YB-1 Stress-Response Protein Conformation Implicated in Post-Transcriptional

YB-1 Stress-Response Protein Conformation Implicated in Post-transcriptional

Control of Myofibroblast Differentiation

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

William L. Willis

Graduate Program in Biomedical Science

The Ohio State University

2013

Dissertation Committee:

Arthur R. Strauch, Ph.D., Advisor

Denis C. Guttridge, Ph.D.

Lai-Chu Wu, Ph.D.

Mark T. Ziolo, Ph.D.

William L. Willis

2013

Abstract

Differentiation of stromal fibroblasts into myofibroblasts is critical for wound healing and tissue repair. Normally a transient process, chronic myofibroblast activation is the leading cause of hypertrophic scarring, loss of tissue compliance, and dysfunctional tissue remodeling. Vascular smooth muscle α-actin (SMαA) is an indicator of myofibroblast differentiation, as well as one of several fetal contractile protein isoforms re-expressed in adult cardiomyocytes in response to mechanical stress-injury. The stress- response protein, Y-box binding protein-1 (YB-1) binds SMαA mRNA and regulates its translational activity. Our central hypothesis is that YB-1 drives maladaptive SMαA expression in injury-activated myofibroblasts by modulating the packaging, delivery, and translational efficiency of its cognate mRNA. In a mouse model for cardiac fibrosis, we observed that accumulation of fetal SMαA protein in cardiac sarcomeres was associated with accumulation of punctate YB-1 deposits which localized to perinuclear regions as well as polyribosome-enriched cytosol proximal to cardiac intercalated discs. Samples from both fibrotic mouse hearts as well as SMαA positive endomyocardial biopsies from human heart transplant patients were enriched with high molecular weight, heat- denaturing resistant YB-1 oligomers migrating in the range of 100-250 kDa during reducing SDS-PAGE. Notably, YB-1 oligomers exhibited selective affinity for an exon-

3 derived translation silencer sequence in SMαA mRNA. Presence of p180 YB-1 oligomers in endomyocardial biopsies increased with SMαA protein expression and graft age, suggesting that in addition to monomeric YB-1 p50, p180 oligomers may be a preferred YB-1 size variant for storing/protecting fetal mRNA transcripts during myocardial remodeling.

Based on these intriguing observations, which suggested that YB-1 oligomer formation may be associated with the packaging and translation control of SMαA mRNA, we examined the regulatory aspects of YB-1 oligomerization using a model system based on isolated human pulmonary fibroblasts. Activation of SMαA gene expression in human pulmonary myofibroblasts by TGF1 was associated with formation of denaturation- resistant YB-1 oligomers with selective affinity for the SMαA exon-3 translation-silencer sequence. We discovered that YB-1 is a substrate for the protein-crosslinking enzyme transglutaminase 2 (TG2) that catalyzes calcium-dependent formation of covalent - glutamyl-isopeptide linkages in response to reactive oxygen signaling. TG2 transamidation reaction studies using intact cells, cell lysates, and recombinant YB-1 revealed covalent crosslinking of the 50 kDa YB-1 polypeptide into protein oligomers that were distributed during SDS-PAGE over a 75 kDa to 250 kDa size range. In vitro

YB-1 transamidation required nanomolar levels of calcium and was enhanced by the presence of SMαA mRNA. YB-1 crosslinking was inhibited by (a) anti-oxidant cystamine, (b) the reactive-oxygen antagonist, diphenyleneiodonium, (c) competitive inhibition of TG2 transamidation using the aminyl-surrogate substrate,

iii monodansylcadaverine, and (d) transfection with small-interfering RNA specific for human TG2 mRNA. YB-1 crosslinking was partially reversible as a function of free- calcium concentration and TG2 enzyme availability.

Metabolic stress incurred during tissue injury may also promote conversion of resident fibroblasts to the myofibroblast phenotype, as temporary loss of tissue perfusion promotes a hypoxic, energy-deficient pro-oxidative cellular microenvironment.

Stimulation of AMPK activity with AICAR activated TG2 transamidation and induced the formation of high molecular weight YB-1 oligomers with enhanced affinity for the

SMαA mRNA exon-3 translation-silencer sequence. We found that AMPK and peroxide differentially regulated phosphorylation of the YB-1 cold-shock domain, which modulates YB-1 subcellular localization and SMαA mRNA binding efficiency. AICAR suppressed YB-1 phosphorylation, which prevented nuclear translocation and activated

SMαA mRNA binding. In contrast, peroxide stimulation activated Erk/MAPK dependent phosphorylation of the YB-1 cold-shock domain and caused the dispersal of YB-1:

SMαA mRNA complexes. Thus, we propose that coordinated early AMPK activation and delayed ROS production during myofibroblast differentiation regulates SMαA expression at the post-transcriptional level, by coordinating the respective packaging and deployment/translation activation of SMαA mRNA from YB-1 ribonucleoprotein complexes. In summary, intracellular calcium accumulation and increased ROS levels incurred during metabolic and biomechanical stress may govern SMαA mRNA

iv translational activity during wound healing and cardiopulmonary stress responses via

TG2-mediated crosslinking of the YB-1 mRNA-binding protein.

Dedicated to my parents, Pamela and William L. Willis

Acknowledgments

I would like to thank my advisor, Dr. Arthur Strauch, for the opportunity to join his lab.

His guidance, insight, and scientific expertise have been invaluable throughout my graduate career, and have greatly contributed to my development as a scientist.

I would also like Dr. Lai-Chu Wu for her guidance and expertise during early rotations in her lab. Her guidance, training, and advice during those early days laid foundation for the work I have completed in this dissertation.

I would to thank Dr. Denis Guttridge, Dr. Lai-Chu Wu, and Dr. Mark Ziolo for their time serving on my committee and their helpful guidance along the way.

Special thanks to Dr. Jason David in the Art Strauch lab who kindly provided training in

YB-1 immunoblots and RNA pull-down techniques as well as sharing some data shown in the dissertation that supported the YB-1 oligomerization hypothesis during the early, formative stages of my work.

Finally I would like to express my sincerest gratitude to my parents, for the encouragement to continue.

vii

Vita

June 20, 1978 ...... Born- W. Palm Beach, FL

2004 ...... B.Sc. Chemistry, The Ohio State University

2006-2008 ...... Graduate Research Associate The Ohio State University

2008-present ...... Graduate Research Associate, The Ohio State University (In the lab of Dr. Arthur Strauch)

Publications

1. Eiring, AM, Neviani P, Santhanam R, Oaks JJ, Chang JS, Notari M, Willis WL, Gambacorti-Passerini C, Violinia S, Marcucci G, Caligiuri MA, Leone GW, Perrotti D. Identification of novel post-transcriptional targets of the BCR/ABL oncoprotein by ribonomics: requirement of E2F3 for BCR/ABL leukemogenesis. Blood 2008 Jan 15;111(2)816-28

2. Hutzen,B.; Willis,WL., Jones,S., Cen,L., Deangelis,S., Fuh,B., Lin,J. Dietary agent, benzyl isothiocyanate inhibits signal transducer and activator of transcription 3 phosphorylation and collaborates with sulforaphane in the growth suppression of PANC-1 cancer cells. Cancer Cell International 2009 Aug 27;9:24

3. Canner,JA., Sobo,M., Ball,S.; Hutzen,B., DeAngelis,S., Willis,WL., Studebaker,A.W., Ding,K., Wang,S.; Yang,D., Lin,J. MI-63: a novel small- molecule inhibitor targets MDM2 and induces apoptosis in embryonal and alveolar rhabdomyosarcoma cells with wild-type p53. British Journal of Cancer 2009 Sep 1;101(5): 774–781

viii

4. David, D.A. Subramanian, S.V, Zhang, A. Willis, WL, Kelm, RJ, Leir, CV, Strauch, AR. Y-Box binding protein-1 implicated in translational control of fetal myocardial gene expression after cardiac transplant. Experimental Biology and Medicine 2012 May1; 237(5): 593-607

5. Willis, WL, Seethalakshmi Hariharan, Jason J. David, Arthur Strauch. Transglutaminase-2 Mediates Calcium-Regulated Crosslinking of the Y-Box 1 (YB-1) Translation-Regulatory Protein in TGFβ1-Activated Myofibroblasts. Journal of Cellular Biochemistry [published online ahead of print June 27, 2013]

Fields of Study

Major Field: Biomedical Sciences Graduate Program

Table of Contents

Abstract ...... ii

Acknowledgments ...... vii

Vita ...... viii

List of Tables...... xii

List of Figures ...... xiii

Chapter 1: Introduction ...... 1

Chapter 2: Covalent YB-1 oligomerization is associated with post-transplant cardiac remodeling and fetal smooth muscle α-actin gene reactivation ...... 5

2.1 Introduction ...... 5

2.2 Materials and Methods ...... 10

2.3 Results ...... 20

2.4 Discussion ...... 26

Chapter 3: Transglutaminase-2 mediates calcium-regulated crosslinking of the Y-Box 1

(YB-1) translation-regulatory protein in TGFβ1-activated myofibroblasts ...... 47

3.1 Introduction ...... 47

3.2 Materials and Methods ...... 51

3.3 Results ...... 60

3.4 Discussion ...... 74

3.5 Acknowledgements ...... 85

Chapter 4: Metabolic stress signaling regulates YB-1 mRNA packaging, translation implicated in control of SMαA expression in human pulmonary myofibroblasts...... 98

4.1 Introduction ...... 98

4.2 Materials and Methods ...... 106

4.3 Results ...... 111

4.4 Discussion ...... 123

Chapter 5: Working model for YB-1-mediated translation control and future directions

...... 157

5.1 Working Model ...... 160

5.2 Future Directions ...... 163

References ...... 169

List of Tables

Table 2.1: YB-1 binds fetal/stress response mRNAs via conserved consensus motifs..... 45

xii

List of Figures

Figure 2.1: Expression and localization of YB-1 after murine cardiac transplant ...... 37

Figure 2.2: Both p50 and p180 forms of YB-1 in biopsies from cardiac transplant patients bind SMαA mRNA with apparent “time-after-transplant” differences in affinity ...... 39

Figure 2.3: High molecular weight YB-1 variants in endomyocardial biopsy-protein extracts collected from heart transplant patients ...... 40

Figure 2.4: Location of potential TG2-reactive amino acids in mammalian YB-1 ...... 41

Figure 2.5: Mouse cardiac isografts subjected to 2 rounds of transplant surgery accumulate transglutaminase 2 (TG2) over a 11-day post-surgical recovery period ...... 42

Figure 2.6: Localization of TG2 after murine cardiac transplant ...... 43

Figure 2.7: YB-1 p150 oligomers are enriched in subcellular fractions containing the cytoskeleton...... 44

Figure 3.1: TG2-mediated YB-1 crosslinking is calcium dependent ...... 86

Figure 3.2: YB-1 is a TG2 crosslinking substrate in human pulmonary fibroblasts ...... 87

Figure 3.3: In-vitro crosslinking of endogenous YB-1 from human pulmonary fibroblast lysates ...... 89

Figure 3.4: Diphenyleneiodonium (DPI) and monodansylcadaverine (MDC) reduce accumulation of oligomeric forms of YB-1 expressed in human pulmonary myofibroblasts ...... 90

xiii

Figure 3.5: TG2 siRNA suppresses YB-1 oligomerization, SMαA protein expression in human pulmonary fibroblasts ...... 92

Figure 3.6: YB-1 p50 and p100 variants bind oligonucleotide probes derived from various regions of human SMαA mRNA...... 93

Figure 3.7: An exon 3 translational silencing element in SMαA mRNA enhanced TG2- mediated YB- 1 crosslinking and captured native YB-1 oligomers in SMαA-positive myofibroblasts ...... 94

Figure 3.8: TG2-mediated crosslinking of YB-1 is partially reversible ...... 96

Figure 4.1: AICAR activates TG2 transamidation in human pulmonary fibroblasts ...... 142

Figure 4.2: AICAR alters YB-1 cold-shock domain phosphorylation, oligomerization, and subcellular distribution in fibroblasts ...... 144

Figure 4.3: AICAR pulse-chase in human pulmonary fibroblasts ...... 145

Figure 4.4: Thrombin activates YB-1 cold shock domain phosphorylation in human pulmonary fibroblasts in a Erk1,2 dependent manner ...... 147

Figure 4.5: YB-1 cold-shock domain phosphorylation modulates affinity for SMαA mRNA ...... 148

Figure 4.6: AICAR and peroxide induce SMαA expression in human pulmonary fibroblasts ...... 150

Figure 4.7: Kinase dependence of AICAR/peroxide induced YB-1 cold-shock domain phosphorylation ...... 152

Figure 4.8: Human SMαA mRNA predicted secondary structure ...... 154

xiv

Figure 4.9: Working model for AMPK/ROS regulation of SMαA expression during myofibroblast differentiation ...... 155

Figure 5.1: Purα and Purβ form a calcium-induced supermolecular complex catalyzed by the protein crosslinking enzyme, transglutaminase 2 (TG2) ...... 165

Figure 5.2: Working Model: Metabolic and biomechanical stress-reprogramming of protein synthesis via modulation of YB-1 mRNP structure and function ...... 167

Chapter 1: Introduction

Differentiation of stromal fibroblasts into myofibroblasts is critical for wound healing and tissue repair. Normally a transient process, poorly regulated chronic myofibroblast activation is the leading cause of hypertrophic scarring, loss of tissue compliance, and dysfunctional tissue remodeling (David et al., 2012; Yang and Ming, 2012; Cronstein,

2011; Lokmic et al., 2012; Rosmorduc and Housset, 2010). Accumulation of fibrocontractile scar tissue is associated with perivascular and interstitial cardiac fibrosis in native heart disease and chronic graft rejection and driven by transition of stromal fibroblasts into scar-forming myofibroblasts (Boluyt et al., 1994; Frangogiannis, 2006;

Hao et al., 1999; Pickering and Boughner, 1990; Naugle et al., 2006; Nicoletti and

Michel, 1999). Deposition of inelastic scar tissue in the myocardium places a mechanical burden on cardiomyocytes resulting in biomechanical stress-activation of fetal gene expression and development of hypertrophic cardiac pathology. Vascular smooth muscle alpha-actin (SMαA) is a well-known indicator of myofibroblast differentiation and one of several fetal contractile protein isoforms that are re-expressed in adult myocardium in response to mechanical-stress injury caused by deposition of scar tissue (Gabbiani, 2003).

In fibrotic lung disorders such as idiopathic pulmonary fibrosis, injury to the alveolar epithelium induces uncontrolled proliferation and differentiation of interstitial fibroblasts

1 into myofibroblasts, leading to accumulation of stiff scar-tissue that obstructs airflow and ultimately destroys healthy lung structure and function.

Recent studies in our lab have implicated the YB-1 cold-shock domain protein as an important post-transcriptional driver of the molecular pathobiology associated with excessive myofibroblast differentiation and cardiopulmonary fibrosis. Our central hypothesis is that YB-1 drives maladaptive SMαA expression in injury-activated myofibroblasts by modulating the packaging, delivery, and translational efficiency of its cognate mRNA. YB-1 is a member of the highly conserved Y-box protein family, containing a cold-shock domain that binds Y-box DNA regulatory sequences and unwinds duplex DNA to alter the transcriptional activity of a variety genes associated with inflammation, wound healing, and stress response (Kamalov et al., 2005; Zhang et al., 2005; En-Nia et al., 2005; Gaudreault et al., 2004). YB-1 is also important for translation control during metabolic stress, sequestering mRNA molecules needed for cell survival during temporary periods of hypoxia, ATP depletion, or oxidative stress (Coles et al., 2005; Roy et al., 2007; Eliseeva et al., 2011). The conserved YB-1 cold-shock domain mediates nucleic acid binding in response to a variety of cellular stress signals including low temperature and anti-cancer drug toxicity in addition to oxidative damage by reactive oxygen species and UV light irradiation (Hasegawa et al., 1991; Asakuno et al., 1994; Ohga et al., 1996; Bargou et al., 1997; Guay et al., 2006; Das et al., 2007).

Genes important in cell proliferation, migration, and survival are also regulated by YB-1, including those encoding α1 and α2 (I) collagen, the B-chain of PDGF, the EGF receptor,

MMP-2, VEGF, GM-CSF, p21 and p53, cyclinA and B1, and the Fas death receptor

(Okamoto et al., 2000; Mertens et al., 2002; Guay et al., 2006; Lu et al., 2005; Roy et al.,

2007; Jurchott et al., 2003; Lasham et al., 2000). Notably, YB-1 recently has been identified as a prominent constituent of stress granules, where it may tether mRNA to microtubules and microfilaments and contribute to mRNA storage, stability, and translation control during periods of metabolic stress (Ruzanov et al., 1999; Nabika et al.,

1988; Chernov et al., 2008a; Chernov et al., 2008b; Anderson and Kedersha, 2002b;

Onishi et al., 2008; Ashizuka et al., 2002; Matsumoto et al., 2005).

In this dissertation we describe our multi-faceted approach to elucidating the biochemical mechanism of YB-1 post-transcriptional control of SMαA expression. Based on the intriguing observation of YB-1 aggregates and high molecular weight SDS-variants in fibrotic heart grafts in mouse and human, we examined the regulatory aspects of YB-1 oligomerization using a model system based on isolated human pulmonary fibroblasts.

Unlike remodeling heart grafts, SMαA expression can be acutely controlled in these cells with fibrotic agonists such as TGFβ1 or thrombin. This model proved to be ideal for examining the molecular pathways of SMαA post-transcriptional control in greater detail, leading to the discovery that YB-1 is a substrate for the protein crosslinking enzyme transglutaminase 2 (TG2), with novel insights into the molecular mechanisms by which nascent myofibroblasts re-program mRNA translation as an adaptation to biomechanical and metabolic stress as a consequence of tissue injury.

While post-transcriptional mechanisms that regulate mRNA stability and/or translational efficiency seem particularly important for coordinating the initiation and resolution of wound healing responses (Anderson, 2010), their molecular control is poorly understood.

In this work we identify key biochemical and signaling mechanisms by which YB-1 coordinates post-transcriptional responses to well-known metabolic and biomechanical stressors that transpire during cardiopulmonary fibrosis. Knowledge of post- transcriptional mechanisms that regulate biomechanical- and metabolic stress-activation of SMαA expression may provide novel therapeutic avenues for disorders associated with chronic myofibroblast activation and excess ECM production such as idiopathic pulmonary fibrosis, for which current treatments are ineffective.

Chapter 2: Covalent YB-1 oligomerization is associated with post-transplant cardiac

remodeling and fetal smooth muscle α-actin gene reactivation

2.1 Introduction

Distinct from normal/physiological hypertrophic remodeling as a healthy adaptive response to exercise, maladaptive cardiac remodeling associated with re-activation of fetal contractile protein expression pre-disposes the heart to fail (Fagard, 1997; Pluim et al., 2000; Rame and Dries, 2007). Accumulation of fibrocontractile scar tissue is associated with perivascular and interstitial cardiac fibrosis in native heart disease and chronic graft rejection and driven by transition of stromal fibroblasts into scar-forming myofibroblasts (Boluyt et al., 1994; Frangogiannis, 2006; Hao et al., 1999; Pickering and

Boughner, 1990; Naugle et al., 2006; Nicoletti and Michel, 1999). Deposition of inelastic scar tissue in the myocardium places a mechanical burden on cardiomyocytes resulting in stress force-activation of fetal gene expression and development of hypertrophic cardiac pathology. Vascular smooth muscle alpha-actin (SMαA) not only is a well-known indicator of cardiac myofibroblast differentiation in damaged heart tissue but also one of several fetal contractile protein isoforms that are re-expressed in adult cardiomyocytes in response to mechanical-stress injury (Gabbiani, 2003; Tomasek et al., 2002; Desmouliere et al., 2005; Black et al., 1991; Eppenberger-Eberhardt et al., 1990).

Cardiac allograft dysfunction is a poorly understood maladaptive response to transplant that ultimately impairs perfusion, performance, and long-term survival of accepted cardiac allografts (Zhang et al., 2008; Subramanian et al., 2002). Re-transplantation surgery to replace a dysfunctional heart graft often is the only recourse but impractical in terms of donor organ availability. Often described as “chronic rejection”, allograft dysfunction typically arises within 3-5 years after transplant in allografts that otherwise seem well tolerated by the immunosuppressed host (Schmauss and Weis, 2008). Allograft dysfunction is a graft-remodeling syndrome that includes interstitial and perivascular fibrosis, accelerated coronary vasculopathy, and altered expression of muscle protein genes by coronary arterial smooth muscle cells and ventricular cardiomyocytes (Cantin et al., 2001; Orbaek, 1999). Importantly, remodeling is observed in accepted grafts despite the lack of sustainable leukocyte infiltration. Evaluation of accepted grafts in published accounts of small-animal allotransplant models has indicated a similar temporal disconnect between immune cell infiltration and remodeling in several types of solid organ grafts (Schmid et al., 1996; Tullius and Tilney, 1995). A recent genome-wide survey of mRNA transcripts associated with future failure in accepted human renal allografts revealed that marker genes statistically linked to graft failure were related to wound healing-associated events including epithelial-to-mesenchymal transition, extracellular matrix remodeling, and TGFβ1 signaling (Einecke et al., 2010).

In a murine heterotopic cardiac transplant model, interstitial and perivascular cardiac fibrosis was a significant component of allograft dysfunction that occurred early after transplant with subsequent detrimental effects on both coronary artery and myocardial structure and function (Armstrong et al., 1997a; Armstrong et al., 1997b; Armstrong et al., 1997c). Cardiac fibroblasts were highly susceptible to conversion to myofibroblasts in accepted grafts as indicated by robust de novo expression of the gene encoding the contractile protein isoform, smooth muscle α-actin (SMαA) (Subramanian et al., 2002;

Subramanian et al., 1998). Ultimately, deposition of non-elastic scar tissue by activated myofibroblasts diminishes myocyte contractile function and alters the structural organization of the myocardium that could lead to premature graft failure (Khan and

Sheppard, 2006).

Recent findings in our laboratory implicate the YB-1 cold-shock domain protein as a potentially important component in the molecular pathobiology of cardiac allograft dysfunction (Zhang et al., 2008; Subramanian et al., 2002; Liu et al., 2009). YB-

1/dbpb/MSY-1 are alternate names for a highly conserved, single-strand specific, nucleic acid-binding protein that regulates expression of multiple genes associated with metabolic stress and tissue repair including those encoding SMαA, the α1 and α2 type I collagen subunits, the B-chain of PDGF, the EGF receptor, MMP-2, VEGF, GM-CSF, p21 and p53, cyclins A and B1, and the Fas death receptor (Zhang et al., 2005; Lu et al.,

2005; Higashi et al., 2003; Kohno et al., 2003; Mertens et al., 1997; Coles et al., 2005). In addition to its role as a nuclear transcription factor, YB-1 also accumulates in the cytosol

7 to perform post-transcriptional regulatory tasks related to its ability to bind stem-loop structures in mRNA (Braunstein et al., 2007; Cobbold et al., 2008). YB-1 has been implicated in controlling protein synthesis after tissue injury by forming complexes with other cytosolic proteins such as PSF, P54nrb, GRSF1, and PTB-1 (Cobbold et al., 2010;

Cobbold et al., 2008) that initiate translation from internal ribosome entry sites (IRES) as opposed to 5’-end cap structures in mRNA molecules that mediate ribosome scanning for

AUG codons. One current idea is that the shift from cap-dependent to cap-independent programs of protein synthesis might be governed by hypoxic stress that specifically enhances translation of mRNAs containing IRES stem-loop structures that encode HIFα,

VEGF, and Bcl2 required for cell growth and survival under low oxygen conditions

(Braunstein et al., 2007; Cobbold et al., 2008; Spriggs et al., 2009; Sonenberg and

Hinnebusch, 2009). Whether cardiomyocyte response to peri-transplant ischemia/reperfusion injury is similarly accompanied by compensatory shift from cap- dependent to IRES-dependent mRNA translation is not known. Of additional relevance to cardiac allograft structure and function is the reported ability of YB-1 to sequester and protect mRNA molecules needed for homeostasis and cell survival during temporary periods of metabolic stress. YB-1 recently was identified as a constituent of stress granules where it may aid in the transport of mRNA along microtubules and microfilaments as well as stabilize and store mRNA until metabolic conditions become more favorable for resumption of normal cell function (Skalweit et al., 2003; Yang and

Bloch, 2007).

We previously showed that re-transplant of cardiac isografts into a second cohort of syngeneic hosts amplified ischemia/reperfusion (I/R) graft injury leading to cardiac myofibroblast differentiation and extensive interstitial and peri-vascular fibrosis (Zhang et al., 2008). Using this “2-hit” I/R injury model, we observed that accumulation of fetal

SMαA protein in cardiac sarcomeres was associated with formation of peri-nuclear YB-1 granule-like structures and accumulation of YB-1 within the polyribosome-enriched cytosol proximal to cardiac intercalated discs. Notably, samples from both 2-hit mouse hearts as well as SMαA positive endomyocardial biopsies from human heart transplant patients were enriched with high molecular weight, heat-denaturing resistant YB-1 oligomers migrating in the range of 100-250 kDa during reducing SDS-PAGE. Further analysis of the RNA binding properties of YB-1 from endomyocardial biopsies also revealed the presence of YB-1 oligomers migrating at approximately 180 kDa (p180) with high affinity for SMαA mRNA. Presence of YB-1 p180 oligomers in endomyocardial biopsies increased with SMαA protein expression and graft age, suggesting that in addition to monomeric YB-1 p50, p180 oligomers may be a preferred

YB-1 size variant for storing/protecting fetal mRNA transcripts during myocardial remodeling. The high stability and heat-denaturing resistance of YB-1 oligomers was suggestive of a covalent linkage, and we present new evidence implicating the protein crosslinking enzyme transglutaminase-2 (TG2) in the formation of covalent YB-1 oligomers that may be important for the packaging, transport and deployment of SMαA mRNA for translation during cardiopulmonary fibrosis.

2.2 Materials and Methods

Murine heterotopic heart transplantation. Murine cardiac transplant surgery was performed on a contract basis by staff members in the Experimental Murine

Microsurgery Laboratory in the Division of Surgery at The Ohio State University College of Medicine (C.G. Orosz and G. Hadley, past directors). Transplant surgery was conducted as noted in David et al (David et al., 2012). To summarize, five-week old, specific pathogen-free female DBA/2 (H-2d), FVB/N (H-2k), and C57BL/6 (H-2b) mice were maintained in a barrier facility for use as heart donors and graft recipients. An

IACUC-approved animal protocol was used in this study in accordance with the Guide for the Care and Use of Laboratory Animals published by the United States National

Research Council (revised 1996). Donor hearts (either DBA/2 or FVB/N strains) were heterotopically-transplanted into the abdomen of gallium nitrate-immunosuppressed

C57BL/6 recipient mice using an adaptation of the method of Corry et al (Subramanian et al., 2002; Armstrong et al., 1997a; Armstrong et al., 1997b; Armstrong et al., 1997c;

Corry et al., 1973). The protocol for performing syngeneic cardiac re-transplant (2-hit I/R model) also has been previously described (Zhang et al., 2008). Briefly, three groups of 3

FVB/N-to-FVB/N heart grafts were explanted 15 days after first transplantation, re- transplanted into another cohort of FVB/N hosts, and then collected after 3, 7, or 11 days for immunohistochemical and biochemical analyses. Controls were non-transplanted donor hearts from age- and sex-matched FVB/N mice or isografts subjected to only a single round of transplant surgery into FVB/N recipients and harvested at either 15 days or 26 days after transplant. Explanted heart grafts were visualized under a dissection

10 microscope and trimmed to remove the atria and coronary vessels. Trimmed ventricles were frozen in liquid nitrogen, ground to powder while submerged under liquid nitrogen using a mortar and pestle, and extracted for either non-denaturing electrophoretic mobility shift assays (EMSA) or denaturing SDS-PAGE as described below.

Immunohistochemical methods. The anti-YB-1 rabbit polyclonal antibodies (anti-YB1

M85-110 and anti-YB1 M276-302) were developed in the laboratory of Robert J. Kelm,

Jr. as described previously (Kelm, Jr. et al., 2003; Kelm, Jr. et al., 1999a; Kelm, Jr. et al.,

1999b). Commercial polyclonal antibodies specific for amino-terminal (Y-0396, amino acid residues 137-150) and carboxyl-terminal (Y-0271, amino acid residues 307-324) segments of YB-1 were obtained from Sigma-Aldrich, St. Louis, MO.

Immunohistochemistry was performed on 4 micron thick, paraffin-embedded sections from 4% paraformaldehyde-fixed isografts or non-transplanted donor hearts

(Subramanian et al., 1998). Sections were de-paraffinized, re-hydrated, blocked with 2% goat serum, 0.1% BSA, and 0.05% Tween 20TM in PBS (blocking solution), and incubated for 90 minutes at 37o C with the primary antibodies at a concentration of 2 ug/ml in blocking solution. After washing, sections were incubated for 30 minutes with a horse radish peroxidase (HRP)-conjugated, goat anti-rabbit secondary antibody and a

VectastainTM protocol was followed for color development using a DAB peroxidase kit

(Vector Laboratories, Burlingame, CA). To detect SMαA, HRP-conjugated anti-human

SMαA mouse monoclonal (clone 1A4, Dako Cytomation California, Carpiteria, CA) was diluted 1:100 prior to use. Dual localization of two antigens was accomplished by

11 incubating tissue sections with a second antibody after completing the detection protocol for the first antibody and washing the sections in TBS, pH 7.4. To distinguish between the two antibody reaction products, a nickel solution was added to the second color development reagent which produced a blue-gray precipitate that contrasted with the red- brown reaction product obtained using the first developing solution without nickel ions.

Sections were viewed on a Zeiss AxioscopeTM 40 microscope using 10X, 20X, and 40X brightfield objectives and color images digitally recorded using Zeiss MRGrabTM 1.0 software.

Collection of human endomyocardial biopsy specimens. Collection and processing of endomyocardial biopsies was performed in collaboration with Dr. Jason David, PhD and

Professor Carl Leier, MD. Right ventricular septal endomyocardial biopsy retrieval from participating patients providing informed written consent was performed by Professor

Carl V. Leier, MD in accordance with IRB-approved protocols under aseptic conditions in the cardiac catheterization laboratory in the Ross Heart Hospital, The Ohio State

University Medical Center. The right internal jugular vein is the site of entry although, if occluded, the left internal jugular or femoral veins are alternate routes. After local instillation of 1% lidocaine, the vein was entered with an 18 gauge Cournand needle, the guidewire positioned under fluoroscopy, and 8 French (Fr) introducer placed for passage of the 7 Fr bioptome instrument. Samples were immediately placed in liquid nitrogen and pulverized to powder form under liquid nitrogen for use in YB-1 immunoblot analysis or mRNA binding studies. Biopsies used in this analysis were collected from long-term

12 transplant patients who returned to the clinic for their required post-surgery evaluation of graft function. For all these patients, at least 1 year elapsed since their last biopsy.

Therefore the data are not likely to reflect processes related to the formation of granulation tissue at earlier sites of biopsy retrieval. Only tissue samples showing viable myocardial tissue were retained for our analysis and samples with visible scar tissue were not included in our study.

Preparation of native protein extracts for mRNA-binding assays. Human endomyocardial biopsy tissue powder or pulverized, biopsy-sized fragments of normal non-transplanted mouse left ventricular tissue were suspended in 8 volumes (80 ul) of ice-cold low-salt, hypotonic cardiomyocyte extraction buffer (20 mM HEPES, pH 7.9,

1.5 mM MgCl2, 10 mM KCl, protease inhibitor cocktail, 0.2 mM PMSF, 0.5 mM DTT), allowed to swell for 20 minutes on ice, and then processed with 100 strokes delivered using a small Dounce homogenizer with a low-clearance pestle. One and ½ volumes of high salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 1.2 M KCl, 0.2 mM EDTA, protease inhibitor cocktail, 0.2 mM PMSF, 0.5 mM DTT) was added followed by gentle rocking for 30 minutes at 4°C. Extracts were clarified by centrifugation at 49,000 rpm for 1 hour at 4°C and the supernatants transferred to a ultrafiltration device (Microcon Ultracel YM-10, Millipore Corporation, Billerica, MA) and centrifuged at 14,000 rpm for 1 hour at 4°C to exchange the extraction buffer with

200 ul of low salt buffer containing 20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM

MgCl2, 20 mM KCl, 0.2 mM EDTA, protease inhibitor cocktail, 0.2 mM PMSF, 0.5 mM

DTT. Extracts were assayed for protein concentration using a reducing agent-compatible version of the BCA colorimetric method, aliquoted, and stored at -80C for use in DNA- or mRNA-binding assays. Each human biopsy specimen or mouse heart tissue fragment

(used for control purposes) had a wet weight of slightly <10 mg and the protein concentration of the final extract usually was about 4-5 ug/ul. For RNA binding studies with purified mouse recombinant YB-1, 10 μg of purified recombinant YB-1 was incubated with 100 pmol mRNA probe as detailed below. The following synthetic biotinylated oligonucleotide probes (Integrated DNA Technologies, Coralville, IA) were used in this study: SMαA mRNA probes: (1) a 30-nt RNA-coding element from exon 3 of SMαA mRNA containing an inverted MCAT motif (underlined text) (CE-RNA, 5’- gggaguaaugguuggaaugggccaaaaaga-3’), previously shown to bind YB-1 and Pur proteins

(Kelm, Jr. et al., 1999b) (2) a 25-nt sequence containing a cold-shock domain-like consensus (underlined text) from exon 9 of SMαA mRNA (SMαA CSD1, 5’- gaucgguggcuccaucuuggcuucgc-3’), (3) a 25-nt sequence containing a cold-shock domain-like consensus motif (underlined text) from exon 8 of SMαA mRNA (SMαA

CSD4, 5’-gcauccacgaaaccaccuauaacagc-3’), and (4) a 25-nt sequence encompassing an

MCAT-like sequence (underlined text) from the 3’untranslated region of SMαA mRNA

(SMαA 3’UTR, 5'-uuuccaaaucauuccuagccaaagcu-3'). βMHC mRNA probes: (1) an mRNA probe with homology to a sequence with previously identified high affinity for cold-shock domain proteins (underlined text) (Coles et al., 2004) (βMHC CSD3, 5' - uccucacaucuucuccaucucugacaac-3'), (2) an mRNA probe with homology to another sequence with previously identified high affinity for cold-shock domain proteins

(underlined text) (βMHC CSD4 5'-ugcagcaguucuucaaccaccacauguu-3'), (3) An mRNA probe with homology to the reverse strand of a conserved distal MCAT motif in the

βMHC promoter (underlined text) (βMHC D/R, 5'-gcagcugcugcauucccagaacaccag-3’),

(4) An mRNA probe with homology to the inverted forward strand of a conserved distal

MCAT motif in the βMHC promoter (underlined text) (βMHC D/Finv, 5'- uccaaguuccgcaaggugcagcacgag-3'), (5) An mRNA probe with homology to the reverse strand of a conserved proximal MCAT motif in the βMHC promoter (underlined text)

(βMHC P/R, 5'-ucauugacuuuggcaugggaccugcag-3'), (6) An mRNA probe with homology to the inverted reverse strand of a conserved proximal MCAT motif in the βMHC promoter (underlined text) (βMHC P/Rinv, 5'-uccccacuuuguacguuguaucauccc-3’).

αMHC mRNA probes: (1) An mRNA probe with homology to the forward strand of an

MCAT regulatory motif in the αMHC promoter (underlined text) (αMHC MCAT, 5'- ucauugacuuuggcauggaccugcagg-3'), (2) an mRNA probe with homology to a RNA sequence with previously identified high affinity for cold-shock domain proteins (Coles et al., 2004) (underlined text) (αMHC CSD4, 5'-ggugcuuuucaaccucaaggagcgcua-3').

SkαA mRNA probe: an mRNA probe with homology to an RNA sequence with previously identified high affinity for cold-shock domain proteins (Coles et al., 2004)

(underlined text) (SkαA CSD4, 5'-gaccaccuacaacagcaucaugaagug-3'). VEGF-A mRNA probes: (1) An mRNA probe with homology to MCAT motif in VEGFA mRNA

(underlined text) (VEGFA MCAT1, 5'-ccccaccacacauuccuuugaaauaag-3'), (2) An mRNA probe with homology to an additional MCAT motif in VEGF-A mRNA

(underlined text) (VEGFA MCAT3, 5'-guaccuccaccaugccaagugguccca-3'). VEGF-B

15 mRNA probes: (1) An mRNA probe with homology to an inverted MCAT motif in

VEGF-B mRNA (underlined text) (VEGFB MCAT1, 5’- gacgauggccuggaaugugugcccacu-3'), (2) An mRNA probe with homology to an additional MCAT motif in VEGF-B mRNA (underlined text) (VEGFB MCAT3, 5'- uaugcacgugccacaugccagcccagggaggug-3').

Reaction mixtures containing protein extract (100 ug of protein) and biotinylated oligonucleotides (100 pmol; Integrated DNA Technologies, Coralville, IA) were incubated in a buffer containing poly (dI-dC), 10 mM Tris, pH 7.5, 50 mM NaCl, 0.5 mM

DTT, 0.5 mM EDTA, 0.2 mM PMSF, 4% glycerol. Protein-biotinylated RNA complexes were captured on streptavidin-immobilized paramagnetic particles (Promega, Madison,

WI; 0.6 ml/reaction, 30 minute incubation) as described previously(Subramanian et al.,

2004; Cogan et al., 2002). After washing four times with buffer containing 25 mM Tris-

HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, bound protein was eluted using 2X protein denaturing buffer containing β-mercaptoethanol and analyzed by SDS-PAGE and immunoblotting procedures.

Reducing SDS-PAGE and immunoblotting methods. Frozen tissue powders derived from pulverized ventricles from donor mouse hearts and 2-hit isografts or human endomyocardial biopsies were denatured by boiling in SDS-PAGE sample buffer for 5 minutes (Subramanian et al., 2002). Mouse and human heart tissue samples were additionally subjected to brief, alternating cycles of sonication and boiling in SDS sample

16 buffer to completely disrupt the material prior to electrophoresis. Aliquots containing 5-

20 g of protein were size-fractionated by SDS-PAGE on 10% polyacrylamide gels and then electrophoretically transferred to nitrocellulose membranes (Schleicher & Schull,

Keene, NH) for 90 minutes at 300 mA in 25 mM Tris-HCl, 192 mM glycine, 20% (v/v) methanol. After overnight blocking at 4° C, blots were incubated with one of several anti-

YB-1 antibodies as noted above at 1:1000 overnight at 4° C, washed in TBS containing

Tween 20TM (0.05% v/v), and incubated with peroxidase-conjugated goat or donkey anti- rabbit secondary antibody (1:2500) for 60 minutes. Bound antibodies were visualized by chemiluminescence (ECLTM, Amersham Biosciences, Arlington Heights, IL) and imaged onto BiomaxTM film (Eastman Kodak, Rochester, NY). For detection of SMαA, membranes were incubated with HRP-conjugated 1A4 (1:100) in TBS containing 0.05%

Tween 20TM (TBST). Following 60-90 minute incubation at ambient temperature with gentle mixing, the membrane was washed 2-3 times in TBST and developed using reagents provided in a DAB-peroxidase VectastainTM kit (Vector Laboratories,

Burlingame, CA). Quantitation of immunoblot band density was performed using laser densitometry (ImageQuant software, GE Healthcare Biosciences) and normalized to values for GAPDH protein as detected by anti-GAPDH antibody.

