DOCSLIB.ORG

Morphological, Molecular and Phylogenetic Study of Filenchus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Morphological, Molecular and Phylogenetic Study of Filenchus Alvani et al., J Plant Pathol Microbiol 2015, S:3 Plant Pathology & Microbiology http://dx.doi.org/10.4172/2157-7471.S3-001 Research Article Open Access Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene Somaye Alvani1, Esmat Mahdikhani Moghaddam1*, Hamid Rouhani1 and Abbas Mohammadi2 1Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran 2Department of Plant Pathology, University of Birjand, Birjand, Iran Abstract Ziziphus zizyphus is very important crop in Iran. Because there isn’t any research of plant parasitic nematodes on Z. zizyphus, authors were encouraged to work on it. Nematodes isolated from the soil samples by whitehead method (1965) and permanent slides were prepared. Among the species Filenchus aquilonius is redescribed for the first time from Southern Khorasan province.F. aquilonius is characterized by lip region rounded, not offset, with fine annuls; four incisures in lateral line; Stylet moderately developed, 10-11.8 µm long with rounded knobs; Hemizonid immediately in front of excretory pore; Deirids at the level of excretory pore; Spermatheca an axial chamber and offset pouch; Tail about 120-157 µm, tapering gradually to a pointed terminus. For molecular identification the large subunit expansion segments of D2/D3 were performed for F. aquilonius to examine the phylogenetic relationships with other Tylenchids. DNA sequence data revealed that F. aquilonius had closet phylogenetic affinity withIrantylenchus vicinus as a sister group and with other Filenchus species for this region and placed them in one clade with 100% for bootstap value support. Phylogenetic position and additional information of other taxa in Tylenchidae from this region of Iran are included. Evidence from the 28S gene strongly supports that Filenchus species are monophyletic. There is the first study of D2D3 segment of F. aquilonius and I. vicinus. Keywords: Filenchus aquilonius; 28S rRNA; D2D3; Phylogeny; ecology. Therefore, a more robust phylogeny based on a combination Nematodes; Southern Khorasan; Iran of morphological and molecular approaches is needed to clarify important relationships within Tylenchomorpha. There is general Introduction agreement that Tylenchida is monophyletic, whereas there is some Nematodes (Phylum Nematoda) are considered one of the most disagreement regarding rank and discussion of polyphyly [35]. abundant and diverse animals on earth. They are found in terrestrial, Typically Aphelenchida is regarded as a sister taxon to Tylenchida. freshwater, brackish, and marine environments [1] and play important Therefore, information and taxonomic resolution of the infra order ecological roles in soil ecosystems [2-4]. Application of integrative Tylenchomorpha requires broader representation, including these taxonomic approaches is useful for the identification of species based on little known groups [36]. both morphology and genome sequences [5]. This application has been The objectives of this study were: (1) Carry out a detailed useful for nematodes [6]. In the last two decades, molecular approaches morphological and morphometric characterization of Filenchus have become more common to nematologists [7-9]. As a result, some aquilonius Wu [37], Lownsbery and Lownsbery [38] as a new species for new nematodes species descriptions are increasingly supported by Iranian nematodes fauna; (2) Perform a molecular characterization of molecular evidence [10,11]. The order Tylenchida includes the largest the new species and other known species of Tylenchidae from Iran for and economically most important group of plant parasitic nematodes so the first investigation of plant parasitic nematodes on three important they have always received ample taxonomic attention. Several attempts crops Berberis vulgaris, Crocus sativus and Ziziphus zizyphus; (3) First based of morphological and molecular characters for classification have register of D2D3 sequences of F. aquilonius, I. vicinus and Neopsilenchus been proposed for Tylenchids [12-29]. Maggenti et