Gene Expression Profiling Integrated Into Network Modelling Reveals Heterogeneity in the Mechanisms of BRCA1 Tumorigenesis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Mouse Rabac1 Knockout Project (CRISPR/Cas9)https://www.alphaknockout.com Mouse Rabac1 Knockout Project (CRISPR/Cas9) Objective: To create a Rabac1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Rabac1 gene (NCBI Reference Sequence: NM_010261 ; Ensembl: ENSMUSG00000003380 ) is located on Mouse chromosome 7. 5 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 5 (Transcript: ENSMUST00000076961). Exon 1~5 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1 starts from about 0.18% of the coding region. Exon 1~5 covers 100.0% of the coding region. The size of effective KO region: ~2657 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 Legends Exon of mouse Rabac1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.
- 
												  Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
- 
												  Old Data and Friends Improve with Age: Advancements with the Updated Tools of GenenetworkbioRxiv preprint doi: https://doi.org/10.1101/2021.05.24.445383; this version posted May 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Old data and friends improve with age: Advancements with the updated tools of GeneNetwork Alisha Chunduri1, David G. Ashbrook2 1Department of Biotechnology, Chaitanya Bharathi Institute of Technology, Hyderabad 500075, India 2Department of Genetics, Genomics and Informatics, University of Tennessee Health Science Center, Memphis, TN 38163, USA Abstract Understanding gene-by-environment interactions is important across biology, particularly behaviour. Families of isogenic strains are excellently placed, as the same genome can be tested in multiple environments. The BXD’s recent expansion to 140 strains makes them the largest family of murine isogenic genomes, and therefore give great power to detect QTL. Indefinite reproducible genometypes can be leveraged; old data can be reanalysed with emerging tools to produce novel biological insights. To highlight the importance of reanalyses, we obtained drug- and behavioural-phenotypes from Philip et al. 2010, and reanalysed their data with new genotypes from sequencing, and new models (GEMMA and R/qtl2). We discover QTL on chromosomes 3, 5, 9, 11, and 14, not found in the original study. We narrowed down the candidate genes based on their ability to alter gene expression and/or protein function, using cis-eQTL analysis, and variants predicted to be deleterious. Co-expression analysis (‘gene friends’) and human PheWAS were used to further narrow candidates.
- 
												  THE ROLE of HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 in CARDIAC CONTRACTILITY and HYPERTROPHIC RESPONSE by © COPYRIGHT by KYOUNG HTHE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE By KYOUNG HAN KIM A THESIS SUBMITTED IN CONFORMITY WITH THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO © COPYRIGHT BY KYOUNG HAN KIM (2011) THE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE KYOUNG HAN KIM DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO 2011 ABSTRACT Irx5 is a homeodomain transcription factor that negatively regulates cardiac fast transient + outward K currents (Ito,f) via the KV4.2 gene and is thereby a major determinant of the transmural repolarization gradient. While Ito,f is invariably reduced in heart disease and changes in Ito,f can modulate both cardiac contractility and hypertrophy, less is known about a functional role of Irx5, and its relationship with Ito,f, in the normal and diseased heart. Here I show that Irx5 plays crucial roles in the regulation of cardiac contractility and proper adaptive hypertrophy. Specifically, Irx5-deficient (Irx5-/-) hearts had reduced cardiac contractility and lacked the normal regional difference in excitation-contraction with decreased action potential duration, Ca2+ transients and myocyte shortening in sub-endocardial, but not sub-epicardial, myocytes. In addition, Irx5-/- mice showed less cardiac hypertrophy, but increased interstitial fibrosis and greater contractility impairment following pressure overload. A defect in hypertrophic responses in Irx5-/- myocardium was confirmed in cultured neonatal mouse ventricular myocytes, exposed to norepinephrine while being restored with Irx5 replacement. Interestingly, studies using mice ii -/- virtually lacking Ito,f (i.e. KV4.2-deficient) showed that reduced contractility in Irx5 mice was completely restored by loss of KV4.2, whereas hypertrophic responses to pressure-overload in hearts remained impaired when both Irx5 and Ito,f were absent.