Purification of recombinant N-His YB-1. Expression of recombinant N-terminal hexahistidine-tagged mouse YB-1 (N-HisYB-1) in Escherichia coli was performed as described (Knapp et al., 2006; Kelm, Jr. et al., 1999a). Bacterial cell pellets weighing approximately 1 g were suspended in XtractorTM lysis buffer (Clonetech, Mountainview,

CA) supplemented with 1 mg/mL lysozyme, 5 U/mL DNase, 5 U/mL RNase, 10 mM β- mercaptoethanol, 0.1 mM PMSF, and protease inhibitor cocktail. The cell suspension was incubated at room temperature for 30 min with gentle agitation. Lysates were cooled on ice for 5 min followed by sonication with a Misonix Microson XL 2000 sonicator (setting

10) for a total of six 10-second bursts with 1-min incubations on ice between bursts.

Lysates were clarified by centrifugation at 14,000xg for 20 min at 4°C and incubated in 1 mL Talon metal-affinity resin (Clontech) for 20 min at room temperature with gentle agitation. Resin-bound protein was sedimented at 700xg for 5 min and washed twice with

20 bed volumes of wash buffer (50 mM sodium phosphate, pH 7.4, 300 mM NaCl, 5 mM

β-mercaptoethanol, 0.1 mM PMSF, protease inhibitor cocktail). Washed resin then was resuspended in 1-bed volume of wash buffer and transferred to a 2 mL gravity-flow column, washed in 14-bed volumes wash buffer, followed by a second wash in 7-bed volumes of wash buffer supplemented with 10 mM imidazole. Bound recombinant N-

HisYB1 was eluted from the resin using 5-bed volumes of wash buffer containing 150 mM imidazole and concentrated in a centrifugation-filter device (Ultracel 10K,

Millipore). The relative purity of N-HisYB-1 -containing fractions was assessed by

Coomassie Fluor-Orange (Invitrogen) staining and SDS-PAGE immunoblot analysis of protein eluate using the RGSHHH anti-HIS mouse IgG1 monoclonal antibody.

Cultivation of human pulmonary fibroblasts. Human pulmonary fibroblasts (hPFB) were established in primary culture from enzyme-dispersed tissue fragments of human neonatal lung tissue obtained at autopsy and were kindly provided by Dr. Daren L.

Knoell (Departments of Pharmacy and Internal Medicine, The Ohio State University,

Columbus, OH). Pulmonary fibroblasts were maintained in a 1:1 mixture of Ham’s F-12 and DMEM (1.0 g/l d-glucose) supplemented with penicillin-streptomycin-FungizoneTM,

GentamicinTM (50 µg/mL), and 10% heat-inactivated fetal bovine serum (hiFBS;

Invitrogen, Carlsbad, CA). Cell preparations were cultivated in a humidified incubator at

37°C at 5% CO2 and were rendered quiescent by a 48 hr exposure to HEPES-buffered

DMEM (1.0 g/L D-glucose) containing 0.5% hiFBS and penicillin-streptomycin-

FungizoneTM.

Subcellular fractionation. Human pulmonary fibroblasts were lysed by a 5-min treatment with lysis buffer containing 10 mM HEPES, pH 6.8, 0.1 M NaCl, 3 mM

MgCl2, 0.3 M ultra pure sucrose, 1mM phenylmethylsulfonyl fluoride (PMSF), and 0.5%

Trition X-100. The released protein solution was collected and referred to as soluble fraction. Protein residue remaining on the culture dish after lysis was washed once with lysis buffer and further extracted for 10 min on ice in a buffer consisting of lysis buffer supplemented with 5 mM ATP and 0.1 mM EGTA. Material released by this treatment was collected and referred to as the ATP/EGTA fraction, leaving behind extraction- resistant material referred to as the cytoskeleton fraction. The cytoskeleton fraction was collected by scraping cell remnants into a cytoskeletal extraction buffer consisting of 2%

SDS, 50 mM Tris, pH 7.5, 0.2 mM PMSF, 1 mM DTT, protease inhibitor cocktail.

2.3 Results

Many published studies on YB-1 center on its functional behavior in the cell nucleus where it regulates the transcription activity of numerous genes associated with cell and tissue adaptation to metabolic stress. However, recent studies also indicate a potential role for cytosolic YB-1 in mRNA translation control of genes required for stress response

(Cobbold et al., 2010; Cobbold et al., 2008; Lu et al., 2005), epithelial-mesenchymal transitions during embryonic development (Evdokimova et al., 2009; Rauen et al., 2009;

Shiota et al., 2008), and cancer metastasis (Shiota et al., 2008; Bader and Vogt, 2008; Lee et al., 2008). In accord with cytosolic localization and possible post-transcriptional regulatory function in the transplanted heart, we observed that YB-1 was localized in heart allografts adjacent to cardiac intercalated discs (Figure 2.1a,c-d). The intercalated disc (ID) is a membrane junctional bridge between electrically coupled cardiomyocytes that is highly enriched for connexin 43-enriched gap junctions and F-actin-linked fascia adherentes adhesion complexes (Yamaguchi et al., 1988). Junctional ID regions also were reported to be enriched for ribosomes (Larsen et al., 1994) as were the cardiac subsarcolemmal and actin filament/I-band regions. Moreover, IDs in chronically rejected, human cardiac allografts reacted strongly with an antibody specific for the phosphorylated form of ribosomal protein S6 (Lepin et al., 2006), a marker for active protein synthesis (Fenton and Gout, 2011).

We previously reported that YB-1 binds a purine-rich sequence in exon 3 of SMαA mRNA and regulates its translational efficiency during TGFβ1-induced myofibroblast

20 differentiation (Zhang et al., 2005; Kelm, Jr. et al., 1999b; Kelm, Jr. et al., 1996).

Localization of YB-1 at ribosome-enriched IDs after cardiac transplant therefore may be potentially important in the post-transcriptional deployment of newly synthesized fetal

SMαA mRNA in stress-injured heart grafts. To further characterize YB-1 expression and sub-cellular distribution in the transplanted heart, we utilized a syngeneic graft model that amplifies interstitial fibrosis and cardiomyocyte biomechanical stress without instigating adaptive alloimmune responses in the host (Zhang et al., 2008; Tullius and Tilney, 1995).

This “2-hit” model utilizes two successive rounds of isograft transplantation surgery that specifically enhances signaling due to mechanical trauma, thrombosis, peri-transplant ischemia/reperfusion injury, and TGFβ1 receptor activation (Zhang et al., 2008).

Importantly, alloantigen-reactive monocytes, macrophages, and T cells do not infiltrate 2- hit isografts. This reduces immune-cell release of pro-inflammatory IFNγ and TNFα that could inhibit TGFβ1 signaling and obscure post-transplant evaluation of YB-1 which is exported from the nucleus in a TGFβ1-dependent manner (Higashi et al., 2003; Zhang et al., 2005; Liu et al., 2009). Immunohistochemical analysis of 2-hit heart grafts revealed accumulation of YB-1 protein within 3 days that was highly localized at cardiac IDs by day 11 after second transplant (Figure 2.1b-d). YB-1 in 2-hit heart grafts also was frequently detected in the form of punctate deposits localized proximal to the ID and perinuclear regions of cardiomyocytes (Figure 2.1d, arrows). YB-1 was not readily detected in non-transplanted donor mouse hearts using the available anti-YB-1 antibodies

(Figure 2.1g). Moreover, YB-1 deposition at cardiac IDs was not observed in hearts subjected to only a single round of transplant surgery (data not shown). Comparison of

Figures 2.3e and 2.3f shows that de novo expression of fetal SMαA protein was not observed in 1-hit isografts but required two rounds of transplant surgery consistent with development of chronic rejection-like histopathology only in the 2-hit model.

Our lab and others have previously reported that YB-1 binds and protects mRNAs important for wound healing and stress response in injury activated fibroblasts including

SMαA (Zhang et al., 2005) and collagen type 1a (Hanssen et al., 2011). We reasoned that

YB-1 may perform a similar task in transplant-injured cardiac tissue by stabilizing nascent SMαA transcripts, and perhaps other mRNAs encoding essential fetal or stress- response proteins, during transit to polyribosome-enriched regions of the sarcoplasm. The deposition of YB-1 proximal to cardiac IDs and ribosomes in mouse heart grafts implied that this protein may chaperone fetal mRNA needed for stress remodeling after cardiac transplant.

An analysis of endomyocardial biopsies collected from heart transplant patients over a

17-year post-transplant surveillance period revealed informative trends regarding the expression of YB-1 and SMαA in accepted allografts. In addition to YB-1 p50, a high molecular weight YB-1 protein complex migrating at 180 kDa in SDS-PAGE (p180) also strongly interacted with SMαA mRNA. As shown in Figure 2.2, (top panels) YB-1 p180 exhibited increased binding to SMαA mRNA roughly in accordance with time after transplant interval. Biopsies from patients obtained over a 9-17 year post-transplant interval, which had increased levels of SMαA expression relative to samples taken over a

1-6 year post-transplant interval, also showed increased levels of YB-1 p180: SMαA mRNA complexes. Notably, the p180 form of YB-1 seemed to be the preferred size- variant for binding SMαA mRNA, as noted in the top panel of Figure 2.2. YB-1 oligomers were not dispersed by heat-denaturing associated with reducing SDS-PAGE, which was suggestive of a covalent linkage. Given the ability to interact specifically with several types of YB-1 antibodies and high affinity for the SMαA mRNA probe, we believe YB-1 p180 to be an authentic, covalently linked YB-1 oligomer. We further speculate that YB-1 oligomers, which may have multiple SMαA mRNA binding sites, may be the preferred form for storage of SMαA mRNA in heart grafts undergoing fetal gene reprogramming and stress-induced remodeling. Further analysis of the complete repertoire of YB-1 detected on immunoblots from endomyocardial biopsies, revealed the presence of multiple, heat-denaturing resistant YB-1 oligomers migrating in the range of

100-250 kDa in reducing SDS-PAGE (Figure 2.3).

The high stability of YB-1 oligomers and relative resistance to dispersal during biochemical extraction and reducing SDS-PAGE was suggestive of a covalent linkage.

YB-1 is known to form high molecular weight polymers in solution, however current reports do not address the phenomena nor explore the biochemical evidence for covalent

YB-1 oligomerization. Due to the intrinsic association of cardiac stress responses with increased calcium flux and production of reactive oxygen intermediates (ROS), we speculated that covalent YB-1 crosslinking may be driven by an enzymatic process activated by these important signaling agonists.

Towards the goal of discovering the biochemical basis for YB-1 oligomerization, we have examined the potential role of the protein crosslinking enzyme transglutaminase 2

(TG2) which is activated by calcium/ROS signaling. Transglutaminases (TGs) are a family of proteins which primarily function to produce covalently crosslinked proteins via intrinsic transamidation activity. TG2 enzymatic transamidation is characterized by the crosslinking of glutamine and lysine residues to form N-ε-(γ-glutamyl) lysyl isopeptide bonds (Greenberg et al., 1991). TG2 is upregulated in animal models of cardiac hypertrophy and heart failure (Iwai et al., 1995). Importantly, transgenic mice which overexpress TG2 in a cardiac-specific manner were found to have mild ventricular hypertrophy with diffuse interstitial fibrosis, accompanied by fetal gene re-activation including β-myosin heavy chain and α-skeletal actin (Small et al., 1999; Zhang et al.,

2003). Analysis of the YB-1 primary polypeptide sequence revealed the presence of glutamine and lysine residues in the amino- and carboxylterminal regions, respectively, of YB-1 positioned within a larger secondary-structure context (QQPPA and

RRRRPENPKP) previously associated with efficient transglutaminase 2 (TG2)-mediated transamidation (Csosz et al., 2008) and protein crosslinking (Figure 2.4). As shown in

Figure 2.5, analysis of mouse cardiac isografts subjected to two rounds of transplant surgery reveal that TG2 accumulates over a 11-day post-surgical recovery period. TG2 exhibited moderate localization at cardiac ICDs in fibrotic 2-hit hearts harvested 11 days after re-transplant. Notably, TG2 was highly enriched in interstitial zones occupied normally by cardiac fibroblasts (Figure 2.6). This observation suggested that TG2-

24 mediated YB-1 crosslinking may be functionally linked to cardiac fibrosis that emanates from the interstitial and perivascular zones after transplant.

2.4 Discussion

Cardiac allograft dysfunction is a slowly evolving pathogenic process that resembles unresolved wound healing (Shi et al., 1999; Schmauss and Weis, 2008; Subramanian et al., 2002). Pro-fibrotic TGFβ1 and thrombin are activated during the peri-transplant period and stimulate cardiac myofibroblast differentiation (Zhang et al., 2005). Scar- forming myofibroblasts may damage the coronary arterial vasa vasorum leading to accelerated transplant vasculopathy (Subramanian et al., 2002; Subramanian et al., 1998;

Suzuki et al., 1996; Shi et al., 1994). Moreover, biomechanical stress due to interstitial collagen may re-activate fetal contractile protein gene expression in graft cardiomyocytes via angiotensin II and TGFβ1 signaling that activates MEK1/Erk1,2 and PI3K/Akt kinases needed for hypertrophic growth and cellular survival (Rosenkranz, 2004; Weber

KT, 1995).

Re-activation of fetal contractile protein genes such as acta2 encoding the SMαA protein is a key feature of biomechanical stress-induced cardiomyocyte hypertrophy in the native heart as demonstrated in rodent models of left-heart failure caused by aortic banding and hemodynamic pressure overload (Black et al., 1991; Small et al., 2010; Small et al., 2010;

Liu et al., 2008). Studies on transgenic heart grafts programmed to express a green fluorescent protein (GFP) reporter gene driven by the mouse SMαA promoter revealed that cardiomyocytes surrounded by scar tissue were highly GFP-positive suggestive of biomechanical stress-specific re-activation of fetal SMαA gene transcription (Zhang et al., 2008). Using transgenic mice that develop severe interstitial fibrosis due to over-

26 expression of renin, Smithies and co-workers observed significantly more expression of the fetal β-myosin heavy chain protein in cardiomyocytes located proximal to scar tissue compared to distal myocytes (Pandya et al., 2006).

A key observation that set the stage for this dissertation project was that the YB-1 stress- response protein accumulates in the sarcoplasm of adult cardiomyocytes in parallel with enhanced expression of fetal SMαA protein. Induction of YB-1 was evident in isolated cardiomyocytes that were induced to de-differentiate either in serum-containing medium or in situ following two rounds of cardiac transplant designed to amplify alloantigen- independent, pro-fibrotic TGFβ1 signaling (Zhang et al., 2008; David et al., 2012). The localization of YB-1 at intercalated discs coupled with its ability to bind SMαA mRNA,

F-actin (Ruzanov et al., 1999), and microtubules (Chernov et al., 2008a) suggests that this protein could mediate transport of newly transcribed mRNAs to polysomes as well as re-program protein synthesis needed for myocyte remodeling and adaptation to cardiac biomechanical stress caused by fibrotic scar tissue. YB-1 has the ability to specifically bind SMαA mRNA transcripts via a purine-rich sequence translation-silencing site located in exon 3 (Kelm, Jr. et al., 1999b; Zhang et al., 2005).

Accumulation of YB-1 occurred in 2-hit heart grafts within sub-cellular regions known to contain polyribosomes. YB-1 is known to form mRNA-containing stress granules in other cell types (Yang and Bloch, 2007; Onishi et al., 2008; Goodier et al., 2007). We suspect that it has a similar function in ventricular myocytes where it might bind and

27 stabilize SMαA transcripts during transport to polyribosomes to augment fetal SMαA protein synthesis during periods of biomechanical stress. Stress injury-activated formation of YB-1 ribonucleoprotein complexes may hasten delivery of SMαA mRNA payloads to polyribosomes for high-output biosynthesis of G-actin monomers that can be quickly added to the ID-anchored, fast-assembly ends of F-actin. The localization of YB-

1 at cardiac intercalated discs in allografts was often proximal to SMαA-containing filamentous structures in 2-hit heart grafts suggestive of the coupling of mRNA translation with actin filament polymerization. Notably, granule-like YB-1 deposits were also noted in the peri-nuclear region, which may be further suggestive of a link between

YB-1 mRNA transport and the cytoskeleton. YB-1 recently was identified as a porter for viral proteins in influenza-infected cells, where YB-1-enriched peri-nuclear RNA granules shuttled nascent viral proteins from the nucleus to viral budding sites adjacent to the cellular membrane by a microtubule-dependent transport mechanism. Preliminary analysis of YB-1 subcellular localization in human pulmonary fibroblasts that will be the model of choice for studies described in Chapters 2 and 3 confirms that YB-1 p50 and p150 size variants are indeed associated with the non-ionic detergent insoluble cytoskeleton (Figure 2.7).

Interestingly, many YB-1-enriched IDs did not contain associated SMαA actin filaments implying that there may be a lag between deployment of cytosolic YB-1 granules to IDs and up-regulation of SMαA protein expression. Importantly, the phosphorylated form of the S6 ribosomal protein (S6RP) has been noted at IDs in human cardiac allografts (Lepin

28 et al., 2006). S6RP is a marker for active protein synthesis required for graft rejection in human heart transplant recipients. The sub-cellular localization of YB-1 at cardiac intercalated disks in fibrotic heart grafts is remarkably similar to the distribution of the

S6RP which is known to be regulated by the PI3K/Akt/mTOR pro-survival signaling that controls mRNA translation in metabolically stressed cells (Ramirez-Valle et al., 2010;

Silvera et al., 2010; Braunstein et al., 2007).

YB-1 ubiquitination and proteosome-mediated turnover is inhibited by mRNA (Chibi et al., 2008; Lutz et al., 2006; Sorokin et al., 2005) implying that the RNA-bound pool of

YB-1 may be preferentially stabilized after cardiac transplant. SMαA mRNA transcripts and YB-1 may be mutually beneficial in that the presence of one enhances stability of the other. This molecular mechanism may have evolved in cardiac muscle to efficiently couple gene transcription in the nucleus with transcript protection during transit to cytosolic polyribosomes. This process could assure adequate production of fetal gene protein needed for the compensatory response of cardiac muscle to abnormal biomechanical stress. Enhanced stability of cytosolic, mRNA-bound YB-1 in stressed cardiomyocytes may also be related to its ability to bind actin thin filaments in muscle either directly (Ruzanov et al., 1999) or via its high affinity interaction with cytosolic

Purα and Purβ proteins (Ohashi et al., 2002). Protein biosynthesis and quality control also may be governed by structural interactions between YB-1 and a number of other cardiac proteins associated with IDs including the cardiac ankyrin repeat domain 1 factor also known as CARP, titin, desmin, calsequestrin, myopalladin, and the MuRF1/2 (muscle-

29 specific RING finger) E3 ubiquitin ligases (Mikhailov and Torrado, 2008). As recently reviewed by Mikhailov and Torrado, these proteins demonstrate dynamic combinatorial interplay via shared ankyrin repeat and coiled coil domains resulting in the formation of specific gene regulatory complexes capable of shuttling between the nucleus and cytoskeleton as part of a cardiomyocyte biomechanical stress-response circuit in the developing and injured heart (Mikhailov and Torrado, 2008).

Samples from fibrotic mouse heart grafts and human myocardial biopsies revealed the presence of high molecular weight YB-1 protein complexes with high affinity for the exon 3 SMαA mRNA sequence. YB-1 p180, which appears to increase with time-after transplant interval, may be the preferred YB-1 mRNA binding isoform in remodeling heart grafts with high levels of SMαA expression. Immunoblots from extracts prepared from biopsies collected from patients 9-17 years after heart transplant showed that fetal

SMαA positive biopsies contained more detectable YB-1 (p50 and p100-p250) than biopsies collected from patients 1-6 years after transplant who were SMαA negative. Of note, high molecular weight variants of YB-1 were extremely stable and resistant to dispersion by denaturing SDS-PAGE, implying that covalent modification of the primary

YB-1 polypeptide chain may mediate the formation of YB-1 oligomers. Covalent oligomerization of YB-1 may also explain how punctate YB-1 aggregates come to be densely accumulated at IDs in transplanted 2-hit heart grafts.

Purified YB-1 does exhibit the ability to polymerize into nanofiber structures (Selivanova et al., 2010) and this appears to affect mRNA binding activity translation. Consistent with

30 this idea, YB-1 can act as either a repressor or activator of global protein synthesis, depending on the YB-1:mRNA ratio. At low YB-1 to mRNA ratios, YB-1 tends to exist in the monomer form and promotes translation initiation (Skabkin et al., 2004;

Evdokimova et al., 1998), while at high YB-1 to mRNA ratios, YB-1 tends to form large multimers (Skabkin et al., 2004) and also strongly inhibits mRNA translation in vitro

(Evdokimova et al., 2001) and in vivo (Davydova et al., 1997). YB-1 has been noted to form extended amyloid-like fibril structures when exposed to high concentrations of monovalent cations (Guryanov et al., 2012; Selivanova et al., 2010), however literature reports on biochemical phenomena that may induce the formation of covalent YB-1 oligomers under physiological conditions are currently lacking. We speculate that YB-1 oligomerization may drive formation of specialized mRNA storage granules important for packaging, protection, and transport of fetal contractile protein transcripts for localized translation at polyribosome-enriched sites in the sarcoplasm.

To explain the process of YB-1 oligomerization, we have focused our attention on the potential role of the crosslinking enzyme transglutaminase 2 (TG2) which has been implicated in wound healing and fibrosis (Olsen et al., 2011; Fesus and Piacentini, 2002), cellular aging (Santhanam et al., 2010; Jandu et al., 2013) cardiac development (Lee et al., 2000), and hypertrophic cardiac disease (Li et al., 2009; Iwai et al., 1995).

Transglutaminases are a family of proteins that primarily crosslink proteins via intrinsic and reversible transamidation activity. Transamidation is characterized by the crosslinking of glutamine and lysine residues to form N-ε-(γ-glutamyl) lysyl isopeptide

31 bonds (Greenberg et al., 1991). TG2 is unique to the transglutaminase family in that is expressed ubiquitously, has sub-and extracellular localization, and exhibits pleiotropic function including GTP-ase and kinase activity (Chen and Mehta, 1999; Fesus and

Piacentini, 2002; Thomazy and Fesus, 1989). TG2 is an important wound healing and stress response protein and has been implicated in the pathobiology of pulmonary and liver fibrosis, atherosclerosis, neurodegenerative and autoimmune diseases, inflammatory enteropathies, and cancer metastasis (Ientile et al., 2007; Telci and Griffin, 2006; Auld et al., 2001; Johnson et al., 2008; Aeschlimann and Thomazy, 2000; De and Gentile, 2008).

TG2 is increasingly expressed during the aging process, in correlation with age- associated increases in oxidative stress and inflammation, both of which drive functional decline in the aging heart (Park et al., 1999; Johnson et al., 2008; Muscari et al., 1996;

Muller-Werdan, 2007).

TG2 is upregulated in animal models of cardiac hypertrophy and heart failure (Iwai et al.,

1995). Importantly, transgenic mice which overexpress TG2 in a cardiac-specific manner were found to have mild ventricular hypertrophy with diffuse interstitial fibrosis, accompanied by fetal gene re-activation including β-myosin heavy chain and α-skeletal actin (Small et al., 1999; Zhang et al., 2003). As shown in this dissertation, TG2 accumulated in mouse cardiac isografts subjected to two rounds of transplant surgery over a 11-day post-surgical recovery period. IHC analysis of these “2-hit” isografts further revealed that TG2 was highly enriched in interstitial cardiac fibroblasts. We previously published that YB-1 regulates SMαA expression at the post-transcriptional

32 level in pulmonary fibroblasts treated with fibrogenic agonists TGFβ or thrombin. Thus, the observed enrichment of TG2 protein in interstitial cardiac fibroblasts is of fundamental interest and suggestive of a role for TG2 in cardiac myofibroblast biology and fibrosis. Covalent crosslinking of the YB-1 polypeptide may be coupled to myofibroblast differentiation leading to increased contractility, interstitial ECM production, and tissue stiffness, ultimately to place an extreme mechanical burden on ventricular cardiomyocytes causing dysfunctional hypertrophic responses.

TG2 may similarly promote myofibroblast activation and fibrosis of the lung, where TG2 has been shown to play an important role in pulmonary fibrosis (Olsen et al., 2011).

Taken together with our present experimental results that implicate TG2 in the formation of covalent YB-1 oligomers, the association of TG2 with myofibroblast activation in the heart and lung suggested that TG2-mediated YB-1 crosslinking may be a fundamental driver of cardiopulmonary fibrosis. In cardiomyocytes, transplant-associated increases in calcium and ROS signaling may stimulate TG2 activation and formation of YB-1 oligomers containing protected mRNA transcripts for fetal contractile proteins en route to localized translation at the IDs. In injury-activated fibroblasts, YB-1 may similarly undergo TG2 mediated crosslinking that promotes differentiation into SMαA-expressing myofibroblasts that further contribute to biomechanical stress-activation of cardiomyocyte fetal gene reprogramming.

YB-1 binds SMαA mRNA and suppresses translation via an exon-3 inverted MCAT motif that also is present as a regulatory motif in the SMαA promoter, where YB-1 functions as an SMαA transcriptional repressor. MCAT regulatory motifs are important regulators of multiple cardiac and smooth muscle specific genes during development and disease and were originally identified as a muscle-specific cytidine-adenosine-thymidine sequence 5’-CATTCCT-3’ in the chicken cardiac troponin T promoter (Cooper and

Ordahl, 1985; Yoshida, 2008). In addition to SMαA, MCAT sequences are present as regulatory motifs in a number of gene promoters associated with mechanical stretch- activation and cardiac fetal gene reprogramming including βMHC, α-MHC, and SkαA

(Yoshida, 2008). The presence of MCAT regulatory sequences in the SMαA promoter as well as SMαA mRNA which both interact with YB-1 is suggestive of a role for YB-1 mediated coupling of translation- and transcriptional control via this MCAT regulatory motif. A new concept in post-transcriptional control of gene expression was recently proposed based on observations that multiple mRNAs are often co-regulated by one or more RNA binding proteins that are thought to coordinate splicing, export, stability, cellular localization, and translation control (Keene and Tenenbaum, 2002; Keene and

Lager, 2005). According to this model, functionally related proteins are coordinately regulated during development, disease, or in response to environmental cues as “post- transcriptional regulons” through a ribonucleoprotein-driven mechanism (Keene, 2007;

Keene and Lager, 2005). Thus, we speculate that YB-1 may similarly regulate the translation of stress-responsive mRNAs as part of a possible stress-response post- transcriptional “regulon” by interacting with MCAT or other conserved regulatory motifs

34 in these mRNAs. To generate preliminary evidence for this hypothesis, the nucleic acid sequences for mRNAs associated with the cardiac stress response including atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), skeletal alpha-actin (SkαA), smooth muscle alpha-actin (SMαA), alpha cardiac myosin heavy chain (αMHC), beta cardiac myosin heavy chain (βMHC), vascular endothelial growth factor A (VEGF-A), and vascular endothelial growth factor B (VEGF-B) were scanned for the presence of the

MCAT motifs CAUUCCU/A or CAUGCCA or one of several RNA sequences known to bind YB-1 and other cold-shock domain family proteins with high affinity (Coles et al.,

2004). After identifying positive hits that were conserved between mouse and human mRNAs, the binding motif and 7-10 flanking nucleic acid sequences were used to create biotinylated mRNA probes that were used to assess binding to purified mouse recombinant YB-1 through RNA affinity methods using paramagnetic streptavidin-coated beads. Besides fetal SMαA mRNA, we have confirmed that YB-1 also can bind homologous sequences in mRNAs encoding mouse and human forms of α-myosin heavy,

β-myosin heavy chain, skeletal α-actin, VEGF-A, and VEGF-B (Table 2.1) that are known to be up-regulated in biomechanically stressed heart muscle. While very preliminary, these results are suggestive of a general role for YB-1 in the collective regulation of stress-response mRNAs associated with chronic cardiopulmonary fibrotic disease. YB-1 oligomer accumulation may have a global role in cardiopulmonary protection by functioning as chaperone proteins for newly transcribed fetal mRNAs during their passage from the nucleus to sites of protein synthesis located at cytosolic polyribosomes. We further surmise that TG2, by modifying YB-1 ribonucleoprotein

35 structure and function, may program mRNA translation efficiency to selectively enhance synthesis of proteins important for tissue adaptation to metabolic and biomechanical stress. Validating these ideas and identifying the molecular events that lead to maladaptive tissue remodeling may facilitate development of therapeutic interventions that reduce the incidence of dysfunctional cardiopulmonary fibrosis.

Figure 2.1: Expression and localization of YB-1 after murine cardiac transplant.1 An antibody specific for the YB-1 cold shock domain (anti-YB1 polyclonal antibody M85-110) revealed deposition of YB-1 protein (red-brown) at cardiac intercalated discs (IDs) in an accepted allograft 60 days after heterotopic transplant (panel a). Double- labeling with an anti-SMαA antibody revealed that cardiomyocyte sarcomeres in allografts also contained fetal SMαA protein (blue-purple) although its distribution did not always correlate with YB-1 deposition at IDs which seemed more consistently reactive with the anti-YB-1 antibody. Panels (b-d) show YB-1 distribution in 2-hit isografts at day 3 (panel b) and day 11 (panels c, d) using an antibody specific for the C- terminus of the YB-1 polypeptide (Y-0271, amino acid residues 307-324) that only reacts with p50 YB-1. While p50 YB-1-enriched IDs were noted at day 3, reactivity of these structures with the anti-YB-1 antibody was more pronounced by day 11 (arrows, panel c). Punctate YB-1 deposits were observed in the peri-nuclear and ID regions of cardiomyocytes in 2-hit, day-11 hearts when viewed at high magnification (arrows, panel d). Panels (e-f) depict 1-hit and 2-hit isografts, respectively, reacted with the anti-SMαA antibody. Only hearts grafts subjected to two rounds of transplant surgery contained SMαA-positive sarcomeres (arrows, panel f) although SMαA-positive microvascular structures were evident in both types of grafts. Non-transplanted donor heart tissue did not react with the p50-specific anti-YB-1 antibody (panel g). LV designates the left ventricular luminal space. Objective magnification: panels a-c and e-g, 10X; panel d, 40X. (Data presented in collaboration with Dr. Jason David and Dr. Arthur Strauch)

Figure 2.1

Figure 2.2: Both p50 and p180 forms of YB-1 in biopsies from cardiac transplant patients bind SMαA mRNA with apparent “time-after-transplant” differences in affinity. 2 RNA-affinity binding assays indicated that the preferred SMαA mRNA binding form of YB-1 in human endomyocardial biopsies is an apparent 180 kDa oligomer. Biopsy samples 1-4 in the left panel were collected from four different patients 52, 82, 262, and 314 weeks after heart transplant, respectively. Samples 1-4 on the right were collected 486, 540, 575, and 890 weeks after transplant, respectively, from another cohort of four patients. Samples 5 and 6 in both series are from normal mouse heart and mouse fibroblasts, respectively. The p180 variant seems to be specific for cardiac muscle. (Data presented in collaboration with Dr. Jason David and Dr. Arthur Strauch)

Figure 2.3: High molecular weight YB-1 variants in endomyocardial biopsy-protein extracts collected from heart transplant patients. 3 YB-1 immunoblot prepared from biopsy-samples collected at the 2, 10, 23, and 162 week post-transplant intervals (lanes from left to right). The prototypical YB-1 p50 band is denoted by the arrow and several higher molecular weight YB-1 bands (hMWYB1) proximal to the p150 marker are variably detected by a CSD-specific, anti-YB-1 antibody. The lower panel depicts GAPDH levels to show equivalent protein loadings in each lane of the immunoblot.

Figure 2.4: Location of potential TG2-reactive amino acids in mammalian YB-1. 4 Amino- and carboxyl-terminal regions of the YB-1 polypeptide contain respective glutamine and lysine residues that are potential substrates for TG2 transamidation.

Figure 2.5: Mouse cardiac isografts subjected to 2 rounds of transplant surgery accumulate transglutaminase 2 (TG2) over a 11-day post-surgical recovery period.5 (left panel). TG2 migrates as a 72 kDa polypeptide. The smaller band seen in day 11 samples may correspond to a MMP2 protease- or ubiquitin-mediated TG2 turnover product observed by others under conditions of high oxidative stress and calcium influx (Jeong et al., 2009; Belkin et al., 2004).

Figure 2.6: Localization of TG2 after murine cardiac transplant. 6 (a) TG2 exhibited moderate localization at cardiac IDs in fibrotic 2-hit hearts harvested 11 days after re-transplant (lower arrow). Notably, TG2 was highly enriched in interstitial zones occupied normally by cardiac fibroblasts (upper arrow). (b) No-antibody control. (Data presented in collaboration with Dr. Jason David and Dr. Arthur Strauch)

Figure 2.7: YB-1 p150 oligomers are enriched in subcellular fractions containing the cytoskeleton. 7 The figure depicts YB-1 expression in the pool of cytoplasmic proteins released from human pulmonary fibroblasts immediately after lysis (S), the fraction released following treatment with 5mM ATP and 1mM EGTA (A/E), and the extraction-resistant cytoskeleton remnant (C). YB-1 p150 approximately 150 kDa in size are highly enriched in the cytoskeleton fraction (arrow).

Table 2.1: YB-1 binds fetal/stress response mRNAs via conserved consensus motifs.1 (top panel) The chart depicts recombinant YB-1 mRNA binding via conserved MCAT motifs (Yoshida, 2008) or via one of several nucleic acid sequences with known affinity for YB-1 and other cold-shock domain proteins (Coles et al., 2004). After identifying the presence of potential YB-1 interacting consensus motifs in the mRNAs listed, biotinylated mRNA probes were constructed and analyzed for binding to purified recombinant YB-1. Positive binding reactions are denoted by ( ). Lack of motif presence is denoted by (---). (bottom panel) Consensus motif legend listing the mRNA binding motifs corresponding to generic nomenclature used for biotinylated mRNA probes (see Materials and Methods). *Note that SMαA mRNA MCAT probes do not follow the above convention, and are referred to as “CE-RNA” and “3’UTR” due to previously established precedents.

Table 2.1

YB-1 binding consensus motifs

Gene CAUUCCA/U CAUGCCA UCCUAC CCCAUCU AAC**CA Products

SMαA ------

SkαA ------

βMHC ---

αMHC ------

VEGF-A ------

VEGF-B ------

Consensus motif legend:

Generic Nomenclature (corresponding to Consensus

mRNA probes)* motif

MCAT 1 CAUUCCA/U

MCAT2 CAUGCCA

CSD1 UCCUAC

CSD3 CCCAUCU

CSD4 AAC**CA

Chapter 3: Transglutaminase-2 mediates calcium-regulated crosslinking of the Y-

Box 1 (YB-1) translation-regulatory protein in TGFβ1-activated myofibroblasts

3.1 Introduction

The role of TGFβ1 receptor signaling is well known in the capacity of initiating the earliest cellular responses to tissue injury that, if poorly regulated, can lead to chronic myofibroblast differentiation and dysfunctional cardiopulmonary fibrosis (Willis and

Borok, 2007; Liu et al., 2009; Frangogiannis, 2006; Grotendorst et al., 2004; Gabbiani,

2003; Strauch and Hariharan, 2013). Inflammatory cells release proteases at sites of tissue damage with resultant activation of latent TGFβ1 deposited at extracellular sites during platelet de-granulation and thrombosis. Subsequent phosphorylation and nuclear translocation of canonical TGFβ1 receptor-regulated Smad proteins initiates myofibroblast differentiation including transcriptional activation of genes encoding smooth muscle α-actin (Liu et al., 2009; Zhang et al., 2005; Subramanian et al., 2004;

Strauch and Hariharan, 2013) and the α1 and α2 subunits of type I collagen (Norman et al., 2001; Higashi et al., 2003; Small et al., 2010) required for assembly of an actomyosin-based contractile apparatus, efficient wound closure, and repair of damage to the extracellular matrix needed for restoring tissue structure and function. Signaling provided by non-canonical signaling downstream from TGFβ1 receptor activation

47 including Akt and p38-MAP kinases can augment SMαA gene transcription via the calcium-regulated NFAT transcription factor (Davis et al., 2012; Nishida et al., 2007;

Gonzalez Bosc et al., 2005). Moreover, polymerization of the filamentous SMαA cytoskeleton from G-actin monomers further augments gene activation in myofibroblasts by fostering nuclear uptake of the MRTF-A transcriptional co-activator protein that dissociates from G-actin during F-actin assembly and potentiates SRF binding and transcriptional activation at several CArG box DNA-sequence motifs in the SMαA promoter (Masszi et al., 2010; Small et al., 2010; Elberg et al., 2008; Strauch and

Hariharan, 2013).

Recent reports indicate an emerging role for Y-box binding protein 1 (YB-1) in governing SMαA and type I collagen mRNA stability, transport, and translational efficiency in the context of TGFβ1-mediated fibrosis and maladaptive tissue remodeling in the heart, lung, liver, and kidney (Subramanian et al., 2002; Zhang et al., 2008; Zhang et al., 2005; Hanssen et al., 2011; Fraser et al., 2008; Dooley et al., 2006) Thrombin and non-canonical TGFβ1 receptor-mediated activation of MEK1/Erk1,2 signaling in human pulmonary myofibroblasts disrupts the physical interaction between YB-1 and a translation-silencer sequence in exon 3 of SMαA mRNA resulting in a rapid and self- limiting burst of SMαA protein synthesis (Kelm, Jr. et al., 1999b; Zhang et al., 2005). In the cytosol, YB-1 also binds actin filaments and microtubules (Chernov et al., 2008b) and accumulates proximal to cardiac intercalated discs following heart transplant (David et al., 2012).

Deposition of ribonucleoprotein complexes of YB-1 and mRNAs at polyribosomes located at cardiac intercalated discs may re-program protein synthesis required for allograft surgical healing, metabolic adaptation, and host tolerance. YB-1 is an evolutionarily conserved member of the ancient Y-box protein family containing a cold- shock domain (CSD) that exhibits high-affinity binding to single-strand nucleic acid

(Evdokimova et al., 2006a; Kohno et al., 2003; Wolffe, 1994). YB-1 unwinds duplex

DNA and regulates transcriptional activity of several genes associated with inflammation, fibrosis, cell proliferation, tumor cell metastasis, and epithelial-mesenchymal transition

(Eliseeva et al., 2011). YB-1 also binds stem-loop structures in mRNAs encoding proteins needed for cell survival and recently was identified in cytoplasmic granules with possible functional importance in controlling mRNA stability, intracellular transport, and translational activity during peroxidative stress. YB-1 may facilitate cellular adaptation to metabolic stress by reducing the energy demand associated with the synthesis of numerous highly specialized proteins while favoring translation of an essential sub-set of mRNAs needed for basic cell survival (Yamasaki and Anderson, 2008; Keene, 2007).

In this report we show that increased expression of SMαA protein during TGFβ1-induced myofibroblast differentiation was associated with the formation of YB-1 oligomers exhibiting SMαA mRNA-binding activity. YB-1 oligomers showed high resistance to dispersal during denaturing SDS-PAGE suggestive of covalent protein crosslinking. We determined that YB-1 is a substrate for the crosslinking enzyme, transglutaminase 2

(TG2), a ubiquitous member of the protein-glutamine γ-glutamyltransferases enzyme family (EC 2.3.2.13) with mechanistic importance in aging, myocardial hypertrophy, vascular compliance, kidney and pulmonary fibrosis, and wound healing (Gundemir et al., 2012; Park et al., 2010; Stamnaes et al., 2010; Stephens et al., 2004; Stamnaes et al.,

2008; Kiraly et al., 2009; Olsen et al., 2011; Lin et al., 2011; Santhanam et al., 2010;

Mehta et al., 2010; Iismaa et al., 2009).

