DOCSLIB.ORG

Sequence Analysis of a Mannitol Dehydrogenase Cdna from Plants Reveals a Function for the Pathogenesis-Related Protein ELI3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sequence Analysis of a Mannitol Dehydrogenase Cdna from Plants Reveals a Function for the Pathogenesis-Related Protein ELI3 Proc. Natl. Acad. Sci. USA Vol. 92, pp. 7148-7152, August 1995 Plant Biology Sequence analysis of a mannitol dehydrogenase cDNA from plants reveals a function for the pathogenesis-related protein ELI3 (salt stress/carbohydrate metabolism/polyols/celery/salicylate) JOHN D. WILLIAMSON*t, JoHAN M. H. STOOP*, MARA 0. MASSEL*, MARK A. CONKLINGt, AND D. MASON PHARR* Departments of *Horticultural Science and tGenetics, North Carolina State University, Raleigh, NC 27695-7609 Communicated by Charles S. Levings III, North Carolina State University, Raleigh, NC, May 10, 1995 ABSTRACT Mannitol is the most abundant sugar alcohol degree of salt tolerance due to the function of mannitol as an in nature, occurring in bacteria, fungi, lichens, and many osmoregulator and compatible solute (6, 11, 12). Celery plants species of vascular plants. Celery (Apium graveolens L.), a grown in hydroponic culture with a salinity equivalent to 30% plant that forms mannitol photosynthetically, has high pho- that of sea water show dry weight gains equal to plants grown tosynthetic rates thought to result from intrinsic differences at normal nutrient levels (12). In addition, tobacco that was in the biosynthesis of hexitols vs. sugars. Celery also exhibits genetically engineered to synthesize mannitol through the high salt tolerance due to the function of mannitol as an introduction of the Escherichia coli NAD-dependent mannitol- osmoprotectant. A mannitol catabolic enzyme that oxidizes 1-phosphate dehydrogenase acquired significant salt tolerance mannitol to mannose (mannitol dehydrogenase, MTD) has (6). been identified. In celery plants, MTD activity and tissue Metabolite pool sizes in plants are usually determined by mannitol concentration are inversely related. MTD provides relative rates of synthesis and utilization. The isolation and the initial step by which translocated mannitol is committed characterization of a plant NAD-dependent mannitol dehydro- to central metabolism and, by regulating mannitol pool size, genase (MTD), the enzyme responsible for the oxidation of is important in regulating salt tolerance at the cellular level. mannitol to mannose in celery, was reported by our laboratory We have now isolated, sequenced, and characterized a Mtd (13). MTD is a monomeric mannitol:mannose 1-oxidoreductase cDNA from celery. Analyses showed that Mtd RNA was more with a molecular mass of "40 kDa (13, 14). In celery plants, the abundant in cells grown on mannitol and less abundant in expression of MTD is highly regulated. MTD activity is highest in salt-stressed cells. A protein database search revealed that the young actively growing root tips, is also high in young rapidly previously described ELL3 pathogenesis-related proteins from growing (sink) leaves, but is not detected in mature photosyn- parsley and Arabidopsis are MTDs. Treatment of celery cells thetic (source) leaves. Extractable MTD activity from different with salicylic acid resulted in increased MTD activity and tissues is inversely correlated with mannitol concentration (13). RNA. Increased MTD activity results in an increased ability Additional evidence that mannitol oxidation serves as a starting to utilize mannitol. Among other effects, this may provide an point for the entry ofcarbon into metabolism is that celery tissues additional source of carbon and energy for response to patho- also contain high hexokinase and phosphomannose isomerase gen attack. These responses ofthe primary enzyme controlling activity (15). These three enzymes provide a pathway