al. [30] proposed magnidens in National Center for Biotechnology Information and (4) four suborders, The Tylenchina, Aphelenchina, Sphaerulariina and Found some information about phylogenetic relationship between Hexatylina. Siddiqi [31,32] identified four suborders, Tylenchina, Irantylenchus and Filenchus genus. Hoplolaimina, Criconematina and Hexatylina and regarded the other suborder, Aphelenchina as a distinct order. The suborder Tylenchina sensu De Ley and Blaxter is represented by broad ecological diversity. Tylenchida infra orders Panagrolaimomorpha, Cephalobomorpha, *Corresponding authors: Esmat Mahdikhani Moghaddam, 1Department and Tylenchomorpha. Plant parasites are found only in the infra of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran, Tel: +989155161529; Fax: +985138788875; E-mail: [email protected], orders Tylenchomorpha. Nematode taxonomy has been strongly based [email protected] on morphological characters [33]. Nematode species are classically Received April 10, 2015; Accepted June 18, 2015; Published June 23, 2015 defined on the basis of these qualitative and quantitative characters. Although morphological information might help species diagnostics, Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New these characters are homoplasious features in many cases, and do not Species for Iranian Nematofauna and Some Other Known Nematodes from Iran adequately consider the possibility of convergent evolution. As a result, Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. new species descriptions are increasingly supported by molecular doi:10.4172/2157-7471.S3-001 evidence [34]. However, the study of morphology remains a critical Copyright: © 2015 Alvani S, et al. This is an open-access article distributed under necessity as morphology is the primary interface of an organism the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and with its environment with key implications for development and source are credited. J Plant Pathol Microbiol Pathological Findings in Plants ISSN:2157-7471 JPPM an open access journal Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. doi:10.4172/2157-7471.S3-001 Page 2 of 7 Material and Methods For determination of identification percent the SDTv 1.0 software was used. In this survey, Rhabditis nidrosiensis (AM399067) was used as Soil samples out group. A total of 320 soil samples were collected in 2012- 2013 years from Results 20-50 cm depth of soil from South Khorasan province in Iran. In this study we obtained original sequences from five species of Tylenchids We discuss only new species F. aquilonius (Figures 1 and 2). along with other sequences that were given from NCBI (Table 1). New Photographs and measurements of other known species also provided sequences reported here have been deposited in GenBank under the (Figure 3, Tables 2 and 3). accession number given in Table 1. Material examined Nematode extraction 13 females and 3 males from one location, in good state of The nematodes were extracted from soil samples using the tray preservation. method [39] and then handpicked under a Motic1000 dissecting microscope. The nematode specimens were heat killed by adding Measurements boiling 4% formalin solution then transferred to anhydrous glycerin Measurements are given in Table 3. according to De Grisse [40]. Measurements and drawings were performed using a drawing tube attached to an Olympus BH2 light GeneBank accession Species Host microscope. Photographs were taken using an Olympus DP72 digital number camera attached to an Olympus BX51 microscope. The ratios and Boleodorus thylactus Ziziphus zizyphus KP313830 the morphometric symbols used in morphometric tables of each Filenchus aquilonius Ziziphus zizyphus KP313834 specimen. Nematodes were identified based on morphological and Irantylenchus vicinus Berberis vulgaris KP313833 morphometrical characters using identification keys. Neopsilenchus magnidens Berberis vulgaris KP313832 DNA extraction Psilenchus hilarulus Crocus sativus KP313831 A single nematode specimen was selected, washed in a drop of Table 1: Species were identified in this survey by host and GeneBank accession number of D2D3 segment of 28SrRNA. clean water (a