TG2 catalyzes the calcium-dependent formation of covalent γ-glutamyl-isopeptide linkages via a transamidation reaction in response to peroxidative stress (Stamnaes et al.,

2008; Stamnaes et al., 2010). Importantly, intracellular TG2 mediates fibrogenesis downstream from TGFβ1 signaling in fibroblasts pointing to its potential importance in the molecular etiology of chronic fibrotic diseases that cause irreversible cardiopulmonary remodeling (Oh et al., 2011). Transamidation reactions using purified recombinant protein, intact human pulmonary fibroblasts, and fibroblast lysates, revealed that YB-1 was an authentic TG2 substrate and that protein-crosslinking activity was calcium-concentration dependent and enhanced by inclusion of an oligonucleotide encompassing the exon 3 YB-1 binding site that mediates translational control of SMαA mRNA. Notably, the YB-1 crosslinking reaction was partly reversible via the known intrinsic isopeptidease activity of TG2 suggesting that YB-1 oligomer formation and dissolution may be dynamic, metabolically regulated events during myofibroblast differentiation.

3.2 Materials and Methods

Cell Culture Methods and Preparation of Protein Extracts. Human Pulmonary fibroblasts were cultivated as described in Chapter 2. Human pulmonary artery adventitial fibroblasts (PAAFs) established in primary culture from artery explants obtained at autopsy were provided by the Pulmonary Hypertension Breakthrough

Initiative, Ann Arbor, MI. PAAFs were cultivated in defined medium SmGM2 containing

5% hiFBS (Lonza, Walkersville, MD). Cell preparations were cultivated in a humidified incubator at 37°C at 5% CO2 and were rendered quiescent by a 48 hr exposure to

HEPES-buffered DMEM (1.0 g/L D-glucose) containing 0.5% hiFBS and penicillin- streptomycin-FungizoneTM. Recombinant human TGFβ1 (5 ng/mL, final concentration;

R&D Systems, Minneapolis, MN) was added to cultures for varying periods before preparation of protein extracts. Human plasma thrombin (1000 NIH U/mg protein) was obtained from Calbiochem (La Jolla, CA) and used at a final concentration of 5U/mL

(Zhang et al., 2005). Right ventricular septal endomyocardial biopsies were retrieved under aseptic conditions from participating patients providing informed written consent.

As previously reported, biopsies were collected in the cardiac catheterization laboratory in the Ross Heart Hospital, The Ohio State University Medical Center and processed for protein extracts in accordance with IRB-approved protocols (David et al., 2012).

To prepare nuclear and cytosolic protein extracts, cell monolayers were washed twice with Dulbecco’s phosphate-buffered saline (PBS), scraped into fresh PBS, sedimented at

3000 rpm, washed once more in PBS, and resuspended in 400 µL of a hypotonic buffer

(10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride [PMSF], and 0.5 mM dithiothreitol [DTT]). Cells were allowed to swell on ice for 15 min followed by the addition of 25 µL of a 10% solution of

NonidetTM NP-40 and vigorous vortexing for 10 sec to rupture the cells and release nuclei that were then collected by centrifugation at 4°C. Supernatants containing the cytosol fraction were reserved and stored at -80°C. Nuclei were re-suspended in ½ packed-pellet volume of ice-cold, low-salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM

MgCl2, 20 mM KCl, 0.2 mM EDTA, 0.2 mM PMSF, 0.5 mM DTT). High salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 1.2 M KCl, 0.2 mM EDTA, 0.2 mM

PMSF, and 0.5 mM DTT) equal to ½ packed-pellet volume was added and the nuclei further extracted with gentle rocking for 20 min at 4°C. Nuclear debris was removed by a

30 min centrifugation at 14,500 rpm at 4°C and the supernatant immediately desalted by buffer-exchange with low-salt buffer using a 0.5 mL capacity 10,000 MWCO Amicon centrifugal-microfiltration device (Millipore, Billerica, MA). To prepare RIPA (whole cell extracts), PBS-washed fibroblasts were scraped from culture vessels into PBS, sedimented at 3000 rpm, washed once in PBS, and extracted in 200 µL of RIPA buffer

(50 mM Tris-HCl, pH 8.0, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail, 0.2 mM PMSF, and 1 mM DTT) for 30 min on ice. RIPA Extracts were clarified by centrifugation at 14,500 rpm for 30 min at 4°C and the resulting supernatant stored at -80°C.

RNA-binding assays. The following synthetic biotinylated oligonucleotide probes

(Integrated DNA Technologies, Coralville, IA) were used in this study: (1) a 30-nt RNA- coding element from exon 3 of SMαA mRNA (CE-RNA, gggaguaaugguuggaaugggccaaaaaga), previously shown to bind YB-1 and Pur proteins

(Kelm, Jr. et al., 1999b) (2) a 25-nt sequence containing a cold-shock domain-like consensus (underlined text) from exon 9 of SMαA mRNA (CSD1, gaucgguggcuccaucuuggcuucgc), (3) a 25-nt sequence containing a cold-shock domain- like consensus motif (underlined text) from exon 8 of SMαA mRNA (CSD4, gcauccacgaaaccaccuauaacagc), and (4) a 25-nt sequence encompassing an MCAT-like sequence (underlined text) from the 3’untranslated region of SMαA mRNA (3’UTR, 5'- uuuccaaaucauuccuagccaaagcu-3'). RNA-binding reactions containing either RIPA or nuclear protein extracts (100 μg) and biotinylated oligonucleotides (100 pmol; Integrated

DNA Technologies, Coralville, IA) were incubated in a buffer containing 5μg/ml poly(dI-dC), 10 mM Tris, pH 7.5, 50 mM NaCl, 0.5 mM DTT, 0.5 mM EDTA, 0.12 mM

PMSF, 4% glycerol. Protein:RNA complexes were captured during a 30 min incubation with streptavidin-immobilized paramagnetic beads (Promega, Madison, WI; 0.6 mL bead suspension/reaction) as described previously (Cogan et al., 2002; Subramanian et al.,

2004; Zhang et al., 2008). After washing four times with buffer containing 25 mM Tris-

HCl, pH 7.5, 1 mM EDTA, and 100 mM NaCl, bound protein was eluted using one packed-bead volume of 2X protein-denaturing buffer and analyzed by SDS-PAGE and immunoblot procedures.

Immunoblot procedures. Proteins were size-fractionated by SDS-PAGE on 10% polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes.

Standard protein transfers were performed overnight at a constant 45 mA using a TE22 electrophoretic transfer apparatus (Hoefer, Inc., Holliston, MA) and a transfer buffer containing 25 mM Tris, 190 mM glycine, 20% methanol. For high-efficiency transfer of high molecular weight YB-1 oligomers, gels were transferred to membranes using a slightly modified method employing a single-use transfer buffer containing 48 mM Tris,

390 mM glycine, 0.05% SDS, and 20% methanol and two-stage electrophoresis process

(60 mA for 16 hr followed by 450 mA for an additional 3 hr).

After overnight blocking at 4°C in Tris-buffered saline (TBS; 25 mM Tris-HCl, pH 7.5, and 150 mM NaCl) containing 0.1% (v/v) Tween 20TM and 5% (w/v) bovine serum albumin (BSA), nitrocellulose blots were incubated with selected rabbit polyclonal antibodies (1–2 µg/mL) overnight at 4°C with gentle rocking. Blots were washed four times at room temperature over a 20-min period in TBS containing 0.3% (v/v) Tween

20TM, incubated with horseradish peroxidase-conjugated, goat anti-rabbit secondary antibody for 45 min, washed, and processed for antibody visualization by chemiluminescence (Thermo Scientific, Rockford, IL) that was detected and captured using ChemiDocTM XRS CCD-based imaging instrumentation (BioRad, Hercules, CA).

Chemiluminescence image-capture times were varied over a period of 30-500 sec to distinctly resolve the p50 and p75-250 weight regions on immunoblots that are depicted

54 in some figures as separate digital-image components. Antibodies for detection of transglutaminase 2 were obtained from Cell Signaling Technology (Beverly, MA).

YB-1-specific rabbit polyclonal antibodies M85–110 and M276–302 are reactive with the

YB-1 CSD and C-terminal regions, respectively and were kindly provided by Dr. Robert

J. Kelm, Jr., in the Department of Medicine, Cardiovascular Research Center, at the

University of Vermont (Kelm, Jr. et al., 1999a). Additional rabbit polyclonal antibodies specific for either N- or C-terminal portions of YB-1 were obtained from Sigma-Aldrich

(St. Louis, MO) and an anti-histidine antibody (RGSHHHH anti-HIS mouse IgG1 monoclonal antibody) used to detect recombinant N-HIS YB-1 (see below) in crosslinking reactions was obtained from Qiagen Sciences (Germantown, MD).

Purification of re d combinant N-His YB-1. Expression of recombinant N-terminal hexahistidine-taggemouse YB-1 (N-HisYB-1) in Escherichia coli was performed as described (Knapp et al., 2006; Kelm, Jr. et al., 1999a). Bacterial cell pellets weighing approximately 1 g were suspended in XtractorTM lysis buffer (Clonetech, Mountainview,

10) for a total of six 10-sec bursts with 1-min incubations on ice between bursts. Lysates were clarified by centrifugation at 14,000xg for 20 min at 4°C and incubated in 1 mL

Talon metal-affinity resin (Clontech) for 20 min at room temperature with gentle agitation. Resin-bound protein was sedimented at 700xg for 5 min and washed twice with

20 bed volumes of wash buffer (50 mM sodium phosphate, pH 7.4, 300 mM NaCl, 5 mM

HisYB1 was eluted from the resin using 5-bed volumes of wash buffer containing 150 mM imidazole and concentrated in a centrifugation-filter device (Ultracel 10K,

Millipore). The relative purity of N-HisYB-1 -containing fractions was assessed by

Coomassie Fluor-Orange (Invitrogen) staining and SDS-PAGE immunoblot analysis of protein eluate using the RGSHHH anti-HIS mouse IgG1 monoclonal antibody.

Transglutaminase 2-mediated YB-1 crosslinking reactions. For crosslinking assays using endogenous YB-1 as substrate, 50 µg aliquots of RIPA whole-cell extracts prepared from human pulmonary fibroblasts were incubated in a transglutaminase 2 (TG2) reaction buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 0.2 mM PMSF, 1 mM DTT, and protease inhibitor cocktail) with the indicated amounts of purified guinea pig liver TG2

(Sigma-Aldrich) in the presence or absence of 3 mM CaCl2. This concentration of calcium was selected to assure maximal in vitro TG2 transamidation activity. For Ca2+- free reactions, buffers were additionally supplemented with 2 mM EGTA. Reactions were incubated for up to 150 minutes at 37°C and terminated by the addition of 2X SDS-

56 sample buffer (100 mM Tris HCl, pH 6.8, 4% w/v SDS, 20% (v/v) glycerol, 0.2% (w/v) bromophenol blue, 200 mM DTT) followed by heating for 5 min at 100°C. Reaction products were size-fractionated by SDS-PAGE using 10% polyacrylamide gels, transferred to nitrocellulose membranes, and processed for immunoblot analysis using the panel of anti-YB-1 antibodies described above. For in vitro TG2-mediated crosslinking assays using purified recombinant mouse N-HisYB1 as a substrate, a calcium/EGTA buffer system was used to precisely control free Ca2+ levels. The reaction buffer base consisted of 100 mM MOPS, pH 7.5, 0.2 mM PMSF, 1 mM DTT and protease inhibitor cocktail adjusted to various concentrations of free calcium using a 2 mM EGTA stock solution. Ca2+/EGTA buffer formulations were determined using a free-access software program (Dweck et al., 2005). Aliquots of N-HisYB1 were pre-warmed for 5 min at

37°C prior to adjusting the free calcium concentration with EGTA. Reaction mixtures containing varying amounts of purified guinea pig liver TG2, (0 to 1 mU/μL) as noted in the text, were incubated for 60 min at 37°C and terminated by adding 2X SDS-sample buffer followed by heating at 100°C for 5 min. Reaction products were size-fractionated by SDS-PAGE on 10% polyacrylamide gels, transferred to nitrocellulose membranes, and processed for immunoblot analysis using anti-histidine or anti-YB-1 antibodies as described above.

For in situ TG2-mediated crosslinking reactions (Oh et al., 2011), human pulmonary fibroblasts were incubated for 60 min with 1 mM biotinylated pentylamine substrate (EZ- link, Pierce, Rockford, IL) followed by an additional 60min exposure to 1.5mM hydrogen

57 peroxide or vehicle. RIPA extracts were prepared as noted above followed by size- fractionation of TG2 reaction products by SDS-PAGE. Biotin-tagged fibroblast proteins were detected on blots using streptavidin-coupled horse radish peroxidase and a standard chromagen-development chemistry (Invitrogen). To immunoprecipitate biotinylated YB-

1 from the TG2 crosslinking reactions, 10 µg of anti N-terminal YB-1 polyclonal antibody (Sigma) was added to 200 µL of whole cell extract at a concentration of 1 mg/mL and allowed to incubate overnight at 4°C. Immune complexes were captured at

4°C by incubation for 90 min with a 50 μL aliquot of IgG-conjugated DynabeadsTM (M-

280, anti-rabbit IgG, Invitrogen). The beads were placed on a magnetic stand and washed thrice in RIPA buffer. Immune complexes were eluted from the beads with 30 µL of 2X

SDS sample buffer followed by heating at 100°C for 5 min and evaluated for the presence of biotinylated proteins by streptavidin-peroxidase immunoblot analysis. IgG-

Dynabead control reactions were also performed using lysates in the absence of the immunoprecipitation capture antibody to assess non-specific adsorption of cellular proteins to the antibody-bead matrix.

Transglutaminase 2 siRNA knock-down and enzyme inhibition. To inhibit endogenous

TG2 protein expression, a duplex siRNA sequence

5'AAGGGCGAACCACCTGAACAA-3' was synthesized (Qiagen Sciences) and utilized in fibroblast-transfection studies to specifically ablate the coding sequence of human TG2 mRNA (Mann et al., 2006). As a control for TG2- targeting specificity, cells also were transfected with a scrambled-sequence siRNA with no homology to any known

58 mammalian gene (AllStarsTM Negative control siRNA, Qiagen). For cell transfections, siRNA-liposomal complexes were pre-formed by incubating duplex siRNA with 3 ul

RNAimaxTM Lipofectamine reagent (Invitrogen) in 500 ul DMEM. After a 20 min incubation period, the mixture was added to pulmonary fibroblasts maintained at 40% confluent in 6-well tissue-culture plates using antibiotic-free, DMEM/Ham’s F12 growth medium (1:1) containing 10% hiFBS. Cells were harvested 72 hrs after transfection following exposure to either rhTGFβ1 (5 ng/mL) or vehicle during the last 24 hrs as noted in the text.

For TG2 enzyme inhibition studies, a stock solution of the competitive TG2 antagonist monodansylcadaverine (MDC; Sigma-Aldrich) was prepared fresh in DMSO and used for a 24 hr dose-response study of YB-1 oligomer expression in human pulmonary fibroblasts maintained in complete growth medium. RIPA extracts were prepared from whole cells treated with either siRNA or MDC, size fractionated on denaturing SDS-

PAGE, and processed for YB-1 immunoblot analysis as described above. The TG2- reactive site inhibitor cystamine (0.1 to 1 mM) also was used to inhibit transamidation in intact fibroblasts and RIPA extracts (Jeon et al., 2004) and diphenyleneiodonium chloride

(DPI, Sigma/Aldrich) was used over a range of 2.5-30 μM to inhibit NADPH oxidase- mediated production of hydrogen peroxide in intact TGFβ1-activated fibroblasts, as previously described (Hecker et al., 2009).

3.3 Results

Recombinant mouse YB-1 is a substrate for transglutaminase 2. Recent histologic analysis of post-transplant myocardial remodeling in accepted murine heart grafts using antibodies specific for the mRNA-binding CSD and C-terminal regions of YB-1 revealed the presence of granular structures in both the peri-nuclear and intercalated disc regions

(Chapter 2 and (David et al., 2012)). This observation was consistent with the intrinsic ability of YB-1 to form large supramolecular structures (Selivanova et al., 2010) as well as cytosolic stress granules containing mRNAs that encode proteins required for cellular adaptation to metabolic stress (Yang and Bloch, 2007; Onishi et al., 2008; Skabkin et al.,

2004; Nekrasov et al., 2003; Chernov et al., 2008b). In support of the idea that YB-1 oligomerization occurs in accepted heart grafts, we noted in Chapter 2 that endomyocardial biopsies collected from heart transplant patients at various times during a

3-year post-operative period revealed YB-1 size variants migrating in the vicinity of the

150 kDa size marker. The relative resistance of YB-1 oligomers to dispersal during denaturing SDS-PAGE in the presence of reducing agents was suggestive of covalent protein crosslinking. In this regard, we also noted the presence of glutamine and lysine residues in the amino- and carboxylterminal regions, respectively, of YB-1 positioned within a larger secondary-structure context (QQPPA and RRRRPENPKP) previously associated with efficient transglutaminase 2 (TG2)-mediated transamidation (Csosz et al.,

2008) and protein crosslinking (Chapter 2). Recombinant 6XHIS-tagged mouse YB-1 (N-

HisYB-1) was used as a substrate for purified porcine liver TG2 enzyme in reaction mixtures supplemented with an EGTA buffer to precisely control free calcium

60 concentration (Dweck et al., 2005) in view of previous reports showing that TG2 transamidation activity is regulated by five low-affinity calcium-binding sites (Kiraly et al., 2009). As shown in Figure 3.1, 10-25 nM calcium was sufficient for the formation of high-molecular weight YB-1 oligomers in the presence of TG2. Consistent with its theoretical size of 35,924 Da, the recombinant form of mouse N-HisYB-1 purified from bacterial lysates migrates close to the p37 size marker. An additional major polypeptide band also was observed slightly below the p50 marker corresponding exactly to the observed mobility of SDS-denatured forms of native YB-1 expressed in mouse and human fibroblasts (David et al., 2012; Zhang et al., 2008). N-HisYB-1 electrophoretic mobility was calcium-concentration dependent with p75-p125 variants clearly detected at

25 nM calcium. Between 100 nM and 500 nM free calcium, a broadly distributed group of less well resolved crosslinked products in excess of 250 kDa in size accumulated near the top of the 10% polyacrylamide running gel. Reaction products formed in the presence of either 1 μM or 100 μM calcium were not highly reactive with the anti-HIS mouse monoclonal antibody used to process the immunoblot shown in Figure 3.1 but detectable on the nitrocellulose transfer membrane after staining with Ponceau S red dye (data not shown). In addition, crosslinking reactions performed at supra-physiologic levels of calcium (1 and 100 uM) may have generated YB-1 oligomers that were too large to enter the SDS polyacrylamide gel. In contrast, YB-1 size heterogeneity in the vicinity of the p37-p50 size markers seemed biphasic with peak accumulation of multiple, distinct bands noted between 10-25 nM calcium as well as 1 μM calcium (Figure 3.1).

Transglutaminase 2-catalyzed YB-1 protein complexes accumulate during TGFβ1- dependent myofibroblast differentiation. Formation of YB-1 protein complexes has not been examined in the regulatory context of myofibroblast differentiation and cardiopulmonary fibrosis. Early passage, TGFβ1-activated human pulmonary myofibroblasts represent a potentially useful experimental model for examining the biochemical control of YB-1 oligomerization that avoids technical complications working with whole tissue specimens containing multiple cell types and histologic specializations. Myofibroblast differentiation induced by TGFβ1 was accompanied by enhanced expression of multiple YB-1 size variants with apparent molecular weights on

SDS gels in the range of 75 to 250 kDa (Figure 3.2a). Compared to the prominent p50 band, higher molecular weight YB-1 variants in TGFβ1-activated myofibroblasts generally were less abundant on immunoblots processed with any of the 4 anti-YB-1 antibodies used in our study. Accordingly, chemiluminescence image-capture times were varied over a period of 30-500 sec to distinctly resolve the p50 and p75-250 weight regions on immunoblots that are depicted as separate digital-image components in Figure

3.2a. Importantly, formation of high-molecular weight YB-1 variants approximately 200-

250 kDa in size was partly inhibited by 1 mM cystamine, a TG2 reactive-site inhibitor

(Jeon et al., 2004), when administered to fibroblasts 60 minutes prior to a 16-hour treatment with 5 ng/ml TGFβ1 (Figure 3.2a). Further experimentation revealed that suppression of the smaller p100-125 YB-1 size variants required a higher amount of cystamine (2 mM) indicative of possible differential rates of YB-1 oligomer formation and/or stability (Willis and Strauch, data not shown). Notably, high molecular weight

62 forms of YB-1 appear to be transient components in TGFβ1-activated myofibroblasts.

The ability to detect size variants in the range of p90 to p250 was markedly reduced if cells were washed following an initial 7.5 hr exposure to TGFβ1 and then incubated for an additional 7.5 hrs with fresh medium alone (Figure 3.2b). However, large-size YB-1 variants were completely eliminated if the washed, TGFβ1-activated myofibroblasts were exposed to fresh medium supplemented with 5U/mL thrombin for an additional 7.5 hrs

(Figure 3.2b). We previously reported that thrombin-mediated MEK1/Erk1,2 signaling dissociates YB-1 from a translation-silencing element in exon 3 of SMαA mRNA resulting in a rapid increase in SMαA protein synthesis (Zhang et al., 2005).

Suggesting that TGFβ1-associated TG2 transamidation in differentiated myofibroblasts may influence access of the N- and C-terminal segments of YB-1 oligomers to other proteins, we have observed that variants in the p100-p250 size range generally were more reactive with a commercial antibody specific for the N-terminal segment of YB-1 while variants migrating between the p37 and p75 were more reactive with a commercial antibody specific for amino acids proximal to the C-terminus (Willis and Strauch, unpublished observations). Rabbit polyclonal antibodies developed by Kelm and co- workers (Kelm, Jr. et al., 1999a) using a peptide antigen corresponding to amino acids

276-302 flanking the C terminal end of the highly conserved YB-1 CSD (used to process the immunoblot depicted in Figure 3.2b) as well as a peptide antigen encompassing amino acids 85-110 within the core of the CSD (used in Figure 3.1a) both reacted with the full range of YB-1 size-variants observed in TGFβ1-activated myofibroblasts

63 suggesting that these epitopes remain accessible following YB-1 oligomerization.

Notably, the CSD and C-terminal regions are known to mediate interaction between YB-

1 and single-strand nucleic acids and are thought to contribute to mRNA translational control (Kohno et al., 2003; Nekrasov et al., 2003).

Transglutaminase 2 expression and biochemical control in myofibroblasts. TG2 has been implicated in the molecular regulation of tissue-stress response, fibrosis, and epithelial-mesenchymal transition that are cellular processes known to be associated with altered YB-1 sub-cellular compartmentalization (Oh et al., 2011; Olsen et al., 2011; Lin et al., 2011; Mehta et al., 2010). Moreover, accumulation of peroxide in myofibroblasts due to elevated activity of NADPH oxidase (Bondi et al., 2010; Hecker et al., 2009) could injure mitochondria resulting in the release of intracellular calcium required for

TG2 enzyme activation (Park et al., 2010; Gundemir et al., 2012). Likewise, pro-fibrotic thrombin (Snead and Insel, 2012) releases intracellular calcium stores in myofibroblasts through its PAR-1 receptor (Meoli and White, 2009; Sabri et al., 2002) that may further augment TG2 crosslinking activity (Kiraly et al., 2009). Thrombin also activates

MEK1/Erk1,2 signaling in myofibroblasts that has been shown to dissociate YB-1 from

SMαA mRNA, promote YB-1 nuclear translocation, and enhance both SMαA mRNA translation (Zhang et al., 2005) and actin-cytoskeleton assembly (Bogatkevich et al.,

2003).

To determine if native human YB-1 was an authentic substrate for TG2 transamidation, pulmonary fibroblasts were exposed to a membrane-permeable, biotinylated primary amine that serves as a surrogate lysine substrate for the TG2 transamidation reaction (Oh et al., 2011). Endogenous TG2 activity in fibroblasts was sufficient to crosslink the biotinylated pentylamine (BP) substrate to accessible glutamine residues in a protein migrating near the 50 kDa size marker that was identified as YB-1 based on immunoprecipitation from fibroblast extracts using a YB-1 antibody (Figure 3.2c).

TGFβ1 was not used in this experiment to limit YB-1 oligomerization that could prevent access of BP substrate to reactive glutamines in the N-terminus of YB-1. Exogenous ROS provided in the form of hydrogen peroxide was not required for TG2-mediated biotinylation of p50 YB-1 nor did it enhance the specific immunoprecipitation of biotin-

YB-1 suggesting that the TG2 enzyme is active in fibroblasts under these particular experimental conditions.

TG2 is a 78 kDa protein and was constitutively expressed in human pulmonary fibroblasts and variably distributed between what appeared to be monomeric and dimeric forms in response to TGFβ1 (Figure 3.2d). Inclusion of hydrogen peroxide to simulate fibroblast peroxidative stress did not alter TG2 expression or distribution nor did it amplify the response to TGFβ1. To account for possible low permeability of the BP substrate and/or poor equilibrium with the YB-1 pool that could limit detection of endogenous TG2 reaction products in intact pulmonary fibroblasts, we performed a second crosslinking reaction using exogenous TG2 enzyme purified from guinea pig liver

65 to crosslink native YB-1 in fibroblast lysates prepared using RIPA extraction buffer.

Increasing amounts of liver TG2 were added to RIPA lysates under a condition of calcium excess (3 mM) to assure high-level TG2 enzymatic activity over the 150 min reaction performed at 37°C (Gundemir et al., 2012; Dai et al., 2011; Kiraly et al., 2009).

TG2 efficiently catalyzed the formation of a large YB-1 oligomeric complex with an apparent mass greater than 250 kDa (p250+) but only in lysates supplemented with excess calcium (Figure 3.3a). Increasing the concentration of TG2 in reaction mixtures resulted in the incorporation of all available p50 YB-1 into the high molecular weight complex. Inclusion of cystamine, a TG2 transamidation reactive site inhibitor (Jeon et al.,

2004; Mishra and Murphy, 2006), reduced accumulation of the p250+ YB-1 oligomer in crosslinking reactions while preserving p50 YB-1 but enhancing the presence of variants approximately 100-125 kDa in mass (Figure 3.3b). The p100 and p125 size variants may correspond to conformational intermediates, possibly dimers, derived by the initial, rapid transamidation of p50 YB-1 monomers but failed to incorporate into p250+ oligomer before TG2 became fully arrested by the cystamine transamidation inhibitor.

TGFβ1 has been shown to stimulate production of hydrogen peroxide, an important mediator of myofibroblast differentiation and pulmonary fibrosis (Hecker et al.,

2009).Moreover, reactive oxygen intermediates reportedly augment both NFκB-mediated

TG2 gene transcription and TG2 transamidation activity (Ientile et al., 2007). NADPH oxidase 4 (NOX4) has been identified as a TGFβ1-responsive enzyme potentially responsible for ROS accumulation in pulmonary myofibroblasts. We therefore examined

66 the effect of the general NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI), that was shown to reduce collagen secretion and accumulation of SMαA-positive myofibroblasts in a mouse model of bleomycin-induced pulmonary fibrosis (O'Donnell et al., 1993; Hecker et al., 2009). As shown in the upper panel of Figure 3.4a, DPI effectively reduced accumulation of the same types of YB-1 size variants expressed in

TGFβ1-activated human pulmonary myofibroblasts that were shown to be a result of

TG2-mediated transamidation. While the level of p50 YB-1 was not significantly altered by DPI treatment, expression of both p100 and p125 variants was completely diminished by 2.5 μM DPI concomitant with the appearance of a novel YB-1 size variant somewhat larger than p125 (p125+) that also became depleted but more gradually over the range of

2.5 to 30 uM DPI. Notably, depletion of the novel p125+ variant occurred in parallel with a graded reduction in SMαA protein expression in DPI-treated pulmonary myofibroblasts

(lower panel, Figure 3.4a). We additionally examined the effect of the TG2 inhibitor monodansylcadaverine (MDC) on YB-1 oligomerization. MDC is a reversible competitive antagonist to TG2 enzyme activity that competes with endogenous lysine substrates for the transamidation reaction (Badarau et al., 2011). MDC suppressed expression of the p250+ YB-1 variant and, to a lesser extent, the p125 variant in a concentration-dependent manner over a 24 hour exposure period (Figure 3.4b).

Suppression of the p250+ YB-1 complex, in particular, occurred in parallel to MDC dependent reduction of SMαA protein expression in MDC-treated myofibroblasts

(Figure 3.4b). Additionally, we observed that TG2-specific, short-interfering RNA

(siRNA) effectively suppressed expression of TG2 protein as well as accumulation of the

67 p125 YB-1 variant in a concentration dependent manner in human pulmonary fibroblasts

(Figure 3.5a). This finding suggested that transamidation enzymatic activity associated with YB-1 oligomerization was largely a function of TG2 isozyme availability as opposed to some other member of the transglutaminase family that might be coexpressed in pulmonary fibroblasts. Recent studies showed that siRNA knockdown of TG2 protein expression in human pulmonary fibroblasts resulted in impaired TGFβ1-dependent adhesion and contraction on collagen-gel substrates (Olsen et al., 2011). In this regard,

TG2- specific siRNA partially reduced the level of unpolymerized SMαA actin detected in supernatants prepared from the cytosol fraction of either quiescent human pulmonary fibroblasts or TGFβ1-activated myofibroblasts (Figure 3.5b)

YB-1 size-variants bind a translational silencing element in SMαA mRNA. Exon 3 in

SMαA mRNA contains a high-affinity binding site for YB-1 that is required for mRNA translational repression in fibroblasts and smooth muscle cells (Kelm, Jr. et al., 1999b;

Zhang et al., 2005). Some YB-1 size variants present in TGFβ1-activated pulmonary myofibroblasts were capable of enhanced binding to oligonucleotide probes derived from various regions of human SMαA mRNA. Protein retained on RNA-beads following incubation with extracts prepared from pulmonary fibroblasts in the presence or absence of TGFβ1 was processed for immunoblot analysis using an antibody specific for the YB-

1 CSD that mediates mRNA binding (antibody 85-110 (Kelm, Jr. et al., 1999a; Kelm, Jr. et al., 1999b). As depicted in Figure 3.6, an oligoribonucleotide encompassing the exon-

3 mRNA-binding site for YB-1 (CERNA) captured, in a TGFβ1-dependent manner,

68 several YB-1 size variants migrating on SDS-PAGE immunoblots in the vicinity of the p50 to p100 size markers. A second RNA that contained a similar exon 3-like sequence motif but derived from the 3’ untranslated region (3’UTR) of SMαA mRNA showed enhanced binding to the p125 YB-1 size variant in TGFβ1-activated myofibroblasts but exhibited rather weak interaction with p50 that was unaffected by TGFβ1. In contrast, two other oligoribonucleotides (CSD1 and CSD4) derived from exons in SMαA mRNA that were partially homologous to RNA sequences with known binding affinity for YB-1 and other cold shock domain proteins (Coles et al., 2004) interacted with some of the

YB-1 size variants but binding in this instance was not enhanced by TGFβ1. Data presented in Figure 3.6 suggests that several YB-1 size variants that accumulate in myofibroblasts were able to bind a known translational silencing element in SMαA mRNA that is under control of TGFβ1 and thrombin signaling.

YB-1 oligomers may perform tasks in injury-activated myofibroblasts associated with stabilizing, sequestering, or transporting mRNAs encoding specialized proteins required for cell-type specific functions or basic survival during periods of metabolic stress (Yang and Bloch, 2007; Skabkin et al., 2004; Nekrasov et al., 2003; Strauch and Hariharan,

2013). Physical interaction of p50 YB-1 with mRNAs that encode proteins serving these needs might facilitate TG2 crosslinking possibly by positioning glutamine and lysine substrate moieties within the transamidation active site. To assess the general effect of mRNA on TG2-mediated YB-1 crosslinking, a 30-nt oligoribonucleotide fragment encompassing the YB-1-binding site in exon-3 of SMαA mRNA was incubated with

69 recombinant N-HisYB-1 prior to addition of liver TG2. As shown in Figure 3.7a, YB-1 in the absence of TG2 and RNA migrated as a single p50 band. Upon addition of TG2 in the presence of 3 mM calcium to maximize transamidation activity, apparent YB-1-size isomerization was observed producing a poly-dispersed array of poorly resolved bands around p50 in size plus protein complexes greater than 250 kDa in size. In the presence of RNA, conversion of p50 YB-1 into higher order complexes was more robust than reactions containing TG2 alone on a per-unit N-HisYB-1 protein-mass basis (Figure

3.7a). To examine the ability of native YB-1 to bind mRNA in relation to the level of

SMαA protein synthesis in human fibroblasts, we utilized exon 3 mRNA-affinity beads to capture YB-1 from whole cells extracts prepared from TGFβ1-activated human pulmonary myofibroblasts as well as several early passage preparations of human pulmonary-artery adventitial fibroblasts (PAAFs) that were classified as having either low- or high-level constitutive expression of SMαA protein. As shown in the immunoblot presented in Figure 3.7b that was processed using an antibody specific for the N-terminal region of YB-1, SMαA exon-3 mRNA affinity beads captured p50 YB-1 plus another variant around 37 kDa in size from all the extracts. Of note, several additional antibody reactive bands corresponding approximately to the p100 and p125 forms of YB-1 described earlier in this report were variably enriched in extracts prepared from TGFβ1 activated pulmonary myofibroblasts (HPFBs) and more robustly in PAAFs exhibiting high-output production of SMαA polypeptide (UP89, UP72, UP88). These observations indicate that the exon-3 element in SMαA mRNA can capture native, YB-1-containing protein complexes and that this binding activity appears to be selectively enriched in YB-

1 oligomers present in fibroblasts capable of high-output SMαA protein synthesis

(Figure 3.7c).

Transglutaminase 2 mediates both the formation and dispersion of YB-1 oligomers.

TG2 has intrinsic isopeptidase activity capable of hydrolyzing protein crosslinks caused by transamidation. The isopeptidase activity results in the deamidation of constituent glutamine residues to glutamic acid especially in the presence of high concentration of

TG2 enzyme (Stamnaes et al., 2008). Reverse YB-1 crosslinking due to deamidation could explain the apparent dispersal of high molecular weight forms of YB-1 observed after exposure of TGFβ1- activated myofibroblasts to thrombin as shown in Figure 3.2b.

To examine if YB-1 crosslinks can be reversed experimentally, mixtures of liver TG2 and

N-His-YB-1 were evaluated by SDS-PAGE immunoblot at various times over a 150- minute reaction period (Figure 3.8). To assure adequate accumulation of high molecular weight YB-1 as substrate and to enhance the efficiency of TG2 isopeptidase activity, calcium level was held constant at 3 mM and a second aliquot of enzyme was added approximately midway in the reaction period to increase TG2 concentration about 8-fold

(Figure 3.8a). In reactions initiated with 0.125 mU/μL of TG2, YB-1 was resolved during the first 30-minute interval as a series of closely migrating bands in the range of

37-50 kDa followed 15 minutes later by a broad accumulation of poorly resolved high- molecular material distributed between the 100 and 250 kDa size markers (45 min,

Figure 3.8b). Increasing the concentration of TG2 to 1.0 mU/μL at the 75-minute interval further shifted distribution of YB-1 size variants toward the upper end of the SDS

71 gel by the 90 minute time point but also resulted in re-appearance of p50 over the next

30-minute interval (120 min, Figure 3.8b). Re-appearance of p50 was transient and its loss during the final 30 minutes of the reaction following replenishment of TG2 enzyme most likely was due to concurrent transamidation and reincorporation into high molecular weight YB-1. Significantly less crosslinked product formed over the course of the full

150-minute reaction was able to enter the 5% stacking gel compared to the earlier time points (150 min, Figure 3.8b) although epitope masking within large-size YB-1 complexes also could explain reduced antibody reactivity with these particular samples.

To optimize detection of p50 YB-1 monomer that would signify oligomer dispersion, the immunoblots depicted in Figure 3.8 were processed using an antibody specific for the C- terminal region of YB-1 that is highly reactivity with monomeric forms of YB-1.

Early in the crosslinking reaction, monomeric YB-1 may form a hypothetical calcium/TG2- dependent transition state that is susceptible to nucleophilic attack by a C- terminal lysine residue in a second YB-1 molecule to form an isopeptide linkage and higher-order YB-1 oligomer (Figure 3.8c). However, in the absence of an amine substrate, other investigators have shown that water can serve as the attacking nucleophile within the TG2 enzyme-substrate complex (Figure 3.8c) resulting in glutamine deamidation rather than transamidation (Stamnaes et al., 2008). Similarly, dispersal of YB-1 oligomers to monomers via TG2 isopeptidase activity may be accomplished under solvent conditions that transiently expose shielded isopeptide bonds within the oligomer to nucleophilic attack. Consistent with this idea, partial depletion of

72 the p250+ YB-1 oligomer pool with concurrent accumulation of variants in the p50-100 size range was observed within 15 minutes after addition of the second aliquot of TG2 enzyme in reactions where the ionic strength was increased using NaCl (Figure 3.8d).

Similarly, oligomer dispersal was enhanced if the reaction was supplemented with single- stranded DNA (Figure 3.8e). Similar to the effect of increasing the ionic strength with salt, interaction of YB-1 oligomer with the sugar-phosphate backbone of the DNA oligonucleotide may alter the isopeptide bond microenvironment to facilitate deamidation. Recovery of p50-100 size-class variants in the NaCl- or nucleic acid-treated reaction mixtures (Figure 3.8d,e) was higher at the 90 minute observation point compared to reactions that received no solvent adjustments (Figure 3.8b). Specific accumulation of the presumptive p50 monomer, however, was somewhat delayed in the nucleic acid-treated reactions requiring an additional 30 or 60 minutes compared to water and NaCl, respectively.

3.4 Discussion

YB-1 is believed to repress SMαA promoter activity in quiescent stromal fibroblasts by binding the reverse strand of an essential MCAT/THR trans-activation element that is known to undergo chromatin conformational changes in response to TGFβ1 signaling

(Becker et al., 2000). During TGFβ1-mediated myofibroblast differentiation, YB-1 dissociates from the MCAT/THR element and the SMαA promoter is re-folded into duplex DNA upon binding of the Smad 2/3, Sp1/3, and serum response factor (SRF) transcriptional activators to their cognate binding sites (Eliseeva et al., 2011; Strauch and

Hariharan, 2013). Smad protein-facilitated displacement of YB-1 from the MCAT/THR within the TGFβ1-activated SMαA promoter appears to be coupled to nuclear export of ribonucleoprotein complexes consisting of YB-1 oligomers and newly transcribed SMαA mRNA (Zhang et al., 2005). Although the functional significance of this finding remains unclear, tissue injury-activated formation of nuclear YB-1 ribonucleoprotein complexes in myofibroblasts may facilitate delivery of SMαA mRNA to polyribosomes for preferential actin G-monomer biosynthesis that allows fast polymerization of F-actin filaments needed for granulation tissue contraction and wound closure. Post- transcriptional mechanisms that modify mRNA stability and/or translational efficiency provide rapid and flexible control of gene expression that may be particularly important in coordinating not only the initiation but, more critically, prompt resolution of myofibroblast differentiation during wound-healing (Anderson, 2010). We speculate that the fibrogenic agonist thrombin assists TGFβ1-activated transcription during wound healing by functioning as a post-transcriptional modifier through its ability to activate

Erk1/2 kinases that stimulate displacement of YB-1 from the exon-3 translation silencing element in SMαA mRNA (Zhang et al., 2005). This YB-1-binding site is proximal to the

5’ AUG translation-start codon based on several thermodynamically favorable stem-loop models constructed from the full-length SMαA mRNA sequence and may help regulate ribosome access to the 5’ cap structure (Willis and Strauch, unpublished data).

