DOCSLIB.ORG

The Complete Mitogenome of Bombyx Mori Strain Dazao (Lepidoptera: Bombycidae) and Comparison with Other Lepidopteran Insects

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Complete Mitogenome of Bombyx Mori Strain Dazao (Lepidoptera: Bombycidae) and Comparison with Other Lepidopteran Insects View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 101 (2013) 64–73 Contents lists available at SciVerse ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno The complete mitogenome of Bombyx mori strain Dazao (Lepidoptera: Bombycidae) and comparison with other lepidopteran insects Qiu-Ning Liu 1, Bao-Jian Zhu 1, Li-Shang Dai, Chao-Liang Liu ⁎ College of Life Science, Anhui Agricultural University, 130 Changjiang West Road 230036, PR China article info abstract Article history: The complete mitochondrial genome (mitogenome) of Bombyx mori strain Dazao (Lepidoptera: Bombycidae) Received 31 August 2012 was determined to be 15,653 bp, including 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes Accepted 6 October 2012 and a A+T-rich region. It has the typical gene organization and order of mitogenomes from lepidopteran in- Available online 13 October 2012 sects. The AT skew of this mitogenome was slightly positive and the nucleotide composition was also biased toward A+T nucleotides (81.31%). All PCGs were initiated by ATN codons, except for cytochrome c oxidase Keywords: subunit 1 (cox1) gene which was initiated by CGA. The cox1 and cox2 genes had incomplete stop codons Mitochondrial genome Lepidoptera consisting of just a T. All the tRNA genes displayed a typical clover-leaf structure of mitochondrial tRNA. Bombyx mori The A+T-rich region of the mitogenome was 495 bp in length and consisted of several features common Phylogeny to the lepidopteras. Phylogenetic analysis showed that the B. mori Dazao was close to Bombycidae. © 2012 Elsevier Inc. All rights reserved. 1. Introduction phylogenetic analyses to the selected species from Lepidoptera, Orthoptera and Diptera based on the mitogenome sequences were Insect mitogenome DNA (mtDNA) is a circular molecule with performed using the neighbor-joining (NJ) method. 14–19 kb in length and contains 13 protein coding genes (PCGs), sub- units 6 and 8 of the ATPase (atp6 and atp8), cytochrome c oxidase subunits 1–3(cox1-cox3), cytochrome B (cob), NADH dehydrogenase Table 1 The complete mitochondrial genome of Lepidoptera. subunits 1–6 and 4 L (nad1-6 and nad4L), two ribosomal RNA genes encoding the small and large subunit rRNAs (rrnL and rrnS), 22 trans- Species Length (bp) Accession number References fer RNA (tRNA) genes and a A+T-rich region which contains initia- Bombyx mori Dazao 15, 653 This study tion sites for transcription and replication [1–3]. Mitochondrial DNA Bombyx mori Xiafang 15, 664 AY048187 [4] has been widely used as an informative molecular marker for diverse Bombyx mori C108 15, 656 AB070264 [5] Japanese Bombyx mandarina 15, 928 NC_003395 [5] evolutionary studies among species [3]. Chinese Bombyx mandarina 15, 682 AY301620 [6] Although Lepidoptera is the 2nd most numerous order of insects, only Antheraea pernyi 15, 575 AY242996 [7] a few complete or near-complete mitogenomes are currently available in Antheraea yamamai 15, 338 EU726630 [8] GenBank (Table 1). The silk-producing insects with economic value in Eriogyna pyretorum 15, 327 FJ685653 [9] Lepidoptera belong to two families of moth, Bombycidae and Saturniidae. Samia cynthia ricini 15, 366 JN215366 [10] Actias selene 15, 236 JX186589 [11] The complete mitogenomes of three species of Bombycidae and six spe- Caligula boisduvalii 15, 360 NC_010613 [12] cies of Saturniidae were sequenced: Bombyx mori Xiafang [4], Bombyx Manduca sexta 15, 516 EU286785 [13] mori C108 [5], Japanese B. mandarina [5] and Chinese B. mandarina [6] be- Hyphantria cunea 15, 481 GU592049 [14] longing to family Bombycidae; Antheraea pernyi [7], Antheraea yamamai Helicoverpa armigera 15, 347 GU188273 [15] Ochrogaster lunifer 15, 593 AM946601 [16] [8], Eriogyna pyretorum [9], Samia cynthia ricini [10], Actias selene [11] Ostrinia nubilalis 14, 535 NC_003367 [17] and Caligula boisduvalii [12] belonging to the family Saturniidae. Chilo