Sequence Analysis of a Mannitol Dehydrogenase Cdna from Plants Reveals a Function for the Pathogenesis-Related Protein ELI3

Proc. Natl. Acad. Sci. USA Vol. 92, pp. 7148-7152, August 1995 Plant Biology

Sequence analysis of a mannitol dehydrogenase cDNA from plants reveals a function for the pathogenesis-related protein ELI3 (salt stress/carbohydrate metabolism/polyols/celery/salicylate) JOHN D. WILLIAMSON*t, JoHAN M. H. STOOP*, MARA 0. MASSEL*, MARK A. CONKLINGt, AND D. MASON PHARR* Departments of *Horticultural Science and tGenetics, North Carolina State University, Raleigh, NC 27695-7609 Communicated by Charles S. Levings III, North Carolina State University, Raleigh, NC, May 10, 1995

ABSTRACT Mannitol is the most abundant sugar alcohol degree of salt tolerance due to the function of mannitol as an in nature, occurring in bacteria, fungi, lichens, and many osmoregulator and compatible solute (6, 11, 12). Celery plants species of vascular plants. Celery (Apium graveolens L.), a grown in hydroponic culture with a salinity equivalent to 30% plant that forms mannitol photosynthetically, has high pho- that of sea water show dry weight gains equal to plants grown tosynthetic rates thought to result from intrinsic differences at normal nutrient levels (12). In addition, tobacco that was in the biosynthesis of hexitols vs. sugars. Celery also exhibits genetically engineered to synthesize mannitol through the high salt tolerance due to the function of mannitol as an introduction of the Escherichia coli NAD-dependent mannitol- osmoprotectant. A mannitol catabolic enzyme that oxidizes 1-phosphate dehydrogenase acquired significant salt tolerance mannitol to mannose (mannitol dehydrogenase, MTD) has (6). been identified. In celery plants, MTD activity and tissue Metabolite pool sizes in plants are usually determined by mannitol concentration are inversely related. MTD provides relative rates of synthesis and utilization. The isolation and the initial step by which translocated mannitol is committed characterization of a plant NAD-dependent mannitol dehydro- to central metabolism and, by regulating mannitol pool size, genase (MTD), the enzyme responsible for the oxidation of is important in regulating salt tolerance at the cellular level. mannitol to mannose in celery, was reported by our laboratory We have now isolated, sequenced, and characterized a Mtd (13). MTD is a monomeric mannitol:mannose 1-oxidoreductase cDNA from celery. Analyses showed that Mtd RNA was more with a molecular mass of "40 kDa (13, 14). In celery plants, the abundant in cells grown on mannitol and less abundant in expression of MTD is highly regulated. MTD activity is highest in salt-stressed cells. A protein database search revealed that the young actively growing root tips, is also high in young rapidly previously described ELL3 pathogenesis-related proteins from growing (sink) leaves, but is not detected in mature photosyn- parsley and Arabidopsis are MTDs. Treatment of celery cells thetic (source) leaves. Extractable MTD activity from different with salicylic acid resulted in increased MTD activity and tissues is inversely correlated with mannitol concentration (13). RNA. Increased MTD activity results in an increased ability Additional evidence that mannitol oxidation serves as a starting to utilize mannitol. Among other effects, this may provide an point for the entry ofcarbon into metabolism is that celery tissues additional source of carbon and energy for response to patho- also contain high hexokinase and phosphomannose isomerase gen attack. These responses ofthe primary enzyme controlling activity (15). These three enzymes provide a pathway for the mannitol pool size reflect the importance of mannitol metab- conversion of mannitol to fructose 6-phosphate for entry into olism in plant responses to divergent types of environmental central metabolism. stress. Recent characterization of mannitol biosynthetic and uti- lizing enzymes in plants suggests that mannitol pool size is Mannitol is a six-carbon noncyclic sugar alcohol found in regulated in response to salt stress primarily at the level of diverse organisms ranging from bacteria to higher plants. utilization or turnover (11, 12). Salt-stressed celery plants Mannitol is present in more than 100 species of higher plants, accumulate mannitol throughout the plant. This is due pri- where it can be a significant portion of the soluble carbohy- marily to the down-regulation of MTD in sink tissues, resulting drate (1-3). For instance, celery (Apium graveolens) translo- in decreased mannitol utilization and increased pool size (12). cates up to 50% of its photoassimilate as mannitol, with the In celery cell suspension cultures, MTD activity is also strongly remainder being sucrose (4). Both translocated carbohydrates influenced by carbon source and is highest in mannitol-grown are assimilated during growth of nonphotosynthetic hetero- cells (16). This, however, does not appear to be simple trophic (i.e., sink) tissues. Other postulated roles for mannitol substrate regulation, because in intact plants tissue mannitol include carbon storage, free radical scavenging, and osmopro- concentration is inversely related to MTD activity. We have tection (4-7). ascertained, in fact, that in addition to salt, the presence of The use of mannitol as a photoassimilate and translocated sugars may also down-regulate MTD expression (17). For carbohydrate is reported to be advantageous to the plant in example, transfer of cells to medium totally lacking carbohy- several ways. Celery, a C3 plant, has carbon fixation rates drates is accompanied by an initial increase in MTD activity equivalent to those of many C4 plants (8). This may result from comparable to that seen on transfer to mannitol. In addition, both increased NADP/NADPH turnover compared to plants celery cultures containing mannose plus mannitol, or sucrose that exclusively form sugars and from the additional cytosolic plus mannitol, have lower MTD activity than cultures with sink for photosynthetically fixed CO2 provided by mannitol mannitol alone (17). This suggests that sugars suppress MTD synthesis (7, 9, 10). In addition to the increased carbon fixation expression. This is consistent with Obaton's report (18) that in that accompanies mannitol biosynthesis, the initial step of flowering celery, mannitol decreased only after stored sugars mannitol utilization generates NADH, thus giving a higher net fell below 1% of dry weight. ATP yield than the catabolism of an equal amount of sucrose Given the evident potential for osmoprotection, increased (7). Finally, mannitol-producing plants also exhibit a high photosynthesis, and more efficient sink metabolism provided