for the mannitol pool size reflect the importance of mannitol metab- conversion of mannitol to fructose 6-phosphate for entry into olism in plant responses to divergent types of environmental central metabolism. stress. Recent characterization of mannitol biosynthetic and uti- lizing enzymes in plants suggests that mannitol pool size is Mannitol is a six-carbon noncyclic sugar alcohol found in regulated in response to salt stress primarily at the level of diverse organisms ranging from bacteria to higher plants. utilization or turnover (11, 12). Salt-stressed celery plants Mannitol is present in more than 100 species of higher plants, accumulate mannitol throughout the plant. This is due pri- where it can be a significant portion of the soluble carbohy- marily to the down-regulation of MTD in sink tissues, resulting drate (1-3). For instance, celery (Apium graveolens) translo- in decreased mannitol utilization and increased pool size (12). cates up to 50% of its photoassimilate as mannitol, with the In celery cell suspension cultures, MTD activity is also strongly remainder being sucrose (4). Both translocated carbohydrates influenced by carbon source and is highest in mannitol-grown are assimilated during growth of nonphotosynthetic hetero- cells (16). This, however, does not appear to be simple trophic (i.e., sink) tissues. Other postulated roles for mannitol substrate regulation, because in intact plants tissue mannitol include carbon storage, free radical scavenging, and osmopro- concentration is inversely related to MTD activity. We have tection (4-7). ascertained, in fact, that in addition to salt, the presence of The use of mannitol as a photoassimilate and translocated sugars may also down-regulate MTD expression (17). For carbohydrate is reported to be advantageous to the plant in example, transfer of cells to medium totally lacking carbohy- several ways. Celery, a C3 plant, has carbon fixation rates drates is accompanied by an initial increase in MTD activity equivalent to those of many C4 plants (8). This may result from comparable to that seen on transfer to mannitol. In addition, both increased NADP/NADPH turnover compared to plants celery cultures containing mannose plus mannitol, or sucrose that exclusively form sugars and from the additional cytosolic plus mannitol, have lower MTD activity than cultures with sink for photosynthetically fixed CO2 provided by mannitol mannitol alone (17). This suggests that sugars suppress MTD synthesis (7, 9, 10). In addition to the increased carbon fixation expression. This is consistent with Obaton's report (18) that in that accompanies mannitol biosynthesis, the initial step of flowering celery, mannitol decreased only after stored sugars mannitol utilization generates NADH, thus giving a higher net fell below 1% of dry weight. ATP yield than the catabolism of an equal amount of sucrose Given the evident potential for osmoprotection, increased (7). Finally, mannitol-producing plants also exhibit a high photosynthesis, and more efficient sink metabolism provided The publication costs of this article were defrayed in part by page charge Abbreviations: MTD, NAD-dependent mannitol dehydrogenase; PR, payment. This article must therefore be hereby marked "advertisement" in pathogenesis related; SA, salicyclic acid. accordance with 18 U.S.C. §1734 solely to indicate this fact. TTo whom reprint requests should be addressed. 