suppressalis 15, 456 HQ860290 [18] Bombyx mori strain Dazao, a member of the Bombycidae family, Diatraea saccharalis 15,490 FJ240227 [19] is an important model organism and used as a bioreactor for the Phthonandria atrilineata 15, 499 EU569764 [20] production of recombinant proteins [28]. In the present study, the Adoxophyes honmai 15, 680 DQ073916 [21] Grapholita molesta 15, 776 HQ116416 [22] complete mitogenome of B. mori strain Dazao was sequenced. The Spilonota lechriaspis 15, 368 HM204705 [23] Artogeia melete 15, 140 EU597124 [24] Coreana raphaelis 15, 314 NC_007976 [25] ⁎ Corresponding author. Fax: +86 551 5786201. Acraea issoria 15, 245 GQ376195 [26] E-mail address: [email protected] (C.-L. Liu). Fabriciana nerippe 15, 140 JF504707 [27] 1 These authors contributed equally to this work. 0888-7543/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygeno.2012.10.002 Q.-N. Liu et al. / Genomics 101 (2013) 64–73 65 Table 2 2.2. PCR amplification and sequencing Primers used for amplification of the mitogenome of B. mori Dazao. Primer pair Primer sequence (5′→3′) For amplification of the entire mitogenome of B. mori strain Dazao, nine primer sets were designed according to the conserved nucleo- F1 GCTTTTGGGCTCATACCTCA R1 GATGAAATACCTGCAAGATGAAG tide sequences of known mitochondrial sequences from Lepidoptera F2 TGGAGCAGGAACAGGATGAAC insects [4–12] and synthesized in Sunbiotech Co., Ltd. (Beijing, R2 GAGACCADTACTTGCTTTCAG China) (Table 2). The fragments were amplified using Aidlab Taq Kit F3 ATTTGTGGAGCTAATCATAG (Aidlab Co., Beijing, China) according to the manufacturer's instruc- R3 GGTCAGGGACTATAATCTAC F4 TCGACCTGGAACTTTAGC tions. The PCR was performed under the following conditions: R4 GCAGCTATAGCCGCTCCTACT 3 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 1–3 min at F5 TAAAGCAGAAACAGGAGTAG 55–60 °C, 10 min at 72 °C. The PCR products were separated by aga- R5 ATTGCGATATTATTTCTTTTG rose gel electrophoresis (1% w/v) and purified using a DNA gel extrac- F6 ACATTCTTAGGTGGATTA tion kit (Aidlab Co., Beijing, China). The purified PCR products were R6 GTTAAAGTGGCATTATCT F7 GGAGCTTCTACATGAGCTTTTGG ligated into the T-vector (TaKaRa Co., Dalian, China) and sequenced R7 GTTTGCGACCTCGATGTTG at least three times at Sunbiotech Co., Ltd., (Beijing, China). F8 GGTCCCTTACGAATTTGAATATATCCT R8 AAACTAGGATTAGATACCCTATTAT 2.3. Sequence assembly and gene annotation F9 CTCTACTTTGTTACGACTTATT R9 TCTAGGCCAATTCAACAACC Sequence annotation was performed using the blast tools in NCBI web site (http://blast.ncbi.nlm.nih.gov/Blast)andDNAStarpackage 2. Materials and methods (DNAStar Inc. Madison, USA). Identification of tRNA genes was verified using the tRNAscan-SE program. The potential stem–loop secondary 2.1. DNA extraction structures within these tRNA gene sequences were calculated using the tRNAscan-SE Search Server (http://lowelab.ucsc.edu/tRNAscan-SE/) The silkworm strain Dazao was maintained in our laboratory. All [29]. The secondary structures of tRNA genes that could not be predicted larvae were fed with fresh mulberry leaves under normal conditions. using the tRNAscan-SE were analyzed by comparison with the Total DNA was isolated from the third day of fifth instar larvae using nucleotide sequences of other insect tRNA sequences [4–12].The the Aidlab Genomic DNA Extraction Kit (Aidlab Co., Beijing, China) PCGs were identified by sequence similarity with B. mori C108 [5]. according to the manufacturer's instructions. Extracted DNA was The nucleotide sequences of PCGs were translated with the inverte- used for PCR amplification of the complete mitogenome. brate mitogenome genetic code. Alignments of PCGs from various Fig. 1. Map of the mitogenome of B. mori strain Dazao. tRNA genes are labeled according to the IUPAC-IUB. Single letter amino acids above the bar indicate coding sequence on major strand whereas below the bar indicates coding on minor strand. Anti-clockwise PCGs or rRNA genes are located on L strand and others are located on H strand. 66 Q.