- 
												  Asian Zika Virus Isolate Significantly Changes the Transcriptional Profileviruses Article Asian Zika Virus Isolate Significantly Changes the Transcriptional Profile and Alternative RNA Splicing Events in a Neuroblastoma Cell Line Gaston Bonenfant 1,2, Ryan Meng 2, Carl Shotwell 2,3 , Pheonah Badu 1,2, Anne F. Payne 4, Alexander T. Ciota 4,5, Morgan A. Sammons 1, J. Andrew Berglund 1,2 and Cara T. Pager 1,2,* 1 Department of Biological Sciences, University at Albany-SUNY, Albany, NY 12222, USA; [email protected] (G.B.); [email protected] (P.B.); [email protected] (M.A.S.); [email protected] (J.A.B.) 2 The RNA Institute, University at Albany-SUNY, Albany, NY 12222, USA; [email protected] (R.M.); [email protected] (C.S.) 3 Department of Biochemistry and Molecular Biology, College of Medicine, University of Florida, Gainesville, FL 32610, USA 4 Wadsworth Center, New York State Department of Health (NYSDOH), Slingerlands, NY 12159, USA; [email protected] (A.F.P.); [email protected] (A.T.C.) 5 Department of Biomedical Sciences, University at Albany-SUNY, School of Public Health, Rensselaer, NY 12144, USA * Correspondence: [email protected]; Tel.: +1-518-591-8841 Received: 9 April 2020; Accepted: 27 April 2020; Published: 5 May 2020 Abstract: The alternative splicing of pre-mRNAs expands a single genetic blueprint to encode multiple, functionally diverse protein isoforms. Viruses have previously been shown to interact with, depend on, and alter host splicing machinery. The consequences, however, incited by viral infection on the global alternative slicing (AS) landscape are under-appreciated. Here, we investigated the transcriptional and alternative splicing profile of neuronal cells infected with a contemporary Puerto Rican Zika virus (ZIKVPR) isolate, an isolate of the prototypical Ugandan ZIKV (ZIKVMR), and dengue virus 2 (DENV2).
- 
												  Relb Deficiency in Dendritic Cells Protects from AutoimmuneRelB Deficiency in Dendritic Cells Protects from Autoimmune Inflammation Due to Spontaneous Accumulation of Tissue T Regulatory Cells This information is current as of September 24, 2021. Nico Andreas, Maria Potthast, Anna-Lena Geiselhöringer, Garima Garg, Renske de Jong, Julia Riewaldt, Dennis Russkamp, Marc Riemann, Jean-Philippe Girard, Simon Blank, Karsten Kretschmer, Carsten Schmidt-Weber, Thomas Korn, Falk Weih and Caspar Ohnmacht Downloaded from J Immunol 2019; 203:2602-2613; Prepublished online 2 October 2019; doi: 10.4049/jimmunol.1801530 http://www.jimmunol.org/content/203/10/2602 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2019/10/01/jimmunol.180153 Material 0.DCSupplemental References This article cites 74 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/203/10/2602.full#ref-list-1 by guest on September 24, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener ErythritolMulti-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol Danie¨lle M. P. H. J. Boesten1*., Alvin Berger2.¤, Peter de Cock3, Hua Dong4, Bruce D. Hammock4, Gertjan J. M. den Hartog1, Aalt Bast1 1 Department of Toxicology, Maastricht University, Maastricht, The Netherlands, 2 Global Food Research, Cargill, Wayzata, Minnesota, United States of America, 3 Cargill RandD Center Europe, Vilvoorde, Belgium, 4 Department of Entomology and UCD Comprehensive Cancer Center, University of California Davis, Davis, California, United States of America Abstract Diabetes is characterized by hyperglycemia and development of vascular pathology. Endothelial cell dysfunction is a starting point for pathogenesis of vascular complications in diabetes. We previously showed the polyol erythritol to be a hydroxyl radical scavenger preventing endothelial cell dysfunction onset in diabetic rats. To unravel mechanisms, other than scavenging of radicals, by which erythritol mediates this protective effect, we evaluated effects of erythritol in endothelial cells exposed to normal (7 mM) and high glucose (30 mM) or diabetic stressors (e.g. SIN-1) using targeted and transcriptomic approaches. This study demonstrates that erythritol (i.e. under non-diabetic conditions) has minimal effects on endothelial cells. However, under hyperglycemic conditions erythritol protected endothelial cells against cell death induced by diabetic stressors (i.e. high glucose and peroxynitrite). Also a number of harmful effects caused by high glucose, e.g. increased nitric oxide release, are reversed. Additionally, total transcriptome analysis indicated that biological processes which are differentially regulated due to high glucose are corrected by erythritol. We conclude that erythritol protects endothelial cells during high glucose conditions via effects on multiple targets.
