Alvani et al., J Plant Pathol Microbiol 2015, S:3 Plant Pathology & Microbiology http://dx.doi.org/10.4172/2157-7471.S3-001 Research Article Open Access Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene Somaye Alvani1, Esmat Mahdikhani Moghaddam1*, Hamid Rouhani1 and Abbas Mohammadi2 1Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran 2Department of Plant Pathology, University of Birjand, Birjand, Iran Abstract Ziziphus zizyphus is very important crop in Iran. Because there isn’t any research of plant parasitic nematodes on Z. zizyphus, authors were encouraged to work on it. Nematodes isolated from the soil samples by whitehead method (1965) and permanent slides were prepared. Among the species Filenchus aquilonius is redescribed for the first time from Southern Khorasan province.F. aquilonius is characterized by lip region rounded, not offset, with fine annuls; four incisures in lateral line; Stylet moderately developed, 10-11.8 µm long with rounded knobs; Hemizonid immediately in front of excretory pore; Deirids at the level of excretory pore; Spermatheca an axial chamber and offset pouch; Tail about 120-157 µm, tapering gradually to a pointed terminus. For molecular identification the large subunit expansion segments of D2/D3 were performed for F. aquilonius to examine the phylogenetic relationships with other Tylenchids. DNA sequence data revealed that F. aquilonius had closet phylogenetic affinity withIrantylenchus vicinus as a sister group and with other Filenchus species for this region and placed them in one clade with 100% for bootstap value support. Phylogenetic position and additional information of other taxa in Tylenchidae from this region of Iran are included. Evidence from the 28S gene strongly supports that Filenchus species are monophyletic. There is the first study of D2D3 segment of F. aquilonius and I. vicinus. Keywords: Filenchus aquilonius; 28S rRNA; D2D3; Phylogeny; ecology. Therefore, a more robust phylogeny based on a combination Nematodes; Southern Khorasan; Iran of morphological and molecular approaches is needed to clarify important relationships within Tylenchomorpha. There is general Introduction agreement that Tylenchida is monophyletic, whereas there is some Nematodes (Phylum Nematoda) are considered one of the most disagreement regarding rank and discussion of polyphyly [35]. abundant and diverse animals on earth. They are found in terrestrial, Typically Aphelenchida is regarded as a sister taxon to Tylenchida. freshwater, brackish, and marine environments [1] and play important Therefore, information and taxonomic resolution of the infra order ecological roles in soil ecosystems [2-4]. Application of integrative Tylenchomorpha requires broader representation, including these taxonomic approaches is useful for the identification of species based on little known groups [36]. both morphology and genome sequences [5]. This application has been The objectives of this study were: (1) Carry out a detailed useful for nematodes [6]. In the last two decades, molecular approaches morphological and morphometric characterization of Filenchus have become more common to nematologists [7-9]. As a result, some aquilonius Wu [37], Lownsbery and Lownsbery [38] as a new species for new nematodes species descriptions are increasingly supported by Iranian nematodes fauna; (2) Perform a molecular characterization of molecular evidence [10,11]. The order Tylenchida includes the largest the new species and other known species of Tylenchidae from Iran for and economically most important group of plant parasitic nematodes so the first investigation of plant parasitic nematodes on three important they have always received ample taxonomic attention. Several attempts crops Berberis vulgaris, Crocus sativus and Ziziphus zizyphus; (3) First based of morphological and molecular characters for classification have register of D2D3 sequences of F. aquilonius, I. vicinus and Neopsilenchus been proposed for Tylenchids [12-29]. Maggenti et al. [30] proposed magnidens in National Center for Biotechnology Information and (4) four suborders, The Tylenchina, Aphelenchina, Sphaerulariina and Found some information about phylogenetic relationship between Hexatylina. Siddiqi [31,32] identified four suborders, Tylenchina, Irantylenchus and Filenchus genus. Hoplolaimina, Criconematina and Hexatylina and regarded the other suborder, Aphelenchina as a distinct order. The suborder Tylenchina sensu De Ley and Blaxter