78, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 ȱȱěȱȱȱ¢ȱ ȱȱęȱȱ ȱȬ T. Hongslo* and E. Jansson National Veterinary Institute, Department of Animal Health and Antimicrobial Strategies, Uppsala, Sweden Abstract ȱȱȱ¢ȱȱ ȱȱęȱȱŘŚȱ ȱȬǰȱȱȱŘŖŖŜȱȱ ŘŖŖŝǰȱȱȱȱȱȱȱȱȱęȱ ȱȱ ȱȬȱǯȱ ¢ȱȱȱŘŞȱǻŘřƖǼȱȱȱŗŘŖȱȱęȱ ȱȱȱȱ ȱȱ ȱȱȱȱȱȱ ȱȬȱǯȱȱȱȱȱȱ¢ȱ ȱ ȱ¡ȱȱȱȱ¢ȱȱȱȱęȱȱȱȱŘŚȱ ȱȬ ȱ¢ȱȱȱȱȱ£ȱȱȬȱȱȱȱȱŘŞȱȱ ęȱ ȱȱȱȱȱȱȱǯȱȱȱȱȱȱȱȱŗŖȱęȱȱ ȱȱȱŘŚȱȬȱȱȱȱȱȱȱȱŘŞȱȱęȱ ȱǰȱ ȱȱȱȱȱŗŜȱȱȱȱȱȱȱ ȱŗŜȱȱȱ ǯȱȱȱȱ¢ȱȱȱȱȱȱȱȱȱȬȱ was Mycobacterium marinumǰȱ ȱ ȱȱȱśŖƖȱȱȱǰȱ ȱ¢ȱM. fortuitum and M. peregrinumǰȱ ȱȱ ȱȱȱŘşƖȱȱȱǯȱȱȱȱȱ ęȱȱȱȱȱȱ¢ȱȱ ȱȱȱŘśȱǻŞşƖǼȱȱȱȱŘŞȱęȱ and that the most common mycobacteria species also detected here was M. marinum that occurred ȱŗśȱǻśŚƖǼȱȱȱęǯȱȱ¢ȱȱęȱȱȱȱęȱ ȱM. arupense, M. chelonae, M. Ěorentinum, M. fortuitum, M. gordonae and M. haemophilum. In summary, 8 species ȱ¢ȱ ȱęȱȱ ȱȱęȱȱ ȱȬǰȱȱȱ ȱȱȱȱȱȱȱȱęǰȱȱȱȱȱ£ǯ Introduction ȱęȱȱȱȱȱȱȱȱ ¢ȱȱ ȱȱȱȱ¡ȱȱ ¢ȱȱ ǯȱ ǰȱȱęȱȱ ȱȱ¢ȱȱȬȱ- ȱȱ ȱǰȱȱ¢ȱ ȱȱȱęȱȱȬȱǻ £ǰȱ bacteria belonging to the genus Mycobacterium 2008; Pate et al., 2005; Wickins et al., 2011). A have been reported to cause serious disease ȱȱ¢ȱȱ ȱȱ ǻĴ ȱȱǯǰȱŘŖŖŖDzȱȱȱǯǰȱŘŖŖśǼǯȱ ęȱȱŘŚȱ ȱȬǰȱȱȱ Several studies have been published regarding ŘŖŖŜȱȱŘŖŖŝǰȱȱȱȱȱȱȱ ȱȱ¢ȱȱȬȱȱ ȱȱȱȱ ȱȱ ȱ ȱȱęȱȱȱęȱǰȱ Ȭȱȱǻ ȱǭȱ ǰȱŘŖŖşǼǯȱ¢ȱ wholesalers and private aquarists (Beran et al., thorough microscopic investigation 28 (23%) 2006; Lescenko et al., 2003; Novotny et al., 2010; ȱŗŘŖȱȱęȱ ȱȱȱȱ ȱ Prearo et al., 2004; Zanoni et al., 2008). However, ȱȱȱȱȱȱȱ ȘȱȱȂȱȬDZȱǯȓǯȱ Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 79 ȱȬȱǯȱȱȱȱȱȱ ǰȱȱȱ ȱȬȱȱȱ ¢ȱ ȱȱ¡ȱȱȱȱ¢- were chosen according to colony morphology ȱȱȱȱęȱȱȱȱ ȱǯȱȱȬȱȱ- 24 Swedish pet-shops previously studied and ȱ ȱȬȱȱ£ȱȱȬŘŖǚȱ ȱȱ£ȱȱȬȱȱȱ ȱ¢ǯȱȱȬȱȱ ȱȱ ȱȱŘŞȱȱęȱ ȱȱȱȱȱ £ȱȱśŖŖȱΐȱȱěȱǻ ȱŞǼǰȱȱ ȱȱǰȱȱȱȱȱ ȱ¢ȱǻǰȱ ǰȱ ¢Ǽȱȱ and/ or molecular genetic techniques. 