Displacement of YB-1 from the stockpile of nascent myofibroblast mRNAs including transcripts encoding SMαA and type I collagen subunits (Hanssen et al., 2011) may relieve translational repression and permit rapid accumulation of specialized proteins needed to mount an efficient wound healing response.

Using both native and recombinant YB-1 as substrates, we have shown that TG2 catalyzes the formation of YB-1 oligomers that retain selective affinity for certain CSD protein-binding sequences in SMαA mRNA. YB-1 protein dimers may nucleate calcium- dependent assembly of higher-order multimers that while seemingly resistant to heat- and

SDS-denaturation nonetheless might be dissociable by deamidation mediated by the intrinsic isopeptidase activity of TG2 (Stamnaes et al., 2008). Others have shown that multimers of YB-1 reportedly influence globin mRNA translational efficiency in reticulocyte lysates (Nekrasov et al., 2003; Skabkin et al., 2004) and TG2 transamidation is well known as an extracellular enzymatic reaction required for matrix-protein crosslinking, fibrosis, and cell adhesion (Chou et al., 2011). Nearly two decades ago,

Rifkin and co-workers showed that TG2 transamidation was linked to activation of latent

TGFβ1 in endothelial cells (Kojima et al., 1993). More recently, expression of TG2 in

75 fibroblasts was shown to increase TGFβ1 bioavailability (Telci et al., 2009) and that mice lacking a functional TG2 gene were protected from renal and pulmonary fibrosis

(Gundemir et al., 2012). In age-associated syndromes such as vascular hypertension, excessive peri-vascular deposition of active TG2 reduces proteolytic clearance of crosslinked matrix proteins resulting in adventitial fibrosis and loss of arterial compliance

(Santhanam et al., 2010). Our study extends these observations and further indicates that transglutaminase 2 may perform important physiologic tasks inside the cell. TG2- mediated transamidation may adjust the proteome to the particular needs of wound- healing biochemistry by deploying YB-1 oligomers that capture and stabilize mRNAs encoding specialized proteins needed to repair damaged tissue. Others have shown that intracellular TG2 helps maintain the functional integrity of mitochondrial electron transport and augments signaling pathways associated with epithelial-mesenchymal transition needed for repair of damaged epithelial cells and their associated basement membrane (Oh et al., 2011; Lin et al., 2011; Gundemir et al., 2012; Olsen et al., 2011;

Mehta et al., 2010). In the nucleus, TG2 crosslinks and governs the action of transcriptional regulatory proteins including Sp1, hypoxia-inducible factor, retinoblastoma protein, and the E2F1 cell-cycle regulatory protein that could regulate cell proliferation and angiogenesis in healing wounds (Kuo et al., 2011).

YB-1 complexes have not previously been described in the context of myofibroblast differentiation prompting us to consider regulatory signals that could govern YB-1 oligomerization in specific response to biochemical conditions within the healing wound.

TGFβ1 activates NADPH oxidase-mediated production of reactive oxygen intermediates and the associated oxidative stress responses that transpire in both the heart (Kuroda et al., 2010) and lung (Hecker et al., 2009) have been linked to fibrosis and dysfunctional cardiopulmonary remodeling. In addition, thrombin amplifies the action of TGFβ1 in myofibroblasts by releasing intracellular calcium via activation of PAR1 receptor- coupled G proteins (Snead and Insel, 2012). Thrombin-dependent calcium release could promote F-actin polymerization and actomyosin contractility downstream from the initial burst of SMαA gene transcription mediated by the TGFβ1-dependent Smad3 trans- activator protein (Bogatkevich et al., 2005; Zhang et al., 2005; Bogatkevich et al., 2003;

Howell et al., 2002; Strauch and Hariharan, 2013). Importantly, TG2 transamidation activity is augmented by both intracellular calcium and reactive oxygen intermediates that are the most likely agonists for YB-1 oligomerization in TGFβ1-activated myofibroblasts.

Although the complete consensus-substrate sequence for TG2 transamidation has not yet emerged, there is a preference for protein targets that are classified as intrinsically disordered and have glutamine and lysine residues situated adjacent to proline (Csosz, et al., 2008). TG2- reactive glutamine and lysine substrates also tend to reside within N- and

C-terminal regions, respectively. While the lysine-substrate preference of TG2 is largely dependent on the tertiary structure of target proteins (Murthy et al., 2009), a peptide consensus sequence for the arrangement of glutamine substrates has been reported. Using phage-display selection methods Keresztessy and colleagues formulated a general

77 consensus motif for TG2 glutamine substrates as pQx(P, T, S)l, where x is any amino acid, p is a polar amino acid, and l corresponds to an aliphatic amino acid (Keresztessy et al., 2006). Examination of the YB-1 primary sequence revealed the presence of a potential glutamine substrate in the N-terminus. We speculate that YB-1 crosslinking occurs when the N-terminal glutamine substrate forms an acyl-enzyme intermediary complex within the TG2 active site. The C-terminal lysine substrate provided by a second

YB-1 monomer could complete formation of a γ-glutamyl isopeptide linkage via nucleophilic attack on the glutamine-TG2 acyl enzyme complex. C-terminal regions of the YB-1 polypeptide chain appear to be partially masked in high-molecular weight oligomers in view of their observed lower avidity for an antibody generated against C- terminal epitopes. On the other hand, YB-1 variants distributed within the 37 to 100 kDa size range reacted quite well with the C-terminal-specific antibody. Conversely, YB-1 antibodies generated against either N-terminal or CSD epitopes showed relatively high avidity for the large YB-1 oligomers. While the mechanistic significance of C-terminal epitope masking in extensively oligomerized YB-1 currently is not known, this region of

YB-1 contains four alternating clusters of basic and acidic amino acids forming a charged zipper that recognizes specific RNA stem-loop structures and provides a docking site for other proteins (Nekrasov et al., 2003; Kohno et al., 2003; Eliseeva et al., 2011). As shown in this report, YB-1 crosslinking by TG2 does not impair protein molecular structure required for post-oligomerization acquisition of mRNA payload. Indeed, native YB-1 oligomers that naturally form within SMαA-positive myofibroblasts possess intrinsic mRNA binding activity and can be isolated from lysates using RNA affinity-binding

78 methods. Moreover, synthetic oligomer formation in vitro was more favorable when TG2 transamidation reactions were supplemented with sequence segments of SMαA mRNA.

TG2 transamidation reportedly is reciprocally regulated by GTP and calcium levels

(Kiraly et al., 2009; Gundemir et al., 2012; Stamnaes et al., 2010; Begg et al., 2006). In the realm of pathophysiology, elevated TG2 transamidation due to increased intracellular calcium reportedly contributes to several dysfunctional cellular responses including altered vascular smooth muscle cell contractility in pulmonary hypertension and abnormal neurite outgrowth and differentiation in certain cognitive disorders (Guilluy et al., 2007; Dai et al., 2011). In the GTP-bound state, TG2 appears to be resistant to calcium-activation of crosslinking. Accordingly, transamidation has been predominately viewed as an extracellular enzymatic reaction due to calcium excess outside the cell relative to available GTP (Begg et al., 2006). Although cytosolic GTP levels also are in excess relative to calcium under normal physiological conditions, our results suggest that

TG2-mediated transamidation of YB-1 substrate may be an advantaged reaction in

TGFβ1-activated myofibroblasts. As an explanation, intracellular calcium levels in myofibroblasts may transiently exceed homeostatic levels in response to binding of fibrogenic agonists such as TGFβ1 and thrombin to their cognate receptors. Peroxide is known to activate TG2 transamidation and its production as a direct consequence of

TGFβ1 receptor-mediated induction of NADPH oxidase-4 activity in pulmonary fibroblasts could further enhance the accumulation of YB-1 oligomers (Griffith et al.,

2009; Hecker et al., 2009). TG2 transamidation also may be enabled by unknown

79 ancillary factors that could mitigate GTP effects despite relatively high cytosolic GTP levels. For example, small GTP-binding proteins such as Rac1 associated with RhoA/Rho kinase (ROCK)-mediated regulation of actin filament assembly and myosin ATPase activation could alter the local intracellular GTP/GDP balance to favor increased TG2 transamidation (Russell et al., 2010). Moreover, alternatively spliced TG2 isoforms have been identified that are not inhibited by GTP (Kiraly et al., 2011; Begg et al., 2006). TG2 crosslinking reactions also might be spatially compartmentalized inside the cells and restricted to sites where calcium/GTP ratios are permissive for transamidation. The high calcium-buffering capacity of cytosol restricts calcium diffusion (Allbritton et al., 1992) resulting in the formation of microdomains where the local concentration of calcium can exceed that of bulk cytosol (Berridge, 2006).

Consistent with the notion of calcium-graded transamidation, we demonstrated that crosslinking of recombinant YB-1 by TG2 was calcium-concentration dependent. As little as 10-25 nM free calcium was capable of driving accumulation of p100-size variants that seemingly were rapidly converted into oligomers with apparent mass of 250 kDa or more. YB-1 size heterogeneity during SDS-PAGE also was evident in the vicinity of the p37-p50 size markers suggestive of TG2-mediated intra-molecular crosslinking and monomer isomerization possibly required as an intermediate step in the formation of high-molecular weight multimers. Others have suggested that TG2 crosslinking substrates may undergo isomerization prior to forming a glutamine substrate/acyl enzyme transition state (Case and Stein, 2003), an idea that is supported by the apparent size-

80 shifting behavior of YB-1 p50 that was observed during the initial phase of the crosslinking reaction. Calcium gradient-dependent regulation of TG2 transamidation is consistent with the well known spatial restriction of calcium in vivo, where levels in the cytosol are maintained approximately at 100 nM but may be much higher in the vicinity of calcium-release sites such as the endoplasmic reticulum (ER) when signaling intermediaries such as inositol-1,4,5-trisphosphate are formed in response to GPCR agonists. TG2-mediated transamidation of RhoA and Rac1 in vascular smooth muscle cells and neuronal cells recently was linked to ER-release of intracellular calcium stores

(Guilluy et al., 2007; Dai et al., 2011). We did not assess the ability of GTP to inhibit

TG2-mediated crosslinking of YB-1. However, the low calcium threshold observed for in vitro crosslinking coupled with the observed formation of mRNA-binding YB-1 oligomers in intact cells suggests that a portion of the cytosolic YB-1 pool can be transamidated in response to accumulation of intracellular calcium and ROS expected as a natural consequence of the myofibroblast differentiation process.

Excessive TG2-mediated YB-1 oligomerization may represent a previously unrecognized mechanistic feature of interstitial and perivascular fibrosis and dysfunctional tissue remodeling in chronic cardiopulmonary disease. Interstitial fibrosis after cardiac transplant was accompanied by increased expression of myocardial SMαA as a consequence of cardiac myofibroblast activation, scar formation, and fetal contractile gene reprogramming in biomechanically stressed cardiomyocytes. YB-1 is a major

SMαA mRNA-binding protein in myofibroblasts and reprogrammed cardiomyocytes and

81 was prominently distributed in fibrotic heart grafts as both peri-nuclear granules and intense cytosolic deposits proximal to cardiac intercalated discs (David et al., 2012;

Zhang et al., 2008). Accumulation of YB-1 in heart grafts also has been linked to peri- transplant associated increases in TGFβ1 signaling and nuclear uptake of phosphorylated

Smad proteins that drive fibrosis and dysfunctional remodeling in accepted heart grafts

(Zhang et al., 2008; Csencsits et al., 2006). Moreover, YB-1 localization at cardiac intercalated discs frequently was associated with de novo assembly of actin thin filaments that were highly enriched for SMαA. Of interest, YB-1 co-localized at intercalated discs with Pur α (Zhang et al., 2008), another prominent mRNA-binding protein in the heart and lung that mediates mRNA transport in neuronal cells through its ability to bind the kinesin microtubule motor protein (Aumiller et al., 2012; Johnson et al., 2006; Kanai et al., 2004; Ohashi et al., 2002; Strauch and Hariharan, 2013).

Data presented in this report suggests that SMαA mRNA may increase the rate and/or efficiency of YB-1 oligomer formation by calcium-activated TG2. Although the functional significance of this observation requires further analysis, we speculate that ribonucleoprotein complexes of YB-1 and mRNA may provide the physical means to selectively route pools of functionally related transcripts to polysomes for immediate protein synthesis. A viable scheme for translational control would require a mechanism for oligomer dispersion and release of SMαA mRNA payload. TG2-mediated reversal of covalent YB-1 cross linkages via cleavage of the isopeptide linkage with associated glutamine deamidation is a plausible mechanism for oligomer dissolution and release of

YB-1-bound SMαA mRNA payload at cytosolic polysomes. We speculate that an intracellular pool of active TG2 with limited access to available lysine substrate in the

YB-1 C-terminus would catalyze reversal of existing γ-glutamyl isopeptide links in YB-1 using water as the attacking nucleophile with subsequent release of glutamine deamidated p50 YB-1. Compared to the nuclear fraction which is highly enriched for YB-1 size variants, preliminary cell fractionation analysis indicates that the myofibroblast cytosol contains a relatively smaller pool of YB-1 that might provide the YB-1-deficient milieu favorable for reversal of TG2-mediated crosslinks (Willis and Strauch, unpublished observations).

When transamidation is considered as a reversible process, TG2 may not only mediate calcium regulated crosslinking of YB-1 and mRNA into storage granule structures but also enable their dissociation to permit rapid synthesis of selected proteins required for the wound-healing response. With respect to repairing tissue injury following heart transplant, mitochondria, the sodium/calcium exchanger, transient receptor potential channels, and the sarcoplasmic reticulum all are likely to be located peripherally near cardiac intercalated discs in metabolically stressed cardiomyocytes providing the necessary spatial compartmentalization for localizing reactive oxygen signaling intermediates and establishing calcium microdomains (Eder and Molkentin, 2011). In theory, calcium/ROS-mediated signaling would not only enable TG2 transamidation and

YB-1 crosslinking but also could control the deamidation reaction required to unload mRNAs and re-program protein synthesis as needed in damaged tissue beds. TG2-

83 mediated YB-1 crosslinking seems a plausible, testable mechanism for governing the stability, transport, and translational efficiency of multiple mRNA species required for normal myofibroblast differentiation and provides a novel target for therapeutic control of these cells to avoid unchecked fibrosis and dysfunctional cardiopulmonary remodeling.

3.5 Acknowledgements

The authors extend their gratitude to Professor Carl V. Leier, M.D. in the Division of

Cardiovascular Medicine in the Ross Heart Hospital, Wexner Medical Center at The

Ohio State University for the collection of endomyocardial biopsy specimens from heart transplant patients.

Figure 3.1: TG2-mediated YB-1 crosslinking is calcium dependent. 8 (left panel) Purified recombinant epitope-tagged N-HisYB-1 was used as a substrate for TG2 from guinea pig liver in reaction mixtures (60 min at 37°C) supplemented with an EGTA buffer to precisely control the free-calcium concentration. The immunoblot was processed using an anti-His antibody and indicates that formation of high-molecular weight YB-1 oligomers by TG2 was initiated between 10-25 nM free calcium. (right panel) As a control for the possibility of non-specific signal, an immunoblot with an equivalent amount of purified recombinant YB-1 (left lane) or guinea pig liver TG2 (right lane) were processed using the anti-HIS antibody.

Figure 3.2: YB-1 is a TG2 crosslinking substrate in human pulmonary fibroblasts.9 (a) Upper panels: Formation of p150-p250 YB-1 oligomers in TGFβ1-activated myofibroblasts was attenuated by cystamine inhibition of TG2 enzyme activity. Lane 1: no treatments; lane 2: cystamine alone (1 mM); lane 3: TGFβ1 + cystamine (1 mM); lane 4: TGFβ1 + cystamine (0.1 mM); lane 5: TGFβ1 alone. Cells were treated with vehicle or cystamine for 60 min prior to adding TGFβ1 (5 ng/ml) for an additional 16h. Whole cell lysates were prepared using RIPA buffer as noted in the methods. The p50 and p75-p250 regions of the immunoblot were processed at the same time using a N-terminal-specific anti-YB-1 antibody but are presented as separate images and were captured using two different exposure settings during development of the chemiluminescence signal. Lower panel: SMαA expression in quiescent human pulmonary fibroblasts maintained in low- serum (0.5%) medium typically increases several fold in response to TGFβ1 treatment (5 ng/mL; 24 hrs). (b) YB-1 oligomers in TGFβ1- activated myofibroblasts are transient and rapidly depleted by thrombin. Monolayers of human pulmonary fibroblasts were treated with TGFβ1 (5 ng/mL) for 15 hrs (lane 1) or washed after 7.5 hrs and transferred to medium without TGFβ1 (lane 2) or medium containing thrombin (lane 3) for another 7.5 hrs before preparing cytosolic extracts. Thrombin treatment (5 U/mL) resulted in dispersion of several high molecular weight oligomers upward of p100 kDa in size. A depiction of the transfer membrane stained with Ponceau S red is shown on the right indicating equivalent protein loadings of the 3 lysate samples. (c) YB-1 is a target for TG2 crosslinking in human pulmonary fibroblasts. Fibroblasts were pre-treated with a biotin-pentylamine TG2 substrate (BP, 1 mM, 60 min) followed by vehicle or peroxide (1.5 mM) for an additional hour prior to cell harvest. Treatment with BP alone or the combination of BP and peroxide resulted in detection of a biotin-tagged p50 polypeptide (left panel) that was identified as YB-1 by immunoprecipitation (IP) from RIPA lysates using an anti-YB-1 polyclonal antibody followed by streptavidin-HRP (S-HRP) western blot (WB) analysis (right panel). Minor, non-specific association of spurious biotinylated p50 protein with the IgG-conjugated beads was noted in bead-only IP control preparations but abundant biotinylated YB-1 was captured using these beads in combination with an anti-YB-1 antibody. (d) Left panel: TG2 protein migrates as a single 75 kDa polypeptide on SDS-PAGE but was variably distributed in RIPA whole cell extracts between apparent monomer and dimer forms when human pulmonary fibroblasts were exposed to TGFβ1, hydrogen peroxide, or a combination of both. Cells were treated with vehicle or TGFβ1 (5 ng/mL) for 16 hrs followed by vehicle or peroxide (1.5 mM) 1 hr prior to harvest. Right panel: Quantification. TG2 p75 (solid bar) and TG2 p150 (hashed bar) were normalized to GAPDH expression to account for possible loading error. The respective values for TG2 p75 and p150 in N/T cells were then arbitrarily set to 1 in order to display fold-change relative to control.

Figure 3.2

a b

5 4.5 4 3.5 3 2.5 2 1.5 1

0.5 change relative changeto N/T

- 0 N/T H2O2 TGF TGF +

fold H2O2 d TG2 P75: solid bar TG2 p150: hashed bar

Figure 3.3: In-vitro crosslinking of endogenous YB-1 from human pulmonary fibroblast lysates. 10 (a) Aliquots of RIPA lysates prepared from pulmonary fibroblasts were combined with purified liver TG2 (0.13 to 1.00 mU/uL) in the presence of a transamidation reaction buffer containing 3 mM calcium. Within a 150 min reaction period, TG2 concentration dependent crosslinking of p50 YB-1 was detected by immunoblot analysis with notable accumulation of calcium-dependent, high-molecular weight products in excess of 250 kDa. (b) TG2-dependent crosslinking of YB-1 in fibroblast RIPA lysates was suppressed by the cystamine TG2 active-site inhibitor. Cystamine (1 mM) partially prevented formation of high-molecular weight YB-1 by TG2 (0.50 mU/uL) in the presence of calcium while enhancing the level of YB-1 variants in the vicinity of the 100 kDa size marker.

Figure 3.4: Diphenyleneiodonium (DPI) and monodansylcadaverine (MDC) reduce accumulation of oligomeric forms of YB-1 expressed in human pulmonary myofibroblasts. 11 (a) Diphenyleneiodonium (DPI) reduced accumulation of oligomeric forms of YB-1 expressed in TGFβ1-activated human pulmonary myofibroblasts. The top panels show that expression of high molecular weight variants of YB-1 were induced by TGFβ1 but depleted when cells were exposed to various amounts of DPI (2.5-30 μM) for 24.5 hrs either in the presence or absence of TGFβ1 (5 ng/mL). Cells were exposed to DPI 30 min prior to addition of TGFβ1 and then processed using RIPA lysis buffer. Expression of the p100 YB-1 variant was completely suppressed at low dosages of DPI while a slightly larger variant (p125) initially was upwardly size-shifted at 2.5 uM DPI and then depleted in an inhibitor concentration-dependent manner. The bottom panels show that the observed depletion of YB-1 p125 variant occurred in parallel to DPI-induced reduction in SMαA protein expression. (b) YB-1 oligomers in SMαA positive human pulmonary myofibroblasts were selectively suppressed by the TG2 inhibitor monodansylcadaverine (MDC). Cells were exposed to various amounts of MDC (10-100 μM) for 24 hrs and processed using RIPA lysis buffer. p250 YB-1 and, to a lesser extent, p125 were suppressed by MDC in a concentration-dependent manner. Suppression of these size variants by MDC was accompanied by a reduction in SMαA protein expression.

Figure 3.4

Figure 3.5: TG2 siRNA suppresses YB-1 oligomerization, SMαA protein expression in human pulmonary fibroblasts. 12 (a) Suppression of p125 YB-1 oligomer by siRNA-mediated inhibition of TG2 protein expression. Human pulmonary myofibroblasts were transfected with 100 nM of either scrambled/negative control siRNA (-) or various amounts of TG2-specific siRNA (10- 100 nM). Whole cell lysates were prepared using RIPA buffer. siRNA reduced expression of TG2 as well as the YB-1 p125 oligomer in a siRNA concentration dependent manner but slightly elevated expression of p50 YB-1. (b) TG2 siRNA partially suppressed expression of unpolymerized SMαA protein in supernatants prepared from the cytosolic fraction of human pulmonary fibroblasts (control) and myofibroblasts (TGFβ). Cells were transfected with 10 nM TG2 siRNA (+) or scrambled siRNA (-) for 48 hrs prior to treatment with either vehicle (control) or TGFβ1 (TGFβ) for an additional 24 hrs. N/T denotes cells that did not receive siRNA or transfection reagents.

Figure 3.6: YB-1 p50 and p100 variants bind oligonucleotide probes derived from various regions of human SMαA mRNA. 13 The upper panel shows diagram depicting the origins of the four biotinylated SMαA mRNA probes used for the RNA pull-down and immunoblot analysis depicted in lower panel. The p100 form of YB-1 present in RIPA lysates prepared from human pulmonary fibroblasts bound to the CERNA and 3’UTR probes in a TGFβ1-dependent manner while binding to other exonic sequences in SMαA mRNA with potential affinity for CSD proteins (CSD1, CSD4; refer to the upper panel) was not enhanced by TGFβ1. Also, p50 binding to the CERNA sequence, but not the other probes, increased in response to TGFβ1 treatment.

Figure 3.7: An exon 3 translational silencing element in SMαA mRNA enhanced TG2-mediated YB- 1 crosslinking and captured native YB-1 oligomers in SMαA- positive myofibroblasts. 14 (a) Selected portions (rows 1-3) of SDS-PAGE immunoblots processed with an anti-His antibody are presented that depict optimized chemiluminescence detection of YB-1 electrophoretic variants migrating in either the 50 or 250+ kDa regions following a 30 min crosslinking reaction performed at 37°C using a fixed amount of TG2 enzyme (0.3 mU/μL) in the presence of excess calcium (3 mM) plus varying amounts of recombinant N-HisYB-1 (rYB-1) with or without the exon 3 CERNA mRNA oligonucleotide (0.5 μM). In the absence of TG2 and mRNA, recombinant N-HisYB-1 migrated as a single p50 band (row 3 samples). Addition of TG2 alone caused apparent size-isomerization of p50 YB-1 and formation of protein complexes in excess of 250 kDa (row 2 samples). Inclusion of both TG2 and the exon 3 fragment of SMαA mRNA resulted in the complete conversion of YB-1 p50 into a high-molecular weight complex (row 1 samples). Native forms of oligomeric YB-1 demonstrated mRNA-binding activity (panel b) and appear specifically enriched in nuclear-protein extracts prepared from fibroblasts exhibiting high-level SMαA expression (panel c). Protein captured by mRNA-affinity beads from nuclear extracts prepared from two human adventitial fibroblast preparations with low baseline expression of SMαA (UP46 and UP65) was enriched for p50 plus a second form of YB-1 that migrated close to the 37 kDa size marker. In contrast, several additional bands proximal to the 100 kDa size marker were detected in nuclear extracts prepared from adventitial fibroblasts that highly express SMαA protein (UP89, UP72, UP88) as well as TGFβ1-activated human pulmonary myofibroblasts (HPFBs). RIPA whole cell lysates were prepared from fibroblasts for assessment of SMαA and GAPDH expression as shown in panel c.

Figure 3.7

Figure 3.8: TG2-mediated crosslinking of YB-1 is partially reversible. 15 The experimental scheme is presented in panel (a). Purified recombinant N-HisYB-1 and liver TG2 (0.125 mU/uL) were combined in a calcium-supplemented (3 mM) reaction buffer. Aliquots for SDS-PAGE were removed at various times during the 150 min reaction period. At the 60 min time-point, the reaction was supplemented with a nucleophile (500 mM NaCl or DNA) followed 15 min later with a second aliquot of TG2 to increase the final enzyme concentration to 1.0 mU/μL for the duration of the reaction. Panel (b) depicts a crosslinking reaction where TG2 was increased at the 75 min time- point resulting in the transient accumulation of p50 YB-1 monomer at the 120 min time- point. Panel (c) depicts the hypothetical models for forward and reverse TG2- mediated crosslinking. Panel (d) shows that addition of NaCl (500 mM) at the 60 min interval prior to adding additional TG2 enzyme to the reaction slightly enhanced the rate of crosslink reversal relative to that seen in (b). Size variants between 50 and 75 kDa were first detected in the presence of NaCl at the 90 min interval. In contrast, panel (e) shows that addition of DNA at 60 min (1:1, mole ratio of DNA:YB1) delayed appearance of p50 YB-1 until the 150 min interval.

Figure 3.8

Chapter 4: Metabolic stress signaling regulates YB-1 mRNA packaging, translation implicated in control of SMαA expression in human pulmonary myofibroblasts.

4.1 Introduction

Fibroblast-to-myofibroblast differentiation is a key event during wound healing and repair of acute tissue injury. By combining the extracellular matrix-secreting ability of fibroblasts with the cytoskeletal features of contractile smooth muscle cells, myofibroblasts promote wound closure and tissue remodeling (Hinz et al., 2012). During normal wound healing events, transient activation of myofibroblasts contributes to the repair of tissue damage by forming a scar (Hinz et al., 2007). Although acute metabolic stress associated with hypoxia and oxidative stress during tissue injury is intrinsic to the wound healing process, when poorly regulated it can lead to chronic myofibroblast activation and excess ECM production, a cause of hypertrophic scarring, loss of tissue compliance, and fibrotic disorders in a number of tissues (David et al., 2012; Yang and

Ming, 2012; Cronstein, 2011; Lokmic et al., 2012; Rosmorduc and Housset, 2010).

A key feature of myofibroblast differentiation is the formation of SMαA containing stress fibers that generate the contractile force required for wound retraction and tissue remodeling (Hinz, 2007). Previous studies in our lab implicate the YB-1 cold shock domain protein in the regulation of SMαA expression at the transcriptional and post-

98 transcriptional levels. At the post-transcriptional level, YB-1 regulates SMαA mRNA expression by binding to SMαA mRNA and regulating its translational activity (Zhang et al., 2005). We recently noted that YB-1 is a substrate for the protein crosslinking enzyme transglutaminase 2 (TG2), which catalyzes formation of covalent γ-glutamyl isopeptide linkages in response to calcium and reactive oxygen signaling. TGFβ1 activation of TG2 during myofibroblast differentiation was associated with the formation YB-1 oligomers with selective affinity for an exon-3 translational silencer sequence in SMαA mRNA.

We hypothesize that calcium and reactive oxygen intermediates (ROS) activate reversible

YB-1 oligomerization that mediates the packaging, transport, and deployment of SMαA mRNA for translation at polysomes.

In the cytosol, YB-1 is one of the major constituents of messenger ribonucleoprotein complexes (mRNPs), where it coordinates the translation, stability, and localization of cellular mRNAs (Wolffe, 1994). Of the cellular mRNP proteins, YB-1 is one of the most tightly-associated with mRNA, where a large portion of YB-1 remains strongly associated with mRNA even under conditions such has a high concentration of monovalent cations, which cause other mRNP proteins to dissociate (Minich and

Ovchinnikov, 1992). YB-1 is found in both free and polysomal mRNPs (Minich et al.,

1989), and it is estimated that YB-1 makes up as much as 0.1% of the total protein in many cells, resulting in a ratio of 5 to 10 YB-1 molecules for every cellular mRNA

(Davydova et al., 1997).

Because YB-1 alone can form natural particles that are very close to natural mRNPs in terms of sedimentation coefficient and buoyant density, it has been suggested that YB-1 may be a major determinant of mRNP structure/function (Skabkin et al., 2004;

Sommerville and Ladomery, 1996; Evdokimova and Ovchinnikov, 1999). Consistent with this idea, YB-1 can act as a repressor or activator of global protein synthesis, depending on the YB-1:mRNA ratio. At low YB-1 to mRNA ratios, YB-1 tends to exist in the monomer form and promotes translation initiation (Skabkin et al., 2004;

Evdokimova et al., 1998), while at high YB-1 to mRNA ratios, YB-1 tends to form large multimers (Skabkin et al., 2004) and also strongly inhibits mRNA translation in vitro

(Evdokimova et al., 2001) and in vivo (Davydova et al., 1997). YB-1 exhibits mRNA secondary structure melting activity (Evdokimova et al., 1995), and efficiently promotes

RNA strand annealing (Skabkin et al., 2001), suggesting that YB-1 may also modulate mRNP structure/function in part by altering the conformational state of associated mRNAs.

YB-1 plays a particularly important role in mounting the appropriate response to metabolic stress at the post-transcriptional level. When faced with adverse environmental conditions that threaten survival, the ability to dynamically reprogram ongoing protein synthesis is critical to prioritize cellular energy resources for the repair of stress-induced molecular damage (Yamasaki and Anderson, 2008). This is accomplished by directing specific mRNAs or functional groups of mRNAs to sites of translation, storage, or decay

(Anderson and Kedersha, 2006; Keene, 2007; Moore, 2005). In this regard, metabolic

100 stress has been shown to promote a shift from cap-dependent to cap-independent programs of protein synthesis by enhancing the translation of mRNAs containing internal ribosomal entry sites (IRESs). IRES mediated translation is promoted by hypoxia, which enhances the translation of mRNAs required for cell survival under these conditions

(Cobbold et al., 2008; Spriggs et al., 2009; Sonenberg and Hinnebusch, 2009). Cap- independent translation is also activated by ROS, activating the production of key stress- response proteins to promote cell survival and homeostasis during oxidative stress

(Giudetti et al., 2013; Li et al., 2010; Daba et al., 2012). When cap-dependent protein translation is suppressed by the formation of stress granules during cellular responses to hypoxia, energy depletion, or oxidative insult, stem-loop structures in mRNAs encoding internal ribosomal entry sites (IRESs) allow essential mRNAs for stress response and survival to escape translation arrest (Stoneley and Willis, 2004). The activity of all known cellular IRES motifs depends on ancillary proteins known as IRES Trans Acting

Factors (ITAFs), which initiate protein synthesis by binding IRES stem-loop structures, directly recruiting ribosomal subunits to mRNAs (Spriggs et al., 2008). YB-1 has a particularly high affinity for IRES stem-loop structures (Braunstein et al., 2007; Cobbold et al., 2008), and is known to form complexes with other ITAFs implicated in the control of protein synthesis during metabolic stress-conditions including PSF, P54nrb, GRSF1, and PTB-1 (Cobbold et al., 2008; Cobbold et al., 2010).

YB-1 has recently been found to be a component of stress granules, where it shifts from polysomes to stress granules in response to metabolic stress (Onishi et al., 2008; Yang

101 and Bloch, 2007). Stress granules are discrete cytosolic granule structures formed in response to a variety of cellular metabolic stressors including heat shock, hypoxia, oxidative stress, and viral infection (Anderson and Kedersha, 2002a). As sites of RNA triage, stress granules promote cell survival by redirecting mRNAs encoding non- essential ‘housekeeping’ proteins from polysomes to translationally silent mRNP complexes while simultaneously promoting the translation of key stress-response mRNAs (Yamasaki and Anderson, 2008).

Stress granule formation was recently linked to the protein AMP-activated kinase

(AMPK), a key intracellular enzyme that coordinates cellular responses to metabolic stress (Hofmann et al., 2012). As a sensor of cellular energy status, AMPK constantly monitors cellular energy charge to maintain metabolic homeostasis. Upon energy depletion intracellular AMP to ATP ratio increases, activating AMPK and simultaneously downregulating anabolic pathways such as protein, triglyceride and fatty acid synthesis while upregulating catabolic pathways such as glycolysis and fatty acid oxidation to augment ATP synthesis (Hardie, 2011). In addition to regulating cellular energy homeostasis by sensing and responding to the intracellular adenylate pool, AMPK has recently been reported to sense and respond to increases in intracellular ROS (Poels et al.,

2009). Thus, cellular conditions such as nutrient depletion, hypoxia, or mitochondrial dysfunction all play a role in AMPK activation. While it has been speculated that ATP depletion induced by ischemic/ by pro-oxidant conditions is the primary means by which

ROS activates AMPK, it has also been shown that AMPK can be activated by ROS under

102 hypoxic conditions without any notable changes in the cellular adenylate pool (Emerling et al., 2009). Moreover, AMPK is directly activated by peroxide (Choi et al., 2001), where exposure to physiologically relevant concentrations results in the oxidation of regulatory cysteine residues, which potentiates kinase activity even in the absence of any decrease in cellular ATP (Zmijewski et al., 2010).

Metabolic stress incurred during tissue injury may also promote myofibroblast differentiation, as loss of tissue perfusion promotes a hypoxic, pro-oxidative cellular microenvironment that activates AMPK, which has recently been implicated in myofibroblast differentiation downstream of non-canonical TGFβ1 signaling. Although the role of canonical/Smad dependent TGFβ1 signaling is well known in its capacity to induce myofibroblast differentiation (Hu et al., 2003), Smad independent pathways also play a significant role (Stratton et al., 2002; Liu et al., 2007; Shi-wen et al., 2009;

Vepachedu et al., 2007; Furukawa et al., 2003; Conte et al., 2011) . Molkentin and colleagues recently published that upregulation of TRPC6 channel-mediated Ca2+ signaling is necessary and sufficient for activating calcineurin/NFAT-mediated transcription during myofibroblast differentiation, where the intracellular TRPC6 calcium leak is potentiated by p38 MAPK dependent non-canonical TGFβ1 signaling (Davis et al., 2012). Further highlighting the importance the p38 MAPK pathway in myofibroblast differentiation, Entman and coworkers recently discovered a non-canonical AMPK mediated pathway also involving Tak1 and p38 MAPK that regulates myofibroblast differentiation. Aging cardiac mesenchymal stem cells and resident fibroblasts, which

103 generate dysfunctional myofibroblasts with reduced SMαA expression and contractile function, can be rescued by stimulating cells with the AMPK agonist AICAR (Cieslik et al., 2011). In this Smad-independent TGFβ1 signaling pathway, stimulation of the

TGFβ1 receptor in response to stress/injury activates TGFβ-associated kinase 1 (Tak1), which phosphorylates and activates AMPK, resulting in downstream activation of p38

MAPK and serum-response factor (SRF) that induces pro-fibrotic gene expression.

ROS signaling also is a key feature of myofibroblast differentiation. TGFβ1 induces a pro-oxidative microenvironment by reducing expression of the endogenous anti-oxidant enzymes MnSOD and catalase (Michaeloudes et al., 2010). TGFβ1 also up-regulates

Nox4 expression to generate increased intracellular and extracellular ROS, which is required for the conversion of lung, kidney, and cardiac fibroblasts to the myofibroblast phenotype (Sturrock et al., 2006; Cucoranu et al., 2005; Barnes and Gorin, 2011; Hecker et al., 2009). It also was recently shown that TGFβ1 activation of myofibroblast differentiation in human pulmonary fibroblasts is dependent on the generation of mitochondrial ROS from complex III of the electron transport chain (Jain et al., 2013).

In this chapter we present evidence suggesting that metabolic stress signaling via coordinated AMPK activation and ROS signaling may be important for the post- transcriptional regulation of SMαA expression during myofibroblast differentiation.

Stimulation of AMPK activity with AICAR activated TG2 transamidation and induced the formation of high molecular weight YB-1 oligomers with enhanced affinity for an

104 exon-3 derived translation-silencer sequence in SMαA mRNA. We further demonstrate that AMPK and peroxide differentially regulate phosphorylation of the YB-1 cold-shock domain, which modulates YB-1 subcellular localization and SMαA mRNA binding efficiency. AICAR suppressed YB-1 phosphorylation, which prevented nuclear translocation and activated SMαA mRNA binding. In contrast, peroxide stimulation activated Erk/MAPK dependent phosphorylation of the YB-1 cold-shock domain and caused the dispersal of YB-1: SMαA mRNA complexes. Thus, we propose that coordinated early AMPK activation and delayed ROS production during myofibroblast differentiation regulates SMαA expression at the post-transcriptional level, by coordinating the respective packaging and deployment/translation activation of SMαA mRNA from YB-1 ribonucleoprotein complexes.

105

4.2 Materials and Methods

Cell Culture Methods and Preparation of Protein Extracts. Human pulmonary fibroblasts (hPFB) were cultivated as described in Chapter 2. Recombinant human

TGFβ1 (5 ng/mL, final concentration; R&D Systems, Minneapolis, MN) was added to cultures for varying periods where indicated before preparation of protein extracts. Other cell culture reagents used included 5-aminoimidazole-4-carboxyamide ribonucleoside

(AICAR, Cell Signaling Technology, Beverly, MA) and hydrogen peroxide (Sigma-

Aldrich Corp., St Louis, MO). For inhibitor studies, cells were pre-treated with indicated concentrations of the PI3K inhibitor LY294002, Mek1 inhibitor U0126, p38 MAPK inhibitor SB203580 (Cell Signaling Technology, Beverly, MA), or the GSK3β inhibitor

LiCl (Sigma-Aldrich Corp., St Louis, MO) for the times indicated. To prepare protein extracts, cell monolayers were washed twice with Dulbecco’s phosphate-buffered saline

(PBS), scraped into fresh PBS, sedimented at 3000 rpm for 5 minutes at 4°C, washed once more in PBS, and resuspended in 400 µL of a hypotonic buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride [PMSF], 0.5 mM dithiothreitol [DTT], protease inhibitor cocktail (Roche), phosphatase inhibitor cocktail 2,3 (Sigma-Aldrich Corp., St Louis, MO)). Cells were allowed to swell on ice for 15 min followed by the addition of 25 µL of a 10% solution of

NonidetTM NP-40 and vigorous vortexing for 10 sec to rupture the cells and release nuclei that were then collected by centrifugation at 5000 rpm for 5 minutes at 4°C.

