrichment and Stonebrink (Clinical (n=10), tissue samples were also cultivated on and Laboratory Standards Institute, 2008). The the media described above (Clinical and Labora- cultivation tubes were incubated at 20°C, 30°C tory Standards Institute, 2008) and on an addi- ȱřŝǚȱǻȱȱŘŚ¡Ś¡řȱǼȱȱ ȱȱ tional 7H10 Middlebrook media with oleic acid, ȱ¡ȱ ¢ȱȱȱȱȱ albumin, dextrose and catalase enrichment and Ȭȱǯȱ ȱȱȱȱŘŚȱȱ 60 μM hemin supplement (Dawson and Jennis, 80, Bull. Eur. Ass. Fish Pathol., 34(3) 2014
1980; Vadney and Hawkins, 1985; Whipps et ȱ ȱȱȱŗŖȱǻŚŘƖǼȱȱȱȬǯȱ ǯǰȱŘŖŖŝǼǰȱ ȱ¢ȱȱ¡ȱȱ ȱȱȱ¢ȱȱȱ selected bacterial colonies. in the pet-shops was M. marinum, which was ȱȱśŖƖȱȱȱȬǰȱ ȱ¢ȱM. ȱȱȱ ȱęȱȱȱ fortuitum and M. peregrinum, which both were ȱȱŗŜȱȱȱȱȱȱŗǯȱȱ ȱȱŘşƖȱȱȱȬǯȱȱȱ ȱȱ ȱȱȱȱȱȱ species were M. gordonae and M. chelonae, which ȱŗŖȱΐȱȱȱşŜȬ¢ȱȱȱȱ ȱȱȱŘŗƖȱȱŗřƖȱȱȱȬǰȱ (Sarstedt, Numbrecht, Germany) on a GeneAmp respectively. When comparing the occurrence PCR System 2700 (Applied Biosystems, Foster ȱ¢ȱȱȱȬȱȱ ¢ǰȱǼǯȱȱȱȱŗŜȱȱȱ ȱȱęȱȱȱȱǻƽŗŘǼȱ was made with BigDyeTerminator v3.1 (Applied with that in pet-shops selling only aquarium ¢ǰȱȱ¢ǰȱǼǯȱ¢ȱȱȱ ęȱǻƽŗŘǼȱǻȱŘǼǰȱȱę¢ȱě- ȱȱ ȱȱ ȱřŝřŖȱȱ- ȱ ȱǰȱȱȱȱȱ¢ȱ lection v3. Consensus sequences were obtained ȱ¢ȱȱȱȱȬȱǻȱ ¢ȱȱȱ ȱȱȱȱ not shown). using CodonCode Aligner 3.631. Editing and ȱȱȱ ȱȱ ȱ ȱ¢ȱȱȱȱȱŘŞȱ- giŇ57116681:1471846-1473382 M. tuberculosis ȱęȱ ȱȱȱȱȱ ȱȱǯȱȱȱȱ ȱȬȱȱȱȱȱȱřǯȱȱ ȱȱȱȱȱȱǻĴDZȦȦ ȱȱȱȱȱ ǯǯǯȦǼȱȱȱ ȱǯ ¢ȱȱȱȱȱŘŘȱǻŝşƖǼȱȱ ȱŘŞȱęȱȱȱȱȱ¢ȱ Results ȱȱřȱǻŗŗƖǼȱȱȱęǯȱ ȱřȱǻŗŗƖǼȱȱȱŘŞȱ ȱȱȱ¢ȱ ȱęȱȱ ęǰȱȱ¢ȱȱȱȱǯ ȱęȱȱȱŘŚȱ ȱȬȱ ȱȱȱŘŞȱęȱ ȱȱȱȱ (Table 2). One mycobacteria species was de- ȱ ȱȬȱȱ ȱȱ- ȱȱȱȱŗŚȱǻśŞƖǼȱȱȱŘŚȱȬȱȱ ȱȱ¢ȱȱȱȱȱǻȱřDZȱ
Table 1.ȱȱȱȱȱȱȱȱȱŗŜȱȱȱȱMycobacteria spp.