200 μL 0.1 mm Zirconia/ Silica beads (Bio Spec ȱ ǯǰȱǰȱ ǰȱǼǰȱ ȱ Materials and methods by DNA extraction with the Biorobot EZ1 robot ȱȱȱȱȱ¢ȱ ǻǰȱ ǰȱ ¢Ǽǯȱǰȱȱ ȱȱȱ¢ȱȱȱȱ ŗŜȱȱȱ ȱęȱȱȱ 24 Swedish pet-shops, one pooled sample con- DNA with selected primers and sequenced as ȱȱȱȱȱŗŖȱ ȱ previously described (Johansson et al., 2006). ęȱǻǯǯȱȱęȱȱŗŖȱěȱǼȱ The consensus sequence was matched using ȱȱȱȱȬȱǻ ȱǭȱ ǰȱ ȱȱ ȱǻĴDZȦȦ ǯǯǯ 2009) was investigated. Fish had primarily been ǯȦǼȱȱȱǻĴDZȦȦǯǯǯȦǼȱ ȱȱȱȱȱǰȱ- ȱȱ ȱȱȱǰȱ- ȱęȱȱȱ¢ȱǯȱȱ spectively. 24 pooled samples had been homogenized ȱȂȱȱȱȱ- ȱȱȬȱȱȱȱȱ ȱ ȱŗŖƖȱȱȱ ȱ- ȱȱ£ȱǻȬŘŖǚǼȱŘŞȱ ȱ tibiotics and the received sediments had been ȱęȱȱȱȱǰȱ- ȱȱȬŝŖǚȱȱȱȱȱ¢ǯȱȱȱ ȱȱȱȱ¢ǰȱǰȱȱ ȱȱȱȱȱȬȱǰȱ ȱǰȱȱȱ ȱȱȱęȱ ȱ the sediments were treated with N-acetyl-L- £ȱȱŗŞŖȱΐȱȱěȱǻǰȱ ¢Ȭȱ¢¡ȱȱȱ Hilden, Germany), using a BeadBeater (MP (Clinical and Laboratory Standards Institute, Biomedicals Fastprep24) and 100 μL 0.1 mm ŘŖŖŞǼǯȱȱȱȱŘŚȱȱ ȱȱ Zirconia/ Silica beads (Bio Spec Products Inc., ȱȱȱȱ ȱDZȱã Ȭ Bartlesville, OK, USA). DNA was extracted Jensen supplemented with glycerol (7.5 mL/ L), ȱ£ȱęȱǰȱȱ ȱ ã Ȭ ȱȱ ȱȱ ȱȱȱȱȱȂȱ- (1.5 g/ L) and galactose (40 g/ L), Middlebrook ǯȱ ȱęȱȱȱȱȱ ŝ ŗŖȱ ȱȱȱǰȱ¡ȱȱ was detected in homogenized tissue samples catalase enrichment and Stonebrink (Clinical (n=10), tissue samples were also cultivated on and Laboratory Standards Institute, 2008). The the media described above (Clinical and Labora- cultivation tubes were incubated at 20°C, 30°C tory Standards Institute, 2008) and on an addi- ȱřŝǚȱǻȱȱŘŚ¡Ś¡řȱǼȱȱ ȱȱ tional 7H10 Middlebrook media with oleic acid, ȱ¡ȱ ¢ȱȱȱȱȱ albumin, dextrose and catalase enrichment and Ȭȱǯȱ ȱȱȱȱŘŚȱȱ 60 μM hemin supplement (Dawson and Jennis, 80, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 1980; Vadney and Hawkins, 1985; Whipps et ȱ ȱȱȱŗŖȱǻŚŘƖǼȱȱȱȬǯȱ ǯǰȱŘŖŖŝǼǰȱ ȱ¢ȱȱ¡ȱȱ ȱȱȱ¢ȱȱȱ selected bacterial colonies. in the pet-shops was M. marinum, which was ȱȱśŖƖȱȱȱȬǰȱ ȱ¢ȱM. ȱȱȱ ȱęȱȱȱ fortuitum and M. peregrinum, which both were ȱȱŗŜȱȱȱȱȱȱŗǯȱȱ ȱȱŘşƖȱȱȱȬǯȱȱȱ ȱȱ ȱȱȱȱȱȱ species were M. gordonae and M. chelonae, which