7148 Downloaded by guest on October 2, 2021 Plant Biology: Williamson et al. Proc. Natl. Acad. Sci. USA 92 (1995) 7149 by mannitol metabolism, the engineering of plants with both Plasmid DNA was isolated from single colonies by using an biosynthetic and catabolic enzymes is a compelling goal. alkaline lysis miniprep (21) and digested with restriction Toward this end we isolated, sequenced, and characterized a enzymes. For both plasmid and genomic DNA blot analysis, mannitol dehydrogenase cDNA§ (Mtd) from celery cells. By restriction fragments were separated by electrophoresis on Tris using this cDNA as a probe, we analyzed the Mtd gene response acetate/EDTA/agarose gels and blotted onto nitrocellulose. to salt, carbon source, and, because of its homology to the For analysis of MTD transcript accumulation, total RNA was pathogenesis-related (PR) protein ELI3, its predicted re- isolated from celery cells in suspension culture as described sponse to salicyclic acid (SA). (26), and poly(A)+ RNA was isolated from total RNA by using oligo(dT)-cellulose chromatography (5 Prime -> 3 Prime, MATERIALS AND METHODS Inc.). Both total and poly(A)+ RNA were separated on denaturing 1.2% agarose/formaldehyde gels and transferred Plant Tissue Growth and Treatment. Celery cell suspension onto nitrocellulose. Resulting blots (both DNA and RNA) cultures used in these studies were maintained in MS medium were hybridized overnight at 65°C as described (21) with (19) with mannitol (180 mM), mannose (180 mM), or sucrose 32P-labeled 1.3-kbp Not I-Sal I insert of clone p5-4 containing (90 mM) as the sole carbon source. Relative growth rates for the entire Mtd cDNA (Fig. 1). Hybridizing bands and colonies cells maintained on these carbon sources are similar (16); however, MTD activity is highest for cells grown in mannitol. H H H A H H H H H H HH H After 14 days, cells were transferred to fresh medium contain- F H H H H FHH 13 a 4 U ing the same carbon sources and grown for 3 or 4 days as to.- q 94 Q indicated to further treatment or Sucrose-grown -A / prior harvest. W.M., i I 1 cells used in salicylate response experiments were supple- '"444- I I- I mented with either salicylic acid (to 1 mM from a 100 mM 0 200bp HC c) stock in distilled H20) or an equal volume of distilled H20 and V4 grown for an additional 24 h. At the conclusion of the various B treatments, cells were harvested by filtration, washed with CCTCTCCTATTTCATTAAACAATCTCAAATTTTTATTTTGACAATGGCGAA so distilled H20, and frozen in liquid nitrogen. Frozen tissue was M A lC 3 ATCGTCAGAAATTGAACACCCTGTCAAGGCTTTTGTCTGGCCTGCAAGGa 100 ground to a fine powder in a mortar and pestle in liquid S S I BH P V A F W A A RD 20 pep 1 150 nitrogen and stored at -80°C. ACACTACTaaTCTCCTTTCTCCGTTTAAGTTTTCCAGAAGGGCAACAGGTO Protein and Enzyme Assays. Protein extractions and MTD T T L L SP F K F S R R A T 0 37 GAGAAGGATGTGAGGCTCAAAGTTCTaTTTTGTGCAGTTTGTCATTCTGA 200 activity assays were performed as described (16). Protein BK D V R L K V L F C a V C H S D 54 pop 2 concentrations were determined by the method of Bradford TCATCACATGATCCATAATAACTGGGCTTCACCACGTATCCTATCGTTC 250 (20). Protein blot analyses of MTD in E.
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Novel Insights Into Mannitol Metabolism in the Fungal Plant
    Novel insights into mannitol metabolism in the fungal plant pathogen Botrytis cinerea Thierry Dulermo, Christine Rascle, Geneviève Billon-Grand, Elisabeth Gout, Richard Bligny, Pascale Cotton To cite this version: Thierry Dulermo, Christine Rascle, Geneviève Billon-Grand, Elisabeth Gout, Richard Bligny, et al.. Novel insights into mannitol metabolism in the fungal plant pathogen Botrytis cinerea. Biochemical Journal, Portland Press, 2010, 427 (2), pp.323-332. 10.1042/BJ20091813. hal-00479283 HAL Id: hal-00479283 https://hal.archives-ouvertes.fr/hal-00479283 Submitted on 30 Apr 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 05 Feb 2010 as manuscript BJ20091813 1 NOVEL INSIGHTS INTO MANNITOL METABOLISM IN THE FUNGAL PLANT 2 PATHOGEN BOTRYTIS CINEREA 3 4 Authors : Thierry Dulermo*†, Christine Rascle*, Geneviève Billon-Grand*, Elisabeth Gout‡, 5 Richard Bligny‡ and Pascale Cotton§ 6 7 Address 8 *Génomique Fonctionnelle des Champignons Pathogènes des Plantes, UMR 5240 9 Microbiologie, Adaptation