-N. Liu et al. / Genomics 101 (2013) 64–73 lepidopteran mitogenomes were performed using Clustal X [30]. A+T-rich region (Fig. 1). The order of genes and the orientation of Composition skewness was calculated according to the formulas: the mitogenome of B. mori Dazao are identical to the sequenced lep- AT skew=[A− T]/[A+T]; GC skew=[G− C]/[G+ C] [31].Tandem idopteran mitogenomes. The placement of the trnM tRNA gene in repeats in the A+ T-rich region were predicted using the Tandem the B. mori Dazao mitogenome differs from the ancestral gene order Repeats Finder program (http://tandem.bu.edu/trf/trf.html) [32]. observed in insects. The ancestral order is: A+T-rich region, trnI, trnQ, trnM, nad2 [39]. The placement of trnM may therefore represent 2.4. Phylogenetic analysis a molecular feature exclusive to lepidopteran mtDNAs [3,37]. The nu- cleotide composition of the mitogenome of B. mori Dazao is: A=6732 To reconstruct the phylogenetic relationship among lepidopteran (43.01%), T=5995 (38.30%), G=1154 (7.37%) and C=1772 insects, the complete mitogenomes of 26 lepidopteran species were (11.32%). As observed in other lepidopterans, the nucleotide compo- obtained from the GenBank database (Table 1). These mitogenomes sition of the B. mori Dazao mitogenome is biased toward A+T were divided into 11 lepidopteran superfamilies within the lepidopter- (81.31%) (Table 4). an suborder. The mitogenomes of Locusta migratoria (NC_001712), Drosophila yakuba (NC_001322) and Anopheles gambiae (NC_002084) were used as outgroups [33–35]. The amino acid sequences of each of 3.2. Overlapping and intergenic spacer regions the 13 mitochondrial PCGs were aligned using default settings and concatenated. The concatenated set of amino acid sequences from the The B. mori Dazao mitogenome has a total of 31 bp overlap be- 13 PCGs was used in phylogenetic analysis, which was performed using tween genes in eight locations. Two longest eight nucleotides over- neighbor-joining (NJ) method with the MEGA version 5.0 program [36]. laps located between trnW and trnC as well as trnF and nad5 were found (Table 3), however, the eight nucleotides overlap between 3.
Load more

Recommended publications
  • Hatay Yellow Strain (Bombyx Mori L.) Under the Threat of Extinction: Determination of Morphological and Biological Features with Some Reviews
    Mustafa Kemal Üniversitesi Tarım Bilimleri Dergisi 26 (2):266-271, 2021 (Mustafa Kemal University Journal of Agricultural Sciences 26 (2):266-271, 2021) e-ISSN: 2667-7733 http://dergipark.org.tr/mkutbd ARAŞTIRMA MAKALESİ RESEARCH ARTICLE Hatay yellow strain (Bombyx mori L.) under the threat of extinction: Determination of morphological and biological features with some reviews İpekböcekçiliğinde yok olma tehditi altında olan Hatay sarısı ırkı (Bombyx mori L.): Bazı incelemelerle morfolojik ve biyolojik özelliklerinin belirlenmesi Başak ULAŞLI1 , Berna İLERİ2 , Feza CAN1 1Hatay Mustafa Kemal University, Faculty of Agriculture, Department of Plant Protect, Antakya-Hatay, Turkey. 2Canakkale Onsekiz Mart University, Faculty of Fine Arts, Department of Textile and Fashion Design, Çanakkale, Turkey. MAKALE BİLGİSİ / ARTICLE INFO Ö Z E T / A B S T R A C T Makale tarihçesi / Article history: Aims: Throughout the history silk fiber is one of the indispensable and DOI: 10.37908/mkutbd.860085 most valuable textile products. Hatay yellow strain, is an indigenous to Geliş tarihi /Received:13.01.2021 Turkey, was domesticated about 5000 years ago and it’s a privilege to have Kabul tarihi/Accepted:04.03.2021 this moth species in our country. In sericulture, the only hibrid strain that weave white coccon has been bred for many years in our country. Keywords: Bombyx mori, Hatay yellow However, Hatay yellow hasn’t been bred for nearly 45 years. In this study, strain, peace silk, biology, Turkey. it is aimed to investigate some morphological and biological characteristics of the Hatay yellow which is facing the danger of extinction. Corresponding author: Başak ULAŞLI Methods and Results: The development of 1000 first-stage larvae with : [email protected] hatching from the eggs in March, which are cultured in the natural habitat under the climate-appropriate lighting time, temperature and humidity conditions in Harbiye district of Hatay province in 2020; the period of five larvae stages, molting four times, coccon period and moth emergence from the cocoons were observed.