Designation Positiona Sequence Application (direction) Forward 4 - 25 GCGGCGTGCTTAACACATGCAA PCR/Sequencing Reverse 1476 - 1452 TTCCGGTACGGCTACCTTGTTACGA PCR/Sequencing Forward 503 - 526 TGTCCGGAATTACTGGGCGTAAAG Sequencing Forward 1131 - 1153 AAGGTGGGGATGACGTCAAGTCA Sequencing Reverse 523 - 500 TACGCCCAGTAATTCCGGACAACG Sequencing Reverse 990 - 968 AGGCCACAAGGGAACGCCTATCT Sequencing aPrimer design and positions according to the Mycobacterium ulcerans 16S rRNA gene sequence Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 81
Table 2.ȱ ęȱ¢ȱȱȱȱ aŗȬŗŘȱƽȱȬȱȱȱȱęȱȱ ȱ ȱ ȱ ęȱ ȱ ŘŚȱ ȱ Ȭ other animals; 13-24 = pet-shops selling only shops. ȱęǯ bȱȱȱȱ ȱǻĴDZȦȦ Mycobacteria Sequenced www.ncbi.nlm.nih.gov/) and RDP Pet-shopa ȱŗŖȱǻĴDZȦȦǯǯǯȦǼȱȱȱ species bases (n)b ȱȱȱǯ M. chelonae 1420 c 1 Matched using only the database RDP release 10 M. marinum 1435 ǻĴDZȦȦǯǯǯȦǼȱ M. fortuitum 1422 2 ȱ ȱǯ M. marinum 1435 3 M. chelonae 1420 M. gordonae 1434 4 ęȱȱśǰȱŜǰȱŗśȱȱŘŘǼǯȱ ǰȱȱȱȱȱ M. peregrinum 1422 ŘŚȱęǰȱŗřȱǻśŚƖǼȱ ȱ¢ȱȱ 5 M. peregrinum 1422 that were in accordance with the mycobacteria M. fortuitum 1422 6 ȱȱȱȱȱȱǻȱřǼǯ M. gordonae 1434 M. fortuitum 1343c 7 M. peregrinum 1422 Discussion 8 M. fortuitum 1422 This study demonstrated that the most common M. marinum 1435 ȱȱ¢ȱȱ ȱȬȱȱ 9 M. peregrinum 1422 2006-2007 was M. marinum, which was detected 10 M. marinum 1435 ȱśŖƖȱȱȱȱȱȱȱŘŚȱȬ ȱǰȱ ȱ¢ȱM. fortuitum 11 M. gordonae 1434 and M. peregrinumȱ ȱ ȱȱȱȱ M. gordonae 1356c 12 M. marinum 1319c ŘşƖȱȱȱȱǯȱ ȱȱŘŞȱ- ȱęȱȱȱŗŞȱȱȱȬǰȱȱ 13 M. peregrinum 1332c most common mycobacteria species was also 14 M. marinum 1435 M. marinumȱȱȱŗśȱǻśŚƖǼȱȱȱęǰȱ M. chelonae 1420 15 ȱ¢ȱM. peregrinum in 3 (11%) and M. M. marinum 1435 fortuitum ȱŘȱǻŝƖǼȱȱȱęǯȱȱęȱ 16 M. gordonae 1434 are important as all three mycobacteria species 17 M. marinum 1435 ȱ ȱȱȱȱȱęȱǻ ěȱȱǯǰȱ ŘŖŖŝDzȱĴ ȱȱǯǰȱŘŖŖŖǼȱȱȱ ȱ 18 M. marinum 1435 ȱȱȱȱȱǻ ȱǭȱǰȱ 19 M. peregrinum 1422 2000; Kamijo et al., 2012; Kothavade et al., 2013). The species M. chelonae, M. Ěorentinum and M. 20 M. fortuitum 1422 gordonae have also been reported to be patho- M. marinum 1435 21 ȱȱȱęȱȱ ȱȱȱǻȱȱ M. peregrinum 1422 M. fortuitum 1422 ǯǰȱŘŖŗŗDzȱ¢ȱȱǯǰȱŘŖŖŖDzȱ ȱȱǯǰȱ 22 M. marinum 1435 2013; Pourahmad et al., 2008; Sakai et al., 2005; 23 M. marinum 1435 ȱȱǯǰȱŘŖŖśǼǰȱȱȱȱ¢ȱ in this study. M. arupense was detected in 1 (4%) 24 M. fortuitum 1422 ȱȱŘŞȱęȱȱȱȱȱȱȱȱȱȱ 82, Bull. Eur. Ass. Fish Pathol., 34(3) 2014