The publication costs of this article were defrayed in part by page charge Abbreviations: MTD, NAD-dependent mannitol dehydrogenase; PR, payment. This article must therefore be hereby marked "advertisement" in pathogenesis related; SA, salicyclic acid. accordance with 18 U.S.C. §1734 solely to indicate this fact. TTo whom reprint requests should be addressed. 7148 Downloaded by guest on October 2, 2021 Plant Biology: Williamson et al. Proc. Natl. Acad. Sci. USA 92 (1995) 7149

by mannitol metabolism, the engineering of plants with both Plasmid DNA was isolated from single colonies by using an biosynthetic and catabolic enzymes is a compelling goal. alkaline lysis miniprep (21) and digested with restriction Toward this end we isolated, sequenced, and characterized a enzymes. For both plasmid and genomic DNA blot analysis, mannitol dehydrogenase cDNA§ (Mtd) from celery cells. By restriction fragments were separated by electrophoresis on Tris using this cDNA as a probe, we analyzed the Mtd gene response acetate/EDTA/agarose gels and blotted onto nitrocellulose. to salt, carbon source, and, because of its homology to the For analysis of MTD transcript accumulation, total RNA was pathogenesis-related (PR) protein ELI3, its predicted re- isolated from celery cells in suspension culture as described sponse to salicyclic acid (SA). (26), and poly(A)+ RNA was isolated from total RNA by using oligo(dT)-cellulose chromatography (5 Prime -> 3 Prime, MATERIALS AND METHODS Inc.). Both total and poly(A)+ RNA were separated on denaturing 1.2% agarose/formaldehyde gels and transferred Plant Tissue Growth and Treatment. Celery cell suspension onto nitrocellulose. Resulting blots (both DNA and RNA) cultures used in these studies were maintained in MS medium were hybridized overnight at 65°C as described (21) with (19) with mannitol (180 mM), mannose (180 mM), or sucrose 32P-labeled 1.3-kbp Not I-Sal I insert of clone p5-4 containing (90 mM) as the sole carbon source. Relative growth rates for the entire Mtd cDNA (Fig. 1). Hybridizing bands and colonies cells maintained on these carbon sources are similar (16);