    [Show full text]
  • Amino Mannitol Dehydrogenases on the Azasugar Biosynthetic Pathway
    Send Orders for Reprints to [email protected] 10 Protein & Peptide Letters, 2014, 21, 10-14 Medium-Chain Dehydrogenases with New Specificity: Amino Mannitol Dehydrogenases on the Azasugar Biosynthetic Pathway Yanbin Wu, Jeffrey Arciola, and Nicole Horenstein* Department of Chemistry, University of Florida, Gainesville Florida, 32611-7200, USA Abstract: Azasugar biosynthesis involves a key dehydrogenase that oxidizes 2-amino-2-deoxy-D-mannitol to the 6-oxo compound. The genes encoding homologous NAD-dependent dehydrogenases from Bacillus amyloliquefaciens FZB42, B. atrophaeus 1942, and Paenibacillus polymyxa SC2 were codon-optimized and expressed in BL21(DE3) Escherichia coli. Relative to the two Bacillus enzymes, the enzyme from P. polymyxa proved to have superior catalytic properties with a Vmax of 0.095 ± 0.002 mol/min/mg, 59-fold higher than the B. amyloliquefaciens enzyme. The preferred substrate is 2- amino-2-deoxy-D-mannitol, though mannitol is accepted as a poor substrate at 3% of the relative rate. Simple amino alco- hols were also accepted as substrates at lower rates. Sequence alignment suggested D283 was involved in the enzyme’s specificity for aminopolyols. Point mutant D283N lost its amino specificity, accepting mannitol at 45% the rate observed for 2-amino-2-deoxy-D-mannitol. These results provide the first characterization of this class of zinc-dependent medium chain dehydrogenases that utilize aminopolyol substrates. Keywords: Aminopolyol, azasugar, biosynthesis, dehydrogenase, mannojirimycin, nojirimycin. INTRODUCTION are sufficient to convert fructose-6-phosphate into manno- jirimycin [9]. We proposed that the gutB1 gene product was Azasugars such as the nojirimycins [1] are natural prod- responsible for the turnover of 2-amino-2-deoxy-D-mannitol ucts that are analogs of monosaccharides that feature a nitro- (2AM) into mannojirimycin as shown in Fig.
    [Show full text]
  • Robust Regression Analysis of GCMS Data Reveals Differential Rewiring of Metabolic Networks in Hepatitis B and C Patients
    Article Robust Regression Analysis of GCMS Data Reveals Differential Rewiring of Metabolic Networks in Hepatitis B and C Patients Cedric Simillion 1,2, Nasser Semmo 2,3, Jeffrey R. Idle 2,3,4, and Diren Beyoğlu 2,4,* 1 Interfaculty Bioinformatics Unit and SIB Swiss Institute of Bioinformatics, University of Bern, Baltzerstrasse 6, 3012 Bern, Switzerland; [email protected] 2 Department of BioMedical Research, University of Bern, Murtenstrasse 35, 3008 Bern, Switzerland; [email protected] (N.S.); [email protected] (J.R.I.) 3 Department of Visceral Surgery and Medicine, Department of Hepatology, Inselspital, University Hospital of Bern, 3010 Bern, Switzerland 4 Division of Systems Pharmacology and Pharmacogenomics, Samuel J. and Joan B. Williamson Institute, Arnold & Marie Schwartz College of Pharmacy and Health Sciences, Long Island University, Brooklyn, 11201 New York, NY, USA * Correspondence: [email protected]; Tel.: +41-31-632-87-11 Received: 11 September 2017; Accepted: 5 October 2017; Published: 8 October 2017 Abstract: About one in 15 of the world’s population is chronically infected with either hepatitis virus B (HBV) or C (HCV), with enormous public health consequences. The metabolic alterations caused by these infections have never been directly compared and contrasted. We investigated groups of HBV-positive, HCV-positive, and uninfected healthy controls using gas chromatography-mass spectrometry analyses of their plasma and urine. A robust regression analysis of the metabolite data was conducted to reveal correlations between metabolite pairs. Ten metabolite correlations appeared for HBV plasma and urine, with 18 for HCV plasma and urine, none of which were present in the controls.