ȱŗŖȱΐȱȱȱşŜȬ¢ȱȱȱȱ ȱȱȱŘŗƖȱȱŗřƖȱȱȱȬǰȱ (Sarstedt, Numbrecht, Germany) on a GeneAmp respectively. When comparing the occurrence PCR System 2700 (Applied Biosystems, Foster ȱ¢ȱȱȱȬȱȱ ¢ǰȱǼǯȱȱȱȱŗŜȱȱȱ ȱȱęȱȱȱȱǻƽŗŘǼȱ was made with BigDyeTerminator v3.1 (Applied with that in pet-shops selling only aquarium ¢ǰȱȱ¢ǰȱǼǯȱ¢ȱȱȱ ęȱǻƽŗŘǼȱǻȱŘǼǰȱȱę¢ȱě- ȱȱ ȱȱ ȱřŝřŖȱȱ- ȱ ȱǰȱȱȱȱȱ¢ȱ lection v3. Consensus sequences were obtained ȱ¢ȱȱȱȱȬȱǻȱ ¢ȱȱȱ ȱȱȱȱ not shown). using CodonCode Aligner 3.631. Editing and ȱȱȱ ȱȱ ȱ ȱ¢ȱȱȱȱȱŘŞȱ- giŇ57116681:1471846-1473382 M. tuberculosis ȱęȱ ȱȱȱȱȱ ȱȱǯȱȱȱȱ ȱȬȱȱȱȱȱȱřǯȱȱ ȱȱȱȱȱȱǻĴDZȦȦ ȱȱȱȱȱ ǯǯǯȦǼȱȱȱ ȱǯ ¢ȱȱȱȱȱŘŘȱǻŝşƖǼȱȱ ȱŘŞȱęȱȱȱȱȱ¢ȱ Results ȱȱřȱǻŗŗƖǼȱȱȱęǯȱ ȱřȱǻŗŗƖǼȱȱȱŘŞȱ ȱȱȱ¢ȱ ȱęȱȱ ęǰȱȱ¢ȱȱȱȱǯ ȱęȱȱȱŘŚȱ ȱȬȱ ȱȱȱŘŞȱęȱ ȱȱȱȱ (Table 2). One mycobacteria species was de- ȱ ȱȬȱȱ ȱȱ- ȱȱȱȱŗŚȱǻśŞƖǼȱȱȱŘŚȱȬȱȱ ȱȱ¢ȱȱȱȱȱǻȱřDZȱ Table 1.ȱȱȱȱȱȱȱȱȱŗŜȱȱȱȱMycobacteria spp. Designation Positiona Sequence Application (direction) Forward 4 - 25 GCGGCGTGCTTAACACATGCAA PCR/Sequencing Reverse 1476 - 1452 TTCCGGTACGGCTACCTTGTTACGA PCR/Sequencing Forward 503 - 526 TGTCCGGAATTACTGGGCGTAAAG Sequencing Forward 1131 - 1153 AAGGTGGGGATGACGTCAAGTCA Sequencing Reverse 523 - 500 TACGCCCAGTAATTCCGGACAACG Sequencing Reverse 990 - 968 AGGCCACAAGGGAACGCCTATCT Sequencing aPrimer design and positions according to the Mycobacterium ulcerans 16S rRNA gene sequence Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 81 Table 2.ȱ ęȱ¢ȱȱȱȱ aŗȬŗŘȱƽȱȬȱȱȱȱęȱȱ ȱ ȱ ȱ ęȱ ȱ ŘŚȱ ȱ Ȭ other animals; 13-24 = pet-shops selling only shops. ȱęǯ bȱȱȱȱ ȱǻĴDZȦȦ Mycobacteria Sequenced www.ncbi.nlm.nih.gov/) and RDP Pet-shopa ȱŗŖȱǻĴDZȦȦǯǯǯȦǼȱȱȱ species bases (n)b ȱȱȱǯ M. chelonae 1420 c 1 Matched using only the database RDP release 10 M. marinum 1435 ǻĴDZȦȦǯǯǯȦǼȱ M. fortuitum 1422 2 ȱ ȱǯ M. marinum 1435 3 M. chelonae 1420 M. gordonae 1434 4 ęȱȱśǰȱŜǰȱŗśȱȱŘŘǼǯȱ ǰȱȱȱȱȱ M. peregrinum 1422 ŘŚȱęǰȱŗřȱǻśŚƖǼȱ ȱ¢ȱȱ 5 M. peregrinum 1422 that were in accordance with the mycobacteria