- 
												  (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosiscells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
- 
												  Genome-Wide Rnai Screening Identifies Human Proteins with ARESOURCES Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway Jeremy C. Simpson1,7, Brigitte Joggerst2, Vibor Laketa2, Fatima Verissimo2, Cihan Cetin2, Holger Erfle2,6, Mariana G. Bexiga1, Vasanth R. Singan1, Jean-Karim Hériché3, Beate Neumann3, Alvaro Mateos2, Jonathon Blake4, Stephanie Bechtel5, Vladimir Benes4, Stefan Wiemann5, Jan Ellenberg2,3 and Rainer Pepperkok2,7 The secretory pathway in mammalian cells has evolved to facilitate the transfer of cargo molecules to internal and cell surface membranes. Use of automated microscopy-based genome-wide RNA interference screens in cultured human cells allowed us to identify 554 proteins influencing secretion. Cloning, fluorescent-tagging and subcellular localization analysis of 179 of these proteins revealed that more than two-thirds localize to either the cytoplasm or membranes of the secretory and endocytic pathways. The depletion of 143 of them resulted in perturbations in the organization of the COPII and/or COPI vesicular coat complexes of the early secretory pathway, or the morphology of the Golgi complex. Network analyses revealed a so far unappreciated link between early secretory pathway function, small GTP-binding protein regulation, actin cytoskeleton organization and EGF-receptor-mediated signalling. This work provides an important resource for an integrative understanding of global cellular organization and regulation of the secretory pathway in mammalian cells. Within higher eukaryotic cells membrane traffic pathways connect the Extensive efforts over many years have revealed a significant number various membrane-bounded organelles, thereby ensuring that they of regulators associated with the secretory pathway. Early biochemical retain the correct complement of proteins and lipids to maintain approaches to identify individual machinery components have started cellular homeostasis.
- 
												  The Structure-Function Relationship of Angular Estrogens and Estrogen Receptor Alpha to Initiate Estrogen-Induced Apoptosis in Breast Cancer Cells SSupplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2020/05/03/mol.120.119776.DC1 1521-0111/98/1/24–37$35.00 https://doi.org/10.1124/mol.120.119776 MOLECULAR PHARMACOLOGY Mol Pharmacol 98:24–37, July 2020 Copyright ª 2020 The Author(s) This is an open access article distributed under the CC BY Attribution 4.0 International license. The Structure-Function Relationship of Angular Estrogens and Estrogen Receptor Alpha to Initiate Estrogen-Induced Apoptosis in Breast Cancer Cells s Philipp Y. Maximov, Balkees Abderrahman, Yousef M. Hawsawi, Yue Chen, Charles E. Foulds, Antrix Jain, Anna Malovannaya, Ping Fan, Ramona F. Curpan, Ross Han, Sean W. Fanning, Bradley M. Broom, Daniela M. Quintana Rincon, Jeffery A. Greenland, Geoffrey L. Greene, and V. Craig Jordan Downloaded from Departments of Breast Medical Oncology (P.Y.M., B.A., P.F., D.M.Q.R., J.A.G., V.C.J.) and Computational Biology and Bioinformatics (B.M.B.), University of Texas, MD Anderson Cancer Center, Houston, Texas; King Faisal Specialist Hospital and Research (Gen.Org.), Research Center, Jeddah, Kingdom of Saudi Arabia (Y.M.H.); The Ben May Department for Cancer Research, University of Chicago, Chicago, Illinois (R.H., S.W.F., G.L.G.); Center for Precision Environmental Health and Department of Molecular and Cellular Biology (C.E.F.), Mass Spectrometry Proteomics Core (A.J., A.M.), Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Mass Spectrometry Proteomics Core (A.M.), and Dan L. Duncan molpharm.aspetjournals.org
- 
												  Slitrks Control Excitatory and Inhibitory Synapse Formation with LARSlitrks control excitatory and inhibitory synapse SEE COMMENTARY formation with LAR receptor protein tyrosine phosphatases Yeong Shin Yima,1, Younghee Kwonb,1, Jungyong Namc, Hong In Yoona, Kangduk Leeb, Dong Goo Kima, Eunjoon Kimc, Chul Hoon Kima,2, and Jaewon Kob,2 aDepartment of Pharmacology, Brain Research Institute, Brain Korea 21 Project for Medical Science, Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 120-752, Korea; bDepartment of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749, Korea; and cCenter for Synaptic Brain Dysfunctions, Institute for Basic Science, Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 305-701, Korea Edited by Thomas C. Südhof, Stanford University School of Medicine, Stanford, CA, and approved December 26, 2012 (received for review June 11, 2012) The balance between excitatory and inhibitory synaptic inputs, share a similar domain organization comprising three Ig domains which is governed by multiple synapse organizers, controls neural and four to eight fibronectin type III repeats. LAR-RPTP family circuit functions and behaviors. Slit- and Trk-like proteins (Slitrks) are members are evolutionarily conserved and are functionally required a family of synapse organizers, whose emerging synaptic roles are for axon guidance and synapse formation (15). Recent studies have incompletely understood. Here, we report that Slitrks are enriched shown that netrin-G ligand-3 (NGL-3), neurotrophin receptor ty- in postsynaptic densities in rat brains. Overexpression of Slitrks rosine kinase C (TrkC), and IL-1 receptor accessory protein-like 1 promoted synapse formation, whereas RNAi-mediated knock- (IL1RAPL1) bind to all three LAR-RPTP family members or dis- down of Slitrks decreased synapse density.