Table 3.ȱ¢ȱȱęȱȱȱŘŞȱȱęȱ ȱȱȱȱȱ ȱ Ȭȱǯ
Mycobacteria Sequenced Matchb Noa Fish group Fish species species bases (n) (%) Platy 1c [23] Live bearers M. marinum 1379 99.7 (Xiphophorus maculatus) Cherry barb 2e [3] Cyprinids M. marinum 1360 100 (Puntius tiĴeya) Cherry barb 3 [8] Cyprinids M. marinum 1383 99.9 (Puntius tiĴeya) ȱę 4c [18] Cyprinids M. marinum 1332 99.9 (Carassius auratus auratus) ȱę M. gordonae 1350 100 5e [–] Cyprinids (Carassius auratus auratus) M. peregrinum 1251 100 ȱę 6e [–] Cyprinids M. fortuitum 1320 100 (Carassius auratus auratus) Tiger barb No mycobacteria 7e [4] Cyprinids - - (Puntius tetrazona) Cosby gourami M. arupense 1334 100 8d,e [7] ¢ȱę (Trichogaster trichopterus) M. peregrinum 1336 100 ȱ 9 [8] ¢ȱę M. marinum 1384 99.9 (Colisa lalia) Honey gourami 10c,e [10] ¢ȱę M. marinum 1351 99.7 (Colisa chuna) ȱęȱę 11c [22] ¢ȱę M. marinum 1390 99.4 (eĴa splendens) ȱęȱę 12c [23] ¢ȱę M. marinum 1339 99.9 (eĴa splendens) Snakeskin gourami M. fortuitum 1311 100 13e [16] ¢ȱę (Trichogaster pectoralis) M. peregrinum 1332 99.9 Thick-lipped gourami 14 [13] ¢ȱę M. marinum 1362 99.3 (Colisa labiosus) ę No mycobacteria 15e [–] Cichlids -- (Pterophyllum scalare) Labidochromis yellow 16e [11] Cichlids M. chelonae 1334 100 (Labidochromis caeruleus) Rainbow krib 17c [14] Cichlids M. marinum 1375 99.9 (Pelvicachromis pulcher) Black tetra No mycobacteria 18e [6] Tetras -- ( ymnocorymbus terneĵi) Cardinal tetra 19c,e [6] Tetras M. gordonae 1324 100 (Paracheirodon axelrodi) Colombian tetra 20c [1] Tetras M. marinum 1384 99.6 (Hyphessobrycon columbianus) Colombian tetra 21c [18] Tetras M. marinum 1393 99.2 (Hyphessobrycon columbianus) Ȃȱȱ 22 [–] Tetras M. haemophilum 1374 98.9 (Boehlkea fredcochui) Glowlight tetra 23c [1] Tetras M. chelonae 1371 99.8 (Hemigrammus erythrozonus) Glowlight tetra 24c [17] Tetras M. marinum 1362 99.9 (Hemigrammus erythrozonus) Glowlight tetra 25c [21] Tetras M. marinum 1380 99.5 (Hemigrammus erythrozonus) Swegles tetra 26 [2] Tetras M. Ěorentinum 1366 97.4 (Hyphessobrycon sweglesi) ȱ ȱę 27c [12] ȱę M. marinum 1383 99.9 (Glossolepis incisus) Peacook gudgeon 28 [23] ȱę M. haemophilum 1374 99.0 (Tateurdina ocellicauda) Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 83 aThe pet-shop number is given in square brackets [ ] and is the same as in Table 2. The square brackets ȱȱǽȮǾȱȱȱęȱȱȱȱȱȱǯ bMatched by the database RDP release 10 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯ c ȱȱ ȱ¢ȱȱȱȱȱȱǯ dPartly ȱȱ ȱ¢ȱȱȱȱȱȱǯ eCultivated. Matched by the database RDP release 11 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯȱ
ȱȱęȱȱȱȱ¢ȱ pet-shops have been published (Gomez, 2008; ȱȱȱȱȱęǯȱM. arupense Pate et al., 2005; Wickins et al., 2011). In the ǰȱ ǰȱ¢ȱȱȱȱȱ ¢ȱ¢ȱ £ȱǻŘŖŖŞǼȱȱȱȱ ȱȱȱȱǻTinca tinca) collected ŘŖŖȱȱęȱ ȱȱȱȱȱ ȱȱęȱȱǻ¢ȱȱǯǰȱŘŖŗŚǼȱȱ ȱȱ ȱȱȬȱȱȱ ǰȱ being reported as a pathogenic agent in man ȱĚȱȱ ȱ (Legout et al., 2012). Ȭȱȱ ȱęȱ¢ȱ ȱŞŗȱǻŚŗƖǼȱȱȱęǰȱ ȱȱȱȱ ȱȱěȱ ȱȱȱȱȱ observed in the current. In another study by ŘŚȱȬȱȱȱŘŞȱȱęȱȱ Wickins and colleagues (2011) regarding 108 was that M. haemophilum was detected in two ȱęȱ ȱȱȱȱȱŘŚȱȬ ǻŝƖǼȱȱȱŘŞȱęȱ¢ȱȱŗŜȱȱȱ ȱȱǰȱ¢ȱŝǯŚƖȱȱȱęȱ ȱ ȱȱȱǰȱȱȱȱ ȱȱȬȱȱȱ¢ȱ ȱȱȱȱ¢ȱȱȱȱȱ and Ziehl-Neelsen staining. However, the acid- ȱȱȬȱ ȱȱ ȱȱ ȱȱ ȱȱȱȱȱȱ ȱŗŜȱȱȱȱ ȱȱ ȱȱȱȱȱ ȱǯȱȱȱ ǯȱȱěȱȱ¢ȱȱȱȱ ¡ȱȱȱěȱȱ¢ȱȱ ȱȱȱȱȱȱȱȬȱ Ȭȱȱȱȱęȱ ȱȱ¢ȱ ȱȱȱȱ¢ȱȱȱ and these two others (Gomez 2008; Wickins et ȱȱM. haemophilum, as the samples ǯǰȱŘŖŗŗǼȱȱȱěȱȱȱȱȱ were cultivated on media without hemin sup- ȱȱęȱǯȱ ȱȱ¢ǰȱęȱ ȱ plement (Dawson and Jennis, 1980; Vadney ȱȱȱȱȱȱ ȱȱȱ and Hawkins, 1985). M. haemophilum has been investigation, whereas in the study by Gomez ȱȱȱęȱȱȱ ǻŘŖŖŞǼȱ¢ȱęȱ ȱȱȱȱȱ ȱ£ęȱǻDanio rerioǼȱȱȱȱ were chosen, which could have contributed to (Whipps et al., 2007). This mycobacteria species ȱȱ¢ȱȱȱȱȬ ȱȱȱ£ȱȱȱȱȱȱ ȱȱȱȱȱȱ¢ǯȱ ȱȱ in humans (Bruijnesteijn van Coppenraet et al., study by Wickins et al (2011) wider criteria in 2005; Straus et al., 1994). ȱȱȱȱȱęȱ ȱȱ ȱȱ¡ȱȱ ȱ¢ȱȱ Few other studies regarding the occurrence ęȱ ȱȬȱȱȱȱȱ¢ǯȱ ȱȬȱȱȱ¢ȱ- ȱ¢ȱ¢ȱȱȱȱǻŘŖŖśǼǰȱȱȱ¢ȱ ęȱȱȱȱǰȱȱȱęǰȱȱ ȱȱȱ¢ȱȱȱřśȱ 84, Bull. Eur. Ass. Fish Pathol., 34(3) 2014
¢ȱ ǰȱ £ȱ ǰȱ ȱ ǰȱ ȱęȱȱȬȱȱȱ ȱ ĵȱȱȱ¡ȱ ȱǻŘŖŖŖǼǯȱȱ in Slovenia, revealed positive microscopy results ȱȱȱ¢ȱMycobacterium ȱȬȱȱȱŗřȱǻřŝƖǼȱȱȱ spp.ȱȱȱȱ¢ȱ ęǯȱȱȱȱȱȱȱ £ȱ ǻBrachydanio rerioǼȱ ǯȱ Comparative Medicine 50, 666-672. with molecular genetic methods and mycobac- ȱȱȱȱęȱȱȱ¢ȱȱ Beran V, Matlova L, Dvorska L, Svastova P and ȱ ȱǻŘŖŖŜǼǯȱȱȱ¢ȱ ŘşȱǻŞřƖǼȱȱȱęǯȱ ȱȱ¢ǰȱȱȱ ȱ¢ȱ¢ȱȱęȱȱ ȱ¢ȱȱęȱ their aquarium environment. Journal of Fish M. fortuitum in 8 (23%) and M. marinum in 7 Diseases 29, 383-393. ǻŘŖƖǼȱȱȱřśȱęǰȱ ȱȱȱȱȱ Bruijnesteijn van Coppenraet LES, Kuijper the results in our study, showing M. marinum EJ, Lindeboom JA, Prins JM and Claas in 15 (54%) and M. fortuitumȱ¢ȱȱŘȱǻŝƖǼȱȱ ECJ (2005). Mycobacterium haemophilum and lymphadenitis in children. Emerging ȱŘŞȱęǯ Infectious Diseases 11, 62-68. Clinical and Laboratory Standards Institute ȱ¢ǰȱěȱ¢ȱȱ (CLSI) (2008). “Laboratory Detection and ȱęȱȱȱȱȱȱȱ ęȱȱ¢Dzȱȱ the 24 pet-shops investigated and in 25 (21%) Guideline”. CLSI document M48-A. CLSI, ȱȱŗŘŖȱȱęȱ ȱȱȱǯȱ Wayne, PA, USA. ȱȱȱ¢ȱȱȱ Dawson DJ and Jennis F (1980). Mycobacteria were M. marinumȱǻȱśŖƖȱȱȱȬȱȱ ȱ ȱ ȱ ȱ ȱ ȱ ȱ ǰȱ ȱ ȱ ȱęȱǼǰȱ ȱ¢ȱM. Mycobacterium haemophilum. Journal of peregrinum, M. fortuitum, M. gordonae and M. Clinical Microbiology 11, 190-192. chelonae. All these mycobacteria species are £ȱȱǻŘŖŖŞǼǯȱȱȱȱ ȱȱȱȱȱęȱȱȱȱȱ ȱȱȱ ȱȱ ¢ȱȱȱǯ ęȱ¡ȱȱȱȱȬęȱ chronic disease. Disease of Aquatic Organisms 80, 167-171. Acknowledgements ȱȱȱȱȱ¢ǰȱ- ěȱ ǰȱ£ȱȱȱ ȱȱǻŘŖŖŝǼǯȱ ¡ȱ¡ȱȱ£ęǰȱDanio tional Veterinary Institute and Uppsala Genome rerio (Hamilton), to Mycobacterium marinum ǰȱȱǰȱ ǰȱȱȱ and Mycobacterium peregrinum reveals technical assistance. The study was supported the gastrointestinal tract as the primary ¢ȱȱ ȱȱȱȱǻȱ ȱȱDZȱȱȱȱȱ ȱ¢ȱǯȱ no. 31-4634/10 and 31-4262/11) and the Albert Journal of Fish Diseases 30, 587-600. §ȱȱǻ¢ȱŘŖŖŞȬŘŖŗŖǼǯ Hongslo T and Jansson E (2009). Health survey ȱȱęȱȱ ȱȬǯȱ References Bulletin of the European Association of Fish Asija A, Prasad A and Eskridge E (2011). Pathologists 29, 163-174. Disseminated Mycobacterium gordonae ȱȱȱȱǯȱ Jernigan JA and Farr BM (2000). Incubation American Journal of Therapeutics 18, e75-e77. ȱ ȱ ȱ ȱ ¡ȱ ȱ cutaneous Mycobacterium marinumȱDZȱ Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 85
ȱȱȱ ȱȱȱǯȱ Taggart JB, Adams A and Richards RH Clinical Infectious Diseases 31, 439-443. (2008). Mycobacterium stomatepiae sp. nov., a slowly growing, non-chromogenic species Johansson A, Aspan A, Bagge E, Båverud V, ȱȱęǯȱInternational Journal of ãȱȱȱ ȱ ȬȱǻŘŖŖŜǼǯȱ Systematic and Evolutionary Microbiology 58, ȱ¢ȱȱClostridium perfringens 2821-2827. ¢ȱȱȱȱǰȱȱȱ outbreaks and sludge. BMC Microbiology 6, ȱǰȱ ȱ ǰȱȱȂȱǰȱ 47. Ĵȱǰȱȱǰȱȱȱȱ Ĵȱ C (2004). Mycobacteriosis: Emerging Kamijo F, Uhara H, Kubo H, Nakanaga K, ȱȱȱęǯȱVeterinary Hoshino Y, Ishii N and Okuyama R (2012). Research Communications 28, 315-317. ȱȱȱ¢ȱȱȱȱ by Mycobacterium peregrinum, and a review Ĵ ȱǰȱȱ ȱȱȱ ȱ ȱ ǯȱ Case Report in A (2000). Mycobacteriosis: detection and Dermatology 4, 76-79. ęȱ ȱ ȱ Mycobacterium species. Fish Veterinary Journal 5, 6-21. Kothavade