Supernatants containing the cytosol fraction were reserved and stored at -80°C. Nuclei were re-suspended in ½ packed-pellet volume of ice-cold, low-salt buffer (20 mM

106

HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 20 mM KCl, 0.2 mM EDTA, 0.2 mM

PMSF, 0.5 mM DTT). High salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM

MgCl2, 1.2 M KCl, 0.2 mM EDTA, 0.2 mM PMSF, 0.5 mM DTT, protease inhibitor cocktail, phosphatase inhibitor cocktail 2,3 (Sigma-Aldrich Corp., St Louis, MO)) equal to ½ packed-pellet volume was added and the nuclei further extracted with gentle rocking for 20 min at 4°C. Nuclear debris was removed by a 30 min centrifugation at 14,500 rpm at 4°C and the supernatant immediately desalted by buffer-exchange with low-salt buffer using a 0.5 mL capacity 10,000 MWCO Amicon centrifugal-microfiltration device

(Millipore, Billerica, MA). To prepare RIPA whole cell extracts, PBS-washed fibroblasts were scraped from culture vessels into PBS, sedimented at 3000 rpm, washed once in

PBS, and extracted in 200 µL of RIPA buffer (50 mM Tris-HCl, pH 8.0, 1% NP-40,

0.5% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail, phosphatase inhibitor cocktail 2,3 (Sigma-Aldrich Corp., St Louis, MO), 0.2 mM PMSF, and 1 mM DTT) for

30 min on ice. Extracts were clarified by centrifugation at 14,500 rpm for 30 min at 4°C and the resulting supernatant stored at -80°C.

RNA-binding assays. A synthetic biotinylated oligonucleotide probe containing 30-nt translation-silencing element from exon 3 of SMαA mRNA

(gggaguaaugguuggaaugggccaaaaaga), previously shown to bind YB-1 and Pur proteins was used for YB-1 RNA binding assays (Kelm, Jr. et al., 1999b). RNA-binding reactions containing protein extract (100 μg) and biotinylated oligonucleotides (100 pmol;

Integrated DNA Technologies, Coralville, IA) were incubated in a buffer containing

107 poly(dI-dC), 10 mM Tris, pH 7.5, 50 mM NaCl, 0.5 mM DTT, 0.5 mM EDTA, 0.12 mM

2004; Zhang et al., 2008). After washing four times with buffer containing 25 mM Tris-

HCl, pH 7.5, 1 mM EDTA, and 100 mM NaCl, bound protein was eluted using one packed-bead volume of 2X protein-denaturing buffer and analyzed by SDS-PAGE and immunoblot procedures.

Immunoblot procedures. Proteins were size-fractionated by SDS-PAGE on 10% polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes.

390 mM glycine, 0.05% SDS, and 20% methanol and two-stage electrophoresis process

(60 mA for 16 hrs followed by 450 mA for an additional 3 hrs). After overnight blocking at 4°C in Tris-buffered saline (TBS; 25 mM Tris-HCl, pH 7.5, and 150 mM NaCl) containing 0.1% (v/v) Tween 20TM and 5% (w/v) bovine serum albumin (BSA), nitrocellulose blots were incubated with selected rabbit polyclonal antibodies (1–2

µg/mL) overnight at 4°C with gentle rocking. Rabbit polyclonal antibodies specific for

108 either N- or C-terminal portions of YB-1 were obtained from Sigma-Aldrich (St. Louis,

MO). Antibodies for detection of transglutaminase 2, YB-1 phospho-serine 102, Akt phospho-serine 473, and phospho-p42/44 MAPK were obtained from Cell Signaling

Technology (Beverly, MA). Blots were washed four times at room temperature over a

20-min period in TBS containing 0.3% (v/v) Tween 20TM, incubated with horseradish peroxidase-conjugated, goat anti-rabbit secondary antibody for 45 min, washed, and processed for antibody visualization by chemiluminescence (Thermo Scientific,

Rockford, IL) that was detected and captured using ChemiDocTM XRS CCD-based imaging instrumentation (BioRad, Hercules, CA). Chemiluminescence image-capture times were varied over a period of 30-500 sec to distinctly resolve the p50 and p100+ molecular weight regions on immunoblots that are depicted in some figures as separate digital-image components.

In-situ TG2 activation assay. For in situ TG2-mediated crosslinking reactions (Oh et al.,

2011), human pulmonary fibroblasts were incubated for 60 min with 1 mM biotinylated pentylamine substrate (EZ-link, Pierce, Rockford, IL). Whole-cell extracts were prepared as noted above followed by size-fractionation of TG2 reaction products by SDS-PAGE.

Biotin-tagged proteins were detected on blots using streptavidin-coupled horse radish peroxidase and a standard chromagen-development chemistry (Invitrogen).

CIP dephosphorylation of protein extracts. Prior to dephosphorylation, whole-cell extracts were buffer-exchanged with NEBuffer 3 (100mM NaCl, 50mM Tris-HCl,

109

10mM MgCl2, 1mM DTT, pH 7.9) using 0.5 mL capacity 10,000 MWCO Amicon centrifugal-microfiltration devices (Millipore, Billerica, MA) and adjusted to a concentration of 0.5μg/μL. For dephosphorylation reactions, 300μL sample aliquots were incubated with 150 units of calf-intestinal alkaline phosphatase (CIP, New England

Biolabs, Ipswich, MA) for 60 minutes at 37°C.

RNA secondary structure prediction. Secondary structure for human SMαA mRNA

(GI:28329) was predicted with the Mfold web server for nucleic acid folding and hybridization prediction (Zuker, 2003).

110

4.3 Results

Ca2+/ROS activation of the protein crosslinking enzyme TG2 during myofibroblast differentiation induces the formation of YB-1 oligomers with selective affinity for an exon-3 derived translation silencer sequence in SMαA mRNA (Chapter 3). As a stress granule protein, YB-1 binds and stabilizes a number of mRNAs that encode proteins needed for cellular adaptation during periods of metabolic stress due to hypoxia or oxidative stress (Onishi et al., 2008; Goodier et al., 2007; Hanssen et al., 2011; Wehner et al., 2010; Yang and Bloch, 2007; Eliseeva et al., 2011; Evdokimova et al., 2006a).

Recently, it was reported activation of the metabolic stress-responsive protein AMPK is necessary for the formation of stress granules in response to cold shock (Hofmann et al.,

2012). The potential importance of AMPK in myofibroblast differentiation was recently brought to light when Entman and colleagues noted that myofibroblast differentiation, which is diminished in mesenchymal stem cells or cardiac fibroblasts of aging mice, was rescued by the administration of the AMPK agonist AICAR. Rescue of myofibroblast differentiation occurred via a non-canonical TGFβ1 mediated pathway associated with activation of Tak1/ AMPK/ p38 MAPK signaling. In addition responding to increases in cellular ATP signaling reduced energy stores, AMPK is also activated via Ca2+- and

ROS-mediated pathways (Hurley et al., 2005; Woods et al., 2005; Irrcher et al., 2009;

Siegel et al., 2008). Given the novel role for Ca2+/ROS-activation of TG2 mediated YB-

1 crosslinking in the post-transcriptional control of SMαA (Chapter 3), we speculated that

AMPK signaling during myofibroblast differentiation may also contribute to post- transcriptional regulation of SMαA expression.

111

To determine if AMPK signaling activates TG2 transamidation, pulmonary myofibroblasts were exposed to a membrane-permeable, biotinylated primary amine (BP) that serves as a surrogate lysine substrate for the TG2 transamidation reaction (Oh et al.,

2011) followed by the administration of AICAR. While endogenous TG2 crosslinking activity was sufficient to induce low-level incorporation of the BP substrate, AICAR administration significantly increased BP incorporation (Figure 4.1a). Notably, AICAR activation of TG2 transamidation was more robust than that of the known TG2 activator hydrogen peroxide. AICAR and peroxide in combination resulted in an additive effect on transamidation, increasing BP incorporation significantly more than AICAR or peroxide alone. Notably, formation of p50-biotin in Figure 4.1a was consistent with data presented in Chapter 3 that identified p50-biotin as TG2-modified YB-1 (Figure 3.2c) in a similar TG2 activation assay.

To examine whether AICAR activates YB-1 crosslinking, human pulmonary fibroblasts were treated with 1mM AICAR for 24 hours. As shown in Figure 4.1b, AICAR increased the formation of p125 and p250 YB-1 enriched protein complexes. AICAR- induced p125 oligomer formation was comparable to that induced by a 24hr TGFβ1 treatment. YB-1 p250 levels were significantly higher in TGFβ1- activated cells, however. YB-1 p125 and p250 levels in cells treated with both TGFβ1- and AICAR- were similar to cells which received AICAR alone. While AICAR had a modest effect on increasing YB-1 oligomers, surprisingly co-administration of AICAR with TGFβ1

112 suppressed SMαA protein expression relative to TGFβ1 alone (Figure 4.1c). Given the result that AICAR activated TG2 transamidation (Figure 4.1a) and YB-1 oligomerization, we speculated that AMPK activation may be regulating SMαA mRNA packaging, but not necessarily deployment and/or translation of these transcripts.

Therefore persistent activation of the AMPK pathway by AICAR may limit SMαA protein expression at the post-transcriptional level, by prolonging the life of- or preventing dispersal of YB-1 oligomers, which may prevent mRNA unloading

(deployment) at polysomes for translation.

YB-1 is dynamically distributed between the nucleus and cytosol. As a nuclear transcription factor, YB-1 regulates multiple genes associated with cellular stress and tissue repair. In the cytosol, YB-1 is one of the major constituents of mRNPs such as stress granules, where it coordinates the translation, stability, and localization of cellular mRNAs (Wolffe, 1994). Because AICAR induced YB-1 oligomerization, which is enhanced by SMαA mRNA binding (Chapter 3), we speculated AICAR may also alter the subcellular distribution of YB-1 and/or YB-1 oligomers. Human pulmonary fibroblasts were pre-treated with AICAR or vehicle control for 1 hr prior to TGFβ1 stimulation for an additional 24 hrs (Figure 4.2). AICAR treatment altered YB-1 subcellular distribution by decreasing nuclear YB-1 p50 levels and increasing the amount of YB-1 p50 in the cytosol. This was correlated with suppression of phosphorylation of serine 102 within the YB-1 cold shock domain, a modification previously noted to be required for YB-1 nuclear translocation (Sutherland et al., 2005). AICAR also increased

113 the presence of high molecular weight YB-1 variants in the cytosol, while simultaneously eliminating the presence of all high molecular weight crosslinked YB-1 variants in the nucleus (Figure 4.2a). TGFβ1 increased the formation of cytosolic p100-250 YB-1 oligomers, while also increasing the levels of a YB-1 p125 protein complex above that of non-treated controls in the nuclear fraction. While AICAR did not affect TGFβ1 induced

YB-1 oligomer formation in the cytosol, it completely suppressed TGFβ1 induced YB-1 oligomerization in the nuclear fraction. Thus, a probable explanation is that AICAR activates TG2 crosslinking and sequesters YB-1 in the cytosol by preventing YB-1 serine

102 phosphorylation and nuclear translocation. The AICAR-induced increase in cytosolic

YB-1 oligomers also coincided with an increase in the binding of YB-1 to an exon-3 translation silencer sequence in the coding region of SMαA mRNA (Figure 4.2b). While

AICAR alone increased YB-1 p50 and p150 binding to SMαA mRNA significantly above non-treated control levels, co-treatment of pulmonary fibroblasts with AICAR and

TGFβ1 substantially increased mRNA binding of p150 and p250 YB-1 protein complexes.

Because AICAR- induced AMPK activation sequesters YB-1 in the cytosol while depleting nuclear YB-1 oligomers (Figure 4.2a), we devised a ‘pulse-chase’ approach to shed some light on the possible functional dynamics of YB-1 oligomers. Cells were pulsed with AICAR for 12 hrs, after which time the AICAR was washed out, and culture media was replaced with either a control media or media supplemented with 5ng/ml

TGFβ1. Cytosolic and nuclear extracts were then sampled at various intervals over the 24 hr ‘chase’ period (Figure 4.3a). In the absence of TGFβ1, YB-1 oligomers of various

114 molecular weights spanning 60-250 kDa in size were present in the nuclear fraction

(Figure 4.3b, lower panel). Exposure to AICAR for 12 hrs significantly reduced YB-1 oligomer levels in the nuclear fraction (Figure 4.3b, ‘pre’ lane). Nuclear YB-1 oligomer levels in control cells rapidly declined over the chase period to undetectable levels by 2 hrs, and did not return to the nuclear fraction to any appreciable extent within the 24 hr sampling period (Figure 4.3b, lower panel). In contrast, cells which received TGFβ1 supplemented media after the AICAR pulse demonstrated a slight increase in nuclear

YB- 1 p125 at 12 hours into the chase period, which further increased several-fold above baseline levels at 24 hours. (Figure 4.3b, lower panel).

In the cytosol, YB-1 p125 remained relatively constant over the course of the experiment, and there was a notable, gradual accumulation of p100 during the chase that was augmented in the presence of TGFβ1 (Figure 4.3b, upper panel). YB-1 p250 oligomers, however, were induced during the chase period in both control- and TGFβ1 treated cells in the cytosol only. (Figure 4.3b, upper panel). In TGFβ1 supplemented cells, cytosolic

YB-1 p250 oligomers were induced from 0.5-12 hrs into the chase period and diminished at 24 hrs, at which time YB-1 oligomers re-formed in the nuclear fraction (Figure 4.3b).

In contrast, cytosolic YB-1 p250 oligomers only mildly increased in control cells over the

24 hr chase period, and YB-1 oligomers were not resolved in the nuclear fraction within the 24 hr observation period (Figure 4.3b).

115

Currently very little is understood in regard to regulation of TG2 subcellular localization.

TG2 generally is regarded as primarily a cytosolic protein, with lesser quantities found in the nucleus (Lesort et al., 1998; Singh et al., 1995), extra-cellular matrix (Balklava et al.,

2002), and plasma membrane (Janiak et al., 2006; Zemskov et al., 2006). The dynamic nature of YB-1 oligomer subcellular distribution in response to the AICAR pulse further suggested that TG2 subcellular localization may be affected. In non-treated human pulmonary fibroblasts, TG2 is predominately located in the nuclear fraction, with moderate levels in the cytosol (Figure 4.3c, lane N/T). In response AICAR treatment,

TG2 shifted from the nucleus to the cytosol (Figure 4.3c, lane pre), and became progressively depleted in the nuclear fraction until 2 hrs into the chase period. TG2 slowly returned to the nuclear fraction from 6-24 hrs during the chase period in both control and TGFβ1-supplemented cells (Figure 4.3c, lower panel). Cytosolic TG2 levels were elevated in TGFβ1-supplemented cells relative to control cells during the 0.5-12 hr chase period (Figure 4.3c, upper panel). This was consistent with a robust increase in

YB-1 p250 oligomers during this time-period (Figure 4.3b, upper panel). At 24 hrs post-

AICAR pulse, TG2 was equally distributed between the nuclear- and cytosolic- fractions in control cells, while TG2 was relatively enriched in the nuclear fraction of TGFβ1 activated cells, with lesser levels in the cytosol that was consistent with appearance of nuclear p250 at the 24 hr time-point (Figure 4.3c).

YB-1 is a SMαA transcriptional repressor, where it binds to an essential MCAT motif in the SMαA promoter (Zhang et al., 2005). This suggested that pulsing cells with AICAR

116 prior to TGFβ1 stimulation may increase SMαA transcriptional output by reducing the amount of YB-1 transcriptional repressor in the nucleus. Consistent with this idea,

TGFβ1-activation of SMαA protein expression, which is typically delayed by 24 hrs or more in cells cultivated on a deformable gelatin substrate (Strauch and Hariharan, 2013), exhibited accelerated activation of SMαA protein expression (Figure 4.3d), showing increased levels of SMαA protein as early as 30 minutes after TGFβ1 activation.

Notably, SMαA levels also increased slightly in control cells, suggestive of post- transcriptional effect.

ROS mediated signaling is known to activate several stress-responsive kinases that target

YB-1 serine 102 within the cold-shock domain including Erk/MAPK (Fubini and

Hubbard, 2003) and PI3K/Akt (Gough and Cotter, 2011) pathways. Peroxide/ROS signaling can also potentiate kinase signaling by inactivating cellular phosphatases

(Heneberg and Draber, 2005; Naughton et al., 2009; Gough and Cotter, 2011). Thus,

ROS-mediated phosphorylation of the YB-1 cold shock domain at serine 102 may be a trigger for deployment and translational activation of YB-1 associated mRNAs. We previously reported that thrombin activates SMαA expression in human pulmonary fibroblasts at the post-transcriptional level, by displacing YB-1 from a translation- silencer sequence in exon 3 of SMαA mRNA (Zhang et al., 2005). Notably, thrombin induced YB-1 phosphorylation also in a Erk1,2 dependent manner (Figure 4.4) at the serine 102 residue. Serine 102 resides within the YB-1 cold-shock domain, a nucleic acid binding motif containing the RNA recognition motifs RNP-1 & RNP-2 (Landsman, 1992;

117

Bouvet et al., 1995). YB-1 targeting by the PI3K/Akt pathway has been shown to be important for the translation control of YB-1 associated mRNAs. Akt mediated phosphorylation of YB-1 at serine 102 activates the translation of silent reporter mRNAs

(Evdokimova et al., 2006b), and oncogenic transcripts during cellular transformation

(Bader and Vogt, 2008). Because we suspected that TGFβ1-induced peroxide production may be a stimulus for SMαA translation, we first examined whether peroxide-treatment of human pulmonary fibroblasts might directly induce YB-1 serine 102 phosphorylation.

Treatment with various concentrations of peroxide induced phosphorylation of YB-1 at serine 102 in a concentration dependent manner over a 60-minute treatment period

(Figure 4.5a). While the PI3K inhibitor LY294002 had no affect on YB-1 serine 102 phosphorylation, it was almost completely suppressed by the Mek1 inhibitor, U0126

(Figure 4.5b).

To examine whether peroxide-induced YB-1 cold-shock domain phosphorylation regulates YB-1 interaction with SMαA mRNA, human pulmonary fibroblasts were treated with peroxide for 60 minutes. Extracts from peroxide- and vehicle-control treated cells were then dephosphorylated with calf intestinal alkaline phosphatase (CIP) and analyzed for YB-1 binding to the SMαA mRNA exon-3 translation-silencer sequence.

Peroxide induced a robust increase in serine 102 phosphorylation of YB-1 p50, p60, and p150 isoforms (Figure 4.5c, right panel), while CIP treatment of extracts almost completely eliminated any detectable YB-1 serine 102 signal.

118

CIP treatment of extracts prior to RNA pulldown assay significantly increased YB-1 binding to SMαA mRNA (Figure 4.5c), indicating that YB-1 cold shock domain phosphorylation governs YB-1 interaction with SMαA mRNA transcripts. In addition to

YB-1 p50, high molecular weight YB-1 oligomers migrating at approximately 150 kDa showed a substantial increase in SMαA mRNA binding in CIP-treated peroxide-extracts.

This is consistent with the AICAR-induced increase in binding of YB-1 p50 and oligomer isoforms to SMαA mRNA in pulmonary fibroblasts noted in Figure 4.2a, suggesting that ROS signaling during myofibroblast differentiation may regulate SMαA expression at the post-transcriptional level, by causing the dissociation and translation activation of silenced SMαA mRNA from YB-1 ribonucleoprotein complexes.

TGFβ1 activates AMPK in fibroblasts within 30 min of treatment (Cieslik et al., 2011), while TGFβ1-induced increase in Nox4 expression generates a delayed increase in cytosolic peroxide levels, which peak at 16 hrs and remain elevated over the next 24+ hrs

(Thannickal and Fanburg, 1995). Thus, we hypothesized that AMPK-activation as part of the non-canonical TGFβ1 pathway activates YB-1 oligomerization and packaging of

SMαA mRNA into translationally silent ribonucleoprotein complexes, while subsequent but delayed peroxide signaling triggers SMαA protein translation by displacing YB-1 from the exon 3 translation-silencer sequence of SMαA mRNA.

To test the hypothesis that AMPK activation followed by a ROS stimulus induces SMαA protein expression, we utilized human pulmonary fibroblasts cultivated on gelatin-coated

119 tissue culture dishes, which exhibit a spontaneous yet delayed activation of SMαA relative to fibroblasts cultivated on a rigid plastic substrate (Strauch and Hariharan,

2013). Human pulmonary fibroblasts were pre-treated with AICAR for 2 hrs, followed by treatment with various concentrations of peroxide for an additional 2 hrs. As shown in

Figure 4.6a, peroxide-or AICAR alone both increased SMαA protein expression, while

300μM peroxide treatment subsequent to AICAR administration modestly boosted

SMαA expression, suggesting that interplay between AMPK signaling and ROS production in fibroblasts may regulate SMαA expression at the post-transcriptional level.

Notably, 500μM peroxide subsequent to AICAR appeared to negate the AICAR induced increase in SMαA expression, which is suggestive of a mechanism whereby increased

YB-1 phospho-serine 102 levels cause loss of mRNA binding and protection that could have resulted in mRNA degradation, rather than translation.

SMαA expression is regulated at the transcriptional level by the binding of Smad3 to the

Smad binding element on the SMαA promoter (Hu et al., 2003) as a result of TGFβ1 receptor activation. Smad3 nuclear translocation and binding to the Smad binding element is dependent on phosphorylation at Ser423/425 residues. Thus, we examined whether AICAR/peroxide stimulation of SMαA expression may occur via a Smad- dependent signaling pathway. Neither various concentrations of peroxide nor AICAR and peroxide in combination induced Smad3 phosphorylation (Figure 4.6b,c), indicating that

AICAR/peroxide induced activation of SMαA expression does not occur via Smad dependent SMαA transcription. The acute treatment period and lack of Smad-activation

120 was suggestive of a post-transcriptional mechanism driven by non-canonical, Smad- independent signaling.

We speculate that AICAR may prime pulmonary myofibroblasts for translational activation of SMαA expression by increasing YB-1 mRNA-binding activity. Subsequent peroxide stimulus, which induces YB-1 phosphorylation, may then activate translation of the unbound YB-1 mRNA payload at polysomes. Although peroxide induced phosphorylation of YB-1 serine 102 is dependent on Erk/MAPK signaling (Figure 4.5b), the kinase dependence of SMαA translational activation has not previously been examined. Peroxide has been reported to activate p38 MAPK phosphorylation in multiple cell types including vascular smooth muscle cells (Blanc et al., 2003) and fibroblasts

(Naderi et al., 2003). Moreover, p38 MAPK is involved in the control of SMαA expression during myofibroblast differentiation (Vepachedu et al., 2007), and AMPK and p38 MAPK are downstream signaling molecules (Du et al., 2005). We therefore examined the kinase-dependence of peroxide-activated SMαA expression in

AICAR/H2O2-treated pulmonary fibroblasts. Cells were pre-treated with 20μm of either the PI3K inhibitor LY294002, the Mek1 inhibitor U0126, or the p38 MAPK inhibitor

SB203580. Inhibitor pre- treatment was followed by AICAR administration for two hours, after which cells were stimulated with 200μM peroxide for an additional 2 hrs.

While AICAR and peroxide alone mildly activated Akt serine 473 phosphorylation,

AICAR + peroxide increased Akt activation several-fold (Figure 4.7a). The PI3K inhibitor completely suppressed Akt activation, however Akt serine 473 phosphorylation

121 was also mildly suppressed by the Mek1 and p38 MAPK inhibitors. Surprisingly, suppression of PI3K signaling with LY294002 activated Erk1,2 phosphorylation in

AICAR/H2O2 treated cells. This correlated with a robust increase in YB-1 serine 102 phosphorylation. While potentiated by the PI3K inhibitor, AICAR/H2O2 induced YB-1 serine 102 phosphorylation was potently suppressed by both the Mek1 and p38 MAPK inhibitors. AICAR/H2O2 induced formation of YB-1 p100 and p125 oligomers was also potentiated by the PI3K kinase inhibitor, and almost completely suppressed by the Mek1 and p38 MAPK inhibitors (Figure 4.7b). Consistent with the idea that peroxide-induced

YB-1 cold-shock domain phosphorylation activates the translation of SMαA mRNA in

AICAR-treated fibroblasts, SMαA protein expression followed a similar pattern to YB-1 serine 102 phosphorylation. SMαA protein expression was activated by AICAR/H2O2, and increased slightly in the presence of the PI3K inhibitor (Figure 4.7c). In contrast,

AICAR/H2O2 induced protein expression was suppressed by the Mek1 and P38 MAPK inhibitors (Figure 4.7c). Thus, in this experimental model, AICAR/H2O2 activation of serine 102 phosphorylation, cytosolic oligomer formation, and SMαA protein expression are coordinated by and seemingly dependent on the Erk/MAPK and p38 MAPK pathways.

122

4.4 Discussion

Although the role of canonical/Smad dependent TGFβ1 signaling is well known in its capacity to induce myofibroblast differentiation (Hu et al., 2003), Smad-independent pathways also play a significant role, especially in shaping the wound–healing response to assure efficient termination of the primary Smad signal. Non-canonical Smad- independent pathways including RAS GTP-ase and Erk/MAPK (Yue and Mulder, 2000;

Stratton et al., 2002), JNK phosphorylation via FAK and Tak1 (Liu et al., 2007; Shi-wen et al., 2009), p38 MAPK (Vepachedu et al., 2007; Furukawa et al., 2003), and Akt

(Wilkes et al., 2005) all contribute to activation of the myofibroblast phenotype. Entman and colleagues recently discovered that cardiac mesenchymal stem cells and resident fibroblasts in aging mouse hearts, which generate dysfunctional myofibroblasts with impaired SMαA expression, can be rescued via stimulation of the AMP-activated protein kinase (AMPK) pathway with AICAR. In this work the investigators found a novel non- canonical TGFβ1 mediated pathway that regulates SMαA expression and contractile function via Tak1/AMPK/p38 MAPK signaling (Cieslik et al., 2011). Further highlighting the importance of AMPK in myofibroblast differentiation, it was recently reported that the tumor suppressor LKB1, which is also an upstream AMPK activator

(Carling et al., 2008), also is necessary for myofibroblast differentiation (Vaahtomeri et al., 2008).

In addition to functioning as a sensor of cellular energy charge by responding to increases in AMP concentration, AMPK also is activated by calcium (Hurley et al., 2005; Woods et

123 al., 2005) and ROS (Horie et al., 2008; Irrcher et al., 2009; Choi et al., 2001) signaling in response to metabolic stress and hypoxia (Emerling et al., 2009; Mungai et al., 2011). We reported in Chapter 3 that calcium/ROS activation of the protein crosslinking enzyme transglutaminase 2 (TG2) regulates myofibroblast differentiation by inducing the crosslinking of the nucleic acid binding protein YB-1, forming YB-1 oligomers that appear to be important for post-transcriptional control of SMαA expression. Reversible crosslinking of YB-1 into RNA binding oligomers results in the formation of RNA granules that may regulate the packaging and transport as well as eventual deployment of

SMαA mRNA at polysomes (Chapter 3 and (Strauch and Hariharan, 2013)). Metabolic stress incurred during tissue injury also may promote conversion of resident fibroblasts into myofibroblasts, as loss of tissue perfusion promotes a hypoxic, pro-oxidative cellular microenvironment. We speculate that activation of calcium and ROS signaling pathways under these conditions may activate AMPK as well as TG2-mediated YB-1 crosslinking to ensure prompt activation of resident fibroblasts needed to promote wound closure. We therefore examined the effect of the AMPK agonist AICAR on YB-1 oligomerization and

SMαA expression to determine whether AMPK stimulation might influence SMαA expression in our human pulmonary myofibroblast model.

Pre-treatment of human pulmonary myofibroblasts with AICAR prior to TGFβ1 activation failed to augment SMαA expression, actually reducing it slightly (Figure

4.1c). This is consistent with previous reports demonstrating that chronic pharmacological activation of the AMPK pathway suppresses TGFβ1 induced

124 myofibroblast differentiation in fibroblasts (Mishra et al., 2008) and hepatic stellate cells

(da Silva et al., 2010), where AMPK activation suppressed pro-fibrotic collagen a1 and

SMαA transcription by antagonizing Smad3 interaction with the transcriptional coactivator p300 (Lim et al., 2012). In contrast, TGFβ1 activation of SMαA expression, which typically is delayed in cells cultured on collagenous substrates, appeared to be accelerated by the 12 hr AICAR pre-treatment (Figure 4.3d). In the nucleus, YB-1 suppresses SMαA transcription by binding to an essential MCAT sequence in the SMαA promoter (Zhang et al., 2005). AICAR prevented YB-1 nuclear translocation, causing

YB-1 to accumulate in the cytosol (Figure 4.2a). Thus, while chronic AICAR treatment may suppress pro-fibrotic gene expression in certain experimental models, transient

AMPK activation may potentiate myofibroblast activation and pro-fibrotic gene expression by reducing the amount of YB-1 transcriptional repressor in the nucleus. This is consistent with the etiology of metabolic stress signaling during wound healing, where acute tissue damage, transient loss of perfusion, and inflammation induces a temporary hypoxic, pro-oxidative cellular microenvironment that activates AMPK to coordinate the stress-response. While AICAR induced suppression of SMαA expression in TGFβ1 activated fibroblasts (Figure 4.1c) may have occurred via a transcriptional repression mechanism, we also found that AICAR activated TG2 transamidation (Figure 4.1a), YB-

1 oligomerization (Figure 4.1b, 4.2a, 4.3), and significantly increased the binding of YB-

1 p50 and high molecular weight oligomers to an exon-3 translation silencer sequence in

SMαA mRNA (Figure 4.2b). This suggested that AMPK signaling, a type of non-

125 canonical TGFβ1 signaling, may also play a role in the post-transcriptional regulation of

SMαA expression by enhancing YB-1 mRNA packaging.

In this chapter we reported that AICAR-induced activation of YB-1 mRNA packaging was associated with reduced YB-1 serine 102 phosphorylation. AICAR treatment of pulmonary fibroblasts prevented YB-1 nuclear translocation, induced the formation of

YB-1 oligomers, and increased YB-1 binding to a translation- silencer sequence in SMαA mRNA (Figure 4.1b, 4.2a,b). Significantly, AICAR reduced phosphorylation of YB-1 serine 102 within the cold-shock domain, a nucleic acid binding motif which harbors both

RNP-1 and RNP-2 homology RNA binding domains (Landsman, 1992) that are involved in both sequence-specific and non-specific interaction with mRNA (Ladomery and

Sommerville, 1994; Bouvet et al., 1995). Phosphorylation of the YB-1 cold-shock domain regulates YB-1 subcellular localization, as others have noted that YB-1 serine

102 phosphorylation is required for nuclear translocation and activation of oncogenic gene expression in cancer cells (Sutherland et al., 2005). YB-1 serine 102 phosphorylation has also been linked to displacement and translational activation of silenced mRNAs from YB-1 ribonucleoprotein complexes (Evdokimova et al., 2006b;

Bader and Vogt, 2007). YB-1 association with the SMαA mRNA exon 3 translation- silencer sequence is disrupted by thrombin and non-canonical TGFβ1 receptor mediated activation of MEK1/Erk1,2 signaling in human pulmonary myofibroblasts (Kelm, Jr. et al., 1999b; Zhang et al., 2005). Thus, by suppressing YB-1 serine 102 phosphorylation,

AICAR prevented YB-1 nuclear translocation and enhanced binding to the exon 3

126 translation-silencer sequence, thereby accumulating SMαA mRNA into YB-1 ribonucleoprotein complexes in a translationally silent state.

Notably, AICAR completely suppressed the formation of YB-1 oligomers in the nucleus in naïve- and TGFβ1- activated fibroblasts (Figure 4.2a). The functional significance of

YB-1 oligomers in the nucleus is currently unknown, although they may represent nascent mRNP complexes formed by nuclear stores of TG2 enzyme during the initial stages of myofibroblast differentiation. In non-activated fibroblasts, nuclear YB-1 represses SMαA transcription by binding to an essential THR/MCAT trans-activation element in the SMαA gene promoter inducing a change in chromatin-conformation and loss of double-stranded DNA structure (Becker et al., 2000). In TGFβ1 activated myofibroblasts, YB-1 exits the nucleus and the SMαA promoter is re-folded into duplex

DNA upon interaction with Smad2/3 and SRF (Eliseeva et al., 2011; Strauch and

Hariharan, 2013). While Smad-mediated displacement of YB-1 from the SMαA promoter may be associated with YB-1 oligomerization and export as ribonucleoprotein complexes containing nascent SMαA mRNA (Zhang et al., 2005), it is also possible that nuclear

YB-1 oligomers have a function that is distinct from mRNA packaging, such as mRNA splicing. Notably, YB-1 has been identified as a spliceosome-associated protein, where it may participate pre-mRNA processing and regulation of alternative splicing (Deckert et al., 2006; Wei et al., 2012), so nuclear YB-1 oligomerization may occur as part of a co- transcriptional mRNA packaging program.

127

The result that YB-1 p250 oligomers accumulated in the cytosolic compartment after the

AICAR pulse (Figure 4.3b) in both control- and TGFβ1-supplemented cells represents a possible transcriptional regulatory function for YB-1 oligomers. Nuclear YB-1 oligomers may exhibit diminished affinity for single-stranded DNA and therefore a reduced ability to suppress SMαA transcription, functioning under TGFβ1-activated conditions to commit cells to the myofibroblast lineage by crosslinking the monomeric YB-1 transcriptional repressor. Consistent with this idea, TG2 has been found to crosslink and modify transcriptional regulation of several nuclear transcription factors including SP1, hypoxia-inducible factor, retinoblastoma protein, and E2F1 (Kuo et al., 2011). In non- activated cells, nuclear YB-1 oligomers may play a similar role; reducing the pool of available monomeric, SMαA transcription-suppressing YB-1 in non-activated cells may ensure a degree of phenotypic plasticity, enabling fibroblasts to undergo spontaneous differentiation into myofibroblasts in culture.

AICAR suppression of nuclear YB-1 oligomerization in both control- and TGFβ1- supplemented cells (Figure 4.2a) suggested that AMPK signaling also may influence the subcellular distribution of TG2. TG2 has been shown to shuttle between the nucleus and cytosol in response to changes in calcium or ROS levels during metabolic stress (Basso and Ratan, 2013). During the 12 hr AICAR pulse (Figure 4.3a), TG2, which was predominately located in the nuclear fraction, partially shifted to the cytosol (Figure

4.3c). Nuclear TG2 levels further decreased after the AICAR pulse until 2 hrs post-

AICAR washout, after which time TG2 levels in the nuclear fraction began to increase

128

(Figure 4.3c, lower panel). Thus, dynamic TG2 subcellular localization may coordinate

YB-1 transcriptional and post-transcriptional control of SMαA expression via its ability to form mRNP granules in myofibroblasts. By activating AMPK, metabolic stress shifts

TG2 to the cytosol. Simultaneous sequestration of YB-1 in the cytosol may increase

SMαA transcriptional output by reducing the availability of nuclear YB-1 for transcriptional repression, while simultaneously providing additional substrate for the formation of cytosolic YB-1 oligomers. Dephosphorylation of cytosolic YB-1 and YB-1 oligomers increases mRNA binding (Figure 4.2b), which we previously found to increase efficiency of YB-1 crosslinking (Willis et al., 2013).

Myofibroblast differentiation also is dependent on the production reactive oxygen species

(ROS) by NADPH oxidase 4 (Nox4). TGFβ1 induces a pro-oxidative cellular environment during myofibroblast differentiation by increasing Nox4 expression while simultaneously decreasing the expression of the antioxidant enzymes MnSOD and catalase (Michaeloudes et al., 2010). In contrast to other Nox isoforms, the primary ROS product of Nox4 is peroxide (Takac et al., 2011). TGFβ1 increases Nox4 expression and peroxide production in multiple cell types including endothelial cells, hepatocytes, smooth muscle cells, and fibroblasts (Bondi et al., 2010; Hecker et al., 2009; Cucoranu et al., 2005; Liu et al., 2010; Carmona-Cuenca et al., 2008; Hu et al., 2005; Sturrock et al.,

2006). Moreover, TGFβ1-activation of myofibroblast differentiation in pulmonary

(Hecker et al., 2009) , kidney, (Bondi et al., 2010) and cardiac fibroblasts (Cucoranu et al., 2005) is dependent on Nox4 mediated peroxide production. We previously published

129 that the Nox4 antagonist diphenyleneiodonium (DPI) is a potent suppressor of both YB-1 oligomerization and SMαA expression in human pulmonary myofibroblasts (Willis et al.,

2013). Moreover, activation of Nox4 expression following TGFβ1 stimulation is dependent on Smad3-mediated transcriptional activation (Hecker et al., 2009), suggesting that Nox4 generated ROS performs a downstream function that augments, rather than initiates TGFβ1-mediated gene expression. This led us to speculate that ROS generated during TGFβ1 signaling may regulate SMαA expression at the post-transcriptional level.

While AMPK signaling is activated within 30 minutes of TGFβ1 stimulation in fibroblasts (Cieslik et al., 2011), TGFβ1 induced peroxide production is far more delayed, with an onset of 8 hrs and peak output at 16 hrs, slowly declining to undetectable levels at 48 hrs (Thannickal and Fanburg, 1995). Thus, we speculated that

AMPK signaling may be important for the packaging of SMαA mRNA into translationally silent YB-1 ribonucleoprotein complexes for subsequent deployment and translational activation via delayed ROS production as a secondary biochemical event.

We previously reported that thrombin induces Erk/MAPK mediated displacement of YB-

1 from SMαA mRNA, rapidly activating translation (Zhang et al., 2005). Here we extend these findings to show that phosphorylation of YB-1 serine 102 triggers release of

SMαA mRNA from YB-1: mRNA complexes. Notably, most serine 102 phosphorylated

YB-1 in non-peroxide stimulated cells exists as high molecular weight oligomers migrating at approximately 150 kDa (Figure 4.5c). Serine 102 phosphorylated p150

130 levels did not change in response to peroxide stimulation. The function of these YB-1 p150 oligomers, which appear to be constitutively phosphorylated, is not known. It is possible that YB-1 oligomers are cyclically phosphorylated and de-phosphorylated at serine 102 as cells package, transport, and deploy mRNA from YB-1 ribonucleoprotein complexes, resulting in a relatively constant pool of recyclable YB-1 phospho-p150 in cells undergoing steady state protein synthesis. Alternatively, the phosphorylation state of YB-1 oligomers may selectively route functionally related groups of mRNAs to YB-1

RNA granules for packaging/transport to polysomes in response to varying cellular or environmental cues (Anderson, 2010). While non-phosphorylated YB-1 serine 102 is associated with suppression of the cap-dependent translation of cognate mRNAs, the ability of YB-1 to stimulate translation via IRES mediated cap-independent translation is unaffected (Evdokimova et al., 2006b). Accumulation of phosphorylated YB-1 therefore, may help relieve suppression of cap-dependent protein translation in normal, quiescent fibroblasts. While the function of these constitutively phosphorylated YB-1 oligomers warrants further investigation, it is clear that phosphorylation of the YB-1 cold-shock domain at serine 102 regulates the interaction of monomeric and high molecular weight oligomer YB-1 isoforms with the exon-3 translation-silencer sequence in SMαA mRNA.