temporary slide was made for each individual) then transferred to a small drop of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a sterilized slide and covered using a clean slide cover glass. The suspension (DNA sample) was recollected by adding 10 µl AE buffer and stored at -20°C as PCR templates. PCR processing Primers used for the amplification of D2-D3 domains were D2a (5’ACAAGTACCGTGAGGGAAAGT 3’) and D3b (5’TGCGAAGGAACCAGCTACTA3’) [41]. The 25 μl PCR mixture contained: 14 μl distilled water, 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mixture, 1.5 μl 50 mM MgCl2, 1 μl of each primer (10 pmoles/μl), 0.5 μl of Taq DNA polymerase (CinaGen, Tehran, Iran, 5 u/µl), and 4 μl of DNA template. The thermal cycling program was
Load more

Recommended publications
  • Description and Identification of Four Species of Plant-Parasitic Nematodes Associated with Forage Legumes
    5 Egypt. J. Agronematol., Vol. 17, No.1, PP. 51-64 (2018) Description and Identification of Four Species of Plant-parasitic Nematodes Associated with Forage Legumes * * Mahfouz M. M. Abd-Elgawad ; Mohamed F.M. Eissa ; Abd-Elmoneim Y. ** *** **** El-Gindi ; Grover C. Smart ; and Ahmed El-bahrawy . * Plant Pathology Department, National Research Centre. ** Department of Agricultural Zoology and Nematology, Faculty of Agriculture, University of Cairo, Giza, Egypt. *** Department of Entomology and Nematology, IFAS, University of Florida, USA. **** Institute for Sustainable Plant Protection, National Council of Research, Bari, Italy. Abstract Four species of plant parasitic nematodes were present in soil samples planted with forage legumes at Alachua County, Florida, USA. The detected species Belonolaimus longicaudatus, Criconemella ornate, Hoplolaimus galeatus, and Paratrichodorus minor were described in the present study. They belong to orders Rhabditida (Belonolaimus longicaudatus, Criconemella ornate, and Hoplolaimus galeatus) and Triplonchida (Paratrichodorus minor) and to taxonomical families Dolichodoridae (Belonolaimus longicaudatus), Hoplolaimidae (Hoplolaimus galeatus) Criconematidae (Criconemella ornate), and Trichodoridae (Paratrichodorus minor). The identification of the present specimens was based on the classical taxonomy, following morphological and morphometrical characters in the species specific identification keys. Keywords: Belonolaimus longicaudatus, Criconemella ornate, Hoplolaimus galeatus, Paratrichodorus minor, morphology,
    [Show full text]
  • Dolichodorus Aestuarius N. Sp. (Nematode: Dolichodoridae) 1
    Simulation Model Refinement: Ferris 201 5. FERRIS, H., and M. V. McKENRY. 1974. 11. NICHOLSON, A. J. 1933. The balance of Seasonal fluctuations in the spatial distribu- animal populations. J. Anita. "Ecol. 2:132-178. tion of nematode populations in a California 12. OOSTENBRINK, M. 1966. Major characteristics vineyard. J. Nematol. 6:203-210. of the relation between nematodes and plants. 6. FERRIS, H., and R. H. SMALL. 1975. Computer Meded. LandbHogesch. Wageningen 66:46 p. simulation of Meloidogyne arenaria egg 13. SEINHORST, J. W. 1965. The relation between development and hatch at fluctuating tem- nematode density and damage to plants. perature. J. Netnatol. 7:322 (Abstr.). Nematologica 11 : 137-154. 7. FREEMAN, B. M., and R. E. SMART. 1976. 14. TYLER, J. 1933. Development of the root-knot Research note: a root ohservation laboratory nematode as affected by temperature. Hil- for studies with grapevines. Am. J. Enol. gardia 7:391-415. Viticult. 27:36-39. 15. VANDERPLANK, J. E. 1963. Plant Diseases: 8. GRIFFIN, G. D., and J. H. ELGIN, JR. 1977. Epidemics and Control. Academic Press, Penetration and development of Meloidogyne New York. 349 p. hapla in resistant and susceptible alfalfa 16. WALLACE, H. R. 1973. Nematode Ecology and under differing temperatures. J. Nematol. Plant Disease. Edward Arnold, New York. 9:51-56. 228 p. 9. McCLURE, M. A. 1977. Meloidogyne incognita: 17. WINKLER, A. J., J. A. COOK, W. M. a metabolic sink. J. Nematol. 9:88-90. KLIEWER, and L. A. LIDER. 1974. General 10. MILNE, D. L., and D. P. DUPLESSIS. 1964. De- Viticulture. University of California Press, velopment of Meloidogyne javanica (Treub) Berkeley.
    [Show full text]
  • Dolichodorus Heterocephalus Cobb, 1914
    CA LIF ORNIA D EPA RTM EN T OF FOOD & AGRICULTURE California Pest Rating Proposal for Dolichodorus heterocephalus Cobb, 1914 Cobb’s awl nematode Current Pest Rating: A Proposed Pest Rating: A Domain: Eukaryota, Kingdom: Metazoa, Phylum: Nematoda, Class: Secernentea Order: Tylenchida, Suborder: Tylenchina, Family: Dolichodoridae Comment Period: 08/10/2021 through 09/24/2021 Initiating Event: This nematode has not been through the pest rating process. The risk to California from Dolichodorus heterocephalus is described herein and a permanent pest rating is proposed. History & Status: Background: The genus Dolichodorus was created by Cobb (1914) when he named D. heterocephalus collected from fresh water at Silver Springs, Florida and Douglas Lake, Michigan. This nematode is a migratory ectoparasite that feeds only from the outside on the cells, on the root surfaces, and mainly at root tip. They live freely in the soil and feed on plants without becoming attached or entering inside the roots. Males and females are both present. This genus is notable in that its members are relatively large for plant parasites and have long stylets. Usually, awl nematodes are found in moist to wet soil, low areas of fields, and near irrigation ditches and other bodies of fresh water. Because they prefer moist to wet soils, they rarely occur in agricultural fields and are not as well studied as other plant-parasitic nematodes (Crow and Brammer, 2003). Infestations in Florida may be due to soil containing nematodes being spread from riverbanks CA LIF ORNIA D EPA RTM EN T OF FOOD & AGRICULTURE onto fields, or by moving with water during flooding (Christie, 1959).
    [Show full text]
  • Mitochondrial COI Gene Is Valid to Delimitate Tylenchidae (Nematoda: Tylenchomorpha) Species
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-038 e2020-38 | Vol. 52 Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species Mengxin Bai1, Xue Qing2,*, Kaikai Qiao1, 3, Xulan Ning1, Shun Xiao1, Xi Cheng1 and Abstract 1, Guokun Liu * Tylenchidae is a widely distributed soil-inhabiting nematode family. 1Key Laboratory of Biopesticide Regardless their abundance, molecular phylogeny based on rRNA and Chemical Biology, Ministry genes is problematic, and the delimitation of taxa in this group remains of Education, Fujian Agriculture poorly documented and highly uncertain. Mitochondrial Cytochrome and Forestry University, 350002, Oxidase I (COI) gene is an important barcoding gene that has been Fuzhou, Fujian, China. widely used species identifications and phylogenetic analyses. 2 However, currently COI data are only available for one species in Department of Plant Pathology, Tylenchidae. In present study, we newly obtained 27 COI sequences Nanjing Agricultural University, from 12 species and 26 sequences from rRNA genes. The results Nanjing, 210095, China. suggest that the COI gene is valid to delimitate Tylenchidae species 3State Key Laboratory of Cotton but fails to resolve phylogenetic relationships. Biology, Institute of Cotton Research of CAAS, 455000, Keywords Anyang, Henan, China. Lelenchus leptosoma, Phylogeny, 28S rRNA, 18S rRNA, Species *E-mails: [email protected]; identification. [email protected] This paper was edited by Zafar Ahmad Handoo. Received for publication January 3, 2020. Tylenchidae is a widely distributed soil-inhabiting 2006; Subbotin et al., 2006). However, rRNA genes nematode family characterized by a weak stylet, an are problematic in Tylenchidae phylogeny and the undifferentiated non-muscular pharyngeal corpus, unresolved status is unlikely to be improved by intensive and a filiform tail.
    [Show full text]
  • Observations on the Genus Doronchus Andrássy
    Vol. 20, No. 1, pp.91-98 International Journal of Nematology June, 2010 Occurrence and distribution of nematodes in Idaho crops Saad L. Hafez*, P. Sundararaj*, Zafar A. Handoo** and M. Rafiq Siddiqi*** *University of Idaho, 29603 U of I Lane, Parma, Idaho 83660, USA **USDA-ARS-Nematology Laboratory, Beltsville, Maryland 20705, USA ***Nematode Taxonomy Laboratory, 24 Brantwood Road, Luton, LU1 1JJ, England, UK E-mail: [email protected] Abstract. Surveys were conducted in Idaho, USA during the 2000-2006 cropping seasons to study the occurrence, population density, host association and distribution of plant-parasitic nematodes associated with major crops, grasses and weeds. Eighty-four species and 43 genera of plant-parasitic nematodes were recorded in soil samples from 29 crops in 20 counties in Idaho. Among them, 36 species are new records in this region. The highest number of species belonged to the genus Pratylenchus; P. neglectus was the predominant species among all species of the identified genera. Among the endoparasitic nematodes, the highest percentage of occurrence was Pratylenchus (29.7) followed by Meloidogyne (4.4) and Heterodera (3.4). Among the ectoparasitic nematodes, Helicotylenchus was predominant (8.3) followed by Mesocriconema (5.0) and Tylenchorhynchus (4.8). Keywords. Distribution, Helicotylenchus, Heterodera, Idaho, Meloidogyne, Mesocriconema, population density, potato, Pratylenchus, survey, Tylenchorhynchus, USA. INTRODUCTION and cropping systems in Idaho are highly conducive for nematode multiplication. Information concerning the revious reports have described the association of occurrence and distribution of nematodes in Idaho is plant-parasitic nematode species associated with important to assess their potential to cause economic damage P several crops in the Pacific Northwest (Golden et al., to many crop plants.
