Morphological, Molecular and Phylogenetic Study of Filenchus

Alvani et al., J Plant Pathol Microbiol 2015, S:3 Plant Pathology & Microbiology http://dx.doi.org/10.4172/2157-7471.S3-001

Research Article Open Access Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene Somaye Alvani1, Esmat Mahdikhani Moghaddam1*, Hamid Rouhani1 and Abbas Mohammadi2 1Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran 2Department of Plant Pathology, University of Birjand, Birjand, Iran

Abstract Ziziphus zizyphus is very important crop in Iran. Because there isn’t any research of plant parasitic nematodes on Z. zizyphus, authors were encouraged to work on it. Nematodes isolated from the soil samples by whitehead method (1965) and permanent slides were prepared. Among the species Filenchus aquilonius is redescribed for the first time from Southern Khorasan province.F. aquilonius is characterized by lip region rounded, not offset, with fine annuls; four incisures in lateral line; Stylet moderately developed, 10-11.8 µm long with rounded knobs; Hemizonid immediately in front of excretory pore; Deirids at the level of excretory pore; Spermatheca an axial chamber and offset pouch; Tail about 120-157 µm, tapering gradually to a pointed terminus. For molecular identification the large subunit expansion segments of D2/D3 were performed for F. aquilonius to examine the phylogenetic relationships with other Tylenchids. DNA sequence data revealed that F. aquilonius had closet phylogenetic affinity withIrantylenchus vicinus as a sister group and with other Filenchus species for this region and placed them in one clade with 100% for bootstap value support. Phylogenetic position and additional information of other taxa in Tylenchidae from this region of Iran are included. . Evidence from the 28S gene strongly supports that Filenchus species are monophyletic. There is the first study of D2D3 segment of F. aquilonius and I. vicinus.

Keywords: Filenchus aquilonius; 28S rRNA; D2D3; Phylogeny; ecology. Therefore, a more robust phylogeny based on a combination Nematodes; Southern Khorasan; Iran of morphological and molecular approaches is needed to clarify important relationships within Tylenchomorpha. There is general Introduction agreement that Tylenchida is monophyletic, whereas there is some Nematodes (Phylum Nematoda) are considered one of the most disagreement regarding rank and discussion of polyphyly [35]. abundant and diverse animals on earth. They are found in terrestrial, Typically Aphelenchida is regarded as a sister taxon to Tylenchida. freshwater, brackish, and marine environments [1] and play important Therefore, information and taxonomic resolution of the infra order ecological roles in soil ecosystems [2-4]. Application of integrative Tylenchomorpha requires broader representation, including these taxonomic approaches is useful for the identification of species based on little known groups [36]. both morphology and genome sequences [5]. This application has been The objectives of this study were: (1) Carry out a detailed useful for nematodes [6]. In the last two decades, molecular approaches morphological and morphometric characterization of Filenchus have become more common to nematologists [7-9]. As a result, some aquilonius Wu [37], Lownsbery and Lownsbery [38] as a new species for new nematodes species descriptions are increasingly supported by Iranian nematodes fauna; (2) Perform a molecular characterization of molecular evidence [10,11]. The order Tylenchida includes the largest the new species and other known species of Tylenchidae from Iran for and economically most important group of plant parasitic nematodes so the first investigation of plant parasitic nematodes on three important they have always received ample taxonomic attention. Several attempts crops Berberis vulgaris, Crocus sativus and Ziziphus zizyphus; (3) First based of morphological and molecular characters for classification have register of D2D3 sequences of F. aquilonius, I. vicinus and Neopsilenchus been proposed for Tylenchids [12-29]. Maggenti et al. [30] proposed magnidens in National Center for Biotechnology Information and (4) four suborders, The Tylenchina, Aphelenchina, Sphaerulariina and Found some information about phylogenetic relationship between Hexatylina. Siddiqi [31,32] identified four suborders, Tylenchina, Irantylenchus and Filenchus genus. Hoplolaimina, Criconematina and Hexatylina and regarded the other suborder, Aphelenchina as a distinct order. The suborder Tylenchina sensu De Ley and Blaxter is represented by broad ecological diversity. Tylenchida infra orders Panagrolaimomorpha, Cephalobomorpha, *Corresponding authors: Esmat Mahdikhani Moghaddam, 1Department and Tylenchomorpha. Plant parasites are found only in the infra of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran, Tel: +989155161529; Fax: +985138788875; E-mail: [email protected], orders Tylenchomorpha. Nematode taxonomy has been strongly based [email protected] on morphological characters [33]. Nematode species are classically Received April 10, 2015; Accepted June 18, 2015; Published June 23, 2015 defined on the basis of these qualitative and quantitative characters. Although morphological information might help species diagnostics, Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New these characters are homoplasious features in many cases, and do not Species for Iranian Nematofauna and Some Other Known Nematodes from Iran adequately consider the possibility of convergent evolution. As a result, Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. new species descriptions are increasingly supported by molecular doi:10.4172/2157-7471.S3-001 evidence [34]. However, the study of morphology remains a critical Copyright: © 2015 Alvani S, et al. This is an open-access article distributed under necessity as morphology is the primary interface of an organism the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and with its environment with key implications for development and source are credited.