    [Show full text]
  • Role in Plant Stress Physiology and Regulation of Gene Expression
    Characterisation of selected Arabidopsis aldehyde dehydrogenase genes: role in plant stress physiology and regulation of gene expression Dissertation Zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Tagnon Dègbédji MISSIHOUN aus Cotonou, Benin Bonn, November 2010 Angefertigt mit Genehmigung der Mathematisch- Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Gedruckt mit Unterstützung des Deutschen Akademischen Austauschdienstes 1. Referentin: Prof. Dr. Dorothea Bartels 2. Koreferent: Priv. Doz. Dr. Hans-Hubert Kirch Tag der Promotion: 22. Februar 2011 Erscheinungsjahr: 2011 II DECLARATION I hereby declare that the whole PhD thesis is my own work, except where explicitly stated otherwise in the text or in the bibliography. Bonn, November 2010 ------------------------------------ Tagnon D. MISSIHOUN III DEDICATION To My wife: Fabienne TOSSOU-MISSIHOUN and our kids Floriane S. Jennifer and Sègnon Anges- Anis My parents: Lucrèce KOTOMALE and Dadjo MISSIHOUN My sister and brothers: Mariette, Marius, Ricardo, Renaud, Ulrich And my dearest aunts and uncles: Hoho, Rebecca, Cyriaque, Dominique, Alphonsine IV CONTENTS ABBREVIATIONS ...............................................................................................................................................X FIGURES AND TABLES ...............................................................................................................................XIII
    [Show full text]
  • Triacylglyceride Metabolism by Fusarium Graminearum During Colonization and Sexual Development on Wheat
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in Food Science and Technology Food Science and Technology Department 2009 Triacylglyceride Metabolism by Fusarium graminearum During Colonization and Sexual Development on Wheat John C. Guenther Michigan State University Heather E. Hallen-Adams University of Nebraska at Lincoln, [email protected] Heike Bücking South Dakota State University Yair Shachar-Hill Michigan State University Frances Trail Michigan State University, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/foodsciefacpub Part of the Food Science Commons Guenther, John C.; Hallen-Adams, Heather E.; Bücking, Heike; Shachar-Hill, Yair; and Trail, Frances, "Triacylglyceride Metabolism by Fusarium graminearum During Colonization and Sexual Development on Wheat" (2009). Faculty Publications in Food Science and Technology. 70. https://digitalcommons.unl.edu/foodsciefacpub/70 This Article is brought to you for free and open access by the Food Science and Technology Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in Food Science and Technology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. MPMI Vol. 22, No. 12, 2009, pp. 1492–1503. doi:10.1094 / MPMI -22-12-1492. © 2009 The American Phytopathological Society e-Xtra* Triacylglyceride Metabolism by Fusarium graminearum During Colonization and Sexual Development on Wheat John C. Guenther,1 Heather E. Hallen-Adams,1 Heike Bücking,2 Yair Shachar-Hill,1 and Frances Trail1,3 1Department of Plant Biology, Michigan State University, East Lansing, MI 48824, U.S.A.; 2Biology and Microbiology Department, South Dakota State University, Northern Plains Biostress, Brookings, SD 57007, U.S.A.; 3Department of Plant Biology and Department of Plant Pathology, Michigan State University, East Lansing, MI 48824, U.S.A.