    [Show full text]
  • ILLUSTRATIONS of MOTHS in TAIWAN, 1-5 by B. S. Chang
    142 BOOK REVIEW TROPICAL LEPIDOPTERJ Tropical Lepidoptera, 4(2): 142 BOOK REVIEW ILLUSTRATIONS OF MOTHS IN TAIWAN, 1-5 by B. S. Chang Vol. 1: Sphingidae, Ratardidae. Epipyropidae, Drepanidae, Cyclidiidae, Thyatiridae, Epicopeiidae, Callidulidae. Lasiocampidae. EupterotidJ Bombycidae, Brahmaeidae, Agaristidae [Noctuidae, part]. 242 pp, 271 col. fig., col. cover. 1989. (paper only) Vol. 2: Arctiidae, Hypsidae [Noctuidae, part], Limacodidae, Notodontidae. 310 pp, 356 col. fig., col. cover. 1989. Vol. 3: Geometridae [1]. Oenochrominae, Geometrinae, Sterrhinae, Larentiinae. 350 pp, 405 col. fig., col. cover. 1989. Vol. 4: Geometridae [2]. Ennominae. 480 pp, 684 col. fig., col. cover. 1990. Vol. 5: Noctuidae [1]. 366 pp. 572 col. fig., col. cover. 1991. (paper only) 1989-91. Taiwan Museum, Taipei. All are 21 x 18.5 cm. (elongate) In Chinese; Latin names. Price for each is S35.00 paper, S42.00 cloth. Available from Flora & Fauna Books, P. O. Box 15718, Gainesville, FL 32604 (plus S2 shipping each, or 55 per set). This series of small, full-color books is the result of a lifetime of with 706 species illustrated out of the 791 recorded for Taiwan. TlJ collecting by retired Taiwan high school teacher B. S. Chang. Until color figures are all excellent but many of the wing venation drawing 1991, 5 volumes were completed, but the second part of the Noctuidae are very faintly reproduced in the books. has unfortunately been halted by the untimely death of the author. It is Overall, the books are one of the unique treatments of Lepidoptera ii not known if a manuscript is available for the eventual completion of the world.
    [Show full text]
  • Scanning Electron Microscope (SEM) Studies on the Egg Ultrastructure of Some Wild Silk Moths Collected from Meghalaya, North-East India
    International Journal of Science and Research (IJSR) ISSN: 2319-7064 ResearchGate Impact Factor (2018): 0.28 | SJIF (2019): 7.583 Scanning Electron Microscope (SEM) Studies on the Egg Ultrastructure of Some Wild Silk Moths Collected from Meghalaya, North-East India Shangpliang Jane Wanry Department of Zoology, Assam Don Bosco University, Tapesia Sonapur Assam India Abstract: Scanning electron microscopy of the eggs of nine species of wild silkmoths belonging to the family Saturniidae has been studied. These species include: Samiaricini (Boisduval, 1854), Samiacanningi (Hutton, 1860), Actiasselene (Hubner, 1807), Antheraeaassamensis (Helfer, 1837) A. royleiMoore, 1859, Caligula simla (Westwood, 1847) C. thibeta Westwood, 1853, Leopakatinka Westwood, 1848 and Rhodinianewara Moore, 1872. These eggs of the moths exhibit different colours and shapes and the study revealed the different patterns of structural elements occurring in these silkmoths. The surface of the chorion had a reticulate pattern of pentagonal and hexagonal cells which also differs among the species studied. The present investigation shows oval main cells, aeropyles and micropylar rosette throughout the egg surface. Keywords: wild silkmoths, Saturniidae, Scanning electron microscope, chorion 1. Introduction Hinton 1969 used scanning electron micrographs to illustrate respiratory systems of various insect eggshells. SEM studies Insect eggs show a characteristic feature by the presence of of the egg has revealed the egg surface to be regionally an outer shell. This outer shell is secreted by the follicular differentiated (Kafatos et al 1977, Margaritis et al 1980) also epithelium during the process of egg formation (Kumar et al allowing a better distinction between closely related species 2007). The structure of insect egg shell are quite complex than by Light Microscopy (LM) (Arbogast et al 1980).