however, MTD activity is highest for cells grown in mannitol. H H H A H H H H H H HH H After 14 days, cells were transferred to fresh medium contain- F H H H H FHH 13 a 4 U ing the same carbon sources and grown for 3 or 4 days as to.- q 94 Q indicated to further treatment or Sucrose-grown -A / prior harvest. W.M., i I 1 cells used in salicylate response experiments were supple- '"444- I I- I mented with either salicylic acid (to 1 mM from a 100 mM 0 200bp HC c) stock in distilled H20) or an equal volume of distilled H20 and V4 grown for an additional 24 h. At the conclusion of the various B treatments, cells were harvested by filtration, washed with CCTCTCCTATTTCATTAAACAATCTCAAATTTTTATTTTGACAATGGCGAA so distilled H20, and frozen in liquid nitrogen. Frozen tissue was M A lC 3 ATCGTCAGAAATTGAACACCCTGTCAAGGCTTTTGTCTGGCCTGCAAGGa 100 ground to a fine powder in a mortar and pestle in liquid S S I BH P V A F W A A RD 20 pep 1 150 nitrogen and stored at -80°C. ACACTACTaaTCTCCTTTCTCCGTTTAAGTTTTCCAGAAGGGCAACAGGTO Protein and Enzyme Assays. Protein extractions and MTD T T L L SP F K F S R R A T 0 37 GAGAAGGATGTGAGGCTCAAAGTTCTaTTTTGTGCAGTTTGTCATTCTGA 200 activity assays were performed as described (16). Protein BK D V R L K V L F C a V C H S D 54 pop 2 concentrations were determined by the method of Bradford TCATCACATGATCCATAATAACTGGGCTTCACCACGTATCCTATCGTTC 250 (20). Protein blot analyses of MTD in E. coli cell extracts H H M I H N N W a * TT Y P I V P 71 CTGGGCACGAAATTGTTGGTGTOGTGACTGAAGTTGGGAGCAAAGTGGAA 300 containing equal amounts of protein were performed as G H E I V G V V T B V G S X V E 88 Xho II described (21) by using polyclonal antisera raised against AAAGTCAAGGTCGGAGATAATGTTGGAATTGGGTGCTTAGOTTGATCTG 350 gel-purified MTD (14). K V X V G D N V G I G C L V G S C 105 TCGTTCATGTGAAAGTTOCTGCGACAACAGGGAGAGTCACTGTGAAA.ATA 400 Library Construction and Clone Isolation. Poly(A)+ RNA R S C B S CC D N R B S H C S N T 122 isolated from mannitol-grown cell suspension cultures 3 days CAATAGATACCTACGGTTCTATATATTTTGATGOAACCATGACACACGGA 450 I D T Y G S I Y P D G T 2 T H 0 139 after subculturing was used for construction of a directional Dal I GOGTALTTCCGATACTATGGTTTGCGGACGAACATTTCATTCTTCGATGC 50o0 cDNA expression library in A-ZIPLOX (GIBCO/BRL). 0 V S D T M V A D 1 H F I L R W P 156 Phage in the unamplified primary library containing cDNA ,bAAGAATTTGCCACTCGATTCTOGTGCTCCTCTATTGTGTGCCGGGATCA 550 encoding MTD were detected as described (22) by using K N L P L D S 0 A P L LC A G I T 173 CAACTTATAGTCCCCTGAAATACTATGGACTCGACAAGCCTGGTACTAAG 600 polyclonal antisera raised against gel-purified MTD (14). T Y S P L K Y Y C L D K P G TK 190 "Mannitol-specific" subtractive probes were also prepared as ATTGOTGTTGTAGGCTTAGGTGGGCTAGGCCATGTAGCTGTGAAGATOGC 650 I 0 V V G L GG L G H V A V K M A 207 described (21) and used to identify phage containing cDNAs Hind III AAAAGCTTGGTGCACAGGTTACGGTAATAGATATTTCTGAAAGCAAAA 700 for sequences more abundant in mannitol- vs. mannose-grown 0 V I S K in screen were K A F A Q T V I D E S R 224 cells. Phage giving strong positive signals either GGAAGGAAGCATTGQAAAAACTCGGTGCTGATTCTTTCTTGTTAAATAGT 750 plaque-purified and excised as plasmids by using the E. coli K K A L E K L