    [Show full text]
  • 2020.01.27.921304.Full.Pdf
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.27.921304; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 A novel metabarcoding strategy for studying nematode 2 communities 3 4 Md. Maniruzzaman Sikder1, 2, Mette Vestergård1, Rumakanta Sapkota3, Tina Kyndt4, 5 Mogens Nicolaisen1* 6 7 1Department of Agroecology, Aarhus University, Slagelse, Denmark 8 2Department of Botany, Jahangirnagar University, Savar, Dhaka, Bangladesh 9 3Department of Environmental Science, Aarhus University, Roskilde, Denmark 10 4Department of Biotechnology, Ghent University, Ghent, Belgium 11 12 13 *Corresponding author 14 Email: [email protected] 15 16 Abstract 17 Nematodes are widely abundant soil metazoa and often referred to as indicators of soil health. 18 While recent advances in next-generation sequencing technologies have accelerated 19 research in microbial ecology, the ecology of nematodes remains poorly elucidated, partly due 20 to the lack of reliable and validated sequencing strategies. Objectives of the present study 21 were (i) to compare commonly used primer sets and to identify the most suitable primer set 22 for metabarcoding of nematodes; (ii) to establish and validate a high-throughput sequencing 23 strategy for nematodes using Illumina paired-end sequencing. In this study, we tested four 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.27.921304; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Life-Stage Specific Transcriptomes of a Migratory Endoparasitic Plant
    www.nature.com/scientificreports OPEN Life-stage specifc transcriptomes of a migratory endoparasitic plant nematode, Radopholus similis Received: 20 July 2018 Accepted: 2 April 2019 elucidate a diferent parasitic and Published: xx xx xxxx life strategy of plant parasitic nematodes Xin Huang, Chun-Ling Xu, Si-Hua Yang, Jun-Yi Li, Hong-Le Wang, Zi-Xu Zhang, Chun Chen & Hui Xie Radopholus similis is an important migratory endoparasitic nematode, severely harms banana, citrus and many other commercial crops. Little is known about the molecular mechanism of infection and pathogenesis of R. similis. In this study, 64761 unigenes were generated from eggs, juveniles, females and males of R. similis. 11443 unigenes showed signifcant expression diference among these four life stages. Genes involved in host parasitism, anti-host defense and other biological processes were predicted. There were 86 and 102 putative genes coding for cell wall degrading enzymes and antioxidase respectively. The amount and type of putative parasitic-related genes reported in sedentary endoparasitic plant nematodes are variable from those of migratory parasitic nematodes on plant aerial portion. There were no sequences annotated to efectors in R. similis, involved in feeding site formation of sedentary endoparasites nematodes. This transcriptome data provides a new insight into the parasitic and pathogenic molecular mechanisms of the migratory endoparasitic nematodes. It also provides a broad idea for further research on R. similis. Te burrowing nematode, Radopholus similis [(Cobb, 1893) Torne, 1949] is an important migratory endopar- asitic plant nematode that was frst discovered by Cobb in 1891, on the banana roots from Fiji. Previously, it was reported that R.