    [Show full text]
  • 1996 No. 4 December
    TROPICAL LEPIDOPTERA NEWS December 1996 No.4 LEPIDOPTERORUM CATALOGUS (New Series) The new world catalog of Lepidoptera renews the series title The new series (as edited by J. B. Heppner) began already in first begun in 1911. The original catalog series was published by 1989 with publication of the catalog of Noctuidae, by R. Poole. W. Junk Publishers of Berlin, Germany (later The Hague, E. J. Brill Publishers, of Leiden, Netherlands, published this first Netherlands), continuing until 1939 when the incomplete series fascicle in 3 volumes, covering already about a third of all known was deactivated due to World War II. The original series Lepidoptera. Since ATL took over the series, several families completed a large number of families between 1911 and 1939, have been readied for publication. Already this month, Fascicle totalling about 3 shelf-feet of text. Most Microlepidoptera, 48, on Epermeniidae, was published (authored by R. Gaedike, of however, were not covered, as also several macro families like the Deutsches Entomologisches Institut, Eberswalde, Germany). Noctuidae, and several families are incomplete (e.g., Geometridae In 1997, several other smaller families are expected, including and Pyralidae). Even for what was treated, the older catalogs are Acanthopteroctetidae (Davis), Acrolepiidae (Gaedike), Cecidosi­ now greatly out of date, due to the description of many new dae (Davis), Cercophanidae (Becker), Glyphipterigidae (Heppner), species and many changes in nomenclature over the last 5 to 8 Neotheoridae (Kristensen), Ochsenheimeriidae (Davis), Opostegi­ decades. dae (Davis), and Oxytenidae (Becker). Much of the publication The new series resembles the old series in some ways but it schedule depends on the cooperation of various specialists who will also have features not found in the old work.
    [Show full text]
  • Genetic Divergence and Voltinism's Expression in Silkworm
    Available online at www.ijpab.com Haghighi and Kumar Int. J. Pure App. Biosci. 4 (4): 255-263 (2016) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.2352 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 4 (4): 255-263 (2016) Research Article Genetic Divergence and Voltinism’s Expression in Silkworm: Revealed through DNA Barcoding Maryam Talebi Haghighi* and T.S. Jagadeesh Kumar Department of Studies in Sericulture Science, Department of Studies in Biotechnology University of Mysore, Manasagangothri, Mysore, India *Corresponding Author E-mail: [email protected] Received: 10.08.2016 | Revised: 16.08.2016 | Accepted: 19.08.2016 ABSTRACT The phylogenetic relationships between bivoltine and polyvoltine silkworm B. mori strains were examined sequencing~520-bp of mitochondrial gene cytochrome c oxidase I (mtCOI). Multiple alignments of the sequences ascertained the probability of Transition/Transversion substitutions. The percentage of A+T content was higher than that of C+G region. Maximum likelihood (ML) analysis clustered four strains into two major groups and accurately segregated them according to their voltinism inheritance. The open reading frames of the gene were found exhibited the strain-specificity indicating their geographical origin. The protein coding sequence identified which commenced with 4-bp TTAG putative initiator codon. The outcome suggested the mtCOI gene has not only crucial task in learning the evolutionary evidences but it can also be characterized as a bar-coding marker for revealing voltinism’s expression and genetic variation in the silkworm, discriminating their genotype based on COI gene nucleotide versatilities. The study was fruitful as we noticed prominent intra -specific versatility among B.