G A D S FL L N 5 241 SSt I Cla I excision host DH12S (23). Resulting colonies were gridded on GACCAGGAACAAATGAAGGGCGCCACTACCTCACTTGATGGAATTATCA 80o0 nitrocellulose disks soaked with isopropyl 13-D-thiogalactoside D Q E Q M K G A R S S L D G I I D 258 .TACTGTACCTGTGAATCACCCTCTTGCTCCACTGTTTGATCTATTAAA0C 850 and incubated on LB agar and appropriate antibiotics. Colo- T V P V N H P L A P L F D L L X P 275 Hind III nies containing cDNA encoding MTD were verified by using CTAATCGAAA2=GTTCATGOTTGGTGCACCTGAAAAGCCCTTTGAGCTG 900 N G KL V M V 0 A P E K P F E L 292 MTD polyclonal antisera as described (21). HindIII CCAGTGTTCTCTTTGCTTAAGGGGAGAA&AGZCTTGGAGGCACTATTAA 950 DNA and Protein Sequence Analysis. Deletion subclones of P V F S L L X 0 R K L L 0 0 T I N 309 p-p3 clone p5-4, containing a putative near full-length Mtd cDNA, TGGTGGGATAAAGGAAACACAAGAAAT0CTTGATTTTGCAGCAAAGCACA 1000 GG I T Q E M L D F AA KX N 326 were made by using the Erase-a-Base kit (Promega). In addition Pvu II ACATAA;A&O ATGTTGAAGTTATTCCTATGGACTATGTGAACACCGCA 1050 to vector universal and reverse sequencing primers, internal I T A D V E V I P M D Y V N T A 343 oligonucleotide primers were used to facilitate sequencing. Oli- ATGGAGAGACTTGTGAAGTCAGATGTTCGATACAGATTTGTCATCGACAT 1100 M E R L V K S D V R Y R F V I D I 360 gonucleotides were synthesized and clones were sequenced at the Ave II TGCTAATACGATOA92AOGAAGAAAGTTTGOGOOCCTAGAGACACCOGO 1150 Iowa State University Nucleic Acid Facility. Sequence analysis A N T H R T E E S L G A 365 was performed using PC/GENE (IntelliGenetics), GenBank On- TCTTTAAATCOACTACATATCTCTACAGAKATG0OCTACCAATGCGTCCA 1200 TATTTOTGTACCAGACTTGGGCATAAATCATTTTTATGTATTTTATTTAT 1250 line Service, and at the National Center for Biotechnology CTTTTTCTCTTTTT 1298 Information by using the BLAST network service (24). Nucleic Acid Manipulations. DNA colony blots were pre- FIG. 1. Mtd cDNA. (A) Partial restriction map of the cDNA clone pared as described (21). For genomic hybridization analysis, p5-4. An arrow indicates reading frame and orientation of the MTD total genomic DNA was isolated from celery by the method of coding region, and a bar indicates the scale. The entire Not I-Sal I fragment was used as a probe in subsequent analyses. (B) Nucleotide Dellaporta et al. (25) and digested with restriction enzymes. and deduced amino acid sequences of the Mtd cDNA. Selected restriction enzyme cut sites are indicated, and peptide sequences §The sequence reported in this paper has been deposited in the confirmed by direct amino acid sequencing of purified MTD (14) are GenBank data base (accession no. U24561). double underlined. Downloaded by guest on October 2, 2021 7150 Plant Biology: Williamson et al. Proc. Natl. Acad. Sci. USA 92 (1995) were visualized by autoradiography. C change. The molecular mass and sequence of the predicted cDNA translation product of clone p5-4 correspond to those of the purified MTD protein (Fig. 1B), confirming its RESULTS identity as an authentic Mtd sequence. DNA blot analyses of Isolation of a Mtd cDNA. Celery cells grown on mannitol as total genomic DNA from celery suspension cells using the the sole carbon source have substantially higher MTD activity entire Not I-Sal I