M. fortuitum 1422 6 ȱȱȱȱȱȱǻȱřǼǯ M. gordonae 1434 M. fortuitum 1343c 7 M. peregrinum 1422 Discussion 8 M. fortuitum 1422 This study demonstrated that the most common M. marinum 1435 ȱȱ¢ȱȱ ȱȬȱȱ 9 M. peregrinum 1422 2006-2007 was M. marinum, which was detected 10 M. marinum 1435 ȱśŖƖȱȱȱȱȱȱȱŘŚȱȬ ȱǰȱ ȱ¢ȱM. fortuitum 11 M. gordonae 1434 and M. peregrinumȱ ȱ ȱȱȱȱ M. gordonae 1356c 12 M. marinum 1319c ŘşƖȱȱȱȱǯȱ ȱȱŘŞȱ- ȱęȱȱȱŗŞȱȱȱȬǰȱȱ 13 M. peregrinum 1332c most common mycobacteria species was also 14 M. marinum 1435 M. marinumȱȱȱŗśȱǻśŚƖǼȱȱȱęǰȱ M. chelonae 1420 15 ȱ¢ȱM. peregrinum in 3 (11%) and M. M. marinum 1435 fortuitum ȱŘȱǻŝƖǼȱȱȱęǯȱȱęȱ 16 M. gordonae 1434 are important as all three mycobacteria species 17 M. marinum 1435 ȱ ȱȱȱȱȱęȱǻ ěȱȱǯǰȱ ŘŖŖŝDzȱĴ ȱȱǯǰȱŘŖŖŖǼȱȱȱ ȱ 18 M. marinum 1435 ȱȱȱȱȱǻ ȱǭȱǰȱ 19 M. peregrinum 1422 2000; Kamijo et al., 2012; Kothavade et al., 2013). The species M. chelonae, M. Ěorentinum and M. 20 M. fortuitum 1422 gordonae have also been reported to be patho- M. marinum 1435 21 ȱȱȱęȱȱ ȱȱȱǻȱȱ M. peregrinum 1422 M. fortuitum 1422 ǯǰȱŘŖŗŗDzȱ¢ȱȱǯǰȱŘŖŖŖDzȱ ȱȱǯǰȱ 22 M. marinum 1435 2013; Pourahmad et al., 2008; Sakai et al., 2005; 23 M. marinum 1435 ȱȱǯǰȱŘŖŖśǼǰȱȱȱȱ¢ȱ in this study. M. arupense was detected in 1 (4%) 24 M. fortuitum 1422 ȱȱŘŞȱęȱȱȱȱȱȱȱȱȱȱ 82, Bull. Eur. Ass. Fish Pathol., 34(3) 2014 Table 3.ȱ¢ȱȱęȱȱȱŘŞȱȱęȱ ȱȱȱȱȱ ȱ Ȭȱǯ Mycobacteria Sequenced Matchb Noa Fish group Fish species species bases (n) (%) Platy 1c [23] Live bearers M. marinum 1379 99.7 (Xiphophorus maculatus) Cherry barb 2e [3] Cyprinids M. marinum 1360 100 (Puntius tiĴeya) Cherry barb 3 [8] Cyprinids M. marinum 1383 99.9 (Puntius tiĴeya) ȱę 4c [18] Cyprinids M. marinum 1332 99.9 (Carassius auratus auratus) ȱę M. gordonae 1350 100 5e [–] Cyprinids (Carassius auratus auratus) M. peregrinum 1251 100 ȱę 6e [–] Cyprinids M. fortuitum 1320 100 (Carassius auratus auratus) Tiger barb No mycobacteria 7e [4] Cyprinids - - (Puntius