    [Show full text]
  • Bombyx Mori L.) and Wild Silkworm (Bombyx Mandarina M.) to Phoxim Insecticide
    African Journal of Biotechnology Vol. 9(12), pp. 1771-1775, 22 March, 2010 Available online at http://www.academicjournals.org/AJB ISSN 1684–5315 © 2010 Academic Journals Full Length Research Paper Resistance comparison of domesticated silkworm (Bombyx mori L.) and wild silkworm (Bombyx mandarina M.) to phoxim insecticide Bing Li1,2, Yanhong Wang2, Haitao Liu2, YaXiang Xu1,2, Zhengguo Wei1,2, YuHua Chen1,2 and Weide Shen1,2 1National Engineering Laboratory for Modern Silk, Soochow University 215123, Suzhou, China. 2School of Basic Medicine and Biological Sciences, Soochow University 215123, Suzhou, China. Accepted 11 March, 2010 In this study, the resistance difference to phoxim between Bombyx mori L. and Bombyx mandarina M was investigated. For the both silkworm species, the whole body of each larval were collected, and on the third day of the 5th instar, the brain, midgut, fat bodies, and silk gland were collected for enzymatic activity assay of acetylcholinesterase (AChE). Our results showed that in the early larval stages, the resistance difference to phoxim was not significant between the two species. However, in the 4th and 5th instar, the resistance differences showed significant increase. When compared to B. mori L, the LC50 of B. mandarina was 4.43 and 4.02-fold higher in the 4th and 5th instar, respectively. From the 1st to 5th instar, the enzymatic activities of AChE of B. mandarina were 1.60, 1.65, 1.81, 1.93 and 2.28-fold higher than that of B. mori, respectively. For the brain, midgut, fat body, and silk gland on the third day of the 5th instar, the enzymatic activity ratios of B.
    [Show full text]
  • Influence of Habitat and Bat Activity on Moth Community Composition and Seasonal Phenology Across Habitat Types
    INFLUENCE OF HABITAT AND BAT ACTIVITY ON MOTH COMMUNITY COMPOSITION AND SEASONAL PHENOLOGY ACROSS HABITAT TYPES BY MATTHEW SAFFORD THESIS Submitted in partial fulfillment of the requirements for the degree of Master of Science in Entomology in the Graduate College of the University of Illinois at Urbana-Champaign, 2018 Urbana, Illinois Advisor: Assistant Professor Alexandra Harmon-Threatt, Chair and Director of Research ABSTRACT Understanding the factors that influence moth diversity and abundance is important for monitoring moth biodiversity and developing conservation strategies. Studies of moth habitat use have primarily focused on access to host plants used by specific moth species. How vegetation structure influences moth communities within and between habitats and mediates the activity of insectivorous bats is understudied. Previous research into the impact of bat activity on moths has primarily focused on interactions in a single habitat type or a single moth species of interest, leaving a large knowledge gap on how habitat structure and bat activity influence the composition of moth communities across habitat types. I conducted monthly surveys at sites in two habitat types, restoration prairie and forest. Moths were collected using black light bucket traps and identified to species. Bat echolocation calls were recorded using ultrasonic detectors and classified into phonic groups to understand how moth community responds to the presence of these predators. Plant diversity and habitat structure variables, including tree diameter at breast height, ground cover, and vegetation height were measured during summer surveys to document how differences in habitat structure between and within habitats influences moth diversity. I found that moth communities vary significantly between habitat types.
    [Show full text]
  • Lepidoptera: Noctuoidea: Erebidae) and Its Phylogenetic Implications
    EUROPEAN JOURNAL OF ENTOMOLOGYENTOMOLOGY ISSN (online): 1802-8829 Eur. J. Entomol. 113: 558–570, 2016 http://www.eje.cz doi: 10.14411/eje.2016.076 ORIGINAL ARTICLE Characterization of the complete mitochondrial genome of Spilarctia robusta (Lepidoptera: Noctuoidea: Erebidae) and its phylogenetic implications YU SUN, SEN TIAN, CEN QIAN, YU-XUAN SUN, MUHAMMAD N. ABBAS, SAIMA KAUSAR, LEI WANG, GUOQING WEI, BAO-JIAN ZHU * and CHAO-LIANG LIU * College of Life Sciences, Anhui Agricultural University, 130 Changjiang West Road, Hefei, 230036, China; e-mails: [email protected] (Y. Sun), [email protected] (S. Tian), [email protected] (C. Qian), [email protected] (Y.-X. Sun), [email protected] (M.-N. Abbas), [email protected] (S. Kausar), [email protected] (L. Wang), [email protected] (G.-Q. Wei), [email protected] (B.-J. Zhu), [email protected] (C.-L. Liu) Key words. Lepidoptera, Noctuoidea, Erebidae, Spilarctia robusta, phylogenetic analyses, mitogenome, evolution, gene rearrangement Abstract. The complete mitochondrial genome (mitogenome) of Spilarctia robusta (Lepidoptera: Noctuoidea: Erebidae) was se- quenced and analyzed. The circular mitogenome is made up of 15,447 base pairs (bp). It contains a set of 37 genes, with the gene complement and order similar to that of other lepidopterans. The 12 protein coding genes (PCGs) have a typical mitochondrial start codon (ATN codons), whereas cytochrome c oxidase subunit 1 (cox1) gene utilizes unusually the CAG codon as documented for other lepidopteran mitogenomes. Four of the 13 PCGs have incomplete termination codons, the cox1, nad4 and nad6 with a single T, but cox2 has TA. It comprises six major intergenic spacers, with the exception of the A+T-rich region, spanning at least 10 bp in the mitogenome.