insert (Fig. 1A) of clone p5-4 as a probe than cells grown on mannose as the sole carbon source (16). showed a simple hybridization pattern consistent with one to Because MTD activity reaches maximal levels between 3 and a few copies of the Mtd gene per haploid genome (data not 4 days after subculturing, poly(A)+ RNA from 3-day- shown). subcultured mannitol-grown cells was used for construction of ELI3 PR Proteins Are MTDs. The deduced amino acid a directional cDNA expression library. Phage containing sequence of clone p5-4 was compared with protein sequences MTD-encoding cDNA were detected in the isopropyl ,B-D- on file in the data bases by using a BLAST search (24). This thiogalactoside-induced unamplified primary library by using showed that the Mtd sequence encodes consensus zinc and antisera raised against gel-purified MTD (14). Of 3 x 105 NAD/NADH binding domains characteristic of many dehy- plaques screened, - 1% were antibody-positive. Mannitol- drogenases (Fig. 2). The deduced MTD peptide sequence was specific subtractive probes were also prepared and used to also found to be essentially identical to those of the ELI3 PR identify phage in the library containing sequences more abun- proteins from parsley andArabidopsis (27). These amino acid dant in mannitol vs. mannose grown cells. Of 15 strongly sequences have an overall 83% identitywith an additional 10% antibody-positive clones and 29 mannitol-enhanced subtrac- similarity. tive clones selected at random, all antibody-positive clones and Accumulation of Mtd Transcript in Response to Carbon 8 of the subtractive clones cross-hybridized. Source, NaCl, and SA in Celery Cells in Suspension Culture. Clones containing the largest putative Mtd cDNA inserts MTD activity increases in mannitol-grown celery cells in were identified by restriction analysis. The 1.3-kbp putative suspension culture for 3-4 days after transfer to fresh medium full-length clone p5-4 was sequenced and found to contain a (16) and remains high until limited by depletion of medium single open reading frame of 1095 nt, encoding a peptide of 365 components. No comparable increase in MTD activity is seen amino acids with a predicted molecular mass of 39.7 kDa (Fig. in similarly treated cultures grown in medium containing 1). Molecular mass of purified celery MTD was previously mannose or sucrose as the sole carbon source. Further, celery determined to be -40 kDa, and sequences of three trypsin- suspension cells and celery roots grown in increasing salinity generated peptides had been determined (14). These were (i) show a dose-dependent decrease in MTD activity (7, 12). For AFGWAAR, (ii) VLF(C/S)GVCHSDHHMIHNNWGF analyses here, celery suspension cells were transferred to fresh (manually terminated), and (iii) LLGGTINGGIK The double medium containing mannitol, mannose, sucrose, or sucrose/ amino acid obtained in the fourth position of peptide 2 0.3 M NaCl. Total proteins were extracted from cells 4 days suggests the presence of two nearly identical Mtd alleles, the after transfer, and MTD activity was determined (16) (Fig. 3). codon difference between cysteine and serine being a single G Differences in MTD activity were as reported (16, 17), with