Given the result that AICAR activated YB-1 mRNA packaging in parallel with suppressing serine 102 phosphorylation, while peroxide displaced SMαA mRNA by inducing serine 102 phosphorylation, we speculated that early activation of AMPK signaling and a delayed increase in ROS levels during myofibroblast differentiation may

131 regulate SMαA expression at the post-transcriptional level by modulating YB-1 oligomerization and mRNA binding properties. To simulate AMPK/ROS signaling during myofibroblast differentiation, naïve fibroblasts, which exhibit a spontaneous yet delayed activation of SMαA expression when cultivated on a deformable gelatin substrate, were sequentially treated with 1mM AICAR followed by various concentrations of hydrogen peroxide. Although both AICAR and H2O2 alone activated

SMαA expression to some extent, sequential administration of AICAR and peroxide had the most potent tangible effect on activating SMαA protein expression (Figure 4.6a,

4.7c). The result that acute treatment with AICAR alone stimulated SMαA expression was interesting, given that extended AICAR treatment increased mRNA packaging and decreased SMαA expression in TGFβ1-activated fibroblasts (Figure 4.1a).

Pharmacological AMPK activation with AICAR has been shown to generate reactive oxygen species (Sauer et al., 2012). Thus, limited ROS production may be intrinsic to

AICAR activation of AMPK, providing a ROS stimulus for mRNA deployment while also activating YB-1 mRNA packaging. AMPK is also transiently activated by peroxide

(Zmijewski et al., 2010; Choi et al., 2001) which may explain our observations that both

AMPK and peroxide treatment alone or in combination activate SMαA expression to varying degrees. Because treatment with AICAR and peroxide was limited to 2 hrs (for a collective 4 hrs total treatment period), we believe this to be a post-transcriptional effect, as the total 4 hr treatment period is likely insufficient for denovo activation of protein expression. Moreover, peroxide in various concentrations and sequential

132

AICAR/peroxide treatment both failed to activate Smad3-phosphorylation (Figure

4.6b,c), further pointing to a non-transcriptional explanation for these findings.

While consistent, the modest increase in SMαA expression in experiments with acute

AICAR and subsequent peroxide treatment suggest that this experimental approach requires some optimization. The concentration of peroxide treatment used subsequent to

AICAR was optimized empirically over the course of a number of experiments, however it is possible that the timing of peroxide administration was not optimal to maximally activate SMαA expression. ROS activation of silent YB-1: mRNA complexes also may be a highly localized effect, requiring additional time for transport of YB-1 RNA granules to polysomes adjacent to cellular calcium or ROS microdomains. Ca2+/ROS microdomains are likely important for localized YB-1 mediated translation control, given the implications of calcium signaling on YB-1 oligomer formation and dispersal noted in

Chapter 3.

In response to nutrient-limiting conditions or metabolic stress, AMPK becomes activated and functions as a repressor of global protein synthesis to conserve energy and ensure cellular survival. AMPK suppresses protein translation elongation by phosphorylating and activating eukaryotic elongation factor 2 kinase (eEF2K), which then phosphorylates and inactivates the eukaryotic translation elongation factor eEF2, suppressing protein translation at the elongation phase (Horman et al., 2002). When translation is suppressed at the elongation phase, mRNAs may accumulate at polysomes facilitating a rapid burst

133 in protein synthesis upon removal of the biochemical elongation-block. Thus, in the context of myofibroblast differentiation, AMPK activation may load YB-1 mRNP complexes with translationally silenced mRNAs important for wound healing and tissue repair, enabling a spatially and temporally controlled burst of protein synthesis in response to localized ROS signaling.

Increases in ROS levels can amplify kinase signaling cascades through ROS-mediated suppression of protein phosphatases (Heneberg and Draber, 2005), which may potentiate activation of YB-1 targeting kinases for mRNA deployment. In addition to providing a stimulus for mRNA release, peroxide also may relieve AMPK-suppression of the protein synthesis machinery. A possible mechanism by which this may occur was recently reported, where it was discovered that Akt represses AMPK via a GSK3β-dependent mechanism (Suzuki et al., 2013). Although Akt generally is a GSK3β inhibitor, it was discovered that GSK3β associated with AMPK is activated, rather than repressed by Akt signaling. Thus, ROS activation of Akt may suppress AMPK activity, enabling the rapid conversion from catabolic states where protein synthesis is repressed, to anabolic states associated with high levels of protein synthesis. Notably, the combination of AICAR and

H2O2 robustly activated Akt phosphorylation (Figure 4.7a), suggesting that this pathway may be operative in the present model. Activation of SMαA expression was not dependent on PI3K signaling however, as demonstrated by the lack of efficacy of the

PI3K inhibitor on AICAR/peroxide-induced SMαA expression (Figure 4.7c). Of note,

PI3K inhibition with LY294002 significantly increased YB-1 serine 102 phosphorylation,

134 which correlated with an increase in phosphorylated Erk1,2 levels. This is suggestive of negative crosstalk between the Erk/MAPK and PI3K pathways during peroxide stimulation, a well-known phenomenon in integrin-linked kinase control of cardiopulmonary fibrosis and remodeling (Shiojima and Walsh, 2006; White et al.,

2006). In contrast, YB-1 serine 102 phosphorylation in response to AICAR/ peroxide treatment was suppressed by both the Mek1 and p38 MAPK inhibitors. This is consistent with literature reports implicating peroxide in the activation of multiple kinase signaling cascades including Erk1,2, p38 MAPK, and Akt signaling (Blanc et al., 2003). Thus, we speculate that activation of Erk and p38 MAPK by peroxide coordinates YB-1 mRNA deployment with possible Akt-mediated de-repression of the cellular protein synthesis machinery.

The result that AMPK activation with AICAR induced TG2 transamidation activity, while also suppressing YB-1 serine 102 phosphorylation is suggestive of a link between

YB-1 serine 102 phosphorylation and TG2-mediated crosslinking. The effect of serine

102 phosphorylation on YB-1 crosslinking has not been previously examined. The effect could be indirect, mediated by SMαA mRNA binding. YB-1 interaction with SMαA mRNA enhances the efficiency or TG2-mediated crosslinking (Willis et al., 2013), and as we have demonstrated in the present study, YB-1 lacking the phospho-serine 102 modification has a higher affinity for SMαA mRNA. Alternatively, YB-1 serine 102 phosphorylation may directly influence the affinity of YB-1 as a TG2 crosslinking substrate. In the absence of a suitable amine substrate, or under particular solvent

135 conditions that favor TG2 isopeptidase activity, YB-1 oligomerization is reversible via a deamidation reaction (Willis et al., 2013). Notably, dispersal of YB-1 oligomers by thrombin also induced Erk/MAPK dependent YB-1 serine 102 phosphorylation (Figure

4.4), which is suggestive of a mechanism by which serine 102 phosphorylation may determine whether TG2 mediated YB-1 crosslinking proceeds in the forward

(transamidation) or reverse (deamidation) direction. YB-1 non-covalent multimerization to form nanofiber structures is regulated by interactions between the YB-1 cold-shock domain and disordered terminal domains (Guryanov et al., 2012). Thus, phosphorylation of YB-1 serine 102, due to its location within the cold-shock domain, may also regulate covalent, TG2-mediated crosslinking.

Further studies are needed to determine whether YB-1 serine 102 phosphorylation plays a direct- or indirect role the regulation of YB-1 crosslinking. The data in this report is suggestive however, of a role for AMPK in the regulation of YB-1 ribonucleoprotein structure and function via modulation of YB-1 serine 102 phosphorylation, oligomerization, and mRNA binding properties. Flanking the YB-1 cold-shock domain are intrinsically disordered N-and C-terminal domains (Guryanov et al., 2012), a property common to the prion-like, low-complexity domains of proteins associated with

RNA granule formation (Kato et al., 2012). It was recently published by McKnight and colleagues that phosphorylation of the low-complexity domain of the RNA granule protein FUS regulates incorporation into RNA granules, which is one of the first studies suggestive of a mechanism for signal-dependent control of RNA granule assembly (Han

136 et al., 2012). While the YB-1 cold-shock domain harboring serine 102 is highly ordered,

YB-1 N-and C-terminal regions are intrinsically disordered (Eliseeva et al., 2011). Thus, dynamic interplay between the YB-1 cold-shock domain and intrinsically disordered terminal domains, which may in-turn regulate TG2 mediated YB-1 oligomerization, may ultimately govern the structure and function of YB-1 RNA granules.

In eukaryotes, 5’cap dependent translation is initiated via a scanning mechanism, where the small (40S) ribosomal subunit loaded with Met-tRNAi in a pre-initiation complex that binds to the mRNA 5’cap structure and scans for the AUG start codon (Sonenberg and

Hinnebusch, 2009). The eIF4F complex, which consists of subunits eIF4A, eIF4B, eIF4E, and eIF4G binds to the mRNA 5’ cap structure and mediates interaction with the small ribosomal subunit. YB-1 has been shown to suppress translation initiation by preventing interaction of the eIF4F translation initiation complex with the 5’cap structure.

This occurs via the YB-1 cold-shock domain, which binds to the mRNA cap-structure, displacing eIF4E, eIF4A, and eIF4B of the eIF4F complex (Eliseeva et al., 2011;

Evdokimova et al., 2001; Bader et al., 2003). Upon phosphorylation of YB-1 serine 102, affinity of the YB-1 cold-shock domain for the 5’cap structure is reduced. This facilitates eIF4F binding and small ribosomal subunit recruitment, activating previously silenced mRNAs for 5’cap-dependent translation. Based on secondary structure prediction of the

SMαA mRNA transcript, the exon-3 YB-1 binding site lies in close proximity to the

AUG start codon (Figure 4.8). As we have shown in this report, AMPK mediated dephosphorylation of YB-1 serine 102 in the cold shock domain greatly increased YB-1

137 interaction with the SMαA exon-3 binding site. We speculate, however, that this spatial proximity may selectively prime YB-1 RNA granules containing translationally silenced

SMαA mRNAs for translation activation during metabolic stress in newly differentiated myofibroblasts.

Once formed, translationally silent YB-1 RNA granules may be transported along the cytoskeleton to localized sites of protein synthesis, awaiting ROS-mediated cues for mRNA deployment and translation activation. YB-1 binds actin filaments and microtubules (Chernov et al., 2008b) in the cytosol and functions as a porter for viral mRNA in influenza-infected cells, leading viral ribonucleoprotein particles to microtubules for transport to endosomes for secretion (Kawaguchi et al., 2012). YB-1 also mediates localization of specific mRNAs to mitochondria for translation (Matsumoto et al., 2012). Moreover, we previously demonstrated that YB-1 accumulates at polysome enriched cardiac intercalated discs in response to cardiopulmonary stress, where it colocalizes with SMαA mRNA and the YB-1 binding partner Purα (Zhang et al., 2008).

Purα, which binds YB-1: mRNA complexes (Kelm, Jr. et al., 1999b), also is a well- known adaptor protein for motor-driven transport of RNA granules in neuronal cells. By tethering mRNA granules to motor proteins for transport along the microtubule cytoskeleton, Purα facilitates the shuttling mRNAs from the nucleus to peripheral dendrites for localized protein synthesis (Johnson et al., 2013; Chen et al., 2008; Johnson et al., 2006; Kanai et al., 2004).

138

Post-transcriptional mechanisms that regulate mRNA stability and/or translational efficiency are particularly important for coordinating the initiation and resolution of wound healing responses (Anderson, 2010). YB-1 binds to and stabilizes myofibroblast transcripts encoding SMαA (Zhang et al., 2005; Kelm, Jr. et al., 1999b) and type 1 collagen subunits (Hanssen et al., 2011), underscoring the importance of YB-1 mRNA packaging to enable rapid production of these two specialized proteins for wound healing and tissue repair. In the context of myofibroblast differentiation, transient AMPK activation, by increasing YB-1 oligomerization and mRNA binding in the cytosol may selectively package mRNAs important for wound healing and tissue repair into YB-1

RNA granules in a translationally silent state. Accumulation of mRNAs in YB-1 RNA granules may also protect these transcripts from degradation, awaiting activation via

ROS-induced kinase targeting of YB-1 serine 102. Thus, we hypothesize that AMPK induced formation of YB-1 mRNA granules during myofibroblast differentiation may stockpile translationally silent mRNAs for cytoskeletal transport and sequestration at local sites of protein synthesis, after which delayed Nox4 mediated ROS production coordinates the deployment of mRNA from YB-1 ribonucleoprotein complexes with de- repression of the protein synthesis machinery (Figure 4.9a).

Turnover of the post-mRNA deployment YB-1 oligomer pool may have important implications for the fate of myofibroblasts during physiological wound healing responses as well as fibrotic disease (Figure 4.9b). We demonstrated in Chapter 3 that TG2 mediated YB-1 crosslinking is a reversible phenomenon, and a plausible way by which

139

YB-1 oligomer complexes are dispersed following phospho-serine 102 activated delivery of their mRNA payloads. Serine 102 phosphorylation is a known trigger for YB-1 nuclear translocation, however there are also reports that stress-induced proteolytic cleavage of

YB-1 by the 20S proteasome results in the formation of truncated YB-1 variants lacking a

C-terminal cytosolic retention signal that translocate to the nucleus (Sorokin et al., 2005).

Additionally, it has been reported that YB-1 is targeted for poly-ubiquitination and 26S proteasome- mediated degradation (Chibi et al., 2008; Lutz et al., 2006), raising the possibility that post-deployment YB-1 mRNP complexes are simply turned over. The nature of YB-1 processing may be an important control point for myofibroblast differentiation, that if dysregulated may be a driver of fibrotic disease. Deamidated and

/or truncated YB-1 monomer variants may have altered function, perhaps being better suited for SMαA transcriptional repression with lesser ability for nuclear mRNA processing/packaging. Such a mechanism may allow myofibroblasts to revert back to the quiescent fibroblast phenotype to end the wound healing response. Moreover, truncated and/or deamidated YB-1 variants may have altered structure/function when crosslinked by TG2 in the nucleus, as the results of Figure 4.3 suggest.

In summary, coordinated AMPK/ROS signaling may enable the rapid and sustained production of proteins essential for wound healing and tissue injury, and may more generally coordinate the packaging, transport, and translation of functionally related mRNAs to ensure cellular survival and adaptation during metabolic stress. The ability of

AMPK to simultaneously induce YB-1 mRNA packaging by increasing YB-1 oligomer

140 formation and mRNA binding is suggestive of a novel role for AMPK signaling in the regulation of cellular metabolism, where metabolic stress signals are simultaneously transduced to the messenger ribonucleoprotein infrastructure and protein synthetic machinery to allow for the rapid and flexible coordination of protein synthesis.

141

Figure 4.1: AICAR activates TG2 transamidation in human pulmonary fibroblasts.

(a) Fibroblasts were pre-treated with a biotin-pentylamine TG2 substrate (BP, 1mM, 60min) followed by vehicle control or AICAR (1mM) for 60 minutes. Cells were then treated with peroxide (1.5mM) or vehicle control for an additional 60 minutes prior to cell harvest. RIPA extracts were size-fractionated by 10% SDS-PAGE and analyzed for biotin-tagging by streptavidin-HRP western blot. To assess activation of TG2 transamidation, a 100 kDa band (arrow) and p50 bands (bracket) that exhibited minimal levels of endogenous biotinylation were examined. Treatment with BP alone slightly increased levels of biotin-tagged p50 and p100 (lane 2). Peroxide, AICAR, or AICAR + peroxide all induced p50 and p100 biotinylation. AICAR increased p50 and p100 biotin tagging to a greater extent than peroxide, while AICAR followed by peroxide activated p50 and p100 biotin tagging more than either reagent alone. Notably, biotin-p50 (Chapter 3) and p100 (data not shown) were previously identified as TG2-modified YB-1 by immunoprecipitation methods. (b and c) Cells were pre-treated with 1mM AICAR or vehicle control prior to TGFβ1 activation (5ng/ml) for an additional 24 hrs. RIPA extracts were size-fractionated by 10% SDS-PAGE and analyzed for (B) YB-1 expression with an antibody targeted to a YB-1 N-terminal epitope or (C) SMαA expression. (b) AICAR activates YB-1 oligomerization in fibroblasts. Immunoblot signals (left panel) were quantified and depicted as fold-change relative to non-treated controls (right panel). AICAR increased levels of p125 and p250 YB-1 oligomers. AICAR induced p125 levels were similar to that of TGFβ1-activated cells, while TGFβ1 induced p250 levels to a greater extent than AICAR or TGFβ1 + AICAR. (c) AICAR suppresses TGFβ1 activation of SMαA protein expression.

142

Figure 4.1

143

Figure 4.2: AICAR alters YB-1 cold-shock domain phosphorylation, oligomerization, and subcellular distribution in fibroblasts. 16 (a and b) Cells were pre- treated with AICAR (1mM) or vehicle control for 1 hr prior to activation with TGFβ1 (5ng/mL) for an additional 24 hrs. Cell extracts were prepared with RIPA buffer. (a) AICAR suppressed phosphorylation of YB-1 serine 102 residing within the cold-shock domain, which also reduced the presence of YB-1 in the nuclear fraction. AICAR induced the formation of p125 and p250 YB-1 oligomers in the cytosol, while completely suppressing nuclear YB-1 oligomerization. (b) AICAR increases association of YB-1 with an exon-3 translation silencer sequence in SMαA mRNA. AICAR increased the interaction of YB-1 p50 and p150 oligomers with SMαA mRNA. TGFβ1 activated cells that were pre-treated with AICAR exhibited significantly increased binding of YB-1 p150 and p250 protein complexes to SMαA mRNA. YB-1 p150 oligomers appear to be a unique YB-1 size-variant specifically enriched by SMαA by mRNA pulldown.

144

Figure 4.3: AICAR pulse-chase in human pulmonary fibroblasts.17 (a) Experimental design. Pulmonary fibroblasts were pulsed with AICAR (1mM) for 12 hrs, after which time AICAR was washed out, and culture media was replaced with vehicle control-or TGFβ1 (5ng/ml)- supplemented media. Cells were harvested according to the depicted intervals over the 24 hr chase period and fractionated into cytosolic and nuclear extracts. (b) AICAR pulse modifies the subcellular distribution of YB-1 oligomers. AICAR suppressed YB-1 nuclear oligomer levels (bottom panel) and increased the formation of p100 and p125 YB-1 oligomers in the cytosol (top panel). Cytosolic YB-1 oligomer formation was enhanced in TGFβ1-activated cells. YB-1 p250 oligomers appeared first in the cytosol in both control, and TGFβ1-activated cells. Nuclear returned to the nuclear fraction in TGFβ1-activated cells only (bottom panel). (c) AICAR pulse modifies TG2 subcellular distribution. TG2, which is predominately located in the nuclear fraction in non-treated cells, is shifted to the cytosol in response to AICAR treatment (pre, top panel). Nuclear TG2 decreases after AICAR pulse until 2 hrs into the chase period, at which time nuclear TG2 levels increase, returning to original levels at 24 hrs (bottom panel). (d) SMαA and GAPDH levels were assessed in cytosolic extracts. AICAR slightly suppressed SMαA levels (‘pre’ lane). Both GAPDH and SMαA levels increase over the chase period in control- and TGFβ1 activated cells. TGFβ1 activation of SMαA expression appears to be accelerated by the AICAR pulse.

145

Figure 4.3

146

Figure 4.4: Thrombin activates YB-1 cold shock domain phosphorylation in human pulmonary fibroblasts in a Erk1,2 dependent manner. 18 (Left panel) Human pulmonary fibroblasts were pre-treated with the Mek1 inhibitor U0126 (20μM, 90min) prior to treatment with Thrombin (2U/mL) for 15 or 60 minutes as depicted in the figure. Thrombin-induced phosphorylation of p50 YB-1 was suppressed by U0126. Notably, apparent YB-1 p75 and p150 oligomer isoforms appeared to be constitutively phosphorylated. While p75 phosphorylation was suppressed slightly by the inhibitor, serine 102 phosphorylated p150 was not affected. (Right panel) A depiction of the transfer membrane stained with Ponceau S is shown on the right indicating equivalent protein loadings in each lane.

147

Figure 4.5: YB-1 cold-shock domain phosphorylation modulates affinity for SMαA mRNA. 19 (a) Peroxide activates phosphorylation of the YB-1 cold-shock domain. Human pulmonary fibroblasts were treated with various concentrations of hydrogen peroxide for 60 minutes followed by the preparation of RIPA extracts. Peroxide induced phosphorylation of YB-1 serine 102 residing within the cold-shock domain in a concentration-dependent manner. (b) Peroxide-induced YB-1 cold shock domain phosphorylation is suppressed by the mek1 inhibitor U0126. Cells were pre-treated with 20μM of the PI3K inhibitor Ly294002, mek1 inhibitor U0126, or 50mM GSK3β inhibitor LiCl for 90 minutes prior to peroxide treatment (1.5mM, 60 min). (c) YB-1 cold shock domain phosphorylation regulates interaction with the SMαA mRNA exon-3 translation silencer sequence. Undifferentiated fibroblasts were treated with peroxide (1mm) or vehicle control for 60 minutes followed by the preparation of RIPA extracts. Cell extracts were then treated with calf-intestinal alkaline phosphatase (CIP) and analyzed for YB-1 cold-shock domain phosphorylation (right panel, WB: YB-1 phospho-serine102) and SMαA mRNA binding (left panel, WB: YB-1 nt). (right panel) Peroxide activated serine 102 phosphorylation of YB-1 isoforms migrating in the vicinity of 50 and 60 kDa. CIP treatment of extracts eliminated all detectable YB-1 phospho-p50, nearly all detectable phospho-p60, and also eliminated a phospho-p150 band which appeared to be constitutively phosphorylated. (left panel) CIP treatment of extracts significantly enhanced interaction of YB-1 p50 and a high molecular weight YB-1 oligomer band migrating at approximately 130 kDa with SMαA mRNA.

148

Figure 4.5

149

Figure 4.6: AICAR and peroxide induce SMαA expression in human pulmonary fibroblasts. 20 (a) Cells were treated with AICAR (1mM, 2 hrs) followed by various concentrations of peroxide or vehicle control for an additional 2 hrs. Peroxide alone slightly activated SMαA protein expression. AICAR significantly increased SMαA protein levels, while AICAR in the presence of 300μM peroxide modestly increase in SMαA expression relative to AICAR alone or AICAR + 100μM peroxide. (b) Peroxide failed to activate the Smad3 pathway. Cells were treated with either TGFβ1 (5ng/ml), various concentrations of peroxide, or vehicle control for 6 hrs. Presence of phospho-Smad3 was assessed in nuclear extracts. (c) Neither AICAR, nor AICAR + peroxide activated Smad3 signaling. Cells were treated with AICAR (1mM) for 2 hrs followed by peroxide (400μM) or vehicle control for an additional 2 hrs. TGFβ1 activated cells (5ng/ml, 6 hrs) were used as a positive control for pSmad3 activation.

150

Figure 4.6

151

Figure 4.7: Kinase dependence of AICAR/peroxide induced YB-1 cold-shock domain phosphorylation. 21 Human pulmonary fibroblasts were pre-treated with PI3K inhibitor LY294002, Mek1 inhibitor U0126, p38 MAPK inhibitor SB203580 (20μM, 60 minutes) or vehicle control. Cells were then treated with AICAR (1mM, 2 hrs) followed by peroxide (200μM, 2 hrs). Cytosolic extracts were assessed for protein expression as follows. (a) Akt, Erk/MAPK, and p38 MAPK pathways mediate AICAR/peroxide induced YB-1 cold-shock domain phosphorylation. Peroxide, and to a lesser extent, AICAR activates Akt serine 473 phosphorylation. AICAR + peroxide potentiate Akt activation, increasing Akt phospho- serine 473 levels significantly more than either reagent alone. Phospho-Erk1,2, which is present at moderate levels in non-treated control cells does not significantly change in response to AICAR, peroxide, or AICAR + peroxide stimulation. Phospho-Erk1,2 levels increase several fold in AICAR/peroxide stimulated cells that were pre-treated with the PI3K inhibitor. YB-1 cold shock domain phosphorylation, which is activated by peroxide, and to a lesser extent, AICAR + peroxide is increased several-fold in cells which were pre-treated with the PI3K inhibitor. Notably, AICAR + peroxide activation of YB-1 cold shock domain phosphorylation is suppressed by the Mek1 inhibitor, and to a lesser extent, the p38 MAPK inhibitor. (b) Kinase dependence of AICAR/peroxide induced YB-1 oligomerization. Cytosolic YB-1 p100 and p125 oligomers, which are induced by AICAR, and to a greater extent AICAR + peroxide, are further induced by pre-treatment with the PI3K inhibitor. AICAR + peroxide induced increase in YB-1 p100/p125 is suppressed by the Mek1 and p38 MAPK inhibitors. (c) Kinase dependence of AICAR + peroxide activation of SMαA expression. Activation of SMαA expression by AICAR + peroxide correlates with YB-1 cold-shock domain phosphorylation. SMαA protein expression, which is activated by AICAR + peroxide, is increased slightly by the PI3K inhibitor, but suppressed by the Mek1 or p38 MAPK inhibitors.

152

Figure 4.7

153

Figure 4.8: Human SMαA mRNA predicted secondary structure. 22 The YB-1 exon-3 binding site forms a stable predicted stem-loop structure (ΔG0 = -29.9 kcal/mol), which lies in close proximity to the AUG start codon.

154

Figure 4.9: Working model for AMPK/ROS regulation of SMαA expression during myofibroblast differentiation. 23 (a) Proposed AMPK/ROS regulation of YB-1 messenger ribonucleoprotein structure/function during myofibroblast differentiation. (0-8 hrs) TGFβ1, which activates non-canonical AMPK signaling via Tak1 (Cieslik et al., 2011; Carling et al., 2008; Vaahtomeri et al., 2008) during myofibroblast differentiation, initiates YB-1: mRNA packaging via TG2-mediated crosslinking (Willis et al., 2013). (16-24+ hrs) Delayed Nox4 mediated peroxide production, which peaks at 16 hrs (Thannickal and Fanburg, 1995), initiates kinase signaling via Erk/MAPK, p38 MAPK, and Akt pathways that coordinate the deployment/translation activation of YB-1 mRNA payloads with activation of protein synthesis. The ability of AMPK to simultaneously induce YB-1 mRNA packaging by increasing YB-1 oligomer formation and mRNA binding is suggestive of a novel role for AMPK signaling in wound healing, where metabolic stress signals are simultaneously transduced to the messenger ribonucleoprotein infrastructure and protein synthetic machinery to allow for the rapid and flexible coordination of protein synthesis. (b) Potential fates of post-mRNA deployment YB-1 oligomer pool: possible mechanisms for YB-1 recycling and turnover. TG2 mediated deamidation is implicated in dispersal of YB-1 oligomer complexes. Serine 102 phosphorylation is a known stimulus for YB-1 nuclear translocation, and has also been reported to undergo 20S-proteasome mediated cleavage, forming a truncated variant via loss of a C-terminal cytosolic retention signal. YB-1 is also a substrate for poly-ubiquitination and 26S proteasome-mediated turnover. The mechanisms and regulation of YB-1 turnover may have important implications for resolution of wound healing responses that become dysregulated in fibrotic disease.

155

Figure 4.9

156

Chapter 5: Working model for YB-1-mediated translation control and future directions

In this dissertation we have presented evidence implicating YB-1 in the translation control of SMαA expression during cardiopulmonary fibrosis. Our discovery that YB-1 forms punctate deposits which localize to perinuclear as well as polyribosome-enriched intercalated disc regions in cardiomyocytes from fibrotic mouse heart grafts led us to speculate that YB-1 may form RNA granule structures important for reprogramming protein synthesis that may selectively package fetal SMαA transcripts for transport and localized translation. Switching to the myofibroblast model to examine biochemical regulation of YB-1 oligomer formation, we discovered that YB-1 is a substrate for the calcium/ROS activated protein crosslinking enzyme transglutaminase 2, implicating YB-

1 oligomerization in the packaging and translation control of SMαA expression during myofibroblast differentiation. We concluded by examining the mechanisms whereby

TGFβ1 signaling converges with AMP kinase- and ROS- driven pathways in the cytosol implicated in the regulation of packaging and delivery of SMαA mRNAs to polysomes in injury-activated fibroblasts. We discovered that AMPK activation induced dephosphorylation of the YB-1 cold shock domain (CSD), which enhanced binding to

SMαA mRNA. A subsequent ROS stimulus induced MAPK-dependent CSD phosphorylation, activating silenced mRNA payloads for translation.

157

Central to the studies presented in this dissertation is the idea that TG2-mediated YB-1 crosslinking induces the formation of YB-1 mRNA storage granules that may play a role in packaging, silencing, and transporting mRNA payloads for localized deployment and translation at polysomes. As a final note, we recently discovered that the transcription regulatory proteins Purα, and Purβ, which collaborate with YB-1 in the nucleus to regulate SMαA transcription, are also substrates for TG2 crosslinking (Figure 5.1a).

Purα is a well-known adaptor protein that tethers RNA granules in neuronal cells to microtubule motor proteins such as kinesin or dynein, facilitating mRNA transport to dendrites for localized translation. Notably, YB-1 interacts with Purα via the CSD

(Eliseeva et al., 2011), which would theoretically leave disordered YB-1 N-and C- terminal domains containing putative TG2 crosslinking sites available for covalent crosslinking. We speculate that TG2 mediated crosslinking of YB-1 disordered terminal

N-and C- domains results in the formation of highly stable RNA granules, with outward- exposed CSD domains that may form mRNA storage/transport granules with extensive

RNA binding surface area via RNP-1 and RNP-2 RNA binding motifs (Figure 5.1b).

Thus, in this capacity TG2 may effectively function as a molecular ‘spot-welding’ enzyme, forming reversible covalent linkages in order to form robust, yet readily dispersible RNA granules that provide a flexible platform for the control of cytosolic

RNA metabolism and protein synthesis.

Although YB-1 is a known constituent of stress granules, we speculate that YB-1 oligomerization also drives the formation of much more dynamic RNA granule structures

158 that may function to rapidly reprogram, rather than completely suppress 5’cap-dependent protein translation. We presented evidence in this dissertation that YB-1 oligomers bind

SMαA mRNA, enhancing production of cognate protein during myofibroblast differentiation. Notably, SMαA has an exceptionally short 3’UTR and is not predicted to form stable stem-loop structures common to transcripts with much longer 5’UTRs that undergo IRES-mediated, cap-independent translation. Our data further suggests that TG2 crosslinking activity may be graded as a function of calcium concentration. Thus, we speculate that low to moderate levels of calcium reprogram protein synthesis by promoting the dynamic packaging, transport, and translation of select mRNAs via YB-1

RNA granule formation, while chronic calcium/ROS increase further activates TG2 crosslinking and forms higher-order YB-1 oligomer complexes that may be a driver for stress granule formation.

159

5.1 Working Model

We propose that biomechanical and metabolic-stress signaling pathways converge to reprogram myofibroblast protein synthesis by modulation YB-1 mRNP structure and function. In the working model presented in Figure 5.2, we hypothesize that there are three distinct phases:

Initiation phase: metabolic and biomechanical stress-activation

Transient hypoxia and ATP depletion due to temporary loss of oxygen perfusion during tissue injury increases the cellular concentration of AMP and decreases cellular pH as cells are increasingly forced to rely on anaerobic glycolysis to augment ATP production.

Under normal physiological conditions, the plasma membrane Na+/H+ exchanger (NHE) equilibrates internal and external sodium and hydrogen ions while the plasma membrane

Na+/Ca2+ exchange pump (NCX) keeps bulk cytosolic calcium levels low. When this system is perturbed by hypoxia or energy depletion, lactic acidosis forces the NHE to import extracellular Na+ resulting in cytosolic Na+ overload (Karmazyn, 1999). This causes a compensatory reversal of sodium-calcium exchange to reduce excess cytosolic sodium, resulting in an influx of extracellular calcium into the cytosol. Biomechanical stress also contributes to elevated cytosolic calcium via stretch-sensitive TRPC-mediated calcium-leak (Maroto et al., 2005; Patel et al., 2010). Tissue injury additionally activates thrombin signaling which increases cellular calcium store release via activation of the

PAR-1 receptor (Ide et al., 2007). Importantly, elevated cytosolic calcium results in increased mitochondrial calcium uptake, which is a positive effector of mitochondrial

160 function (Balaban, 2002; Hansford and Zorov, 1998; McCormack and Denton, 1993).

The primary role of mitochondrial calcium is to stimulate oxidative phosphorylation, effectively functioning as a ‘molecular throttle’ to augment ATP synthesis. The cost of increased rates of oxidative phosphorylation is paid for with increased ROS generation, however.

Mitochondria-generated ROS activates MAP kinase signaling cascades (Levonen et al.,

2001; Ramachandran et al., 2002), and it has been shown that the Erk, JNK, and p38

MAPK signaling pathways are all activated by ischemia/reperfusion injury (Naito et al.,

2000; Yue et al., 2000; Kulisz et al., 2002). Importantly, Erk1,2 activation also leads to phosphorylation and further activation of NHE-1 (Rothstein et al., 2002; Snabaitis et al.,

2002) , which may further augment cytosolic calcium levels via mechanisms described above. Thus, metabolic and biomechanical stress-induced increases in cytosolic calcium and ROS create a potentially stressful feed-forward loop.

Adaptive phase: reprogramming of cap-dependent protein synthesis

When this metabolic and biomechanical stress-induced feed-forward loop is sufficiently stimulated, we speculate that AMPK and TG2 signaling are activated to reprogram protein synthesis in the adaptive phase, by forming YB-1 oligomers which selectively package fetal/stress response mRNAs destined for preferential translation at the leading edge of fibroblasts, or intercalated discs in cardiomyocytes. Moreover, the level of

TGFβ1 released by infiltrating leukocytes at sites of tissue damage is further augmented

161 by disruption of the cell matrix and increased ROS levels, which activates latent TGFβ stores (Barcellos-Hoff and Dix, 1996). Concurrently, transient activation of AMPK signaling is expected to induce the formation of YB-1 RNA granules that selectively bind stress responsive mRNAs including SMαA mRNA for packaging/protection and subsequent ROS-mediated deployment and translation activation.

Chronic phase: cap-dependent translation arrest

We speculate that failure to close the feed-forward loop driving the adaptive phase leads to ever-increasing cytosolic calcium and ROS, that if allowed to reach sufficient levels may further increase TG2 crosslinking and AMPK activity, resulting in the formation of stress granules. Under these conditions, cap-dependent protein synthesis is arrested and any cap-dependent mRNAs that are not degraded are sequestered into large stress granules. The storehouse of mRNAs essential for survival and stress response are then translated via cap-independent mechanisms such as IRES-mediated translation initiation until metabolic conditions improve allowing resumption of normal cellular homeostasis.

162

5.2 Future Directions

Elucidation of the biochemical mechanisms that drive YB-1 post-transcriptional regulation may extend our fundamental understanding of how stressed cells are able to coordinate molecular control of the protein synthetic machinery with messenger ribonucleoprotein remodeling to rapidly re-program mRNA translation in response to metabolic and biomechanical stress. Mechanisms governing YB-1 mediated mRNP packaging, transport, and translation control are currently of interest in our lab. Three ideas we would like to explore as they relate to stress-reprogramming of protein synthesis during cardiopulmonary fibrosis are as follows:

(1) Examine the mechanisms governing intracellular transport of stress-activated

YB-1 mRNPs. One idea we would like to explore is that YB-1 RNA granules may be tethered to motor proteins such as kinesin or dynein via Purα for motor-driven transport along the microtubule cytoskeleton. Such a mechanism may be critical for the delivery of stress-response mRNAs for localized translation during myofibroblast differentiation.

(2) Examine the mechanisms driving deployment and translation activation of YB-1 mRNA payloads at polyribosomes. TG2 mediated deamidation/dispersal of YB-1 oligomer complexes is a plausible mechanism by which YB-1 mRNP complexes may release their mRNA payloads at polysomes for translation. Moreover, ROS-induced YB-

1 serine 102 phosphorylation is a trigger for the release mRNA from YB-1: SMαA mRNA complexes. Further characterizing the mechanisms and biochemical control of

163

YB-1 mRNA deployment and how this is spatially and temporally coordinated with control of the protein synthetic machinery may provide novel insights into the molecular control stress-response protein translation.

(3) Examine the mechanisms of YB-1 recycling/turnover. Metabolic/biomechanical stress-driven protein translation in myofibroblasts may be associated with continual recharging of YB-1 mRNPs with stress-response mRNAs to support ongoing fibrogenic mRNA translation and maintain the myofibroblast phenotype. Alternatively, YB-1 may undergo processing to arrest myofibroblast differentiation and promote de-differentiation to quiescent fibroblasts. There are a number of plausible mechanisms by which post- mRNA deployment YB-1 mRNPs may be processed, including TG2-mediated deamidation, YB-1 serine 102 phosphorylation, 20S-proteasome mediated formation of truncated YB-1 variants, as well as 26S-proteasome-mediated degradation. Identification of the mechanisms and biochemical control of YB-1 turnover during stress-activated protein translation may lead to novel therapeutic avenues to arrest uncontrolled myofibroblast differentiation associated with fibrotic disease.

164

Figure 5.1: Purα and Purβ form a calcium-induced supermolecular complex catalyzed by the protein crosslinking enzyme, transglutaminase 2 (TG2). 24 (a) Purα and Purβ form a calcium-induced supermolecular complex catalyzed by the protein crosslinking enzyme, transglutaminase 2 (TG2). Purified TG2 from guinea pig liver (0.13-1.00mU/ul) was combined with hPFB lysates in a transamidation reaction buffer containing 3mM Ca2+. Within a 2 hr reaction period, TG2 concentration- dependent crosslinking of the respective 44- and 42 kDa Purα and Purβ polypeptides was detected by anti-Pur protein immunoblot analysis with significant accumulation of high molecular weight complexes of 75, 100, and 250+ kDa. (b) Proposed YB-1 mRNP structure and intracellular transport via Purα-coupled interaction with microtubule motor proteins. We speculate that TG2 mediated crosslinking of YB-1 disordered terminal N- and C- domains results in the formation of covalently linked RNA granules with outward-exposed CSD domains that may result in the formation of mRNA storage/transport granules with maximal RNA binding surface area via RNP-1 and RNP- 2 homology RNA binding motifs in the cold-shock domain.

165

Figure 5.1

166

Figure 5.2: Working Model: Metabolic and biomechanical stress-reprogramming of protein synthesis via modulation of YB-1 mRNP structure and function. 25 Initiation phase: metabolic and biomechanical stress-activation. Metabolic and biomechanical stress collaborate to increase calcium and ROS levels that initiates a feed- forward loop, leading to stress-responsive programming of protein synthesis. Adaptive phase: reprogramming of CAP-dependent protein synthesis. Once this metabolic and biomechanical stress-induced feed-forward loop is sufficiently induced, AMPK and TG2 signaling are activated to reprogram protein synthesis in the adaptive phase, by forming YB-1 oligomers which selectively package fetal/stress response mRNAs destined for localized translation. Chronic phase: CAP-dependent translation arrest. Failure to close the feed-forward loop driving the adaptive phase leads to ever-increasing cytosolic calcium and ROS, that further increase TG2 crosslinking and AMPK activity, resulting in the formation of stress granules. Under these conditions, CAP-dependent protein synthesis is arrested and mRNAs essential for survival and stress response are translated via CAP-independent, IRES-mediated translation initiation.

167

Figure 5.2

168

References

Aeschlimann,D. and Thomazy,V. (2000). Protein crosslinking in assembly and remodelling of extracellular matrices: the role of transglutaminases. Connect. Tissue Res. 41, 1-27.