J Plant Pathol Microbiol Pathological Findings in Plants ISSN:2157-7471 JPPM an open access journal Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. doi:10.4172/2157-7471.S3-001

Page 2 of 7

Material and Methods For determination of identification percent the SDTv 1.0 software was used. In this survey, Rhabditis nidrosiensis (AM399067) was used as Soil samples out group. A total of 320 soil samples were collected in 2012- 2013 years from Results 20-50 cm depth of soil from South Khorasan province in Iran. In this study we obtained original sequences from five species of Tylenchids We discuss only new species F. aquilonius (Figures 1 and 2). along with other sequences that were given from NCBI (Table 1). New Photographs and measurements of other known species also provided sequences reported here have been deposited in GenBank under the (Figure 3, Tables 2 and 3). accession number given in Table 1. Material examined Nematode extraction 13 females and 3 males from one location, in good state of The nematodes were extracted from soil samples using the tray preservation. method [39] and then handpicked under a Motic1000 dissecting microscope. The nematode specimens were heat killed by adding Measurements boiling 4% formalin solution then transferred to anhydrous glycerin Measurements are given in Table 3. according to De Grisse [40]. Measurements and drawings were performed using a drawing tube attached to an Olympus BH2 light GeneBank accession Species Host microscope. Photographs were taken using an Olympus DP72 digital number camera attached to an Olympus BX51 microscope. The ratios and Boleodorus thylactus Ziziphus zizyphus KP313830 the morphometric symbols used in morphometric tables of each Filenchus aquilonius Ziziphus zizyphus KP313834 specimen. Nematodes were identified based on morphological and Irantylenchus vicinus Berberis vulgaris KP313833 morphometrical characters using identification keys. Neopsilenchus magnidens Berberis vulgaris KP313832 DNA extraction Psilenchus hilarulus Crocus sativus KP313831 A single nematode specimen was selected, washed in a drop of Table 1: Species were identified in this survey by host and GeneBank accession number of D2D3 segment of 28SrRNA. clean water (a temporary slide was made for each individual) then transferred to a small drop of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a sterilized slide and covered using a clean slide cover glass. The suspension (DNA sample) was recollected by adding 10 µl AE buffer and stored at -20°C as PCR templates. PCR processing Primers used for the amplification of D2-D3 domains were D2a (5’ACAAGTACCGTGAGGGAAAGT 3’) and D3b (5’TGCGAAGGAACCAGCTACTA3’) [41]. The 25 μl PCR mixture contained: 14 μl distilled water, 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mixture, 1.5 μl 50 mM MgCl2, 1 μl of each primer (10 pmoles/μl), 0.5 μl of Taq DNA polymerase (CinaGen, Tehran, Iran, 5 u/µl), and 4 μl of DNA template. The thermal cycling program was as follows: an initial denaturation at 95ºC for 6 min, followed by 35 cycles of denaturation at 94ºC for 30 s, annealing at 47ºC for 30 s, and extension at 72ºC for 1 min. A final extension was performed at 72ºC for 10 min. PCR products were electrophoresed on 1% agarose gels and subsequently the gels were stained using Green viewer (SYBR). Sequencing and phylogenetic analysis The PCR products were sequenced after purification with PCR Pure Kit (Fermentase Company) in both directions using the same PCR primers using an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The sequences chromatograms were checked using Bioedit software [42]. Forward and reverse sequences were assembled in DNA Baser. Sequences produced in the present study can be consulted on GenBank database. Fifty two sequences of the 28 srRNA region were retrieved from Genbank and aligned together with our sequences from this current study using Clustal X software (ver. 2) [43] with default parameters. The phylogenic trees were reconstructed using Bayesian inference (BI). Bayesian analysis was implemented on the data set with the GTR+I+G nucleotide substitution model, using MrBayes ver. 3.1.2 Figure 1: Filenchus aquilonius. Anterior end with oesophageus (A), Excretory pore (B), Vulva and Ovary with special spermetheca (C), Lateral lines in vulva [44]. Analysis was for 2 millions generations. Reconstructed tree was region (D), Tail in female genus (E), Lateral lines in middle of the body (F), observed with Fig. Tree ver. 1.3.1 software. The MEGA 5 program Spicules in male genus (G) and bursa (H). [45] and K2P model [46] was used to calculate nucleotides distance.