1Zn binding ELI3 ...... -.0 EL13-2 ELI3-1 MTm

at i t a I ELI3 - - ID ELI3-2 F _3- EL13-1 MTD F -z :ess 3e:M-3ERRSlDR3 3 NT U

ELI3' PNVm I *3 I I ELI3-2

ELI3-1 WI Y I z-r'' I I MTD I M~ n

ELI3 ELI3-2 ELI3-1 MTD

EhI3 H I LV _ V| _ ELI3-2 ELI3-1 MTD I 3 ;SWS'^:V 3 F

EL13 *_ .. .3 *3 11:z:vs:- - I ZS..I ELI3-2 XE Gb:S:e"sR:XE3 M-CS'SE MIX:1e! ELI3-1 = I s ; F^,|.|-§b X@" :X Es:sS@":BW-P:'e .eEI ES Mm ;A FIG. 2. Amino acid comparison of MTD and the ELI3 PR proteins. The deduced amino acid sequence of NAD-dependent MTD from Apium graveolens was aligned with those of ELI3 from parsley (Petroselinum crispum) (fragment) and ELI3-1 and ELI3-2 from Arabidopsis thaliana (27). Identical amino acids are indicated by a black background, similar amino acids (neutral substitutions) are indicated by a gray background, and a dash indicates a space added to preserve alignment. The zinc and NAD/NADH binding motifs are indicated by bracketed labels. Peptide sequences confirmed by amino acid sequencing of purified MTD (14) are double underlined. Identity is -83% with an additional 10% similarity. Similarity groups used were A,G,S,T; I,L,V,M; F,Y,W; D,E,N,Q; and K,R,H. Downloaded by guest on October 2, 2021 Plant Biology: Williamson et al. Proc. Natl. Acad. Sci. USA 92 (1995) 7151 analyses of total RNA showed that this difference was paral- 1.4 leled by a corresponding change in Mtd RNA accumulation.

E 1.2 DISCUSSION

45-.8 Previous work in this laboratory demonstrated (13) the exis- 0.6 tence of a NAD-dependent mannitol dehydrogenase in celery that catalyzes the conversion of mannitol to mannose. After 2 0.2 ... phosphorylation by hexokinase and subsequent isomerization 0 by phosphomannose isomerase, mannose ultimately enters Mt Ms Suc NaCI central metabolism as fructose 6-phosphate. MTD appears to control mannitol pool size by regulating mannitol turnover or utilization in response to various stimuli. For instance, MTD is highly expressed in heterotrophic (sink) tissues of whole Mtd (pA+) plants and in cell suspension cultures in the presence of its substrate mannitol. However, in the presence of sugars and/or NaCi (7, 16, 17), MTD expression is repressed. The derepression of MTD expression in sugar-depleted sink tissues allows Mtd (tot) increased utilization of mannitol in central metabolism. Con- versely, the negative regulation of MTD expression in response to NaCl leads to higher mannitol concentrations and may FIG. 3. Effect of carbon source and NaCl on MTD activity and Mtd contribute to salt tolerance (7, 12). RNA accumulation in celery cells. Celery cell suspension cultures were Comparison of molecular mass and partial amino acid transferred to fresh medium containing mannitol (Mt), marnose (Ms), sequence of purified MTD protein with those deduced from sucrose (Suc), or sucrose/0.3 M NaCl (NaCl). Cultures were incubated the cDNA sequence indicates that p5-4 is an authentic Mtd for 3 days and harvested. Total proteins were extracted and MTD clone (Fig. 2). The transcript size revealed by RNA blot activity was determined. One unit (U) of MTD activity is defined as analysis (-1.3 kbp) was comparable to the cloned insert size 1 ,umol/h. Total (tot) and poly(A)+ (pA+) RNA was extracted from (1298 bp), further indicating that the clone is nearly full length. cells from each treatment and relative amounts ofMtd transcript were RNA RNA blot analyses of both total and poly(A)+ RNA showed determined by blot analysis. that changes in the amount of Mtd transcript in celery cells in activity being highest in mannitol-grown cells, much lower in suspension culture paralleled changes in MTD activity mod- sucrose- and mannose-grown cells, and lowest in cells grown in ulated both by carbon source and NaCl (Fig. 3). Thus, the sucrose/0.3 M NaCl. To see whether transcript accumulation reported changes in MTD activity are regulated, at least in mirrors these differences, relative amounts of Mtd transcript part, at the level of RNA accumulation. of the deduced MTD were assessed by RNA blot analysis. Total and poly(A)+ RNA Subsequent analysis protein sequence indicated that MTD, and hence also may be involved blots were with a 32P-labeled Not I-Sal I mannitol, probed 1.3-kbp in plant responses to pathogen attack. A BLAST search of the fragment (Fig. 1) containing the entire Mtd cDNA insert. protein databases revealed that a group of PR proteins of Differences in amounts ofMtd transcript paralleled differences previously unknown function, the ELI3 proteins of parsley and in MTD activity (Fig. 3). Arabidopsis (27), are in fact MTDs. In leaves ofArabidopsis, the Identification of MTD as a PR protein also led us to examine pathogen-induced expression of these genes was proposed to its response to SA. Celery cells in suspension culture grown for be critical in resistance to Pseudomonas and is dependent on 24 h in sucrose-containing medium supplemented with 1 mM the presence of a wild-type copy of the R-gene resistance locus SA had almost 20-fold higher MTD activity than samples from RPM1 (27). Various combinations of susceptible and resistant cells grown in unsupplemented cultures (Fig. 4). RNA blot Arabidopsis and virulent and avirulent pathovars of Pseudo- monas syringae were evaluated. In all cases, incompatible 1.0 interactions (resistant host or avirulent pathogen) were char- 0.8 acterized by a more rapid accumulation of Mtd RNA than were E compatible interactions (susceptible host). SA mediates a 0.6 number of plant resistance responses to pathogen attack. .5 These responses range from the direct suppression of enzyme 0.4 activity, as for catalase (28), to the increased accumulation of specific PR proteins (29). Not surprisingly, therefore, we were 0.2 able to demonstrate that both MTD activity and Mtd RNA