RJ, Dhurat RS, Mishra SN and Kothavade UR (2013). Clinical and Sakai M, Kono T, Tassakka ACMAR, ¢ȱ ȱ ȱ ȱ ȱ Ponpornpisit A, Areechon N, Katagiri ȱ ȱ ȱ ȱ ȱ T, Yoshida T and Endo M (2005). ȱȱȱ¢ȱ¢ȱ £ȱȱȱMycobacterium sp. growing mycobacteria [review]. European ȱ ȱ ¢ȱ Poecilia reticulata, Journal of Clinical Microbiology and Infectious using 16S ribosomal RNA and its internal 32, 161-188. transcribed spacer sequences. Bulletin of the European Association of Fish Pathologists ȱǰȱĴȱǰȱȱǰȱ£ȱ 25, 64-69. N, Ajana F, Beltrand E and Senneville ȱ ǻŘŖŗŘǼǯȱ ¢ȱ ȱ ȱ ȱ Slany M, Makovcova J, Jezek P, Bodnarova M caused by Mycobacterium arupense in an ȱȱ ȱǻŘŖŗŚǼǯȱȱȱȱ immunocompetent patient: a unique case Mycobacterium marinumȱȱęȱȱ ǽĴǾǯȱInternational Journal of Infectious ȱȱȱȱ ȱȱ Diseases 16, e761-e762. central Europe. Journal of Fish Diseases 37, 527-533. Lescenko P, Matlova L, Dvorska L, Bartos M, Vavra O, Navratil S, Novotny L and Pavlik I ȱǰȱěȱǰȱ ȱǰȱ ȱ ǻŘŖŖřǼǯȱ¢ȱȱȱȱ TE, Sordillo EM, Armstrong D, Boone ęǯȱVeterinary Medicine – Czech Republic N, Schneider N, Kilburn JO, Silcox VA, 48, 71-78. LaBombardi V and Good RC (1994). Clinical and epidemiologic characteristics Novotny L, Halouka R, Matlova L, Vavra ȱMycobacterium haemophilum, an emerging O, Bartosova L, Slany M and Pavlik I pathogen in immunocompromised patients. ǻŘŖŗŖǼǯȱ¢ȱȱȱȱ Annals of Internal Medicine 120, 118-125. ȱĚȱȱ ȱ ȱęȱȱ ȱ¢ǯȱ Tortoli E, Rindi L, Goh KS, Katila ML, Journal of Fish Diseases 33, 947-955. Mariottini A, Mattei R, Mazzarelli G, Suomalainen S, Torkko P and Rastog N ȱǰȱ ²²ȱǰȱȬ²ȱȱȱȱ (2005). Mycobacterium Ěorentinum sp. nov., ȱǻŘŖŖśǼǯȱȱȱ¢ȱȱ ȱȱǯȱInternational Journal ȱęȱȱȱ¢ȱȱȱ of Systematic and Evolutionary Microbiology molecular methods. Diseases of Aquatic 55, 1101-1106. Organisms 64, 29-35. ¢ȱȱȱ ȱ ȱǻŗşŞśǼǯȱȱȱ Pourahmad F, Cervellione F, Thompson KD, 86, Bull. Eur. Ass. Fish Pathol., 34(3) 2014
ȱȱȱȱ ȱMycobacterium haemophilum. Journal of Clinical Microbiology 22, 884-885. Whipps CM, Dougan ST and Kent ML (2007). Mycobacterium haemophilumȱȱȱ £ęȱǻDanio rerioǼȱȱȱǯȱ FEMS Microbiology LeĴers 270, 21-26. Wickins SC, Dennis MM, Landos M, Šlapeta J and Whittington RJ (2011). ȱ¢ȱȱȱȱ ȱěȱȱȱęȱȱ pet shops in New South Wales, Australia. Diseases of Aquatic Organisms 94, 143-152. Zanoni RG, Florio D, Fioravanti ML, Rossi ȱȱȱȱǻŘŖŖŞǼǯȱȱȱ Mycobacterium ǯȱȱȱęȱȱ Italy. Journal of Fish Diseases 31, 433-441.