Allbritton,N.L., Meyer,T., and Stryer,L. (1992). Range of messenger action of calcium ion and inositol 1,4,5-trisphosphate. Science 258, 1812-1815.

Anderson,P. (2010). Post-transcriptional regulons coordinate the initiation and resolution of inflammation. Nat. Rev. Immunol. 10, 24-35.

Anderson,P. and Kedersha,N. (2002a). Stressful initiations. J. Cell Sci. 115, 3227-3234.

Anderson,P. and Kedersha,N. (2002b). Visibly stressed: the role of eIF2, TIA-1, and stress granules in protein translation. Cell Stress. Chaperones. 7, 213-221.

Anderson,P. and Kedersha,N. (2006). RNA granules. J Cell Biol. 172, 803-808.

Armstrong,A.T., Strauch,A.R., Starling,R.C., Sedmak,D.D., and Orosz,C.G. (1997a). Morphometric analysis of neointimal formation in murine cardiac allografts. Transplantation 63, 941-947.

Armstrong,A.T., Strauch,A.R., Starling,R.C., Sedmak,D.D., and Orosz,C.G. (1997b). Morphometric analysis of neointimal formation in murine cardiac allografts: II. Rate and location of lesion development. Transplantation 64, 322-328.

Armstrong,A.T., Strauch,A.R., Starling,R.C., Sedmak,D.D., and Orosz,C.G. (1997c). Morphometric analysis of neointimal formation in murine cardiac grafts: III. Dissociation of intestitial fibrosis from neointimal formation. Transplantation 64, 1198-1202.

Asakuno,K., Kohno,K., Uchiumi,T., Kubo,T., Sato,S., Isono,M., and Kuwano,M. (1994). Involvement of a DNA binding protein, MDR-NF1/YB-1, in human MDR1 gene expression by actinomycin D. Biochem. Biophys. Res. Commun. 199, 1428-1435.

Ashizuka,M., Fukuda,T., Nakamura,T., Shirasuna,K., Iwai,K., Izumi,H., Kohno,K., Kuwano,M., and Uchiumi,T. (2002). Novel translational control through an iron- responsive element by interaction of multifunctional protein YB-1 and IRP2. Mol Cell Biol 22, 6375-6383.

169

Auld,G.C., Ritchie,H., Robbie,L.A., and Booth,N.A. (2001). Thrombin upregulates tissue transglutaminase in endothelial cells: a potential role for tissue transglutaminase in stability of atherosclerotic plaque. Arterioscler Thromb Vasc Biol 21, 1689-1694.

Aumiller,V., Graebsch,A., Kremmer,E., Niessing,D., and Forstemann,K. (2012). Drosophila Pur-alpha binds to trinucleotide-repeat containing cellular RNAs and translocates to the early oocyte. RNA. Biol. 9, 633-643.

Badarau,E., Collighan,R.J., and Griffin,M. (2011). Recent advances in the development of tissue transglutaminase (TG2) inhibitors. Amino. Acids.

Bader,A.G., Felts,K.A., Jiang,N., Chang,H.W., and Vogt,P.K. (2003). Y box-binding protein 1 induces resistance to oncogenic transformation by the phosphatidylinositol 3- kinase pathway. Proc. Natl. Acad. Sci. U. S. A 100, 12384-12389.

Bader,A.G. and Vogt,P.K. (2007). Phosphorylation by Akt disables the anti-oncogenic activity of YB-1. Oncogene.

Bader,A.G. and Vogt,P.K. (2008). Phosphorylation by Akt disables the anti-oncogenic activity of YB-1. Oncogene 27, 1179-1182.

Balaban,R.S. (2002). Cardiac energy metabolism homeostasis: role of cytosolic calcium. J Mol. Cell Cardiol. 34, 1259-1271.

Balklava,Z., Verderio,E., Collighan,R., Gross,S., Adams,J., and Griffin,M. (2002). Analysis of tissue transglutaminase function in the migration of Swiss 3T3 fibroblasts: the active-state conformation of the enzyme does not affect cell motility but is important for its secretion. J. Biol. Chem. 277, 16567-16575.

Barcellos-Hoff,M.H. and Dix,T.A. (1996). Redox-mediated activation of latent transforming growth factor-beta 1. Mol. Endocrinol. 10, 1077-1083.

Bargou,R.C., Jurchott,K., Wagener,C., Bergmann,S., Metzner,S., Bommert,K., Mapara,M.Y., Winzer,K.J., Dietel,M., Dorken,B., and Royer,H.D. (1997). Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat. Med. 3, 447-450.

Barnes,J.L. and Gorin,Y. (2011). Myofibroblast differentiation during fibrosis: role of NAD(P)H oxidases. Kidney Int. 79, 944-956.

Basso,M. and Ratan,R.R. (2013). Transglutaminase is a therapeutic target for oxidative stress, excitotoxicity and stroke: a new epigenetic kid on the CNS block. J Cereb. Blood Flow Metab 33, 809-818.

170

Becker,N.A., Kelm,R.J., Jr., Vrana,J.A., Getz,M.J., and Maher,L.J., III (2000). Altered sensitivity to single-strand-specific reagents associated with the genomic vascular smooth muscle alpha-actin promoter during myofibroblast differentiation. J. Biol. Chem. 275, 15384-15391.

Begg,G.E., Carrington,L., Stokes,P.H., Matthews,J.M., Wouters,M.A., Husain,A., Lorand,L., Iismaa,S.E., and Graham,R.M. (2006). Mechanism of allosteric regulation of transglutaminase 2 by GTP. Proc. Natl. Acad. Sci. U. S. A 103, 19683-19688.

Belkin,A.M., Zemskov,E.A., Hang,J., Akimov,S.S., Sikora,S., and Strongin,A.Y. (2004). Cell-surface-associated tissue transglutaminase is a target of MMP-2 proteolysis. Biochemistry 43, 11760-11769.

Berridge,M.J. (2006). Calcium microdomains: organization and function. Cell Calcium 40, 405-412.

Black,F.M., Packer,S.E., Parker,T.G., Michael,L.H., Roberts,R., Schwartz,R.J., and Schneider,M.D. (1991). The vascular smooth muscle alpha-actin gene is reactivated during cardiac hypertrophy provoked by load. J. Clin. Invest 88, 1581-1588.

Blanc,A., Pandey,N.R., and Srivastava,A.K. (2003). Synchronous activation of ERK 1/2, p38mapk and PKB/Akt signaling by H2O2 in vascular smooth muscle cells: potential involvement in vascular disease (review). Int. J Mol. Med 11, 229-234.

Bogatkevich,G.S., Gustilo,E., Oates,J.C., Feghali-Bostwick,C., Harley,R.A., Silver,R.M., and Ludwicka-Bradley,A. (2005). Distinct PKC isoforms mediate cell survival and DNA synthesis in thrombin-induced myofibroblasts. Am. J. Physiol Lung Cell Mol. Physiol 288, L190-L201.

Bogatkevich,G.S., Tourkina,E., Abrams,C.S., Harley,R.A., Silver,R.M., and Ludwicka- Bradley,A. (2003). Contractile activity and smooth muscle alpha-actin organization in thrombin-induced human lung myofibroblasts. Am. J. Physiol Lung Cell Mol. Physiol 285, L334-L343.

Boluyt,M.O., O'Neill,L., Meredith,A.L., Bing,O.H., Brooks,W.W., Conrad,C.H., Crow,M.T., and Lakatta,E.G. (1994). Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure. Marked upregulation of genes encoding extracellular matrix components. Circ Res. 75, 23-32.

Bondi,C.D., Manickam,N., Lee,D.Y., Block,K., Gorin,Y., Abboud,H.E., and Barnes,J.L. (2010). NAD(P)H oxidase mediates TGF-beta1-induced activation of kidney myofibroblasts. J Am Soc. Nephrol. 21, 93-102.

171

Bouvet,P., Matsumoto,K., and Wolffe,A.P. (1995). Sequence-specific RNA recognition by the Xenopus Y-box proteins. An essential role for the cold shock domain. J Biol. Chem. 270, 28297-28303.

Braunstein,S., Karpisheva,K., Pola,C., Goldberg,J., Hochman,T., Yee,H., Cangiarella,J., Arju,R., Formenti,S.C., and Schneider,R.J. (2007). A hypoxia-controlled cap-dependent to cap-independent translation switch in breast cancer. Mol. Cell 28, 501-512.

Cantin,B., Wen,P., Zhu,D., Dai,M., Panchal,S.N., Billingham,M.E., Gwathmey,J.K., and Valantine,H.A. (2001). Transplant coronary artery disease: a novel model independent of cellular alloimmune response. Circulation 104, 2615-2619.

Carling,D., Sanders,M.J., and Woods,A. (2008). The regulation of AMP-activated protein kinase by upstream kinases. Int. J. Obes. (Lond) 32 Suppl 4, S55-S59.

Carmona-Cuenca,I., Roncero,C., Sancho,P., Caja,L., Fausto,N., Fernandez,M., and Fabregat,I. (2008). Upregulation of the NADPH oxidase NOX4 by TGF-beta in hepatocytes is required for its pro-apoptotic activity. J Hepatol. 49, 965-976.

Case,A. and Stein,R.L. (2003). Kinetic analysis of the action of tissue transglutaminase on peptide and protein substrates. Biochemistry 42, 9466-9481.

Chen,J.S. and Mehta,K. (1999). Tissue transglutaminase: an enzyme with a split personality. Int. J. Biochem. Cell Biol. 31, 817-836.

Chen,N., Onisko,B., and Napoli,J.L. (2008). The nuclear transcription factor RARalpha associates with neuronal RNA granules and suppresses translation. J. Biol. Chem.

Chernov,K.G., Mechulam,A., Popova,N.V., Pastre,D., Nadezhdina,E.S., Skabkina,O.V., Shanina,N.A., Vasiliev,V.D., Tarrade,A., Melki,J., Joshi,V., Baconnais,S., Toma,F., Ovchinnikov,L.P., and Curmi,P.A. (2008a). YB-1 promotes microtubule assembly in vitro through interaction with tubulin and microtubules. BMC. Biochem. 9, 23.

Chernov,K.G., Curmi,P.A., Hamon,L., Mechulam,A., Ovchinnikov,L.P., and PastrD. (2008b). Atomic force microscopy reveals binding of mRNA to microtubules mediated by two major mRNP proteins YB-1 and PABP. FEBS Letters 582, 2875-2881.

Chibi,M., Meyer,M., Skepu,A., DJ,G.R., Moolman-Smook,J.C., and Pugh,D.J. (2008). RBBP6 interacts with multifunctional protein YB-1 through its RING finger domain, leading to ubiquitination and proteosomal degradation of YB-1. J. Mol. Biol 384, 908- 916.

Choi,S.L., Kim,S.J., Lee,K.T., Kim,J., Mu,J., Birnbaum,M.J., Soo,K.S., and Ha,J. (2001). The regulation of AMP-activated protein kinase by H(2)O(2). Biochem. Biophys. Res. Commun. 287, 92-97.

172

Chou,C.Y., Streets,A.J., Watson,P.F., Huang,L., Verderio,E.A., and Johnson,T.S. (2011). A crucial sequence for transglutaminase type 2 extracellular trafficking in renal tubular epithelial cells lies in its N-terminal beta-sandwich domain. J. Biol. Chem. 286, 27825- 27835.

Cieslik,K.A., Trial,J., and Entman,M.L. (2011). Defective myofibroblast formation from mesenchymal stem cells in the aging murine heart rescue by activation of the AMPK pathway. Am. J Pathol. 179, 1792-1806.

Cobbold,L.C., Spriggs,K.A., Haines,S.J., Dobbyn,H.C., Hayes,C., de Moor,C.H., Lilley,K.S., Bushell,M., and Willis,A.E. (2008). Identification of internal ribosome entry segment (IRES)-trans-acting factors for the Myc family of IRESs. Mol. Cell Biol. 28, 40- 49.

Cobbold,L.C., Wilson,L.A., Sawicka,K., King,H.A., Kondrashov,A.V., Spriggs,K.A., Bushell,M., and Willis,A.E. (2010). Upregulated c-myc expression in multiple myeloma by internal ribosome entry results from increased interactions with and expression of PTB-1 and YB-1. Oncogene.

Cogan,J.G., Subramanian,S.V., Polikandriotis,J.A., Kelm,R.J., Jr., and Strauch,A.R. (2002). Vascular smooth muscle alpha-actin gene transcription during myofibroblast differentiation requires Sp1/3 protein binding proximal to the MCAT enhancer. J Biol Chem. 277, 36433-36442.

Coles,L.S., Bartley,M.A., Bert,A., Hunter,J., Polyak,S., Diamond,P., Vadas,M.A., and Goodall,G.J. (2004). A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA. Potential role in mRNA stabilization. Eur. J. Biochem. 271, 648-660.

Coles,L.S., Lambrusco,L., Burrows,J., Hunter,J., Diamond,P., Bert,A.G., Vadas,M.A., and Goodall,G.J. (2005). Phosphorylation of cold shock domain/Y-box proteins by ERK2 and GSK3beta and repression of the human VEGF promoter. FEBS Lett. 579, 5372- 5378.

Conte,E., Fruciano,M., Fagone,E., Gili,E., Caraci,F., Iemmolo,M., Crimi,N., and Vancheri,C. (2011). Inhibition of PI3K prevents the proliferation and differentiation of human lung fibroblasts into myofibroblasts: the role of class I P110 isoforms. PLoS. One. 6, e24663.

Cooper,T.A. and Ordahl,C.P. (1985). A single cardiac troponin T gene generates embryonic and adult isoforms via developmentally regulated alternate splicing. J Biol. Chem. 260, 11140-11148.

173

Corry,R.J., Winn,H.J., and Russell,P.S. (1973). Primarily vascularized allografts of hearts in mice. The role of H-2D, H-2K, and non-H-2 antigens in rejection. Transplantation 16, 343-350.

Cronstein,B.N. (2011). Adenosine receptors and fibrosis: a translational review. F1000. Biol. Rep. 3, 21.

Csencsits,K., Wood,S.C., Lu,G., Faust,S.M., Brigstock,D., Eichwald,E.J., Orosz,C.G., and Bishop,D.K. (2006). Transforming growth factor beta-induced connective tissue growth factor and chronic allograft rejection. Am. J. Transplant. 6, 959-966.

Csosz,E., Bagossi,P., Nagy,Z., Dosztanyi,Z., Simon,I., and Fesus,L. (2008). Substrate preference of transglutaminase 2 revealed by logistic regression analysis and intrinsic disorder examination. J. Mol. Biol 383, 390-402.

Cucoranu,I., Clempus,R., Dikalova,A., Phelan,P.J., Ariyan,S., Dikalov,S., and Sorescu,D. (2005). NAD(P)H oxidase 4 mediates transforming growth factor-beta1-induced differentiation of cardiac fibroblasts into myofibroblasts. Circ Res 97, 900-907. da Silva,M.A., Abarca-Quinones,J., Guigas,B., Viollet,B., Starkel,P., Horsmans,Y., and Leclercq,I.A. (2010). Development of hepatic fibrosis occurs normally in AMPK- deficient mice. Clin. Sci. (Lond) 118, 411-420.

Daba,A., Koromilas,A.E., and Pantopoulos,K. (2012). Alternative ferritin mRNA translation via internal initiation. RNA. 18, 547-556.

Dai,Y., Dudek,N.L., Li,Q., and Muma,N.A. (2011). Phospholipase C, Ca2+, and calmodulin signaling are required for 5-HT2A receptor-mediated transamidation of Rac1 by transglutaminase. Psychopharmacology (Berl) 213, 403-412.

Das,S., Chattopadhyay,R., Bhakat,K.K., Boldogh,I., Kohno,K., Prasad,R., Wilson,S.H., and Hazra,T.K. (2007). Stimulation of NEIL2-mediated oxidized base excision repair via YB-1 interaction during oxidative stress. J. Biol. Chem. 282, 28474-28484.

David,J.J., Subramanian,S.V., Zhang,A., Willis,W.L., Kelm,R.J., Jr., Leier,C.V., and Strauch,A.R. (2012). Y-box binding protein-1 implicated in translational control of fetal myocardial gene expression after cardiac transplant. Exp. Biol. Med. (Maywood. ) 237, 593-607.

Davis,J., Burr,A.R., Davis,G.F., Birnbaumer,L., and Molkentin,J.D. (2012). A TRPC6- dependent pathway for myofibroblast transdifferentiation and wound healing in vivo. Dev. Cell 23, 705-715.

174

Davydova,E.K., Evdokimova,V.M., Ovchinnikov,L.P., and Hershey,J.W. (1997). Overexpression in COS cells of p50, the major core protein associated with mRNA, results in translation inhibition. Nucleic Acids Res. 25, 2911-2916.

De,V.G. and Gentile,V. (2008). Transglutaminase-catalyzed post-translational modifications of proteins in the nervous system and their possible involvement in neurodegenerative diseases. CNS. Neurol. Disord. Drug Targets. 7, 370-375.

Deckert,J., Hartmuth,K., Boehringer,D., Behzadnia,N., Will,C.L., Kastner,B., Stark,H., Urlaub,H., and Luhrmann,R. (2006). Protein composition and electron microscopy structure of affinity-purified human spliceosomal B complexes isolated under physiological conditions. Mol. Cell Biol. 26, 5528-5543.

Desmouliere,A., Chaponnier,C., and Gabbiani,G. (2005). Tissue repair, contraction, and the myofibroblast. Wound. Repair Regen. 13, 7-12.

Dooley,S., Said,H.M., Gressner,A.M., Floege,J., En-Nia,A., and Mertens,P.R. (2006). Y- box protein-1 is the crucial mediator of antifibrotic interferon-gamma effects. J. Biol. Chem. 281, 1784-1795.

Du,J.H., Xu,N., Song,Y., Xu,M., Lu,Z.Z., Han,C., and Zhang,Y.Y. (2005). AICAR stimulates IL-6 production via p38 MAPK in cardiac fibroblasts in adult mice: a possible role for AMPK. Biochem. Biophys. Res. Commun. 337, 1139-1144.

Dweck,D., Reyes-Alfonso,A., Jr., and Potter,J.D. (2005). Expanding the range of free calcium regulation in biological solutions. Anal. Biochem. 347, 303-315.

Eder,P. and Molkentin,J.D. (2011). TRPC channels as effectors of cardiac hypertrophy. Circ. Res. 108, 265-272.

Einecke,G., Reeve,J., Sis,B., Mengel,M., Hidalgo,L., Famulski,K.S., Matas,A., Kasiske,B., Kaplan,B., and Halloran,P.F. (2010). A molecular classifier for predicting future graft loss in late kidney transplant biopsies. J. Clin. Invest 120, 1862-1872.

Elberg,G., Chen,L., Elberg,D., Chan,M.D., Logan,C.J., and Turman,M.A. (2008). MKL1 mediates TGF-beta1-induced alpha-smooth muscle actin expression in human renal epithelial cells. Am. J. Physiol Renal Physiol 294, F1116-F1128.

Eliseeva,I.A., Kim,E.R., Guryanov,S.G., Ovchinnikov,L.P., and Lyabin,D.N. (2011). Y- box-binding protein 1 (YB-1) and its functions. Biochemistry (Mosc. ) 76, 1402-1433.

Emerling,B.M., Weinberg,F., Snyder,C., Burgess,Z., Mutlu,G.M., Viollet,B., Budinger,G.R., and Chandel,N.S. (2009). Hypoxic activation of AMPK is dependent on mitochondrial ROS but independent of an increase in AMP/ATP ratio. Free Radic. Biol. Med 46, 1386-1391.

175

En-Nia,A., Yilmaz,E., Klinge,U., Lovett,D.H., Stefanidis,I., and Mertens,P.R. (2005). Transcription factor YB-1 mediates DNA polymerase alpha gene expression. J. Biol. Chem. 280, 7702-7711.

Eppenberger-Eberhardt,M., Flamme,I., Kurer,V., and Eppenberger,H.M. (1990). Reexpression of alpha-smooth muscle actin isoform in cultured adult rat cardiomyocytes. Dev. Biol 139, 269-278.

Evdokimova,V., Ovchinnikov,L.P., and Sorensen,P.H. (2006a). Y-box binding protein 1: providing a new angle on translational regulation. Cell Cycle 5, 1143-1147.

Evdokimova,V., Ruzanov,P., Anglesio,M.S., Sorokin,A.V., Ovchinnikov,L.P., Buckley,J., Triche,T.J., Sonenberg,N., and Sorensen,P.H. (2006b). Akt-mediated YB-1 phosphorylation activates translation of silent mRNA species. Mol. Cell Biol. 26, 277- 292.

Evdokimova,V., Ruzanov,P., Imataka,H., Raught,B., Svitkin,Y., Ovchinnikov,L.P., and Sonenberg,N. (2001). The major mRNA-associated protein YB-1 is a potent 5' cap- dependent mRNA stabilizer. EMBO J. 20, 5491-5502.

Evdokimova,V., Tognon,C., Ng,T., Ruzanov,P., Melnyk,N., Fink,D., Sorokin,A., Ovchinnikov,L.P., Davicioni,E., Triche,T.J., and Sorensen,P.H. (2009). Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell 15, 402-415.

Evdokimova,V.M., Kovrigina,E.A., Nashchekin,D.V., Davydova,E.K., Hershey,J.W., and Ovchinnikov,L.P. (1998). The major core protein of messenger ribonucleoprotein particles (p50) promotes initiation of protein biosynthesis in vitro. J Biol. Chem. 273, 3574-3581.

Evdokimova,V.M. and Ovchinnikov,L.P. (1999). Translational regulation by Y-box transcription factor: involvement of the major mRNA-associated protein, p50. Int. J Biochem. Cell Biol. 31, 139-149.

Evdokimova,V.M., Wei,C.L., Sitikov,A.S., Simonenko,P.N., Lazarev,O.A., Vasilenko,K.S., Ustinov,V.A., Hershey,J.W., and Ovchinnikov,L.P. (1995). The major protein of messenger ribonucleoprotein particles in somatic cells is a member of the Y- box binding transcription factor family. J Biol. Chem. 270, 3186-3192.

Fagard,R.H. (1997). Impact of different sports and training on cardiac structure and function. Cardiol. Clin. 15, 397-412.

Fenton,T.R. and Gout,I.T. (2011). Functions and regulation of the 70kDa ribosomal S6 kinases. Int. J Biochem. Cell Biol. 43, 47-59.

176

Fesus,L. and Piacentini,M. (2002). Transglutaminase 2: an enigmatic enzyme with diverse functions. Trends Biochem. Sci. 27, 534-539.

Frangogiannis,N.G. (2006). The mechanistic basis of infarct healing. Antioxid. Redox. Signal. 8, 1907-1939.

Fraser,D.J., Phillips,A.O., Zhang,X., van Roeyen,C.R., Muehlenberg,P., En-Nia,A., and Mertens,P.R. (2008). Y-box protein-1 controls transforming growth factor-beta1 translation in proximal tubular cells. Kidney Int. 73, 724-732.

Fubini,B. and Hubbard,A. (2003). Reactive oxygen species (ROS) and reactive nitrogen species (RNS) generation by silica in inflammation and fibrosis. Free Radic. Biol. Med 34, 1507-1516.

Furukawa,F., Matsuzaki,K., Mori,S., Tahashi,Y., Yoshida,K., Sugano,Y., Yamagata,H., Matsushita,M., Seki,T., Inagaki,Y., Nishizawa,M., Fujisawa,J., and Inoue,K. (2003). p38 MAPK mediates fibrogenic signal through Smad3 phosphorylation in rat myofibroblasts. Hepatology 38, 879-889.

Gabbiani,G. (2003). The myofibroblast in wound healing and fibrocontractive diseases. J Pathol. 200, 500-503.

Gaudreault,I., Guay,D., and Lebel,M. (2004). YB-1 promotes strand separation in vitro of duplex DNA containing either mispaired bases or cisplatin modifications, exhibits endonucleolytic activities and binds several DNA repair proteins. Nucleic Acids Res. 32, 316-327.

Giudetti,A.M., Damiano,F., Gnoni,G.V., and Siculella,L. (2013). Low level of hydrogen peroxide induces lipid synthesis in BRL-3A cells through a CAP-independent SREBP-1a activation. Int. J Biochem. Cell Biol. 45, 1419-1426.

Gonzalez Bosc,L.V., Layne,J.J., Nelson,M.T., and Hill-Eubanks,D.C. (2005). Nuclear factor of activated T cells and serum response factor cooperatively regulate the activity of an alpha-actin intronic enhancer. J. Biol. Chem. 280, 26113-26120.

Goodier,J.L., Zhang,L., Vetter,M.R., and Kazazian,H.H., Jr. (2007). LINE-1 ORF1 protein localizes in stress granules with other RNA-binding proteins, including components of RNA interference RNA-induced silencing complex. Mol. Cell Biol. 27, 6469-6483.

Gough,D.R. and Cotter,T.G. (2011). Hydrogen peroxide: a Jekyll and Hyde signalling molecule. Cell Death. Dis. 2, e213.

Greenberg,C.S., Birckbichler,P.J., and Rice,R.H. (1991). Transglutaminases: multifunctional cross-linking enzymes that stabilize tissues. FASEB J. 5, 3071-3077.

177

Griffith,B., Pendyala,S., Hecker,L., Lee,P.J., Natarajan,V., and Thannickal,V.J. (2009). NOX enzymes and pulmonary disease. Antioxid. Redox. Signal. 11, 2505-2516.

Grotendorst,G.R., Rahmanie,H., and Duncan,M.R. (2004). Combinatorial signaling pathways determine fibroblast proliferation and myofibroblast differentiation. FASEB J. 18, 469-479.

Guay,D., Gaudreault,I., Massip,L., and Lebel,M. (2006). Formation of a nuclear complex containing the p53 tumor suppressor, YB-1, and the Werner syndrome gene product in cells treated with UV light. Int. J. Biochem. Cell Biol. 38, 1300-1313.

Guilluy,C., Rolli-Derkinderen,M., Tharaux,P.L., Melino,G., Pacaud,P., and Loirand,G. (2007). Transglutaminase-dependent RhoA activation and depletion by serotonin in vascular smooth muscle cells. J. Biol. Chem. 282, 2918-2928.

Gundemir,S., Colak,G., Tucholski,J., and Johnson,G.V. (2012). Transglutaminase 2: a molecular Swiss army knife. Biochim. Biophys. Acta 1823, 406-419.

Guryanov,S.G., Selivanova,O.M., Nikulin,A.D., Enin,G.A., Melnik,B.S., Kretov,D.A., Serdyuk,I.N., and Ovchinnikov,L.P. (2012). Formation of amyloid-like fibrils by Y-box binding protein 1 (YB-1) is mediated by its cold shock domain and modulated by disordered terminal domains. PLoS. One. 7, e36969.

Han,T.W., Kato,M., Xie,S., Wu,L.C., Mirzaei,H., Pei,J., Chen,M., Xie,Y., Allen,J., Xiao,G., and McKnight,S.L. (2012). Cell-free formation of RNA granules: bound RNAs identify features and components of cellular assemblies. Cell 149, 768-779.

Hansford,R.G. and Zorov,D. (1998). Role of mitochondrial calcium transport in the control of substrate oxidation. Mol. Cell Biochem. 184, 359-369.

Hanssen,L., Frye,B.C., Ostendorf,T., Alidousty,C., Djudjaj,S., Boor,P., Rauen,T., Floege,J., Mertens,P.R., and Raffetseder,U. (2011). Y-box binding protein-1 mediates profibrotic effects of calcineurin inhibitors in the kidney. J Immunol. 187, 298-308.

Hao,J., Ju,H., Zhao,S., Junaid,A., Scammell-La,F.T., and Dixon,I.M. (1999). Elevation of expression of Smads 2, 3, and 4, decorin and TGF-beta in the chronic phase of myocardial infarct scar healing. J Mol. Cell Cardiol. 31, 667-678.

Hardie,D.G. (2011). AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev. 25, 1895-1908.

Hasegawa,S.L., Doetsch,P.W., Hamilton,K.K., Martin,A.M., Okenquist,S.A., Lenz,J., and Boss,J.M. (1991). DNA binding properties of YB-1 and dbpA: binding to double- stranded, single-stranded, and abasic site containing DNAs. Nucleic Acids Res. 19, 4915- 4920.

178

Hecker,L., Vittal,R., Jones,T., Jagirdar,R., Luckhardt,T.R., Horowitz,J.C., Pennathur,S., Martinez,F.J., and Thannickal,V.J. (2009). NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nat. Med 15, 1077-1081.

Heneberg,P. and Draber,P. (2005). Regulation of cys-based protein tyrosine phosphatases via reactive oxygen and nitrogen species in mast cells and basophils. Curr. Med Chem. 12, 1859-1871.

Higashi,K., Inagaki,Y., Fujimori,K., Nakao,A., Kaneko,H., and Nakatsuka,I. (2003). Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3. J. Biol. Chem. 278, 43470-43479.

Hinz,B. (2007). Formation and function of the myofibroblast during tissue repair. Journal of Investigative Dermatology 127, 526-537.

Hinz,B., Phan,S.H., Thannickal,V.J., Galli,A., Bochaton-Piallat,M.L., and Gabbiani,G. (2007). The myofibroblast: one function, multiple origins. Am. J Pathol. 170, 1807-1816.

Hinz,B., Phan,S.H., Thannickal,V.J., Prunotto,M., Desmouliere,A., Varga,J., De,W.O., Mareel,M., and Gabbiani,G. (2012). Recent developments in myofibroblast biology: paradigms for connective tissue remodeling. Am. J Pathol. 180, 1340-1355.

Hofmann,S., Cherkasova,V., Bankhead,P., Bukau,B., and Stoecklin,G. (2012). Translation suppression promotes stress granule formation and cell survival in response to cold shock. Mol. Biol. Cell 23, 3786-3800.

Horie,T., Ono,K., Nagao,K., Nishi,H., Kinoshita,M., Kawamura,T., Wada,H., Shimatsu,A., Kita,T., and Hasegawa,K. (2008). Oxidative stress induces GLUT4 translocation by activation of PI3-K/Akt and dual AMPK kinase in cardiac myocytes. J Cell Physiol 215, 733-742.

Horman,S., Browne,G., Krause,U., Patel,J., Vertommen,D., Bertrand,L., Lavoinne,A., Hue,L., Proud,C., and Rider,M. (2002). Activation of AMP-activated protein kinase leads to the phosphorylation of elongation factor 2 and an inhibition of protein synthesis. Curr. Biol. 12, 1419-1423.

Howell,D.C., Laurent,G.J., and Chambers,R.C. (2002). Role of thrombin and its major cellular receptor, protease-activated receptor-1, in pulmonary fibrosis. Biochem. Soc. Trans. 30, 211-216.

Hu,B., Wu,Z., and Phan,S.H. (2003). Smad3 mediates transforming growth factor-beta- induced alpha-smooth muscle actin expression. Am. J Respir. Cell Mol. Biol. 29, 397- 404.

179

Hu,T., Ramachandrarao,S.P., Siva,S., Valancius,C., Zhu,Y., Mahadev,K., Toh,I., Goldstein,B.J., Woolkalis,M., and Sharma,K. (2005). Reactive oxygen species production via NADPH oxidase mediates TGF-beta-induced cytoskeletal alterations in endothelial cells. Am. J Physiol Renal Physiol 289, F816-F825.

Hurley,R.L., Anderson,K.A., Franzone,J.M., Kemp,B.E., Means,A.R., and Witters,L.A. (2005). The Ca2+/calmodulin-dependent protein kinase kinases are AMP-activated protein kinase kinases. J Biol. Chem. 280, 29060-29066.

Ide,J., Aoki,T., Ishivata,S., Glusa,E., and Strukova,S.M. (2007). Proteinase-activated receptor agonists stimulate the increase in intracellular Ca2+ in cardiomyocytes and proliferation of cardiac fibroblasts from chick embryos. Bull. Exp. Biol Med. 144, 760- 763.

Ientile,R., Caccamo,D., and Griffin,M. (2007). Tissue transglutaminase and the stress response. Amino. Acids 33, 385-394.

Iismaa,S.E., Mearns,B.M., Lorand,L., and Graham,R.M. (2009). Transglutaminases and disease: lessons from genetically engineered mouse models and inherited disorders. Physiol Rev. 89, 991-1023.

Irrcher,I., Ljubicic,V., and Hood,D.A. (2009). Interactions between ROS and AMP kinase activity in the regulation of PGC-1alpha transcription in skeletal muscle cells. Am. J Physiol Cell Physiol 296, C116-C123.

Iwai,N., Shimoike,H., and Kinoshita,M. (1995). Genes up-regulated in hypertrophied ventricle. Biochem. Biophys. Res. Commun. 209, 527-534.

Jain,M., Rivera,S., Monclus,E.A., Synenki,L., Zirk,A., Eisenbart,J., Feghali-Bostwick,C., Mutlu,G.M., Budinger,G.R., and Chandel,N.S. (2013). Mitochondrial reactive oxygen species regulate transforming growth factor-beta signaling. J Biol. Chem. 288, 770-777.

Jandu,S.K., Webb,A.K., Pak,A., Sevinc,B., Nyhan,D., Belkin,A.M., Flavahan,N.A., Berkowitz,D.E., and Santhanam,L. (2013). Nitric oxide regulates tissue transglutaminase localization and function in the vasculature. Amino. Acids 44, 261-269.

Janiak,A., Zemskov,E.A., and Belkin,A.M. (2006). Cell surface transglutaminase promotes RhoA activation via integrin clustering and suppression of the Src- p190RhoGAP signaling pathway. Mol. Biol Cell 17, 1606-1619.

Jeon,J.H., Lee,H.J., Jang,G.Y., Kim,C.W., Shim,D.M., Cho,S.Y., Yeo,E.J., Park,S.C., and Kim,I.G. (2004). Different inhibition characteristics of intracellular transglutaminase activity by cystamine and cysteamine. Exp. Mol. Med. 36, 576-581.

180

Jeong,E.M., Kim,C.W., Cho,S.Y., Jang,G.Y., Shin,D.M., Jeon,J.H., and Kim,I.G. (2009). Degradation of transglutaminase 2 by calcium-mediated ubiquitination responding to high oxidative stress. FEBS Lett. 583, 648-654.

Johnson,E.M., Daniel,D.C., and Gordon,J. (2013). The pur protein family: genetic and structural features in development and disease. J Cell Physiol 228, 930-937.

Johnson,E.M., Kinoshita,Y., Weinreb,D.B., Wortman,M.J., Simon,R., Khalili,K., Winckler,B., and Gordon,J. (2006). Role of Pur alpha in targeting mRNA to sites of translation in hippocampal neuronal dendrites. J Neurosci. Res. 83, 929-943.

Johnson,K.A., Polewski,M., and Terkeltaub,R.A. (2008). Transglutaminase 2 is central to induction of the arterial calcification program by smooth muscle cells. Circ. Res. 102, 529-537.

Jurchott,K., Bergmann,S., Stein,U., Walther,W., Janz,M., Manni,I., Piaggio,G., Fietze,E., Dietel,M., and Royer,H.D. (2003). YB-1 as a cell cycle-regulated transcription factor facilitating cyclin A and cyclin B1 gene expression. J. Biol. Chem. 278, 27988-27996.

Kamalov,G., Varma,B.R., Lu,L., Sun,Y., Weber,K.T., and Guntaka,R.V. (2005). Expression of the multifunctional Y-box protein, YB-1, in myofibroblasts of the infarcted rat heart. Biochem. Biophys. Res. Commun. 334, 239-244.

Kanai,Y., Dohmae,N., and Hirokawa,N. (2004). Kinesin transports RNA: isolation and characterization of an RNA-transporting granule. Neuron 43, 513-525.

Karmazyn,M. (1999). The role of the myocardial sodium-hydrogen exchanger in mediating ischemic and reperfusion injury. From amiloride to cariporide. Ann. N Y. Acad. Sci. 874, 326-334.

Kato,M., Han,T.W., Xie,S., Shi,K., Du,X., Wu,L.C., Mirzaei,H., Goldsmith,E.J., Longgood,J., Pei,J., Grishin,N.V., Frantz,D.E., Schneider,J.W., Chen,S., Li,L., Sawaya,M.R., Eisenberg,D., Tycko,R., and McKnight,S.L. (2012). Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels. Cell 149, 753-767.

Kawaguchi,A., Matsumoto,K., and Nagata,K. (2012). YB-1 functions as a porter to lead influenza virus ribonucleoprotein complexes to microtubules. J. Virol. 86, 11086-11095.

Keene,J.D. (2007). RNA regulons: coordination of post-transcriptional events. Nat. Rev. Genet. 8, 533-543.

Keene,J.D. and Lager,P.J. (2005). Post-transcriptional operons and regulons coordinating gene expression. Chromosome. Res. 13, 327-337.

181

Keene,J.D. and Tenenbaum,S.A. (2002). Eukaryotic mRNPs may represent posttranscriptional operons. Mol. Cell 9, 1161-1167.

Kelm,R.J., Jr., Cogan,J.G., Elder,P.K., Strauch,A.R., and Getz,M.J. (1999a). Molecular interactions between single-stranded DNA-binding proteins associated with an essential MCAT element in the mouse smooth muscle alpha-actin promoter. J. Biol Chem. 274, 14238-14245.

Kelm,R.J., Jr., Elder,P.K., and Getz,M.J. (1999b). The single-stranded DNA-binding proteins, Puralpha, Purbeta, and MSY1 specifically interact with an exon 3-derived mouse vascular smooth muscle alpha-actin messenger RNA sequence. J. Biol Chem. 274, 38268-38275.

Kelm,R.J., Jr., Sun,S., Strauch,A.R., and Getz,M.J. (1996). Repression of transcriptional enhancer factor-1 and activator protein-1-dependent enhancer activity by vascular actin single-stranded DNA binding factor 2. J. Biol Chem. 271, 24278-24285.

Kelm,R.J., Jr., Wang,S.X., Polikandriotis,J.A., and Strauch,A.R. (2003). Structure/function analysis of mouse Purbeta, a single-stranded DNA-binding repressor of vascular smooth muscle alpha-actin gene transcription. J. Biol Chem. 278, 38749- 38757.

Keresztessy,Z., Csosz,E., Harsfalvi,J., Csomos,K., Gray,J., Lightowlers,R.N., Lakey,J.H., Balajthy,Z., and Fesus,L. (2006). Phage display selection of efficient glutamine-donor substrate peptides for transglutaminase 2. Protein Sci. 15, 2466-2480.

Khan,R. and Sheppard,R. (2006). Fibrosis in heart disease: understanding the role of transforming growth factor-beta in cardiomyopathy, valvular disease and arrhythmia. Immunology 118, 10-24.

Kiraly,R., Csosz,E., Kurtan,T., Antus,S., Szigeti,K., Simon-Vecsei,Z., Korponay- Szabo,I.R., Keresztessy,Z., and Fesus,L. (2009). Functional significance of five noncanonical Ca-binding sites of human transglutaminase 2 characterized by site-directed mutagenesis. FEBS J.

Kiraly,R., Demeny,M., and Fesus,L. (2011). Protein transamidation by transglutaminase 2 in cells: a disputed Ca2+-dependent action of a multifunctional protein. FEBS J. 278, 4717-4739.

Knapp,A.M., Ramsey,J.E., Wang,S.X., Godburn,K.E., Strauch,A.R., and Kelm,R.J., Jr. (2006). Nucleoprotein interactions governing cell type-dependent repression of the mouse smooth muscle alpha-actin promoter by single-stranded DNA-binding proteins Pur alpha and Pur beta. J Biol Chem. 281, 7907-7918.