tetrazona) Cosby gourami M. arupense 1334 100 8d,e [7] ¢ȱę (Trichogaster trichopterus) M. peregrinum 1336 100 ȱ 9 [8] ¢ȱę M. marinum 1384 99.9 (Colisa lalia) Honey gourami 10c,e [10] ¢ȱę M. marinum 1351 99.7 (Colisa chuna) ȱęȱę 11c [22] ¢ȱę M. marinum 1390 99.4 (eĴa splendens) ȱęȱę 12c [23] ¢ȱę M. marinum 1339 99.9 (eĴa splendens) Snakeskin gourami M. fortuitum 1311 100 13e [16] ¢ȱę (Trichogaster pectoralis) M. peregrinum 1332 99.9 Thick-lipped gourami 14 [13] ¢ȱę M. marinum 1362 99.3 (Colisa labiosus) ę No mycobacteria 15e [–] Cichlids -- (Pterophyllum scalare) Labidochromis yellow 16e [11] Cichlids M. chelonae 1334 100 (Labidochromis caeruleus) Rainbow krib 17c [14] Cichlids M. marinum 1375 99.9 (Pelvicachromis pulcher) Black tetra No mycobacteria 18e [6] Tetras -- ( ymnocorymbus terneĵi) Cardinal tetra 19c,e [6] Tetras M. gordonae 1324 100 (Paracheirodon axelrodi) Colombian tetra 20c [1] Tetras M. marinum 1384 99.6 (Hyphessobrycon columbianus) Colombian tetra 21c [18] Tetras M. marinum 1393 99.2 (Hyphessobrycon columbianus) Ȃȱȱ 22 [–] Tetras M. haemophilum 1374 98.9 (Boehlkea fredcochui) Glowlight tetra 23c [1] Tetras M. chelonae 1371 99.8 (Hemigrammus erythrozonus) Glowlight tetra 24c [17] Tetras M. marinum 1362 99.9 (Hemigrammus erythrozonus) Glowlight tetra 25c [21] Tetras M. marinum 1380 99.5 (Hemigrammus erythrozonus) Swegles tetra 26 [2] Tetras M. Ěorentinum 1366 97.4 (Hyphessobrycon sweglesi) ȱ ȱę 27c [12] ȱę M. marinum 1383 99.9 (Glossolepis incisus) Peacook gudgeon 28 [23] ȱę M. haemophilum 1374 99.0 (Tateurdina ocellicauda) Bull. Eur. Ass. Fish Pathol., 34(3) 2014, 83 aThe pet-shop number is given in square brackets [ ] and is the same as in Table 2. The square brackets ȱȱǽȮǾȱȱȱęȱȱȱȱȱȱǯ bMatched by the database RDP release 10 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯ c ȱȱ ȱ¢ȱȱȱȱȱȱǯ dPartly ȱȱ ȱ¢ȱȱȱȱȱȱǯ eCultivated. Matched by the database RDP release 11 (ĴDZȦȦǯǯǯȦǼȱȱȱ ȱǯȱ ȱȱęȱȱȱȱ¢ȱ