Page 3 of 7

abutting intestine, ca 11.62±1.26 (10-14.5 µm) width and ca 25.11±1.97 (21-28 µm) height. Excretory port ca 110.7±4.48 from anterior end. Hemizonid immediately anterior of the excretory pore. Oesophago- intestinal valve conoid. Vulva a simple transverse slit, flush with body contour. Vagina perpendicular to body axis. Reproductive system monodelphic, prodelphic. Ovary outstretched, oocytes in single row. Spermatheca oval shaped, an axial chamber and offset pouch separated by narrowing. Post vulval sac ca 11.05±1.6 (9-14µm) length. Tail elongate-conoid, narrowing perceptibly to a finely-pointed (needle- like) tip ca 141.95±10.12 (120-157) in length. Male: General morphology similar to that of female but slightly slender. Testis single, anteriorly outstretched. Spicules sickle shaped ca 18.5±1 (17.5-19.5µm) in length, gubernaculum distinct, rod shaped with slightly curved top and measuring about 6.43±0.11 (6.3-6.5 µm). Bursa adanal, with crenate margin, extending approximately at the same distance anteriorly and posteriorly from cloaca. Discussion Morphometrical and Molecular characterization and phylogenetic relationships of F. aquilonius The Iranian population of F. aquilonius did not differ with the main description of F. aquilonius. F. aquilonius show similarity to F. orbus. It can be easily distinguished from F. orbus in having a weaker spear

Neopsilenchus Boleodorus Character Psilenchus hilarulus magnidens thylactus Female Female Female n 6 9 8 1029 ± 143.3 (887.5- 873.7 ± 40.7 (817.5- 483 ± 32.4 (437- L 1224.5) 906) 526) a 43.3 ± 0.9 (42.2-44.3) 34.1 ± 2.2 (31.2-36.2) 27 ± 2.2 (25-30.9) Figure 2: Filenchus aquilonius. Anterior end of female (A) and male (B), Stylet b 7.1 ± 0.4 (6.4-7.5) 6.5 ± 0.8 (5.8-7.8) 4.8 ± 0.2 (4.4-5.2) (C), Body in female (D) and male (E), Deirid (F), Ovary with spermetheca (G), c 7.7 ± 1.3 (6.7-9.7) 6.2 ± 0.8 (5.4-7.3) 7.8 ± 0.9 (6.8-9.1) Tail in female (H) and male (I), Lateral lines (J). c’ 8.7 ± 1.7 (6.2-10.0) 9.8 ± 2.0 (7.8-12.2) 5.9 ± 0.5 (5.1-6.8) 65.6 ± 1.2 (63.8- V 49.8 ± 2.6 (47.8-53.5) 66.5 ± 3.1 (62.9-70.1) 67.4) 75.4 ± 1.1 (73.2- V’ 57.3 ± 2.2 (55.1-59.6) 79.4 ± 2.1 (76.3-81.1) 76.5) Stylet 13 ± 0.7 (12.5-14) 12.6 ± 0.9 (12-14) 10.0 ± 1.6 (8.5-12) Pharynx 144.5 ± 19.8 (128.5- 100.1 ± 5.1 (94- 144.5 ± 7.4 (138-155) length 173.5) 107) 51.2 ± 4.7 (46.7- MB 55.7 ± 2.5 (53.6-59.1) 44.1 ± 2.6 (40.5-47) 61) 117.3 ± 21.3 (100.5- 108.8 ± 5.6 (104.5- S-E pore 82.3 ± 3.4 (79-87) 148.5) 117) 515.2 ± 95.9 (445.5- 581.6 ± 34.5 (555.5- 317.6 ± 24.6 (283- Head-Vulva 656) 632.5) 355) 381 ± 54.5 (311- 150.3 ± 18.1 (135- 103.3 ± 9.9 (91.5- Vulva-Anus Figure 3: Anterior end of Psilenchus hilarulus (A), Neopsilenchus magnidens 443.5) 176.5) 119) (B), Irantylenchus vicinus (C) and Boleodorus thylactus (D). Maximum 23.7 ± 3.3 (20-28) 25.7 ± 2.7 (23-29) 17.9 ± 1.2 (16-19) body width PVS - 11.5 ± 2.6 (9-15) 5.4 ± 1.3 (3-7) Female: Body tapering gradually from the vulva to a narrowly 132.7 ± 10.4 (125- 141.7 ± 20.0 (122- 62.4 ± 5.8 (51.5- Tail length pointed posterior end, slightly curved ventrally at vulval region 148) 159) 70) Cuticular annulation rounded with ca 1.56±0.14 (1.5-1.9 µm) width. Width in vulva 23.6 ± 2.8 (20-27) 25.3 ± 2.2 (23-27.5) 15.6 ± 1.7 (13-18) Lateral field with four lines, ca 5.11±0.45 (4.5-6 µm) width, inner two Width in anus 15.6 ± 3.0 (13-20) 14.5 ± 1.0 (13-15.5) 10.5 ± 0.9 (9-12) very faint, outer pair distinct, crenate. Cephalic region continuous T/VA 0.3 ± 0.0 (0.2-0.4) 0.9 ± 0.1 (0.8-1.1) 0.6 ± 0.0 (0.4-0.6) with body contour, not separated, rounded, not striated ca 7.1±0.21 G1 24.3 ± 3.0 (21.6-27.3) - - (7-7.5 µm) width and 3.46±0.17 (3-3.8 µm) height. Amphids not seen. Stylet moderately developed, basal knobs rounded. Median bulb, ca G2 25.6 ± 0.6 (24.9-26.3) - - 8.5±0.71 (7.5-10 µm) width and ca 13.07±0.83 (11.5-14 µm) height. Table 2: Morphometric characters of Psilenchus hilarulus, Neopsilenchus Isthmus thin, slender, encircled by nerve ring. Terminal bulb pyriform, magnidens and Boleodorus thylactus collected from Iran. All measurements are in µm and in the form: mean ± s.d. (range).