    [Show full text]
  • Description of Four Species of Tylenchidae Örley, 1880 (Nematoda: Tylenchomorpha) with Two New Records from Iran
    J. Crop Prot. 2016, 5 (4): 627-642______________________________________________________ doi: 10.18869/modares.jcp.5.4.627 Research Article Description of four species of Tylenchidae Örley, 1880 (Nematoda: Tylenchomorpha) with two new records from Iran Behrouz Golhasan, Ramin Heydari*, Mehrab Esmaeili and Hadi Ghorbanzad Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. Abstract: During a nematological survey, nineteen known species of plant- parasitic nematodes belonging to the family Tylenchidae (Tylenchomorpha: Tylenchoidea) were collected and identified from different localities of West Azerbayjan and Kermanshah provinces, Iran. Among them two species, namely Discotylenchus attenuatus and Tylenchus bhitaii, are new records for Iranian nematode fauna, the male of T. bhitaii is recorded for the first time. Also, two previously reported species Filenchus quartus and Tylenchus stachys are illustrated and described. Descriptions, morphometric data, line drawings and microscopic photographs are provided. Keywords: Description, Discotylenchus, Filenchus, Nematode, New record, Tylenchus Introduction12 To date, more than 64 species of the family Tylenchidae have been reported from different The family Tylenchidae was established by Örley regions of Iran, some with full illustration and (1880), the members of Tylenchidae are some as short reports without any additional cosmopolitan and weak parasites of plants. On the taxonomic information (Ghaderi et al., 2012). The evolutionary ladder of Tylenchida Thorne, 1949, taxonomic studies of Tylenchidae members in Iran they represent the first rung in being both weak has received attention in recent years, e. g., Ghaemi plant parasites and as a conservative group with et al., 2012; Atighi et al., 2013; Panahandeh et al., many ancestral characters (e.g., weak feeding 2015 and Mirbabaei Karani et al., 2015.
    [Show full text]
  • Pratylenchus
    Pratylenchus Taxonomy Class Secernentea Order Tylenchida Superfamily Tylenchoidea Family Pratylenchidae Genus Pratylenchus The genus name is derived from the words pratum (Latin= meadow), tylos (Greek= knob) and enchos ( Greek=spear). Originally described as Tylenchus pratensis by De Man in 1880 from a meadow in England. Pratylenchus scribneri was reported from potato in Tennessee in 1889. Root-lesion nematodes of the genus Pratylenchus are recognised worldwide as major constraints of important economic crops, including banana, cereals, coffee, corn, legumes, peanut, potato and many fruits. Their economic importance in agriculture is due to their wide host range and their distribution in every terrestrial environment on the planet (Castillo and Vovlas, 2007). Plant‐parasitic nematodes of the genus Pratylenchus are among the top three most significant nematode pests of crop and horticultural plants worldwide. There are more than 70 described species, most are polyphagous with a wide range of host plants. Because they do not form obvious feeding patterns characteristic of sedentary endoparasites (e.g. galls or cysts), and all worm‐like stages are mobile and can enter and leave host roots, it is more difficult to recognise their presence and the damage they cause. Morphology There are more than 70 described species, fewer than half of them are known to have males. Morphological identification of Pratylenchus species is difficult, requiring considerable subjective evaluation of characters and overlapping morphomertrics. Nematodes in this genus are 0.4-0.5 mm long (under 0.8 mm). No sexual dimorphism in the anterior part of the body. Deirids absent. Lip area low, flattened anteriorly, not offset, or only weakly offset, from body contour.
    [Show full text]
  • The Wisconsin Integrated Cropping Systems Trial - Sixth Report
