CLONING and SEROTONERGIC REGULATION of RING FINGER PROTEIN38 (Rnf38) in the BRAIN of MEDAKA (ORYZIAS LATIPES)

Neuroscience 294 (2015) 109–115

CLONING AND SEROTONERGIC REGULATION OF RING FINGER PROTEIN38 (rnf38) IN THE BRAIN OF MEDAKA (ORYZIAS LATIPES)

S. MORIYA, * N. B. KHEL AND I. S. PARHAR involved in various cellular processes through protein– Brain Research Institute, Jeffrey Cheah School of Medicine protein or protein–DNA interactions (Saurin et al., 1996; and Health Sciences, Monash University Malaysia, PJ Borden, 2000). Many RING finger proteins, such as 46150, Malaysia PJA1, neuroregulin receptor degradation protein-1 and Parkin play important roles in their ubiquitin-conjugating enzyme (E2)-dependent E3 ubiquitin ligase activities Abstract—Serotonin (5-HT) is a key regulator of mood and (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). sexual behaviors. 5-HT reuptake inhibitors have been used Furthermore, several RING finger proteins such as AO7 as antidepressants. Really interesting new gene (RING) fin- and Cbl bind to E2 ubiquitin enzymes and regulate ubiqui- ger proteins have been associated with 5-HT regulation but their role remains largely unknown. Some RING finger tination (Lorick et al., 1999; Yokouchi et al., 1999; proteins are involved in the serotonergic system, therefore, Freemont, 2000). Therefore, involvement in ubiquitination we speculate that the gene expression of RING finger pro- is considered as a general function of RING finger proteins. tein38 (rnf38) is regulated by the serotonergic system. In On the other hand, several RING finger proteins such as the present study, we aimed to identify the full length RING finger protein8 have other functions like transcrip- sequence of medaka (Oryzias latipes) rnf38 mRNA and tion-stimulating activity (Takano et al., 2004). investigate its association with the serotonergic system RING finger protein 38 (Rnf38) possesses a using an antidepressant, citalopram (CIT). We identified conserved RING-H2 domain among species, which the full length rnf38 cDNA, which consisted of 2726 nucleo- consists of C-X -C-X -C-X -H-X -H-X -C- tides spanning 12 exons and the deduced protein sequence 2 (9–39) (1–3) (2–3) 2 X -C-X -C where C is cysteine residue, H is consisting of 518 amino acid residues including a RING fin- (4–48) 2 ger domain, a KIT motif and a coiled-coil domain. Medaka histidine residue and X is any amino acid residue and exposed to 107 M of CIT showed anxiety-like behavior. binds two zinc atoms (Fig. 1)(Freemont et al., 1991; The expressions of 5-HT-related genes, pet1, solute carrier Freemont, 1993; Nalepa et al., 2006), and is widely family 6, member 4A (slc6a4) and tryptophan hydroxylase expressed throughout the body in human, especially (tph2) were significantly low (P < 0.05) in the hindbrain. highly expressed in the heart, brain, placenta and the tes- On the other hand, rnf38 gene was significantly high tis (Eisenberg et al., 2002). The role of Rnf38 remains (P < 0.05) in the telencephalon and the hypothalamus. unknown. This shows that 5-HT synthesis and transport in the hind- Serotonin (5-HT) is a key modulator of numerous brain is suppressed by CIT, which induces rnf38 gene physiological processes and behaviors, such as mood, expression in the forebrain where 5-HT neurons project. anxiety and sexual behaviors (Jacobs and Azmitia, Thus, the expression of rnf38 is negatively regulated by the serotonergic system. Ó 2015 The Authors. Published 1992; Lucki, 1998), therefore, many genes are regulated by Elsevier Ltd. on behalf of IBRO. This is an open access by the serotonergic system (Sillaber et al., 2008; Park article under the CC BY-NC-ND license (http://creativecom- et al., 2012). Antidepressant-related gene 34 (Adgr34), mons.org/licenses/by-nc-nd/4.0/). a RING finger protein, is regulated by the serotonergic system (Yamada et al., 2000). Adrg34 gene expression is induced in the rat hippocampus and the frontal cortex Key words: rnf38, RING finger domain, serotonergic system, by disruption of the serotonergic system. Furthermore, citalopram, medaka brain. another RING finger protein, Rines regulates the serotonergic system by modulating ubiquitination and degradation of monoamine oxidase A, which is the catabolic INTRODUCTION enzyme of amine neurotransmitters such as 5-HT (Kabayama et al., 2013). We speculate that Rnf38 is also Really interesting new gene (RING) finger protein is a regulated by the serotonergic system in the brain. protein which possesses a characteristic zinc-binding Selective serotonin reuptake inhibitors (SSRIs) induce motif (RING finger domain). The RING finger proteins are an increase in extracellular 5-HT by inhibition of reuptake of 5-HT through serotonin transporter at neurons, *Corresponding author. Tel: +60-3-5514-6376; fax: +60-3-5514- therefore, SSRIs have been used to evaluate effects of 6341. the serotonergic system in fish. Fluoxetine (FLU), which E-mail address: [email protected] (S. Moriya). Abbreviations: CIT, citalopram; FLU, fluoxetine; RING, really is one of SSRIs, exposure decreases feeding rates and interesting new gene; rnf38, RING finger protein38; RO, reverse growth in fathead minnows (Pimephales promelas) osmosis; SSRIs, selective serotonin reuptake inhibitors. http://dx.doi.org/10.1016/j.neuroscience.2015.03.012 0306-4522/Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 109 110 S. Moriya et al. / Neuroscience 294 (2015) 109–115