is represented by broad ecological diversity. Tylenchida infra orders Panagrolaimomorpha, Cephalobomorpha, *Corresponding authors: Esmat Mahdikhani Moghaddam, 1Department and Tylenchomorpha. Plant parasites are found only in the infra of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran, Tel: +989155161529; Fax: +985138788875; E-mail: [email protected], orders Tylenchomorpha. Nematode taxonomy has been strongly based [email protected] on morphological characters [33]. Nematode species are classically Received April 10, 2015; Accepted June 18, 2015; Published June 23, 2015 defined on the basis of these qualitative and quantitative characters. Although morphological information might help species diagnostics, Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New these characters are homoplasious features in many cases, and do not Species for Iranian Nematofauna and Some Other Known Nematodes from Iran adequately consider the possibility of convergent evolution. As a result, Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. new species descriptions are increasingly supported by molecular doi:10.4172/2157-7471.S3-001 evidence [34]. However, the study of morphology remains a critical Copyright: © 2015 Alvani S, et al. This is an open-access article distributed under necessity as morphology is the primary interface of an organism the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and with its environment with key implications for development and source are credited. J Plant Pathol Microbiol Pathological Findings in Plants ISSN:2157-7471 JPPM an open access journal Citation: Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. doi:10.4172/2157-7471.S3-001 Page 2 of 7 Material and Methods For determination of identification percent the SDTv 1.0 software was used. In this survey, Rhabditis nidrosiensis (AM399067) was used as Soil samples out group. A total of 320 soil samples were collected in 2012- 2013 years from Results 20-50 cm depth of soil from South Khorasan province in Iran. In this study we obtained original sequences from five species of Tylenchids We discuss only new species F. aquilonius (Figures 1 and 2). along with other sequences that were given from NCBI (Table 1). New Photographs and measurements of other known species also provided sequences reported here have been deposited in GenBank under the (Figure 3, Tables 2 and 3). accession number given in Table 1. Material examined Nematode extraction 13 females and 3 males from one location, in good state of The nematodes were extracted from soil samples using the tray preservation. method [39] and then handpicked under a Motic1000 dissecting microscope. The nematode specimens were heat killed by adding Measurements boiling 4% formalin solution then transferred to anhydrous glycerin Measurements are given in Table 3. according to De Grisse [40]. Measurements and drawings were performed using a drawing tube attached to an Olympus BH2 light GeneBank accession Species Host microscope. Photographs were taken using an Olympus DP72 digital number camera attached to an Olympus BX51 microscope. The ratios and Boleodorus thylactus Ziziphus zizyphus KP313830 the morphometric symbols used in morphometric tables of each Filenchus aquilonius Ziziphus zizyphus KP313834 specimen. Nematodes were identified based on morphological and Irantylenchus vicinus Berberis vulgaris KP313833 morphometrical characters using identification keys. Neopsilenchus magnidens Berberis vulgaris KP313832 DNA extraction Psilenchus hilarulus Crocus sativus KP313831 A single nematode specimen was selected, washed in a drop of Table 1: Species were identified in this survey by host and GeneBank accession number of D2D3 segment of 28SrRNA. clean water (a temporary slide was made for each individual) then transferred to a small drop of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a sterilized slide and covered using a clean slide cover glass. The suspension (DNA sample) was recollected by adding 10 µl AE buffer and stored at -20°C as PCR templates. PCR processing Primers used for the amplification of D2-D3 domains were D2a (5’ACAAGTACCGTGAGGGAAAGT 3’) and D3b (5’TGCGAAGGAACCAGCTACTA3’) [41]. The 25 μl PCR mixture contained: 14 μl distilled water, 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mixture, 1.5 μl 50 mM MgCl2, 1 μl of each primer (10 pmoles/μl), 0.5 μl of Taq DNA polymerase (CinaGen, Tehran, Iran, 5 u/µl), and 4 μl of DNA template. The thermal cycling program was