Page 4 of 7

Origin characters Filenchus aquilonius Irantylenchus vicinis Female Male Female Male n 13 3 7 2 835.3 ± 38.7 (771.5- L 823 ± 99.0 (747-935) 803.1 ± 111.2 (645-906) 822 ± 16.9 (810-834) 910.5) a 33.2 ± 2.8 (29.9-37.7) 36.2 ± 3.2 (33.4-39.7) 34.7 ± 3.7 (31.7-40.2) 43.8 ± 0.0 (43.7-43.8) b 5.9 ± 0.3 (5.3-6.6) 6.0 ± 0.6 (5.5-6.8) 5.6 ± 0.6 (4.7-6) 5.9 ± 0.0 (5.9-6) c 5.8 ± 0.3 (5.2-6.4) 4.8 ± 0.4 (4.4-5.1) 5.2 ± 0.2 (4.8-5.4) 4.9 ± 0.1 (4.8-5.0) c’ 9.7 ± 0.9 (8.1-11.1) 9.9 ± 0.6 (9.1-10.3) 11.8 ± 2.4 (10.2-15.4) 10.9 ± 0.2 (10.7-11.1)

V 63.3 ± 3.4 (60.3-72.3) - 63.2 ± 1.4 (62.4-65.5) -

V’ 75.1 ± 1.0 (73.6-76.5) - 77.1 ± 1.0 (76.2-78.6) - Stylet 10.6 ± 0.5 (10-11.8) 11 ± 0.5 (10.5-11.5) 11.6 ± 0.2 (11.5-12) 11.2 ± 0.3 (11-11.5) 140.5 ± 3.8 (136- Pharynx length 136.3 ± 2.5 (133.5-138.5) 140.7 ± 7.0 (135-151) 109 ± 1.4 (108-110) 146.5) MB 43.9 ± 1.1 (42.4-45.4) 44.2 ± 1.4 (42.5-45.3) 45.1 ± 1.9 (43.1-47.4) 41.7 ± 1.0 (41-42.4) 110.7 ± 4.4 (105.5- S-E pore 105.3 ± 7.5 (98.5-113.5) 105.2 ± 9.5 (91.5-113.5) 109 ± 1.4 (108-110) 121.5) 528.9 ± 30.6 (490.5- Head-vulva - 501.2 ± 69.5 (403-566.5) - 587) 174.4 ± 9.2 (159.5- Vulva-anus - 148 ± 18.8 (120-160) - 193.5) Maximum body width 25.2 ± 2.0 (21.5-28) 22.6 ± 1.4 (21-23.5) 23.1 ± 2.8 (19.5-26) 18.7 ± 0.3 (18.5-19) PVS 11.0 ± 1.6 (9-14) - 15.6 ± 2.0 (13-17.5) - Tail length 141.9 ± 10.1 (120-157) 169.3 ± 17.7 (151.5-187) 153.8 ± 25.9 (122-185.5) 167.2 ± 8.1 (161.5-173) Width in vulva 23.9 ± 1.5 (21.5-25.5) - 22.3 ± 2.3 (19-24.5) - Width in anus 14.6 ± 1.2 (13-17) 17 ± 0.8 (16.5-18) 13.1 ± 1.9 (11-15) 15.2 ± 0.3 (15-15.5) T/VA - - 1.0 ± 1.2 (0.9-1.2) - Spicule - 18.5 ± 1 (17.5-19.5) 21.5 ± 0.7 (21-22) Gubernaculum - 6.4 ± 0.1 (6.3-6.5) 4.4 ± 0.1 (4.3-4.5) Table. 3: Morphometric characters of Filenchus aquilonius and Irantylenchus vicinis collected from Iran. All measurements are in μm and in the form: mean ± s.d. (range). and much finer annulation on lip region. An, obvious difference is the one half to one stylet length posterior to the knobs (Figure 3). Other position of the excretory pore (anterior the nerve ring in F. orbus vs characters are similar to the Filenchus genus: Cephalic framework behind the nerve ring in F. aquilonius). The median esophageal bulb delicate, stylet with conus about one-third of total stylet length, deirids more ovate and body annulation coarser. near excretory pore, cuticle finely annulated, median bulb muscular, posterior bulb offset, cardia distinct, female genital tract prodelphic, In this survey, this is a first report of this new species ofZiziphus vulva a transverse slit without flaps, spermatheca an offset pouch, post zizyphus from the southern Khorasan province, Iran. vulval uterine sac short, ad-vulval papillae present, Tail elongated The partial sequencing of the 28S rRNA D2-D3 segment for F. conoid, male with paired hypoptygmata on anterior cloacal lip, arcuate aquilonius yielded 720 bp nucleotides. A phylogenetic tree was inferred spicules and symmetrical ad-cloacal bursa. There are some hypotheses from Bayesian