    [Show full text]
  • Supplementary Table S1 List of Proteins Identified with LC-MS/MS in the Exudates of Ustilaginoidea Virens Mol
    Supplementary Table S1 List of proteins identified with LC-MS/MS in the exudates of Ustilaginoidea virens Mol. weight NO a Protein IDs b Protein names c Score d Cov f MS/MS Peptide sequence g [kDa] e Succinate dehydrogenase [ubiquinone] 1 KDB17818.1 6.282 30.486 4.1 TGPMILDALVR iron-sulfur subunit, mitochondrial 2 KDB18023.1 3-ketoacyl-CoA thiolase, peroxisomal 6.2998 43.626 2.1 ALDLAGISR 3 KDB12646.1 ATP phosphoribosyltransferase 25.709 34.047 17.6 AIDTVVQSTAVLVQSR EIALVMDELSR SSTNTDMVDLIASR VGASDILVLDIHNTR 4 KDB11684.1 Bifunctional purine biosynthetic protein ADE1 22.54 86.534 4.5 GLAHITGGGLIENVPR SLLPVLGEIK TVGESLLTPTR 5 KDB16707.1 Proteasomal ubiquitin receptor ADRM1 12.204 42.367 4.3 GSGSGGAGPDATGGDVR 6 KDB15928.1 Cytochrome b2, mitochondrial 34.9 58.379 9.4 EFDPVHPSDTLR GVQTVEDVLR MLTGADVAQHSDAK SGIEVLAETMPVLR 7 KDB12275.1 Aspartate 1-decarboxylase 11.724 112.62 3.6 GLILTLSEIPEASK TAAIAGLGSGNIIGIPVDNAAR 8 KDB15972.1 Glucosidase 2 subunit beta 7.3902 64.984 3.2 IDPLSPQQLLPASGLAPGR AAGLALGALDDRPLDGR AIPIEVLPLAAPDVLAR AVDDHLLPSYR GGGACLLQEK 9 KDB15004.1 Ribose-5-phosphate isomerase 70.089 32.491 32.6 GPAFHAR KLIAVADSR LIAVADSR MTFFPTGSQSK YVGIGSGSTVVHVVDAIASK 10 KDB18474.1 D-arabinitol dehydrogenase 1 19.425 25.025 19.2 ENPEAQFDQLKK ILEDAIHYVR NLNWVDATLLEPASCACHGLEK 11 KDB18473.1 D-arabinitol dehydrogenase 1 11.481 10.294 36.6 FPLIPGHETVGVIAAVGK VAADNSELCNECFYCR 12 KDB15780.1 Cyanovirin-N homolog 85.42 11.188 31.7 QVINLDER TASNVQLQGSQLTAELATLSGEPR GAATAAHEAYK IELELEK KEEGDSTEKPAEETK LGGELTVDER NATDVAQTDLTPTHPIR 13 KDB14501.1 14-3-3
    [Show full text]
  • Metabolomics and Molecular Approaches Reveal Drought Stress Tolerance in Plants
    International Journal of Molecular Sciences Review Metabolomics and Molecular Approaches Reveal Drought Stress Tolerance in Plants Manoj Kumar 1,* , Manish Kumar Patel 2 , Navin Kumar 3 , Atal Bihari Bajpai 4 and Kadambot H. M. Siddique 5,* 1 Institute of Plant Sciences, Agricultural Research Organization, Volcani Center, Rishon LeZion 7505101, Israel 2 Department of Postharvest Science of Fresh Produce, Agricultural Research Organization, Volcani Center, Rishon LeZion 7505101, Israel; [email protected] 3 Department of Life Sciences, Ben-Gurion University, Be’er Sheva 84105, Israel; [email protected] 4 Department of Botany, D.B.S. (PG) College, Dehradun 248001, Uttarakhand, India; [email protected] 5 The UWA Institute of Agriculture, and UWA School of Agriculture and Environment, The University of Western Australia, Perth, WA 6001, Australia * Correspondence: [email protected] (M.K.); [email protected] (K.H.M.S.) Abstract: Metabolic regulation is the key mechanism implicated in plants maintaining cell osmotic potential under drought stress. Understanding drought stress tolerance in plants will have a signif- icant impact on food security in the face of increasingly harsh climatic conditions. Plant primary and secondary metabolites and metabolic genes are key factors in drought tolerance through their involvement in diverse metabolic pathways. Physio-biochemical and molecular strategies involved in plant tolerance mechanisms could be exploited to increase plant survival under drought stress. This review summarizes the most updated findings on primary and secondary metabolites involved in drought stress. We also examine the application of useful metabolic genes and their molecular Citation: Kumar, M.; Kumar Patel, responses to drought tolerance in plants and discuss possible strategies to help plants to counteract M.; Kumar, N.; Bajpai, A.B.; Siddique, unfavorable drought periods.