dissected. Total RNA was isolated from the medaka whole brain with TRIzol (Invitrogen, Carlsbad, CA, USA) and converted to cDNA with SuperScript III reverse transcriptase (Invitrogen) and oligo d(T) primer. Partial CDS region was amplified with PCR. The primers were designed based on the genomic sequence of a predicted medaka rnf38 gene (accession No. ENSORLG00000 003296). The primer sequences were as follows: forward primer, 50-GGGACAAGATGGAGGACAGTCCCAC-30,and reverse primer, 50-CAGTTGACGCGACTCAAAGTCAC TC-30. The PCR reaction was performed in a 20-ll reaction mixture containing 1 HotStarTaq Master Mix (Qiagen, Hilden, Germany), 0.5 lM each of the primers and 1 ll of cDNA. The reaction program consisted of Fig. 1. Schematic structure of RING-H2 domain. C: cysteine residue, 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s H: histidine residue, X: any amino acid residue and Zn: zinc. Modified and 72 °C for 2 min followed by 72 °C for 3 min. The from Nalepa et al. (2006). amplified DNA was subjected to direct sequencing using BigDye Terminator v3.1 Cycle Sequencing kit (Applied (Stanley et al., 2007), exerts negative effects on swimming Biosystems, Foster City, CA, USA) and 3130 Genetic and feeding behavior of hybrid striped bass (Morone Analyzer (Applied Biosystems). saxatiles Morone chrysops)(Gaworecki and Klaine, Full length rnf38 mRNA sequence was identified by 30- 2008), delays the development of sexual characteristics and 50-rapid amplification of cDNA end (RACE). Gene- of maturing western mosquitofish (Gambusia affinis) specific primers were designed based on the identified (Henry and Black, 2008), alters plasma estradiol, and partial mRNA sequence. For 30-RACE, 1 lg of total RNA inhibited egg production in zebrafish (Lister et al., 2009). was converted to cDNA with SuperScript III (Invitrogen) In the bluehead wrasse, chronic administration of FLU and 50 pmol of oligo d(T)-containing adapter primer (AP) causes reduction of aggressive behavior (Semsar et al., in 20-ll volume according to the manufacturer’s 2004). Furthermore, fish exhibit anxiety-like behavior instruction. The converted cDNA was subjected to PCR against novelty stress and 5-HT levels affect their behavior in a 10-ll reaction containing 1 HotStarTaq Master (Blaser and Gerlai, 2006; Levin et al., 2007). In zebrafish, Mix, 10 pmol each of Abridged universal amplification manipulation of 5-HT levels with FLU affects anxiety-like primer (AUAP, Invitrogen), and a gene-specific primer behavior in the novel tank (Cachat et al., 2010). 50-CTGTGCGTAGTGTGTATGAGTG-30. The reaction pro- The present study was designed to identify the full gram consisted of 95 °C for 5 min, 35 cycles of 94 °C for length sequence of medaka (Oryzias latipes) rnf38 30 s, 64 °C for 30 s and 72 °C for 3 min followed by 72 °C mRNA and correlate the expression of rnf38 gene with for 10 min. 5-HT-related genes, tryptophan hydroxylase (tph2, For 50-RACE, 1 lg of the total RNA was converted to regulator of 5-HT synthesis), solute carrier family 6, cDNA in 20-ll volume with SuperScript III (Invitrogen), member 4A (slc6a4, encodes 5-HT transporter) and 2 pmol of gene-specific primer 50-CTGGACCTCCGAG pet1 (transcript factor regulating tph2 and slc6a4) in the GCATCTGCAC-30. Polyadenine was added at the 30 end brain by manipulating the serotonergic system using a of the cDNA with terminal transferase (Roche SSRI, citalopram (CIT). In addition, we assessed Diagnostics, Mannheim, Germany) according to the anxiety-like behavior following CIT treatment to evaluate manufacturer’s instruction. The polycytosine -tailed cDNA the effect of CIT.