analysis and showed F. aquilonius is a close sister group regarding the genus Irantylenchus. This genus was proposed as a with other Filenchus species. subgenus of Tylenchus while describing Tylenchus (Irantylenchus) clavidorus. This new species was at the same time compared with NBLAST analysis based on 28S gene for Iranian population of F. the very similar Tylenchus vicinus and both species are mentioned to aquilonius (KP313834) attributed 96% similarities with Filenchus sp. belong to the same new subgenus, but without transferring this species (JQ005015) and F. annulatus (JQ005017). to the new subgenus. Kheiri [48] didn’t designate his new species as The phylogenetic trees reconstructed based on partial sequences of type species, but being the sole representative of the new (sub) genus D2-D3 segment of 28S sequence, using the Bayesian analysis, showed Tylenchus. Andrássy [49] raised the subgenus to genus rank. The F. aquilonius (KP313834) to be form a monophyletic group with other combination Irantylenchus vicinus is used for the first time in Brzeski Filenchus species (Figure 4) and placed them in one clade with 100% and Sauer [50] but also without mentioning its transfer. Both species bootstrap value support. Athighi et al. [47] also showed that Filenchus are now considered to be synonyms [51]. In this survey F. aquilonius species are monophyletic based on 28SrRNA. placed by with I. vicinus in one clade with high bootstrap value support (100%), So Irantylenchus will be a very close genus to Filenchus based In the phylogenetic tree F. aquilonius (KP313834) was also placed on 28SrRNA. Further investigation is needed for this genus. Based on in the one clade with I. vicinus by 100% bootstrap value support (Figure Ashrafi et al. [52] these two genera also are very close phylogenetic 4). Results of SDTv 1.0 software also showed 97.7% similarity between relationship based on SSU of rRNA and they also placed in one clade. F. aquilonius and I. vicinus (Figure 5). Irantylenchus has a very similar morphology to the species of the genus Filenchus, except for three In this survey Psilenchus hilarulus is grouped with high bootstrap differences in the head region: (1) the amphidial aperture is a straight value support (100%) as basal taxa of some Belonolaimidae longitudinal (2) the stylet knobs are dorsally amalgamated and clavate representatives sensu De Ley and Blaxter [53]. Siddiqi [54] distinguished (or the ventral knob are not developed) resulting in a ventrally situated four families within the superfamily Dolichodoroidea, namely opening of the pharyngeal lumen (3) the dorsal gland opening is found Psilenchidae, Telotylenchidae, Dolichodoridae and Belonolaimidae.

Page 5 of 7

Figure 4: Bayesian 50% majority rule consensus tree inferred from 57 sequences of the D2-D3 domains of the 28S rRNA under the GTR+I+G model. The newly sequenced taxa/isolates are bold.

Figure 5: Pairwise identity between species based on SDTv 1.0 software. Brown and red color show higher percentage of identity between species.