    [Show full text]
  • 2 Life Table Studies of Trilocha Virescence
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Directory of Open Access Journals Asian J Agri Biol, 2013, 1(1):2-7. LIFE TABLE STUDIES OF TRILOCHA VIRESCENCE (BOMBYCIDAE: LEPIDOPTERA) ON FICUS NITIDA Muhammad Asif Aziz 1, Ayesha Iftkhar 1 and Muhammad Hanif 2 1Department of Entomology, PMAS-Arid Agriculture University Rawalpindi, Pakistan 2Department of Mathematics and Statistics, PMAS-Arid Agriculture University Rawalpindi, Pakistan ABSTRACT The life table of Trilocha virescence was constructed in the laboratory which is a serious Lepidopterous pest of Ficus nitida . The study declared different impact of larval and adult mortality on the population. Pre reproductive mortality was 30% and 70 percent of the individuals’ survived up to the maturity and took part in reproduction. Larval mortality was greater in 1 st instar than all other stages. No mortality was observed in 4 th and 5 th larval instar in subsequent stages. High mortality during 1 st instar may exert significant negative effect on the insect population and may be best used for applying control tactics. The net reproductive rate of the insect was 45.44 per individual per generation. Keywords: Trilocha virescence , stage specific, cohort, life table, life expectancy, mortality rate, survivorship INTRODUCTION revealing the maximal growth potential of a population (Gabre et al, 2004). Life tables used Computing life tables is a fairly current can make quantitatively and qualitatively approach used by entomologists to study the evaluation of various host plants insects’ population dynamics. With the recent (Ambegaonkar and Bilapate, 1981). emphasis on population dynamic studies of Two kinds of life tables have been developed: insects, the usefulness of life table in this area (1).
    [Show full text]
  • EUROPEAN JOURNAL of ENTOMOLOGYENTOMOLOGY ISSN (Online): 1802-8829 Eur
    EUROPEAN JOURNAL OF ENTOMOLOGYENTOMOLOGY ISSN (online): 1802-8829 Eur. J. Entomol. 113: 482–488, 2016 http://www.eje.cz doi: 10.14411/eje.2016.063 ORIGINAL ARTICLE The mitochondrial genome of the Mediterranean fl our moth, Ephestia kuehniella (Lepidoptera: Pyralidae), and identifi cation of invading mitochondrial sequences (numts) in the W chromosome KATRIN LÄMMERMANN 1, 3, HEIKO VOGEL 2 and WALTHER TRAUT 3, * 1 Universität zu Lübeck, Institut für Neuro- und Bioinformatik, Ratzeburger Allee 160, D-23538 Lübeck, Germany; e-mail: [email protected] 2 Max Planck Institute for Chemical Ecology, Department of Entomology, Hans-Knoell-Strasse 8, D-07745 Jena, Germany; e-mail: [email protected] 3 Universität zu Lübeck, Zentrum für Medizinische Strukturbiologie, Institut für Biologie, Ratzeburger Allee 160, D-23538 Lübeck, Germany; e-mail: [email protected] Key words. Lepidoptera, Pyralidae, Ephestia kuehniella, mitogenome, Mediterranean fl our moth, phylogeny, numts, W chromosome Abstract. The Mediterranean fl our moth, Ephestia kuehniella is a widespread pest of stored products and a classical object in experimental biology. In the present study, we determined its complete mitochondrial genome sequence. The genome is circular, consists of 15,327 bp and comprises 13 protein-coding, 2 rRNA- and 22 tRNA-coding genes in an order typical for the Ditrysia clade of the order Lepidoptera. A phylogenetic study of the Lepidoptera based on complete mitochondrial genomes places E. kuehniella correctly in the family Pyralidae and supports major lepidopteran taxa as phylogenetic clades. The W chromosome of E. kuehniella is an exceptionally rich reservoir of originally mitochondrial sequences (numts). Around 0.7% of the W DNA was found to be of mitochondrial origin, 83% of the mitogenome sequence was represented between 1–11 × in the W chromosome.