    THE WISCONSIN INTEGRATED CROPPING SYSTEMS TRIAL - SIXTH REPORT TABLE OF CONTENTS Prologue ..................................................... Introduction .................................................... ii MAIN SYSTEMS TRIAL -1996 1 . Arlington Agricultural Research Station - 1996 Agronomic Report . 1 2. Lakeland Agricultural Complex - 1996 Agronomic Report .................. 3 3. Weed Seed Bank Changes: 1990 To 1996 ............................ 9 4. Monitoring Fall Nitrates in the Wisconsin Integrated Cropping Systems Trial . 18 5. WICST Intensive Rotational Grazing of Dairy Heifers .................... 26 6. Wisconsin Integrated Cropping Systems Trial Economic Analysis - 1996 ...... 32 WICST SATELLITE TRIALS - 1996 8. Cropping System Three Chemlite Satellite Trial - Arlington, 1995 and 1996 .... 35 9. Corn Response to Commercial Fertilizer in a Low Input Cash Grain System ..... 36 10. WICST On-Farm Cover Crop Research .............................. 38 11 . Summer Seeded Cover Crops - Phase 1, 1996 ........................ 43 12. Improving Weed Control Using a Rotary Hoe .......................... 49 WICST SOIL BIODIVERSITY STUDY - 1996 13. Preliminary Report on Developing Sampling Procedures and Biodiversity Indices 53 14. Soil Invertebrates Associated with 1996 Soil Core Sampling and Residue Decomposition . 66 15. Analysis of Soil Macroartropods Associated with Pitfall Traps in the Wisconsin Integrated Cropping Systems Trial, 1995 ............................ 71 16. Biodiversity of Pythium and Fusarium from Zea mays in different
    [Show full text]
  • Describing Species
    DESCRIBING SPECIES Practical Taxonomic Procedure for Biologists Judith E. Winston COLUMBIA UNIVERSITY PRESS NEW YORK Columbia University Press Publishers Since 1893 New York Chichester, West Sussex Copyright © 1999 Columbia University Press All rights reserved Library of Congress Cataloging-in-Publication Data © Winston, Judith E. Describing species : practical taxonomic procedure for biologists / Judith E. Winston, p. cm. Includes bibliographical references and index. ISBN 0-231-06824-7 (alk. paper)—0-231-06825-5 (pbk.: alk. paper) 1. Biology—Classification. 2. Species. I. Title. QH83.W57 1999 570'.1'2—dc21 99-14019 Casebound editions of Columbia University Press books are printed on permanent and durable acid-free paper. Printed in the United States of America c 10 98765432 p 10 98765432 The Far Side by Gary Larson "I'm one of those species they describe as 'awkward on land." Gary Larson cartoon celebrates species description, an important and still unfinished aspect of taxonomy. THE FAR SIDE © 1988 FARWORKS, INC. Used by permission. All rights reserved. Universal Press Syndicate DESCRIBING SPECIES For my daughter, Eliza, who has grown up (andput up) with this book Contents List of Illustrations xiii List of Tables xvii Preface xix Part One: Introduction 1 CHAPTER 1. INTRODUCTION 3 Describing the Living World 3 Why Is Species Description Necessary? 4 How New Species Are Described 8 Scope and Organization of This Book 12 The Pleasures of Systematics 14 Sources CHAPTER 2. BIOLOGICAL NOMENCLATURE 19 Humans as Taxonomists 19 Biological Nomenclature 21 Folk Taxonomy 23 Binomial Nomenclature 25 Development of Codes of Nomenclature 26 The Current Codes of Nomenclature 50 Future of the Codes 36 Sources 39 Part Two: Recognizing Species 41 CHAPTER 3.
    [Show full text]
  • Characterization and Functional Importance of Two Glycoside Hydrolase Family 16 Genes from the Rice White Tip Nematode Aphelenchoides Besseyi
    animals Article Characterization and Functional Importance of Two Glycoside Hydrolase Family 16 Genes from the Rice White Tip Nematode Aphelenchoides besseyi Hui Feng , Dongmei Zhou, Paul Daly , Xiaoyu Wang and Lihui Wei * Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, 210014 Nanjing, China; [email protected] (H.F.); [email protected] (D.Z.); [email protected] (P.D.); [email protected] (X.W.) * Correspondence: [email protected] Simple Summary: The rice white tip nematode Aphelenchoides besseyi is a plant parasite but can also feed on fungi if this alternative nutrient source is available. Glucans are a major nutrient source found in fungi, and β-linked glucans from fungi can be hydrolyzed by β-glucanases from the glycoside hydrolase family 16 (GH16). The GH16 family is abundant in A. besseyi, but their functions have not been well studied, prompting the analysis of two GH16 members (AbGH16-1 and AbGH16-2). AbGH16-1 and AbGH16-2 are most similar to GH16s from fungi and probably originated from fungi via a horizontal gene transfer event. These two genes are important for feeding on fungi: transcript levels increased when cultured with the fungus Botrytis cinerea, and the purified AbGH16-1 and AbGH16-2 proteins inhibited the growth of B. cinerea. When AbGH16-1 and AbGH16-2 expression A. besseyi was silenced, the reproduction ability of was reduced. These findings have proved for the first time that GH16s contribute to the feeding and reproduction of A. besseyi, which thus provides Citation: Feng, H.; Zhou, D.; Daly, P.; novel insights into how plant-parasitic nematodes can obtain nutrition from sources other than their Wang, X.; Wei, L.
    [Show full text]