Page 6 of 7

Genus Psilenchus, was grouped with strong support with genera of Daptonema (Nematoda, Xyalidae) with comments on the systematics of some the subfamily Merlininae . The present study also indicated a close related taxa. Zoological Journal of theLinnean Society 158: 1-15. relationship between Psilenchidae and Merlinidae. Surprisingly, this 7. Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldeman P, et al. (1998) A clade includes only stunt nematode genera that bear deirids (except molecular evolutionary framework for the phylum Nematoda. Nature 392: 71- 75. Scutylenchus which lacks deirids) and phasmids. These are sense organs laterally located at the anterior (level of basal bulb) and posterior (tail) 8. De Ley P, Blaxter M (2004) A new system for Nematoda: combining morphological characters with molecular trees, and translating clades into region of the body, respectively. Such morphological features are ranks and taxa. In: Cook RC, Hunt DJ (eds) A new system for Nematoda: also found in Psilenchus and therefore it was suggested by Ryss [55] combining morphological characters with molecular trees, and translating as a synapormophy (“lateral complex”) to group these genera. In fact, clades into ranks and taxa. Brill, Leiden, The Netherlands, pp. 615-632. Siddiqi recognized Psilenchus and Atetylenchus in a separate family 9. Van Megen H, van den Elsen S, Holterman M, Karssen G, Mooyman P, et al. (Psilenchidae) and did not consider them to be closely related to other (2009) A phylogenetic tree of nematodes based on about 1200 full-length small Tylenchidae genera (i.e. Aglenchus, Coslenchus), but instead placed subunit ribosomal DNA sequences. Nematology 11: 927-950. them within the superfamily Dolichodoroidea which includes all the 10. Palomares-Rius JE, Subbotin SA, Liebanas G, Landa BB, Castillo P (2009) Eutylenchus excretorius Ebsary & Eveleigh, 1981 (Nematoda: Tylodorinae) stunt nematodes (e.g. Nagelus, Merlinius, etc). from Spain with approaches to molecular phylogeny of related genera. Based on the D2D segment of 28S rRNA, Subbotin et al. [56] further Nematology 11: 343-354. explored the relationships within Tylenchomorpha and added some 11. Ragsdale EJ, Baldwin JG (2010) Resolving phylogenetic incongruence to controversy on the position of some Tylenchidae and Belonolaimidae articulate homology and phenotypic evolution: a case study from Nematoda. Proc Biol Sci 277: 1299-1307. genera. In particular, the Tylenchidae genera (i.e. Aglenchus, Coslenchus and Boleodorus) were grouped together but not at the most basal 12. AndrÃ¡ssy I (1976) Evolution as a basis for the systematization of nematodes. London, UK, Pitman Publishing p.288. position of the tree as in Bert et al. [57] and Holterman et al. [58,59]. In this survey also these species placed in one clade with each other. 13. Chitwood BG, Chitwood MB (1950) An introduction to Nematology. Baltimore, Monumental Print Co, p. 213. All other species also placed near same species in the tree (Figure 5). Within Tylenchidae, the genera Aglenchus, Coslenchus, and Filenchus 14. Chizhov VN, Berezina NV (1988) Structure and evolution of the female genital system of nematodes of the order Tylenchida (Nematoda). 2. Primary didelphic are recovered as monophyletic with high branch support (100%). species. Zoologichesky Zhurnal 67: 485-494. Moreover, the genera Boleodorus and Neopsilenchus are also strongly supported as monophyletic with high branch support (100%). Siddiqi 15. Chizhov VN, Kruchina SN (1988) Phylogeny of the nematode order Tylenchida (Nematoda). Zoologichesky Zhurnal 67: 1282-1293. classified the former three genera under the subfamily Tylenchinae and the later under Boleodorinae, both as Tylenchidae. 16. Chizhov VN, Kruchina, SN (1989) Particularities of origins of different forms for plant parasitism and phylogeny of the order Tylenchida (Nematoda). Trudy It seems that most molecular phylogenies show economically Helmintologicheskoi Laboratorii 37: 174-195. important plant parasite nematodes to be nested within clades of 17. Chizhov VN, Kruchina SN (1992) The systematics of the nematode order fungal-feeding Tylenchomorpha. These phylogenies have been based Tylenchida (Nematoda). Zoologichesky Zhurnal 71: 5-16. on a single gene approach, either SSU or LSU gene. Therefore, some 18. Chizhov VN (2004) Entomogenous nematodes from the order Tylenchida relationships within Tylenchomorpha are still unresolved, especially (Nematoda). In: Sonin ED (ed) Parasitic nematodes of plants and insects. Moscow, Nauka. pp. 277-293. at the lower taxonomic levels (i.e. family and genus). In order to rigorously test these hypotheses, a more comprehensive phylogeny is 19. Decraemer W, Hunt DJ (2006) Structure and classification. In: Perry RN, Moens required, especially including under represented taxa (i.e. Tylenchidae M (eds) Plant Nematology. Wallingford, UK, CAB International, pp. 3-32. and Belonolaimidae) as well as DNA sequences from multiple genes. 20. Geraert E (2008) The Tylenchidae of the word - Identification of the family Tylenchidae (Nematoda). Academia Press, Ghent, Belgium, p. 540. Acknowledgements 21. Geraert E (2011) The Dolichodoridae of the world. Identification of the family The authors appreciate the kind help of Dr. M. Pedram to take pictures of Dolichodoridae. Ghent, Belgium, Academia Press. samples in Tarbiat Moddares University and Tiago José Pereira (Ph. D. student, Department of Nematology, University of California, Riverside) for helping. The 22. Hunt D J, Bert W, Siddiqi MR (2013) Tylenchidae and Dolichodoridae. In: authors thank of Ferdowsi University of Mashhad for providing equipment and Manzanilla-Lopez RH, Marban-Mendoza N (eds) Practical plant nematology. support in this research. Montecillo, Mexico, Bibliotheca Basica de Agricultura, pp. 209-250.