0 dramatically increase in celery suspension cells treated with -SA +SA SA. Although, to our knowledge, neither parsley nor Arabi- dopsis had previously been reported to make mannitol, we Mtd found (14) in separate studies that parsley contains substantial amounts of mannitol, MTD protein, and regulated MTD activity. Plant responses to pathogen attack are complex, and while FIG. 4. Differential MTD activity and Mtd transcript accumulation a number of specific responses have been delineated, the in the presence and absence of exogenous SA. Celery cell suspension functions of many PR proteins remain obscure. Our work cultures were transferred to fresh sucrose-containing medium and supports the observation that a number of PR proteins may be grown for 72 h. Replicate cultures were then supplemented with SA (to proteins with well-defined metabolic roles (e.g., ,3-glucanase; 1 mM) (+SA) or with an equal volume of water (- SA) and incubated ref. that also be activated attack. for an additional 24 h. Total proteins were extracted and MTD activity 30) may during pathogen was determined. One unit (U) of MTD activity is defined as 1 ,umol/h. While not specifically defining the role of MTD in pathogen Total RNA was extracted from cells from each treatment and relative response, our findings suggest several possibilities. As detailed amounts of Mtd transcript (Mtd) were determined by RNA blot above, MTD expression is repressed in the presence of sugars. analysis. The SA derepression of MTD expression in the presence of Downloaded by guest on October 2, 2021 7152 Plant Biology: Williamson et al. Proc. Natl. Acad. Sci. USA 92 (1995) sucrose allows access to mannitol as an added carbon and 8. Loescher, W. H. (1987) Physiol. Plant. 70, 553-557. energy source. This might be advantageous in tissues under- 9. Rumpho, M. E., Edwards, G. E. & Loescher, W. H. (1983) Plant going induction of defense mechanisms by allowing access to Physiol. 73, 869-873. additional energy and carbon to support the increased demand 10. Fox, T. C., Kennedy, R. A. & Loescher, W. H. (1986) Plant Physiol. 82, 307-311. for both inherent in many pathogen responses (e.g., cell wall 11. Everard, J. D., Gucci, R., Kann, S. C., Flore, J. A. & Loescher, and phytoalexin synthesis). Alternatively, lower mannitol in W. H. (1994) Plant Physiol. 106, 281-292. tissues may affect the invading pathogen directly. Because 12. Stoop, J. M. H. & Pharr, D. M. (1994) Plant Physiol. 106, 503- mannitol is an antioxidant, its removal, like the inactivation of 511. catalase (28), might enhance the pathogen-induced oxidative 13. Stoop, J. M. H. & Pharr, D. M. (1992) Arch. Biochem. Biophys. burst reported by several groups (31). Further, as a number of 298, 612-619. plant pathogens (especially fungi) can utilize mannitol as a 14. Stoop, J. M. H., Williamson, J. D., Conkling, M. A. & Pharr, carbon and energy source, its removal may retard pathogen D. M. (1995) Plant Physiol. 