    [Show full text]
  • Phytohormones Regulate Accumulation of Osmolytes Under Abiotic Stress
    biomolecules Review Phytohormones Regulate Accumulation of Osmolytes Under Abiotic Stress Anket Sharma 1,* , Babar Shahzad 2, Vinod Kumar 3 , Sukhmeen Kaur Kohli 4, Gagan Preet Singh Sidhu 5, Aditi Shreeya Bali 6, Neha Handa 7 , Dhriti Kapoor 7, Renu Bhardwaj 4 and Bingsong Zheng 1,* 1 State Key Laboratory of Subtropical Silviculture, Zhejiang A&F University, Hangzhou 311300, China 2 School of Land and Food, University of Tasmania, Hobart, Tasmania 7005, Australia 3 Department of Botany, DAV University, Sarmastpur, Jalandhar 144012, Punjab, India 4 Plant Stress Physiology Laboratory, Department of Botanical & Environmental Sciences, Guru Nanak Dev University, Amritsar 143005, India 5 Department of Environment Education, Government College of Commerce and Business Administration, Chandigarh 160047, India 6 Mehr Chand Mahajan D.A.V. College for Women, Chandigarh 160036, India 7 School of Bioengineering & Biosciences, Lovely Professional University, Phagwara 144411, India * Correspondence: [email protected] (A.S.); [email protected] (B.Z.); Tel.: +86-(0)-5716-373-0936 (B.Z.) Received: 13 June 2019; Accepted: 16 July 2019; Published: 17 July 2019 Abstract: Plants face a variety of abiotic stresses, which generate reactive oxygen species (ROS), and ultimately obstruct normal growth and development of plants. To prevent cellular damage caused by oxidative stress, plants accumulate certain compatible solutes known as osmolytes to safeguard the cellular machinery. The most common osmolytes that play crucial role in osmoregulation are proline, glycine-betaine, polyamines, and sugars. These compounds stabilize the osmotic differences between surroundings of cell and the cytosol. Besides, they also protect the plant cells from oxidative stress by inhibiting the production of harmful ROS like hydroxyl ions, superoxide ions, hydrogen peroxide, and other free radicals.
    [Show full text]
  • A Phase II Neoadjuvant Study of Apalutamide, Abiraterone Acetate, Prednisone, Degarelix and Indomethacin in Men with Localized Prostate Cancer Pre-Prostatectomy
    CC Protocol Number: 9628 PI: Michael T. Schweizer, MD Neoadjuvant therapy in high-risk Prostate Cancer Protocol Version: 4.0; March 23, 2018 A Phase II neoadjuvant study of Apalutamide, abiraterone acetate, prednisone, degarelix and indomethacin in men with localized prostate cancer pre-prostatectomy University of Washington / Seattle Cancer Care Alliance Cancer Consortium Protocol Number: 9628 IND Number: 129692 ClinicalTrials.gov: NCT02849990 Protocol Version Number: 4.0 March 23, 2018 Sponsor-Investigator / Principal Investigator: Site: Michael T. Schweizer, MD University of Washington / Seattle University of Washington / Seattle Cancer Care Alliance Cancer Care Alliance Email: [email protected] Medication Support Provided by: Biostatistician: Janssen Scientific Affairs, LLC Roman Gulati Fred Hutchinson Cancer Research Center Email: [email protected] 1 CC Protocol Number: 9628 PI: Michael T. Schweizer, MD Neoadjuvant therapy in high-risk Prostate Cancer Protocol Version: 4.0; March 23, 2018 Title: A Phase II neoadjuvant study of Apalutamide, abiraterone acetate, prednisone, degarelix and indomethacin in men with localized prostate cancer pre-prostatectomy Objectives: To assess the pathologic effects of 3-months (12 weeks) of neoadjuvant apalutamide, abiraterone acetate, degarelix and indomethacin in men with localized prostate cancer pre-prostatectomy. Study Design: Open label, single-site, Phase II study designed to determine the pathologic effects that 3-months (12 weeks) of neoadjuvant therapy has on men with localized prostate cancer. Primary Center: University of Washington/Seattle Cancer Care Alliance Participating Institutions: 1 site in the United States. Medication Support: Janssen Scientific Affairs, LLC Timeline: This study is planned to complete enrollment in one year, with 2-years of additional follow up following accrual of the last subject.