References 23. Luc M, Maggenti AR, Fortuner R, Raski DJ, Geraert E (1987) A reappraisal of Tylenchina (Nemata). 1. For a new approach to the taxonomy of Tylenchina. 1. Bert W, Karssen G, Helder J (2011) Phylogeny and evolution of nematodes. In: Revue de NÃ©matologie 10: 127-134. Jones J, Gheysen G, Fenoll C (eds) Phylogeny and evolution of nematodes. Springer, London, UK, pp. 45-59. 24. Maggenti AR (1971) Nemic relationships and the origins of plant parasitic nematodes. In: Zuckerman M, Mai WF, Rohde RA (eds) Plant parasitic 2. Austen MC (2004) Natural nematode communities are useful tools to address nematodes, NewYork, London, Academic Press, pp. 65-81. ecological and applied questions. In: Cook RC, Hunt DJ (eds) Natural nematode communities are useful tools to address ecological and applied questions. Brill, 25. Maggenti AR (1981) General nematology. NewYork, Heidelberg & Berlin, Leiden, The Netherlands, pp. 1-17. Springer Verlag 372 pp.

3. Bongers T, Ferris H (1999) Nematode community structure as a bioindicator in 26. Ryss A, Krall E (1981) Classification of the super families Tylenchoidea and environmental monitoring. Trends Ecol Evol 14: 224-228. Hoplolaimoidea with notes on the phylogeny of the suborder Tylenchina (Nematoda). Proceedings of the Estonian Academy of Sciences, Biologia 30: 4. Warwick RM, Price R (1979) Ecological and metabolic studies on free-living 288-298. nematodes from an estuarine mud-flat. Estuarine and Coastal Marine Science 9: 257-271. 27. Siddiqi MR (1980) The origin and phylogeny of the nematode order Tylenchida Thorne, 1949 and Aphelenchida. Helminthological Abstracts, Series B49: 143- 5. Dayrat B (2005) Towards integrative taxonomy. Biological journal of the 170. Linnean Society 85: 407-415. 28. Skarbilovich TS (1978) A short classification of high taxa of the nematodes 6. Neres PF, Da Fonseca-Genevois VG, Torres RA, Da Fonseca Cavalcanti M, from the order Tylenchida Thorne, 1949.Bulleten Vsesoyznogo Instituta De Castro FJV, et al. (2010) Morphological and molecular taxonomy of a new Gelmintologii 23: 31-35.

Page 7 of 7

29. Sturhan D (2012) Contribution to a revision of the family Merlinidae Ryss, 45. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA5: 1998, with proposal of Pratylenchoidinae subfam. N., Paramerlinius gen. n., molecular evolutionary genetics analysis using maximum likelihood, Macrotylenchus gen. n. and description of M. hylophilus sp. n. (Tylenchida). evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: Journal of Nematode Morphology and Systematics 15: 127-147. 2731-2739.

30. Maggenti AR, Luc M, Raski DJ, Fortuner R. Geraert E (1987) A reappraisal of 46. Kimura M (1980) A simple method for estimating evolutionary rates of base Tylenchina (Nemata). 2. Classification of the suborder Tylenchina (Nemata: substitutions through comparative studies of nucleotide sequences. Molecular Diplogasteria). Revue de NÃ©matologie 10: 135-142. Biology and Evolution 16: 111-120.