    [Show full text]
  • Lepidoptera: Saturniidae) 127-143 Nachr
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Nachrichten des Entomologischen Vereins Apollo Jahr/Year: 2010 Band/Volume: 31 Autor(en)/Author(s): Naumann Stefan, Nässig Wolfgang A. Artikel/Article: Two species in Saturnia (Rinaca) zuleika Hope, 1843 (Lepidoptera: Saturniidae) 127-143 Nachr. entomol. Ver. Apollo, N. F. 31 (3): 127–143 (2010) 127 Two species in Saturnia (Rinaca) zuleika Hope, 1843 (Lepidoptera: Saturniidae) 1 2 Stefan Naumann and Wolfgang A. Nässig Dr. Stefan Naumann, Hochkirchstrasse 71, D­10829 Berlin, Germany; [email protected] Dr. Wolfgang A. Nässig, Entomologie II, Forschungsinstitut Senckenberg, Senckenberganlage 25, D­60325 Frankfurt am Main, Germany; wolfgang.naessig@ senckenberg.de Abstract: The type locality for Saturnia zuleika Hope, different populations in the group, but only hesitated to 1843 as reported in the original description (“Silhet”) is describe them at the species level. We also uncovered a evident ly erroneous; the same probably being the case for misidentified type lo ca li ty, which might also have been Salassa lola (West wood, 1847). Based on the illustration in the ori gin al de scrip tion and possible syntype material, the responsible for the hesi ta tion of earlier authors. taxon was apparently describ ed from Himalayan material Saturnia zuleika was described by Hope (1843: 132, pl. (prob ab ly from the Dar ji ling area) bearing wrong locality XI, fig. 5) stating that it came from “Silhet”. Hope’s new data. The populations from all extra­Hi ma lay an localities belong to a different spe cies, Saturnia (Ri na ca) lesoudieri species was illustrated; this drawing is reproduced here Le Moult, 1933.
    [Show full text]
  • Denver Museum of Natural History
    PROCEEDINGS OF THE Denver Museum of Natural History SERIES 3, NUMBER 3, OCTOBER 15, 1993 A REVIEW OF THE GENUS AGAPEMA (LEPIDOPTERA: SATURNIIDAE) RICHARD S. PEIGLER Department of Zoology, Denver Museum of Natural History 2001 Colorado Boulevard, Denver, Colorado 80205-5798 and ROY O. KENDALL 5598 Mt. McKinley Drive N.E. San Antonio, Texas 78251-3626 ABSTRACT — Agapema is a genus of saturniid moths ranging in Mexico and the southwestern United States. Agapema galbina, the type-species, was found to be misidenti- fied by authors during the last 21 years. John Pope collected the original type specimens in the lower Rio Grande Valley of Texas, not in western Texas. Agapema platensis, spec. nov., is described from the Edwards Plateau of Texas. Four taxa in far western Texas (dyari, nom. rev.), Arizona and western Mexico (anona, stat. rev.), Baja California (pelora, stat. nov.) and northeastern Mexico (dentifasciata, stat. nov.), previously considered to he subspecies of galbina, are elevated to full species rank based on larval and genitalic dif- ferences. The female and mature larva of dentifasciata and mature larvae of dyari and platensis are described for the first time. Figures and a key to the adult moths are pro- vided. The distribution of each species is plotted on a map. All known records for host- plants and parasitoids are tabulated, and phylogeny, habitats, and other field observa- tions are discussed. KEYWORDS: Agapema, Arizona, Colorado, Condalia, galbina, Mexico, moths, par- asitoids, Rhamnaceae, Saturnia, Saturniidae, taxonomy, Texas PEIGLER AND KENDALL The genus Agapema is a holophyletic group of TAMU— Texas A&M University, College small to medium-sized nocturnal saturniid moths that Station range in southwestern North America south to the region SDNHM— San Diego Natural History Museum, of Mexico City.
    [Show full text]