JOURNAL of NEMATOLOGY Article | DOI: 10.21307/Jofnem-2021-045 E2021-45 | Vol
Total Page：16
File Type：pdf, Size：1020Kb
JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2021-045 e2021-45 | Vol. 53 An interesting rare tylenchid species, Antarctenchus urmiensis n. sp. (Tylenchomorpha; Psilenchidae) from Urmia Lake islands, northwest Iran, with a discussion on the taxonomy of related genera Mohammad Amiri Bonab1, Joaquín Abolafia2 and Majid Pedram1,* Abstract 1Department of Plant Pathology, A population of an amphidelphic tylenchid nematode was re- Faculty of Agriculture, Tarbiat covered from Urmia Lake islands in association with native shrubs Modares University, Tehran, Iran. of the region. It had a Tylenchidae-type cloacal bursa in male and looked morphologically similar to the genera under the family 2Departamento de Biología Animal, Psilenchidae sensu Siddiqi, representing a new species, described Biología Vegetal y Ecología, and illustrated in present study as Antarctenchus urmiensis n. sp. Universidad de Jaén, Campus de It is characterized by the slender body at anterior region, gradually las Lagunillas, Avenida de Ben narrowing toward posterior end. Four lines in lateral fields in Saprut s/n. 23071-Jaén, Spain. extremities, increasing to six at mid-body. Deirids at secretory- *E-mail: majid.pedram@modares. excretory pore (S-E pore) level and phasmids at 38–62% of the tail. ac.ir Low-expanded cephalic region having a moderately sclerotized cephalic framework, continuous with body, and not flattened This paper was edited by dorso-ventrally. Finely annulated cuticle. Amphidial apertures pore- Zafar Ahmad Handoo. like. Short (13–15 µm long) stylet, its conus 35–42% of the total Received for publication length and three small tear-drop like knobs. Pharynx with ellipsoid February 01, 2021. metacorpus and small valve, small saccate pharyngeal bulb offset from intestine. Reproductive system didelphic-amphidelphic, vulva with no membrane or epyptigma. Tail conical, not elongate or filiform, usually slightly ventrally bent, with a sharp or blunt tip and a small indentation at dorsal side close to tip. Males with similar anterior body region and tail to those of female, tylenchoid spicules and small cloacal bursa. In molecular phylogenetic analyses using partial small and large subunit ribosomal DNA (SSU and LSU rDNA D2-D3) sequences, the new species appeared as an independent lineage between the clades of Hoplolaimina sensu Siddiqi and the clades of Atetylenchus spp. + Psilenchus spp. in the SSU phylogeny. In LSU phylogeny, it placed in a clade including representa- tives of Atetylenchus, Psilenchus, Amplimerlinius, Pratylenchoides, Nagelus, and Geocenamus. The currently available phylogenies and taxonomic frameworks were re-evaluated for the placement of the didelphic Tylenchidae- like genera, the overall results showing the best resolution is achieved with the family concept of Psilenchidae under Dolichodoroidea. Keywords Atetylenchus, Morphology, Phylogeny, Psilenchidae, West Azarbaijan province. © 2021 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Antarctenchus urmiensis n. sp. from Iran: Amiri Bonab et al. The taxonomy and phylogeny of tylenchids have already The tray method (Whitehead and Hemming, 1965) been studied and revised by several authors (Bert et al., was used to extract nematodes from soil samples. 2008; De Ley and Blaxter, 2002; Holterman et al., 2009; The nematodes of interest were handpicked under Panahandeh et al., 2019; Sturhan, 2012; Subbotin et al., a Nikon SMZ1000 stereomicroscope, heat-killed by 2006). Following the molecular phylo genetic study of De adding boiling 4% formalin solution, transferred to Ley and Blaxter (2002), the order Tylenchida Thorne, anhydrous glycerin according to De Grisse (1969), 1949 sensu Siddiqi (2000), together with the former mounted in permanent slides and examined using a order Aphelenchida Siddiqi, 1980, formed the infraorder Nikon Eclipse E600 light microscope. Photographs Tylenchomorpha De Ley and Blaxter, 2002 within were taken using an Olympus DP72 digital camera the order Rhabditida Chitwood, 1933. This infraorder attached to an Olympus BX51 microscope powered now contains four superfamilies: Aphelenchoidea De with differential interference contrast (DIC). Drawings Ley and Blaxter, 2002, Criconematoidea Taylor, 1936 were made using a drawing tube attached to the Sphaerularioidea Lubbock, 1861, and Tylenchoidea microscope and were redrawn using the CorelDRAW® (Örley, 1880) (Decraemer and Hunt, 2013). Six families, software version 12. namely, Tylenchidae Örley, 1880, Dolichodoridae Chitwood, 1950, Hemicycliophoridae Skarbilovich, Scanning Electron Microscopy (SEM) 1959, Hoplolaimidae Filipjev, 1934, Pratylenchidae Thorne, 1949, and Tylenchulidae Skarbilovich, 1947 Specimens preserved in glycerin were selected for are placed under the superfamily Tylenchoidea Örley, observation under SEM according to Abolafia (2015). 