31. Siddiqi MR (1980) The origin and phylogeny of the nematode order Tylenchida 47. Atighi MR, Pourjam E, Pereira TJ, Okhovvat SM, Alizada BA, et al. (2012) Thorne, 1949 and Aphelenchida. Helminthological Abstracts, Series B49: 143- Redescription of Filenchus annulatus (Siddiqi, Khan, 1983) Siddiqi, 1986 based 170. on specimens from Iran with contributions to the molecular phylogeny of the Tylenchidae. Nematology (in press). 32. Siddiqi MR (1986) Tylenchida parasites of plants and insects. Farnham Royal, Slough, UK, Commonwealth Agricultural Bureaux, p. 645. 48. Kheiri A (1970) Two new species in the family Tylenchidae (Nematoda) from Iran, with a key to Psilenchus. Nematologica 16: 359-368. 33. De Ley P, De Ley IT, Morris K, Abebe E, Mundo-Ocampo M, et al. (2005) An integrated approach to fast and informative morphological vouchering of 49. AndrÃ¡ssy I (2007) Free-living nematodes of Hungary, II. Pedozoologica nematodes for applications in molecular barcoding. Philosophical Transactions Hungarica No. 4. Hungarian Natural History Museum, p. 496. of the Royal Society B: Biological Sciences 360: 1945-1958. 50. Brzeski MW, Sauer MR (1983) Scanning electron micrography of some 34. Ragsdale EJ, Mundo-Ocampo M, Bumbarger DJ, Baldwin JB (2011) Cervidellus Tylenchidae and Boleodoridae and reappraisal of the Boleodoridae. sonorensis n. sp. from the desert of Anza-Borrego, California. Nematology 13: Nematologica 28: 437-446. 607-617. 51. Brzeski MW (1998) Nematodes of Tylenchina in Poland and temperate Europe. 35. Baldwin JG, Nadler SA, Adams BJ (2004) Evolution of plant parasitism among Muzeum I Instytut Zoologii PAN, Warszawa, p. 397. nematodes. Annu Rev Phytopathol 42: 83-105. 52. Ashrafi S, Mugniery D, van Heese EYJ, van Aelst AC, Helder J, et al. (2012) 36. Bert W, Okada H, Tavernier I, Borgonie G, Houthoofd W (2010) Morphological, Description of Meloidoderita salina sp. n. (Nematoda, Sphaeronematidae) from morphometrical and molecular characterisation of Filenchus fungivorus n. a micro-tidal salt marsh at Mont-Saint-Michel Bay in France. Zookeys 249: sp., a fungivorous nematode from Japan in a most likely polyphyletic genus 1-26. (Nematoda: Tylenchina). Nematology 12: 235-246. 53. Deley P, Blaxter ML (2002) Systematic position and phylogeny. In: Lee DL (ed.) 37. Wu LY (1969) Five new species of Tylenchus Bastian, 1965 (Nematoda: The biology of nematodes. London, UK, Taylor & Francis, pp. 1-30. Tylenchidae) from the Canadian High Arctic. Canadian Journal of Zoology 47: 1005-1010. 54. Siddiqi MR (2000) Tylenchida Parasites of Plants and Insects, (2ndedn) CABI Publishing, Wallingford, Oxon, UK, p. 833. 38. Lownsbery JW, Lownsbery BF (1985) Plant-parasitic nematodes associated with forest trees in alifornia. Hilgardia 53: 1-16. 55. Ryss AY (1993) Phylogeny of the order Tylenchida (Nematoda). Russian Journal of Nematology 1: 74-95. 39. Whitehead AG, Hemming JR (1965) A comparison of some quantitative methods of extracting vermiform nematodes from soil. Annual Applied Biology 56. Subbotin S, Sturhan D, Chizhov V, Volvas N, Baldwin J (2006) Phylogenetic 55: 25-38. analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragments of the 28S rRNA gene sequences. Nematology 8: 455-474. 40. De Grisse A (1969) Redescription ou modifications de quelques techniques utilisees dans li etude des nematodes phytoparasitaires. Mededlingen 57. Bert W, Leliaert F, Vierstraete AR, Vanfleteren JR, Borgonie G (2008) Molecular Rijksfaculteit der Landbouwwetenschappen Gent 34: 351-369. phylogeny of the Tylenchina and evolution of the female gonoduct (Nematoda: Rhabditida). Mol Phylogenet Evol 48: 728-744. 41. Nunn GB (1992) 1ematode molecular evolution. Ph.D. dissertation, University of Nottingham, UK. 58. Holterman M, van der Wurff A, van den Elsen S, van Megen H, Bongers T, et al. (2006) Phylum-wide analysis of SSU rDNA reveals deep phylogenetic 42. Hall TA (1999) Bioedit: a user-friendly biological sequence alignment editor and relationships among nematodes and accelerated evolution toward crown analysis program for Windows 95/98/NT. Nucleic Acids Research 41: 95-98. Clades. Mol Biol Evol 23: 1792-1800.

43. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) 59. Holterman M, Karssen G, van den Elsen S, van Megen H, Bakker J, et al. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948. (2009) Small subunit rDNA-based phylogeny of the Tylenchida sheds light on relationships among some high-impact plant-parasitic nematodes and the 44. Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic evolution of plant feeding. Phytopathology 99: 227-23. inference under mixed models. Bioinformatics 19: 1572-1574.

Submit your next manuscript and get advantages of OMICS Group submissions Unique features:

• User friendly/feasible website-translation of your paper to 50 world’s leading languages • Audio Version of published paper • Digital articles to share and explore Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Special features: Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes • 400 Open Access Journals from Iran Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol • 30,000 editorial team S3: 001. doi:10.4172/2157-7471.S3-001 • 21 days rapid review process • Quality and quick editorial, review and publication processing • Indexing at PubMed (partial), Scopus, EBSCO, Index Copernicus and Google Scholar etc • Sharing Option: Social Networking Enabled This article was originally published in a special issue, Pathological Findings • Authors, Reviewers and Editors rewarded with online Scientific Credits in Plants handled by Editor(s). Dr. Chioma Okeoma, Department of • Better discount for your subsequent articles Microbiology University of Iowa, USA Submit your manuscript at: www.editorialmanager.com/lifesciences

J Plant Pathol Microbiol Pathological Findings in Plants ISSN:2157-7471 JPPM an open access journal