182

Kohno,K., Izumi,H., Uchiumi,T., Ashizuka,M., and Kuwano,M. (2003). The pleiotropic functions of the Y-box-binding protein, YB-1. Bioessays 25, 691-698.

Kojima,S., Nara,K., and Rifkin,D.B. (1993). Requirement for transglutaminase in the activation of latent transforming growth factor-beta in bovine endothelial cells. J. Cell Biol. 121, 439-448.

Kulisz,A., Chen,N., Chandel,N.S., Shao,Z., and Schumacker,P.T. (2002). Mitochondrial ROS initiate phosphorylation of p38 MAP kinase during hypoxia in cardiomyocytes. Am. J Physiol Lung Cell Mol. Physiol 282, L1324-L1329.

Kuo,T.F., Tatsukawa,H., and Kojima,S. (2011). New insights into the functions and localization of nuclear transglutaminase 2. FEBS J. 278, 4756-4767.

Kuroda,J., Ago,T., Matsushima,S., Zhai,P., Schneider,M.D., and Sadoshima,J. (2010). NADPH oxidase 4 (Nox4) is a major source of oxidative stress in the failing heart. Proc. Natl. Acad. Sci. U. S. A 107, 15565-15570.

Ladomery,M. and Sommerville,J. (1994). Binding of Y-box proteins to RNA: involvement of different protein domains. Nucleic Acids Res. 22, 5582-5589.

Landsman,D. (1992). RNP-1, an RNA-binding motif is conserved in the DNA-binding cold shock domain. Nucleic Acids Res. 20, 2861-2864.

Larsen,T.H., Hesketh,J.E., Rotevatn,S., Greve,G., and Saetersdal,T. (1994). Ribosome distribution in normal and infarcted rat hearts. Histochem. J. 26, 79-89.

Lasham,A., Lindridge,E., Rudert,F., Onrust,R., and Watson,J. (2000). Regulation of the human fas promoter by YB-1, Puralpha and AP-1 transcription factors. Gene 252, 1-13.

Lee,C., Dhillon,J., Wang,M.Y., Gao,Y., Hu,K., Park,E., Astanehe,A., Hung,M.C., Eirew,P., Eaves,C.J., and Dunn,S.E. (2008). Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res. 68, 8661-8666.

Lee,S.K., Chi,J.G., Park,S.C., and Chung,S.I. (2000). Transient expression of transglutaminase C during prenatal development of human muscles. J Histochem. Cytochem. 48, 1565-1574.

Lepin,E.J., Zhang,Q., Zhang,X., Jindra,P.T., Hong,L.S., Ayele,P., Peralta,M.V., Gjertson,D.W., Kobashigawa,J.A., Wallace,W.D., Fishbein,M.C., and Reed,E.F. (2006). Phosphorylated S6 ribosomal protein: a novel biomarker of antibody-mediated rejection in heart allografts. Am. J. Transplant. 6, 1560-1571.

183

Lesort,M., Attanavanich,K., Zhang,J., and Johnson,G.V. (1998). Distinct nuclear localization and activity of tissue transglutaminase. J Biol. Chem. 273, 11991-11994.

Levonen,A.L., Patel,R.P., Brookes,P., Go,Y.M., Jo,H., Parthasarathy,S., Anderson,P.G., and Darley-Usmar,V.M. (2001). Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases. Antioxid. Redox. Signal. 3, 215-229.

Li,W., Thakor,N., Xu,E.Y., Huang,Y., Chen,C., Yu,R., Holcik,M., and Kong,A.N. (2010). An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res. 38, 778-788.

Li,X., Wei,X.L., Meng,L.L., Chi,M.G., Yan,J.Q., Ma,X.Y., Jia,Y.S., Liang,L., Yan,H.T., and Zheng,J.Q. (2009). Involvement of Tissue Transglutaminase in Endothelin 1-Induced Hypertrophy in Cultured Neonatal Rat Cardiomyocytes. Hypertension.

Lim,J.Y., Oh,M.A., Kim,W.H., Sohn,H.Y., and Park,S.I. (2012). AMP-activated protein kinase inhibits TGF-beta-induced fibrogenic responses of hepatic stellate cells by targeting transcriptional coactivator p300. J Cell Physiol 227, 1081-1089.

Lin,C.Y., Tsai,P.H., Kandaswami,C.C., Chang,G.D., Cheng,C.H., Huang,C.J., Lee,P.P., Hwang,J.J., and Lee,M.T. (2011). Role of tissue transglutaminase 2 in the acquisition of a mesenchymal-like phenotype in highly invasive A431 tumor cells. Mol. Cancer 10, 87.

Liu,N., Bezprozvannaya,S., Williams,A.H., Qi,X., Richardson,J.A., Bassel-Duby,R., and Olson,E.N. (2008). microRNA-133a regulates cardiomyocyte proliferation and suppresses smooth muscle gene expression in the heart. Genes Dev. 22, 3242-3254.

Liu,R.M., Choi,J., Wu,J.H., Gaston Pravia,K.A., Lewis,K.M., Brand,J.D., Mochel,N.S., Krzywanski,D.M., Lambeth,J.D., Hagood,J.S., Forman,H.J., Thannickal,V.J., and Postlethwait,E.M. (2010). Oxidative modification of nuclear mitogen-activated protein kinase phosphatase 1 is involved in transforming growth factor beta1-induced expression of plasminogen activator inhibitor 1 in fibroblasts. J Biol Chem. 285, 16239-16247.

Liu,S., Xu,S.W., Kennedy,L., Pala,D., Chen,Y., Eastwood,M., Carter,D.E., Black,C.M., Abraham,D.J., and Leask,A. (2007). FAK is required for TGFbeta-induced JNK phosphorylation in fibroblasts: implications for acquisition of a matrix-remodeling phenotype. Mol. Biol. Cell 18, 2169-2178.

Liu,X., Kelm,R.J., Jr., and Strauch,A.R. (2009). Transforming growth factor beta1- mediated activation of the smooth muscle alpha-actin gene in human pulmonary myofibroblasts is inhibited by tumor necrosis factor-alpha via mitogen-activated protein kinase kinase 1-dependent induction of the Egr-1 transcriptional repressor. Mol. Biol Cell 20, 2174-2185.

184

Lokmic,Z., Musyoka,J., Hewitson,T.D., and Darby,I.A. (2012). Hypoxia and hypoxia signaling in tissue repair and fibrosis. Int. Rev. Cell Mol. Biol. 296, 139-185.

Lu,Z.H., Books,J.T., and Ley,T.J. (2005). YB-1 is important for late-stage embryonic development, optimal cellular stress responses, and the prevention of premature senescence. Mol. Cell Biol. 25, 4625-4637.

Lutz,M., Wempe,F., Bahr,I., Zopf,D., and von,M.H. (2006). Proteasomal degradation of the multifunctional regulator YB-1 is mediated by an F-Box protein induced during programmed cell death. FEBS Lett. 580, 3921-3930.

Mann,A.P., Verma,A., Sethi,G., Manavathi,B., Wang,H., Fok,J.Y., Kunnumakkara,A.B., Kumar,R., Aggarwal,B.B., and Mehta,K. (2006). Overexpression of tissue transglutaminase leads to constitutive activation of nuclear factor-kappaB in cancer cells: delineation of a novel pathway. Cancer Res. 66, 8788-8795.

Maroto,R., Raso,A., Wood,T.G., Kurosky,A., Martinac,B., and Hamill,O.P. (2005). TRPC1 forms the stretch-activated cation channel in vertebrate cells. Nat. Cell Biol. 7, 179-185.

Masszi,A., Speight,P., Charbonney,E., Lodyga,M., Nakano,H., Szaszi,K., and Kapus,A. (2010). Fate-determining mechanisms in epithelial-myofibroblast transition: major inhibitory role for Smad3. J. Cell Biol. 188, 383-399.

Matsumoto,K., Tanaka,K.J., and Tsujimoto,M. (2005). An acidic protein, YBAP1, mediates the release of YB-1 from mRNA and relieves the translational repression activity of YB-1. Mol. Cell Biol. 25, 1779-1792.

Matsumoto,S., Uchiumi,T., Tanamachi,H., Saito,T., Yagi,M., Takazaki,S., Kanki,T., and Kang,D. (2012). Ribonucleoprotein Y-box-binding protein-1 regulates mitochondrial oxidative phosphorylation (OXPHOS) protein expression after serum stimulation through binding to OXPHOS mRNA. Biochem. J. 443, 573-584.

McCormack,J.G. and Denton,R.M. (1993). Mitochondrial Ca2+ transport and the role of intramitochondrial Ca2+ in the regulation of energy metabolism. Dev. Neurosci. 15, 165- 173.

Mehta,K., Kumar,A., and Kim,H.I. (2010). Transglutaminase 2: a multi-tasking protein in the complex circuitry of inflammation and cancer. Biochem. Pharmacol.

Meoli,D.F. and White,R.J. (2009). Thrombin induces fibronectin-specific migration of pulmonary microvascular endothelial cells: requirement of calcium/calmodulin- dependent protein kinase II. Am. J. Physiol Lung Cell Mol. Physiol 297, L706-L714.

185

Mertens,P.R., Harendza,S., Pollock,A.S., and Lovett,D.H. (1997). Glomerular mesangial cell-specific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J. Biol. Chem. 272, 22905-22912.

Mertens,P.R., Steinmann,K., Alfonso-Jaume,M.A., En-Nia,A., Sun,Y., and Lovett,D.H. (2002). Combinatorial interactions of p53, activating protein-2, and YB-1 with a single enhancer element regulate gelatinase A expression in neoplastic cells. J. Biol. Chem. 277, 24875-24882.

Michaeloudes,C., Sukkar,M.B., Khorasani,N.M., Bhavsar,P.K., and Chung,K.F. (2010). TGF-{beta} regulates Nox4, MnSOD and catalase expression and IL-6 release in airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol.

Mikhailov,A.T. and Torrado,M. (2008). The enigmatic role of the ankyrin repeat domain 1 gene in heart development and disease. Int. J. Dev. Biol. 52, 811-821.

Minich,W.B., Korneyeva,N.L., Berezin,Y.V., and Ovchinnikov,L.P. (1989). A special repressor/activator system controls distribution of mRNA between translationally active and inactive mRNPs in rabbit reticulocytes. FEBS Lett. 258, 227-229.

Minich,W.B. and Ovchinnikov,L.P. (1992). Role of cytoplasmic mRNP proteins in translation. Biochimie 74, 477-483.

Mishra,R., Cool,B.L., Laderoute,K.R., Foretz,M., Viollet,B., and Simonson,M.S. (2008). AMP-activated protein kinase inhibits transforming growth factor-beta-induced Smad3- dependent transcription and myofibroblast transdifferentiation. J Biol. Chem. 283, 10461- 10469.

Mishra,S. and Murphy,L.J. (2006). The p53 oncoprotein is a substrate for tissue transglutaminase kinase activity. Biochem. Biophys. Res. Commun. 339, 726-730.

Moore,M.J. (2005). From birth to death: the complex lives of eukaryotic mRNAs. Science 309, 1514-1518.

Muller-Werdan,U. (2007). Inflammation and ageing. Z. Gerontol. Geriatr. 40, 362-365.

Mungai,P.T., Waypa,G.B., Jairaman,A., Prakriya,M., Dokic,D., Ball,M.K., and Schumacker,P.T. (2011). Hypoxia triggers AMPK activation through reactive oxygen species-mediated activation of calcium release-activated calcium channels. Mol. Cell Biol. 31, 3531-3545.

Murthy,S.N., Lukas,T.J., Jardetzky,T.S., and Lorand,L. (2009). Selectivity in the post- translational, transglutaminase-dependent acylation of lysine residues. Biochemistry 48, 2654-2660.

186

Muscari,C., Giaccari,A., Giordano,E., Clo,C., Guarnieri,C., and Caldarera,C.M. (1996). Role of reactive oxygen species in cardiovascular aging. Mol. Cell Biochem. 160-161, 159-166.

Nabika,T., Chaldakov,G.N., Nara,Y., Endo,J., and Yamori,Y. (1988). Phorbol 12- myristate 13-acetate prevents isoproterenol-induced morphological change in cultured vascular smooth muscle cells. Exp. Cell Res. 178, 358-368.

Naderi,J., Hung,M., and Pandey,S. (2003). Oxidative stress-induced apoptosis in dividing fibroblasts involves activation of p38 MAP kinase and over-expression of Bax: resistance of quiescent cells to oxidative stress. Apoptosis. 8, 91-100.

Naito,Z., Kudo,M., Xu,G., Nishigaki,R., Yokoyama,M., Yamada,N., and Asano,G. (2000). Immunohistochemical localization of mitogen-activated protein kinase (MAPK) family and morphological changes in rat heart after ischemia-reperfusion injury. Med Electron Microsc. 33, 74-81.

Naughton,R., Quiney,C., Turner,S.D., and Cotter,T.G. (2009). Bcr-Abl-mediated redox regulation of the PI3K/AKT pathway. Leukemia 23, 1432-1440.

Naugle,J.E., Olson,E.R., Zhang,X., Mase,S.E., Pilati,C.F., Maron,M.B., Folkesson,H.G., Horne,W.I., Doane,K.J., and Meszaros,J.G. (2006). Type VI collagen induces cardiac myofibroblast differentiation: implications for postinfarction remodeling. Am J Physiol Heart Circ Physiol 290, H323-H330.

Nekrasov,M.P., Ivshina,M.P., Chernov,K.G., Kovrigina,E.A., Evdokimova,V.M., Thomas,A.A., Hershey,J.W., and Ovchinnikov,L.P. (2003). The mRNA-binding protein YB-1 (p50) prevents association of the eukaryotic initiation factor eIF4G with mRNA and inhibits protein synthesis at the initiation stage. J. Biol. Chem. 278, 13936-13943.

Nicoletti,A. and Michel,J.B. (1999). Cardiac fibrosis and inflammation: interaction with hemodynamic and hormonal factors. Cardiovasc. Res. 41, 532-543.

Nishida,M., Onohara,N., Sato,Y., Suda,R., Ogushi,M., Tanabe,S., Inoue,R., Mori,Y., and Kurose,H. (2007). Galpha12/13-mediated up-regulation of TRPC6 negatively regulates endothelin-1-induced cardiac myofibroblast formation and collagen synthesis through nuclear factor of activated T cells activation. J. Biol. Chem. 282, 23117-23128.

Norman,J.T., Lindahl,G.E., Shakib,K., En-Nia,A., Yilmaz,E., and Mertens,P.R. (2001). The Y-box binding protein YB-1 suppresses collagen alpha 1(I) gene transcription via an evolutionarily conserved regulatory element in the proximal promoter. J. Biol. Chem. 276, 29880-29890.

187

O'Donnell,B.V., Tew,D.G., Jones,O.T., and England,P.J. (1993). Studies on the inhibitory mechanism of iodonium compounds with special reference to neutrophil NADPH oxidase. Biochem. J. 290 ( Pt 1), 41-49.

Oh,K., Park,H.B., Byoun,O.J., Shin,D.M., Jeong,E.M., Kim,Y.W., Kim,Y.S., Melino,G., Kim,I.G., and Lee,D.S. (2011). Epithelial transglutaminase 2 is needed for T cell interleukin-17 production and subsequent pulmonary inflammation and fibrosis in bleomycin-treated mice. J Exp. Med 208, 1707-1719.

Ohashi,S., Koike,K., Omori,A., Ichinose,S., Ohara,S., Kobayashi,S., Sato,T.A., and Anzai,K. (2002). Identification of mRNA/protein (mRNP) complexes containing Puralpha, mStaufen, fragile X protein, and myosin Va and their association with rough endoplasmic reticulum equipped with a kinesin motor. J. Biol. Chem. 277, 37804-37810.

Ohga,T., Koike,K., Ono,M., Makino,Y., Itagaki,Y., Tanimoto,M., Kuwano,M., and Kohno,K. (1996). Role of the human Y box-binding protein YB-1 in cellular sensitivity to the DNA-damaging agents cisplatin, mitomycin C, and ultraviolet light. Cancer Res. 56, 4224-4228.

Okamoto,T., Izumi,H., Imamura,T., Takano,H., Ise,T., Uchiumi,T., Kuwano,M., and Kohno,K. (2000). Direct interaction of p53 with the Y-box binding protein, YB-1: a mechanism for regulation of human gene expression. Oncogene 19, 6194-6202.

Olsen,K.C., Sapinoro,R.E., Kottmann,R.M., Kulkarni,A.A., Iismaa,S.E., Johnson,G.V., Thatcher,T.H., Phipps,R.P., and Sime,P.J. (2011). Transglutaminase 2 and its role in pulmonary fibrosis. Am. J Respir. Crit Care Med 184, 699-707.

Onishi,H., Kino,Y., Morita,T., Futai,E., Sasagawa,N., and Ishiura,S. (2008). MBNL1 associates with YB-1 in cytoplasmic stress granules. J Neurosci. Res. 86, 1994-2002.

Orbaek,A.H. (1999). Heart allograft vascular disease: an obliterative vascular disease in transplanted hearts. Atherosclerosis 142, 243-263.

Pandya,K., Kim,H.S., and Smithies,O. (2006). Fibrosis, not cell size, delineates beta- myosin heavy chain reexpression during cardiac hypertrophy and normal aging in vivo. Proc. Natl. Acad. Sci U. S. A 103, 16864-16869.

Park,D., Choi,S.S., and Ha,K.S. (2010). Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino. Acids.

Park,S.C., Yeo,E.J., Han,J.A., Hwang,Y.C., Choi,J.Y., Park,J.S., Park,Y.H., Kim,K.O., Kim,I.G., Seong,S.C., and Kwak,S.J. (1999). Aging process is accompanied by increase of transglutaminase C. J Gerontol A Biol Sci Med Sci 54, B78-B83.

188

Patel,A., Sharif-Naeini,R., Folgering,J.R., Bichet,D., Duprat,F., and Honore,E. (2010). Canonical TRP channels and mechanotransduction: from physiology to disease states. Pflugers Arch. 460, 571-581.

Pickering,J.G. and Boughner,D.R. (1990). Fibrosis in the transplanted heart and its relation to donor ischemic time. Assessment with polarized light microscopy and digital image analysis. Circulation 81, 949-958.

Pluim,B.M., Zwinderman,A.H., van der Laarse,A., and van der Wall,E.E. (2000). The athlete's heart. A meta-analysis of cardiac structure and function. Circulation 101, 336- 344.

Poels,J., Spasic,M.R., Callaerts,P., and Norga,K.K. (2009). Expanding roles for AMP- activated protein kinase in neuronal survival and autophagy. Bioessays 31, 944-952.

Ramachandran,A., Moellering,D., Go,Y.M., Shiva,S., Levonen,A.L., Jo,H., Patel,R.P., Parthasarathy,S., and Darley-Usmar,V.M. (2002). Activation of c-Jun N-terminal kinase and apoptosis in endothelial cells mediated by endogenous generation of hydrogen peroxide. Biol. Chem. 383, 693-701.

Rame,J.E. and Dries,D.L. (2007). Heart failure and cardiac hypertrophy. Curr. Treat. Options. Cardiovasc. Med 9, 289-301.

Ramirez-Valle,F., Badura,M.L., Braunstein,S., Narasimhan,M., and Schneider,R.J. (2010). Mitotic raptor promotes mTORC1 activity, G(2)/M cell cycle progression, and internal ribosome entry site-mediated mRNA translation. Mol. Cell Biol. 30, 3151-3164.

Rauen,T., Raffetseder,U., Frye,B.C., Djudjaj,S., Muhlenberg,P.J., Eitner,F., Lendahl,U., Bernhagen,J., Dooley,S., and Mertens,P.R. (2009). YB-1 acts as a ligand for Notch-3 receptors and modulates receptor activation. J. Biol. Chem. 284, 26928-26940.

Rosenkranz,S. (2004). TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovasc. Res. 63, 423-432.

Rosmorduc,O. and Housset,C. (2010). Hypoxia: a link between fibrogenesis, angiogenesis, and carcinogenesis in liver disease. Semin. Liver Dis. 30, 258-270.

Rothstein,E.C., Byron,K.L., Reed,R.E., Fliegel,L., and Lucchesi,P.A. (2002). H(2)O(2)- induced Ca(2+) overload in NRVM involves ERK1/2 MAP kinases: role for an NHE-1- dependent pathway. Am. J Physiol Heart Circ. Physiol 283, H598-H605.

Roy,S., Khanna,S., Rink,T., Radtke,J., Williams,W.T., Biswas,S., Schnitt,R., Strauch,A.R., and Sen,C.K. (2007). P21waf1/cip1/sdi1 as a central regulator of inducible smooth muscle actin expression and differentiation of cardiac fibroblasts to myofibroblasts. Mol. Biol Cell 18, 4837-4846.

189

Russell,B., Curtis,M.W., Koshman,Y.E., and Samarel,A.M. (2010). Mechanical stress- induced sarcomere assembly for cardiac muscle growth in length and width. J. Mol. Cell Cardiol. 48, 817-823.

Ruzanov,P.V., Evdokimova,V.M., Korneeva,N.L., Hershey,J.W., and Ovchinnikov,L.P. (1999). Interaction of the universal mRNA-binding protein, p50, with actin: a possible link between mRNA and microfilaments. J. Cell Sci. 112 ( Pt 20), 3487-3496.

Sabri,A., Short,J., Guo,J., and Steinberg,S.F. (2002). Protease-activated receptor-1- mediated DNA synthesis in cardiac fibroblast is via epidermal growth factor receptor transactivation: distinct PAR-1 signaling pathways in cardiac fibroblasts and cardiomyocytes. Circ. Res. 91, 532-539.

Santhanam,L., Tuday,E.C., Webb,A.K., Dowzicky,P., Kim,J.H., Oh,Y.J., Sikka,G., Kuo,M., Halushka,M.K., Macgregor,A.M., Dunn,J., Gutbrod,S., Yin,D., Shoukas,A., Nyhan,D., Flavahan,N.A., Belkin,A.M., and Berkowitz,D.E. (2010). Decreased S- nitrosylation of tissue transglutaminase contributes to age-related increases in vascular stiffness. Circ Res 107, 117-125.

Sauer,H., Engel,S., Milosevic,N., Sharifpanah,F., and Wartenberg,M. (2012). Activation of AMP-kinase by AICAR induces apoptosis of DU-145 prostate cancer cells through generation of reactive oxygen species and activation of c-Jun N-terminal kinase. Int. J. Oncol. 40, 501-508.

Schmauss,D. and Weis,M. (2008). Cardiac allograft vasculopathy: recent developments. Circulation 117, 2131-2141.

Schmid,C., Heemann,U., and Tilney,N.L. (1996). Retransplantation reverses mononuclear infiltration but not myointimal proliferation in a rat model of chronic cardiac allograft rejection. Transplantation 61, 1695-1699.

Selivanova,O.M., Guryanov,S.G., Enin,G.A., Skabkin,M.A., Ovchinnikov,L.P., and Serdyuk,I.N. (2010). YB-1 is capable of forming extended nanofibrils. Biochemistry (Mosc. ) 75, 115-120.

Shi,C., Feinberg,M.W., Zhang,D., Patel,A., Sim,C.U., Dong,Z.M., Chapman,S.M., Gutierrez-Ramos,J.C., Wagner,D.D., Sibinga,N.E., and Haber,E. (1999). Donor MHC and adhesion molecules in transplant arteriosclerosis. J. Clin. Invest 103, 469-474.

Shi,C., Russell,M.E., Bianchi,C., Newell,J.B., and Haber,E. (1994). Murine model of accelerated transplant arteriosclerosis. Circ. Res. 75, 199-207.

Shi-wen,X., Parapuram,S.K., Pala,D., Chen,Y., Carter,D.E., Eastwood,M., Denton,C.P., Abraham,D.J., and Leask,A. (2009). Requirement of transforming growth factor beta- activated kinase 1 for transforming growth factor beta-induced alpha-smooth muscle

190 actin expression and extracellular matrix contraction in fibroblasts. Arthritis Rheum. 60, 234-241.

Shiojima,I. and Walsh,K. (2006). Regulation of cardiac growth and coronary angiogenesis by the Akt/PKB signaling pathway. Genes Dev. 20, 3347-3365.

Shiota,M., Izumi,H., Onitsuka,T., Miyamoto,N., Kashiwagi,E., Kidani,A., Yokomizo,A., Naito,S., and Kohno,K. (2008). Twist promotes tumor cell growth through YB-1 expression. Cancer Res. 68, 98-105.

Siegel,M., Strnad,P., Watts,R.E., Choi,K., Jabri,B., Omary,M.B., and Khosla,C. (2008). Extracellular transglutaminase 2 is catalytically inactive, but is transiently activated upon tissue injury. PLoS. One. 3, e1861.

Silvera,D., Formenti,S.C., and Schneider,R.J. (2010). Translational control in cancer. Nat. Rev. Cancer 10, 254-266.

Singh,U.S., Erickson,J.W., and Cerione,R.A. (1995). Identification and biochemical characterization of an 80 kilodalton GTP-binding/transglutaminase from rabbit liver nuclei. Biochemistry 34, 15863-15871.

Skabkin,M.A., Evdokimova,V., Thomas,A.A., and Ovchinnikov,L.P. (2001). The major messenger ribonucleoprotein particle protein p50 (YB-1) promotes nucleic acid strand annealing. J Biol. Chem. 276, 44841-44847.

Skabkin,M.A., Kiselyova,O.I., Chernov,K.G., Sorokin,A.V., Dubrovin,E.V., Yaminsky,I.V., Vasiliev,V.D., and Ovchinnikov,L.P. (2004). Structural organization of mRNA complexes with major core mRNP protein YB-1. Nucleic Acids Res. 32, 5621- 5635.

Skalweit,A., Doller,A., Huth,A., Kahne,T., Persson,P.B., and Thiele,B.J. (2003). Posttranscriptional control of renin synthesis: identification of proteins interacting with renin mRNA 3'-untranslated region. Circ. Res 92, 419-427.

Small,E.M., Thatcher,J.E., Sutherland,L.B., Kinoshita,H., Gerard,R.D., Richardson,J.A., Dimaio,J.M., Sadek,H., Kuwahara,K., and Olson,E.N. (2010). Myocardin-related transcription factor-a controls myofibroblast activation and fibrosis in response to myocardial infarction. Circ. Res. 107, 294-304.

Small,K., Feng,J.F., Lorenz,J., Donnelly,E.T., Yu,A., Im,M.J., Dorn,G.W., and Liggett,S.B. (1999). Cardiac specific overexpression of transglutaminase II (G(h)) results in a unique hypertrophy phenotype independent of phospholipase C activation. J Biol Chem. 274, 21291-21296.

191

Snabaitis,A.K., Hearse,D.J., and Avkiran,M. (2002). Regulation of sarcolemmal Na(+)/H(+) exchange by hydrogen peroxide in adult rat ventricular myocytes. Cardiovasc. Res. 53, 470-480.

Snead,A.N. and Insel,P.A. (2012). Defining the cellular repertoire of GPCRs identifies a profibrotic role for the most highly expressed receptor, protease-activated receptor 1, in cardiac fibroblasts. FASEB J. 26, 4540-4547.

Sommerville,J. and Ladomery,M. (1996). Transcription and masking of mRNA in germ cells: involvement of Y-box proteins. Chromosoma 104, 469-478.

Sonenberg,N. and Hinnebusch,A.G. (2009). Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136, 731-745.

Sorokin,A.V., Selyutina,A.A., Skabkin,M.A., Guryanov,S.G., Nazimov,I.V., Richard,C., Th'ng,J., Yau,J., Sorensen,P.H., Ovchinnikov,L.P., and Evdokimova,V. (2005). Proteasome-mediated cleavage of the Y-box-binding protein 1 is linked to DNA-damage stress response. EMBO J. 24, 3602-3612.

Spriggs,K.A., Cobbold,L.C., Ridley,S.H., Coldwell,M., Bottley,A., Bushell,M., Willis,A.E., and Siddle,K. (2009). The human insulin receptor mRNA contains a functional internal ribosome entry segment. Nucleic Acids Res 37, 5881-5893.

Spriggs,K.A., Stoneley,M., Bushell,M., and Willis,A.E. (2008). Re-programming of translation following cell stress allows IRES-mediated translation to predominate. Biol. Cell 100, 27-38.

Stamnaes,J., Fleckenstein,B., and Sollid,L.M. (2008). The propensity for deamidation and transamidation of peptides by transglutaminase 2 is dependent on substrate affinity and reaction conditions. Biochim. Biophys. Acta 1784, 1804-1811.

Stamnaes,J., Pinkas,D.M., Fleckenstein,B., Khosla,C., and Sollid,L.M. (2010). Redox regulation of transglutaminase 2 activity. J. Biol. Chem. 285, 25402-25409.

Stephens,P., Grenard,P., Aeschlimann,P., Langley,M., Blain,E., Errington,R., Kipling,D., Thomas,D., and Aeschlimann,D. (2004). Crosslinking and G-protein functions of transglutaminase 2 contribute differentially to fibroblast wound healing responses. J. Cell Sci. 117, 3389-3403.

Stoneley,M. and Willis,A.E. (2004). Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression. Oncogene 23, 3200- 3207.

Stratton,R., Rajkumar,V., Ponticos,M., Nichols,B., Shiwen,X., Black,C.M., Abraham,D.J., and Leask,A. (2002). Prostacyclin derivatives prevent the fibrotic

192 response to TGF-beta by inhibiting the Ras/MEK/ERK pathway. FASEB J 16, 1949- 1951.

Strauch,A. and Hariharan,S. (2013). Dynamic interplay of smooth muscle á-actin gene regulatory proteins reflects the biological complexity of myofibroblast differentiation. Biology (MDPI, Base1) 2, 555-586.

Sturrock,A., Cahill,B., Norman,K., Huecksteadt,T.P., Hill,K., Sanders,K., Karwande,S.V., Stringham,J.C., Bull,D.A., Gleich,M., Kennedy,T.P., and Hoidal,J.R. (2006). Transforming growth factor-beta1 induces Nox4 NAD(P)H oxidase and reactive oxygen species-dependent proliferation in human pulmonary artery smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 290, L661-L673.

Subramanian,S.V., Kelm,R.J., Polikandriotis,J.A., Orosz,C.G., and Strauch,A.R. (2002). Reprogramming of vascular smooth muscle alpha-actin gene expression as an early indicator of dysfunctional remodeling following heart transplant. Cardiovasc. Res. 54, 539-548.

Subramanian,S.V., Orosz,C.G., and Strauch,A.R. (1998). Vascular smooth muscle alpha- actin expression as an indicator of parenchymal cell reprogramming in cardiac allografts. Transplantation 65, 1652-1656.

Subramanian,S.V., Polikandriotis,J.A., Kelm,R.J., Jr., David,J.J., Orosz,C.G., and Strauch,A.R. (2004). Induction of vascular smooth muscle alpha-actin gene transcription in transforming growth factor beta1-activated myofibroblasts mediated by dynamic interplay between the Pur repressor proteins and Sp1/Smad coactivators. Mol Biol Cell 15, 4532-4543.

Sutherland,B.W., Kucab,J., Wu,J., Lee,C., Cheang,M.C., Yorida,E., Turbin,D., Dedhar,S., Nelson,C., Pollak,M., Leighton,G.H., Miller,K., Badve,S., Huntsman,D., Blake-Gilks,C., Chen,M., Pallen,C.J., and Dunn,S.E. (2005). Akt phosphorylates the Y- box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24, 4281-4292.

Suzuki,J., Isobe,M., Aikawa,M., Kawauchi,M., Shiojima,I., Kobayashi,N., Tojo,A., Suzuki,T., Kimura,K., Nishikawa,T., Sakai,T., Sekiguchi,M., Yazaki,Y., and Nagai,R. (1996). Nonmuscle and smooth muscle myosin heavy chain expression in rejected cardiac allografts. A study in rat and monkey models. Circulation 94, 1118-1124.

Suzuki,T., Bridges,D., Nakada,D., Skiniotis,G., Morrison,S.J., Lin,J.D., Saltiel,A.R., and Inoki,K. (2013). Inhibition of AMPK Catabolic Action by GSK3. Mol. Cell 50, 407-419.

Takac,I., Schroder,K., Zhang,L., Lardy,B., Anilkumar,N., Lambeth,J.D., Shah,A.M., Morel,F., and Brandes,R.P. (2011). The E-loop is involved in hydrogen peroxide formation by the NADPH oxidase Nox4. J Biol. Chem. 286, 13304-13313.

193

Telci,D., Collighan,R.J., Basaga,H., and Griffin,M. (2009). Increased TG2 expression can result in induction of transforming growth factor beta1, causing increased synthesis and deposition of matrix proteins, which can be regulated by nitric oxide. J. Biol. Chem. 284, 29547-29558.

Telci,D. and Griffin,M. (2006). Tissue transglutaminase (TG2)--a wound response enzyme. Front Biosci. 11, 867-882.

Thannickal,V.J. and Fanburg,B.L. (1995). Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor beta 1. J Biol Chem. 270, 30334-30338.

Thomazy,V. and Fesus,L. (1989). Differential expression of tissue transglutaminase in human cells. An immunohistochemical study. Cell Tissue Res. 255, 215-224.

Tomasek,J.J., Gabbiani,G., Hinz,B., Chaponnier,C., and Brown,R.A. (2002). Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 3, 349-363.

Tullius,S.G. and Tilney,N.L. (1995). Both alloantigen-dependent and -independent factors influence chronic allograft rejection. Transplantation 59, 313-318.

Vaahtomeri,K., Ventela,E., Laajanen,K., Katajisto,P., Wipff,P.J., Hinz,B., Vallenius,T., Tiainen,M., and Makela,T.P. (2008). Lkb1 is required for TGFbeta-mediated myofibroblast differentiation. J. Cell Sci. 121, 3531-3540.

Vepachedu,R., Gorska,M.M., Singhania,N., Cosgrove,G.P., Brown,K.K., and Alam,R. (2007). Unc119 regulates myofibroblast differentiation through the activation of Fyn and the p38 MAPK pathway. J Immunol. 179, 682-690.

Weber KT (1995). Wound Healing in Cardiovascular Disease. (Armonk, NY: Futrua Publishing Co.).

Wehner,K.A., Schutz,S., and Sarnow,P. (2010). OGFOD1, a novel modulator of eukaryotic translation initiation factor 2alpha phosphorylation and the cellular response to stress. Mol. Cell Biol. 30, 2006-2016.

Wei,W.J., Mu,S.R., Heiner,M., Fu,X., Cao,L.J., Gong,X.F., Bindereif,A., and Hui,J. (2012). YB-1 binds to CAUC motifs and stimulates exon inclusion by enhancing the recruitment of U2AF to weak polypyrimidine tracts. Nucleic Acids Res. 40, 8622-8636.

White,D.E., Coutu,P., Shi,Y.F., Tardif,J.C., Nattel,S., St,A.R., Dedhar,S., and Muller,W.J. (2006). Targeted ablation of ILK from the murine heart results in dilated cardiomyopathy and spontaneous heart failure. Genes Dev. 20, 2355-2360.

194

Wilkes,M.C., Mitchell,H., Penheiter,S.G., Dore,J.J., Suzuki,K., Edens,M., Sharma,D.K., Pagano,R.E., and Leof,E.B. (2005). Transforming growth factor-beta activation of phosphatidylinositol 3-kinase is independent of Smad2 and Smad3 and regulates fibroblast responses via p21-activated kinase-2. Cancer Res. 65, 10431-10440.

Willis,B.C. and Borok,Z. (2007). TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am. J. Physiol Lung Cell Mol. Physiol. 293, L525-L534.

Willis,W.L., Hariharan,S., David,J.J., and Strauch,A.R. (2013). Transglutaminase-2 mediates calcium-regulated crosslinking of the Y-box 1 (YB-1) translation-regulatory protein in TGFbeta1-activated myofibroblasts. J Cell Biochem.

Wolffe,A.P. (1994). Structural and functional properties of the evolutionarily ancient Y- box family of nucleic acid binding proteins. Bioessays 16, 245-251.

Woods,A., Dickerson,K., Heath,R., Hong,S.P., Momcilovic,M., Johnstone,S.R., Carlson,M., and Carling,D. (2005). Ca2+/calmodulin-dependent protein kinase kinase- beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell Metab 2, 21-33.

Yamaguchi,M., Yamano,S., Muguruma,M., and Robson,R.M. (1988). Polarity and length of actin filaments at the fascia adherens of the cardiac intercalated disk. J. Ultrastruct. Mol. Struct. Res. 100, 235-244.

Yamasaki,S. and Anderson,P. (2008). Reprogramming mRNA translation during stress. Curr. Opin. Cell Biol. 20, 222-226.

Yang,W.H. and Bloch,D.B. (2007). Probing the mRNA processing body using protein macroarrays and "autoantigenomics". RNA. 13, 704-712.

Yang,Z. and Ming,X.F. (2012). mTOR signalling: the molecular interface connecting metabolic stress, aging and cardiovascular diseases. Obes. Rev. 13 Suppl 2, 58-68.

Yoshida,T. (2008). MCAT Elements and the TEF-1 Family of Transcription Factors in Muscle Development and Disease. Arterioscler Thromb Vasc Biol 28, 8-17.

Yue,J. and Mulder,K.M. (2000). Requirement of Ras/MAPK pathway activation by transforming growth factor beta for transforming growth factor beta 1 production in a Smad-dependent pathway. J Biol. Chem. 275, 30765-30773.

Yue,T.L., Wang,C., Gu,J.L., Ma,X.L., Kumar,S., Lee,J.C., Feuerstein,G.Z., Thomas,H., Maleeff,B., and Ohlstein,E.H. (2000). Inhibition of extracellular signal-regulated kinase enhances Ischemia/Reoxygenation-induced apoptosis in cultured cardiac myocytes and exaggerates reperfusion injury in isolated perfused heart. Circ. Res. 86, 692-699.

195

Zemskov,E.A., Janiak,A., Hang,J., Waghray,A., and Belkin,A.M. (2006). The role of tissue transglutaminase in cell-matrix interactions. Front Biosci. 11, 1057-1076.

Zhang,A., David,J.J., Subramanian,S.V., Liu,X., Fuerst,M.D., Zhao,X., Leier,C.V., Orosz,C.G., Kelm,R.J., Jr., and Strauch,A.R. (2008). Serum response factor neutralizes Pur alpha- and Pur beta-mediated repression of the fetal vascular smooth muscle alpha- actin gene in stressed adult cardiomyocytes. Am. J. Physiol Cell Physiol 294, C702- C714.

Zhang,A., Liu,X., Cogan,J.G., Fuerst,M.D., Polikandriotis,J.A., Kelm,R.J., Jr., and Strauch,A.R. (2005). YB-1 coordinates vascular smooth muscle alpha-actin gene activation by transforming growth factor beta1 and thrombin during differentiation of human pulmonary myofibroblasts. Mol. Biol. Cell 16, 4931-4940.

Zhang,Z., Vezza,R., Plappert,T., McNamara,P., Lawson,J.A., Austin,S., Pratico,D., Sutton,M.S., and Fitzgerald,G.A. (2003). COX-2-dependent cardiac failure in Gh/tTG transgenic mice. Circ. Res. 92, 1153-1161.

Zmijewski,J.W., Banerjee,S., Bae,H., Friggeri,A., Lazarowski,E.R., and Abraham,E. (2010). Exposure to hydrogen peroxide induces oxidation and activation of AMP- activated protein kinase. J Biol. Chem. 285, 33154-33164.

Zuker,M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415.

196