108, 1219-1225. ingress. 15. Stoop, J. M. H. & Pharr, D. M. (1994) J. Am. Soc. Hort. Sci. 119, The identification of MTD as a PR protein opens various 237-242. 16. Stoop, J. M. H. & Pharr, D. M. (1993) Plant Physiol. 103, 1001- lines of inquiry into the possible biological basis for this 1008. unexpected relationship. Thus, with our previous findings (7, 17. Pharr, D. M., Stoop, J. M. H., Studer Feusi, M. E., Williamson, 12, 14, 17), these resplts suggest that mannitol metabolism J. D., Massel, M. 0. & Conkling, M. A. (1995) in Carbon Parti- plays an important role in plant responses to diverse biotic and tioning and Source-Sink Interactions in Plants, eds. Madore, M. & abiotic stresses. Lucas, W. (Am. Soc. Plant Physiol., Rockville, MD), in press. 18. Obaton, M. F. (1929) Rev. Gen. Bot. 41, 622-633. We thank Dr. M. Ehrenshaft for many valuable discussions and Mr. 19. Murashige, T. & Skoog, F. (1962) Physiol. Plant. 15, 473-497. M. Williams for photographic support. This research was supported in 20. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254. part by U.S. Department of Agriculture Grant 9302250 to D.M.P. and 21. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular M.A.C. Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY), 2nd Ed. 1. Bieleski, R. L. (1982) in Encyclopedia of Plant Physiology: New 22. Young, R. A. & Davis, R. W. (1983) Proc. Natl. Acad. Sci. USA Series, eds. Loewus, F. A. & Tanner, W. (Springer, New York), 80, 1194-1198. Vol. 13A, pp. 158-192. 23. Lin, J.-J., Jessee, J. & Bloom, F. (1992) Focus 14, 98-101. 2. Lewis, D. H. (1984) Storage Carbohydrates in Vascular Plants, ed. 24. Altschul, S. F., Gish, W., Miller, W., Meyers, E. W. & Lipman, Lewis, D. H. (Cambridge Univ. Press, Cambridge, U.K.), pp. D. J. (1990) J. Mol. Biol. 215, 403-410. 143-184. 25. Dellaporta, S. L., Wood, J. & Hicks, J. B. (1983) Plant Mol. Biol. 3. Thompson, M. R., Douglas, T. J., Obata-Sasamoto, H. & Thorpe, Rep. 1, 19-21. T. A. (1986) Physiol. Plant. 67, 365-369. 26. Williamson, J. D., Quatrano, R. S. & Cuming, A. C. (1985) Eur. 4. Loescher, W. H., Tyson, R. H., Everard, J. D., Redgwell, R. J. & J. Biochem. 152, 501-507. Bieleski, R. L. (1992) Plant Physiol. 98, 1396-1402. 27. Kiedrowski, S., Kawalleck, P., Hahlbrock, K., Somssich, I. E. & 5. Smirnoff, N. & Cumbes, Q. J. (1989) Phytochemistry 28, 1057- Dangl, J. L. (1992) EMBO J. 11, 4677-4684. 1089. 28. Chen, Z., Silva, H. & Klessig, D. F. (1993) Science 262, 1883- 6. Tarczynski, M. C., Jensen, R. G. & Bohnert, H. J. (1993) Science 1886. 259, 508-510. 29. Yalpani, N. & Raskin, I. (1993) Trends Microbiol. 1, 88-92. 7. Pharr, D. M., Stoop, J. M. H., Williamson, J. D., Studer Feusi, 30. Kauffmann, S., Legrand, M., Geoffroy, P. & Fritig, B. (1987) M. E., Massel, M. 0. & Conkling, M. A. (1995) HortScience, in EMBO J. 6, 3209-3212. press. 31. Sutherland, M. W. (1991) Physiol. Mol. Plant Pathol. 38, 79-93. Downloaded by guest on October 2, 2021