    [Show full text]
  • Purification of A-Raf and Structural Studies of Mannitol Dehydrogenase
    Purification of A-Raf and Structural Studies of Mannitol Dehydrogenase A Thesis Submitted to the College of Graduate Studies and Research in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Department of Biochemistry University of Saskatchewan Saskatoon By Jennifer Puttick © Copyright Jennifer Puttick, September 2008. All rights reserved. Copyright Note I hereby grant the University of Saskatchewan and/or its agents the non-exclusive license to archive and make accessible, under the conditions specified below, my thesis, dissertation, or project report in whole or in part in all forms of media, now or for the duration of my copyright ownership. I retain all other ownership rights to the copyright of the thesis, dissertation or project report. I also reserve the right to use in future works (such as articles or books) all or part of this thesis, dissertation, or project report. I hereby certify that, if appropriate, I have obtained and attached hereto a written permission statement from the owner(s) of each third party copyrighted matter that is included in my thesis, dissertation, or project report, allowing distribution as specified below. I certify that the version I submitted is the same as that approved by my advisory committee. i Abstract The work herein describes the research of two separate projects: the purification of A- Raf and the crystallization and X-ray diffraction of Thermotoga maritima mannitol dehydrogenase (TmMtDH). A-Raf is a one of three Raf isoforms of serine/threonine kinases involved in the mitogen-activated protein kinase (MAPK) pathway, a cell proliferation pathway that has been associated with many cancers.
    [Show full text]
  • (Mtdh) from Caldicellulosiruptor Hydrothermalis 108 for D-Mannitol Synthesis
    separations Article Promising Pathway of Thermostable Mannitol Dehydrogenase (MtDH) from Caldicellulosiruptor hydrothermalis 108 for D-Mannitol Synthesis Marwa Y. F. Koko 1,*, Rokayya Sami 2 , Bertrand Muhoza 1, Ebtihal Khojah 2 and Ahmed M. A. Mansour 3 1 Department of Food, Grease and Vegetable Protein Engineering, School of Food Science, Northeast Agricultural University, Harbin 150030, China; [email protected] 2 Department of Food Science and Nutrition, College of Sciences, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia; [email protected] (R.S.); [email protected] (E.K.) 3 Department of Biotechnology, Faculty of Science, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia; [email protected] * Correspondence: [email protected] Abstract: In this study, we conducted the characterization and purification of the thermostable man- nitol dehydrogenase (MtDH) from Caldicellulosiruptor hydrothermalis 108. Furthermore, a coupling- enzyme system was designed using (MtDH) from Caldicellulosiruptor hydrothermalis 108 and formate dehydrogenase (FDH) from Ogataea parapolymorpha. The biotransformation system was constructed using Escherichia coli whole cells. The purified enzyme native and subunit molecular masses were Citation: Koko, M.Y.F.; Sami, R.; 76.7 and 38 kDa, respectively, demonstrating that the enzyme was a dimer. The purified and couple Muhoza, B.; Khojah, E.; Mansour, enzyme system results were as follows; the optimum pH for the reduction and the oxidation was ◦ A.M.A. Promising Pathway of 7.0 and 8.0, the optimum temperature was 60 C, the enzyme activity was inhibited by EDTA and Thermostable Mannitol restored by zinc. Additionally, no activity was detected with NADPH and NADP.
    [Show full text]