1880 (Decraemer and Hunt, 2013). Currently, there They were hydrated in distilled water, dehydrated in are conflicting viewpoints about the taxonomic place- a graded ethanol-acetone series, critical point dried, ment of didelphic genera attributed to Psilenchidae coated with gold, and observed with a Zeiss Merlin Paramonov, 1967 (Geraert, 2008; Hunt, Bert and microscope (5 kV) (Zeiss, Oberkochen, Germany). Siddiqi, 2000; 2012); or no decisions were made on their position in the reference books, e.g. Plant Nematology (Decraemer and Hunt, 2013). DNA extraction, PCR, and sequencing Based on available data, few researchers have A single nematode specimen of the new species discussed about the status of Psilenchidae. Subbotin was picked out and transferred to a small drop of et al. (2006) gave a historic overview on the case, TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, and recently Hosseinvand et al. (2020) followed the Qiagen) on a clean slide and squashed using a clean framework used by Geraert (2008), stating that the coverslip. The suspension was collected by adding followed taxonomic frame is supported by their 25 μ l TE buffer. Two DNA samples were prepared resolved SSU phylogeny (also see Discussion section). in this manner. DNA samples were stored at −20°C During present study, a didelphic tylenchid popu- until using as PCR templates. Primers for partial am- lation was recovered from the soil samples obtained plification of SSU rDNA were forward primer 22F (5´– from the Urmia Lake islands. By its typological simi- TCCAAGGAAGGCAGCAGGC–3´) and revers primer larities, and having a Tylenchidae-type cloacal bursa in 13R (5´–GGGCATCACAGACCTGTTA–3´) (Dorris et al., male, i.e. lacking a bursa enveloping the tail or a trilobed 2002). Sometimes the reverse primer 1573 R (5´–TA bursa, common in dolichodoirds sensu Geraert (2019) CAAAGGGCAGGGACGTAAT–3´) (Mullin et al., 2005) and Decraemer and Hunt (2013), it looked similar to was used interchangeably. The LSU rDNA D2-D3 Psilenchidae sensu Siddiqi (2000) members (also see expansion segments were amplified using the for- Discussion section). Thus, the present study aims to ward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) describe the recovered po pulation as Antarctenchus and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3´) urmiensis n. sp. using both traditional and phylogenetic (Nunn, 1992) primer pairs. The PCR products were approaches and discuss on the taxonomy of the genera sequenced in both directions using the same primers placed under Psilenchidae sensu Siddiqi (2000). used in PCR with an ABI3730XL sequencer. The newly obtained sequences were deposited into the Materials and methods GenBank database under the accession numbers MW208950 and MW208951 for SSU and MW208952 Nematode sampling and morphological for LSU rDNA. identification The newly obtained sequences were compared with those of other nematode species available in GenBank Several soil samples were collected from different using the BLAST homology search program. For parts of the Urmia Lake islands, northwest Iran. reconstruction of the phylogenetic relationships, two 2 JOURNAL OF NEMATOLOGY independent SSU and LSU datasets were prepared. (S-E pore) level, phasmids at about mid-tail. Stylet The selected DNA sequences (representatives of short, its conus shorter than the shaft, abut 37–46% most tylench genera were included) were aligned of the total stylet, with three tear-drop like knobs. The using Q-INS-i algorithm of the online version of MAFFT stylet guiding apparatus complex, usually three rings (version 0.91b) (http://mafft.cbrc.jp/aligment/seaver/) were observed, forming two chambers at shaft region. (Katoh and Standley, 2013). The poorly aligned po- Pharynx tylenchoid, procorpus slender, metacorpus sitions and divergent regions of SSU and LSU small, oval, at 40.0–45.8% of the pha rynx with weak datasets were eliminated using all three less strin gent valve, isthmus narrow, pharyngeal bulb small, with options. The model of base substitution was selected usually one visible nucleus. Cardia large. Intestine using MrModeltest.2 (Nylander, 2004). The Bayesian simple, rectum and anus functional. S-E pore analyses were performed using MrBayes v3.1.2 position just anterior of pharyngeal bulb. Hemizonid (Ronquist and Huelsenbeck, 2003) running the chains distinct, just anterior to S-E pore. Nerve ring for 5,000,000 generations for both datasets. After encircling isthmus. Reproductive system didelphic- discarding burn-in samples, the remaining samples amphidelphic, each branch composed of an ovary, were retained for further analyses. The Markov chain with oocytes in a single row,