EXPERIMENTAL PROCEDURES Animals Five-month-old male medaka (O. latipes) were maintained in fresh water at 27 ± 1.0 °C under a controlled natural photo regimen (14-h light/10-h dark cycle). The ﬁsh were fed Advanced Fish Diets (ZM, Winchester, UK) twice daily. All experimental procedures were performed in accordance with the guidelines of the Animal Ethics Committee of Monash University (approval No. SOBSB_MY_2010_64). Fig. 2. Schematic drawing of the sagittal brain section of the medaka showing the regions used for gene expression analysis. The Region I Cloning of full length rnf38 cDNA (telencephalic region): the telencephalon, the preoptic area and olfactory bulb, the Region II (optic tectum): the optic tectum, the Medaka were anesthetized by immersing in a 0.01% Region III (hypothalamic region): the hypothalamus and midbrain, the solution of benzocaine (Sigma, St. Louis, MO, USA), Region IV (cerebellum): the cerebellum and the Region V (hindbrain): killed by decapitation and the fresh brains were the hindbrain and the spinal cord. S. Moriya et al. / Neuroscience 294 (2015) 109–115 111

Table 1. Real-time PCR primers used in this study 50-TAGGAGAAGATGGAGTGGAGG-30. The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C Gene Sequence (50–30) Product size (bp) for 30 s, 64 °C for 30 s and 72 °C for 4 min followed by b-actin GAGCTATGAGCTGCCTGACG 103 72 °C for 10 min. The complete nucleotide sequence of GCAGGACTCCATACCAAGGA rnf38 mRNA was confirmed by a sequence analysis of pet1 GCGGAGGAAAGCTCATGTTC 139 each PCR product. A RING finger domain was further AGGAACTGCCACAGCTGGAT analyzed by the simple modular architecture research slc6a4 CGTGACTTGGTCCAACTTATCC 93 AGCTGGTGCAGACCTGATGA tool (SMART) (Schultz et al., 1998; Letunic et al., 2012). tph2 TGTTTGATCACCGGAACCAG 88 TCGTTGATGGGACAGAAGGA rnf38 TGACCCAGCCTTCTTGATTC 138 CIT treatment ATCCTCTGTAACGGTGAACG CIT (Sigma–Aldrich, St. Louis, MO, USA) was dissolved in reverse osmosis (RO) water to final concentrations of 0 (control), 107 and 108 M. Fish were randomly selected was subjected to PCR reaction in 20-ll volume containing 0 and divided into three groups (N = 10 in each group). 1 HotStarTaq Master Mix, 10 pmol each of 5 -RACE The treatment was performed in the tanks (280 mm abridged anchor primer (Invitrogen) and a gene-specific 0 0 (L) 210 mm (W) 180 mm (H)) containing 3 L of water primer 5 -GCGTATGGCATCTCTCTGGTATG-3 . The with different concentrations of CIT. During the reaction program consisted of 95 °C for 5 min, 35 cycles experiment, CIT solution was changed every day for of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 4 min 14 days. Doses 107 M and 108 M were selected based followed by 72 °C for 10 min. Furthermore, 1 ll of the on the previous study using male goldfish, where male PCR reaction mixture was subjected to nested PCR. 7 goldfish exposed to 1.7 10 M FLU for 14 days had Nested PCR was performed in a 20-ll reaction disrupted reproductive physiology such as decreased milt mixture containing 1 HotStarTaq Master Mix, 10 pmol volume and testosterone levels (Mennigen et al., 2010). each of AUAP (Invitrogen) and a gene-specific primer 7 This suggests that exposure to 1.7 10 M SSRI is

Fig. 3. (A) Deduced amino acid sequence of medaka Rnf38 and predicted domains. Coiled-coil domain is amino acids 412–432, KIL motif is amino acids 443–439, RING ﬁnger domain is amino acids 466–506. (B) Alignment of RING ﬁnger domain among human (AF394047), rat (NP_604462), mouse (NP_598825), drosophila (XP_082352), and Arabidopsis (NP_566651). Shaded boxes indicate amino acids involved in zinc coordination. 112 S. Moriya et al. / Neuroscience 294 (2015) 109–115

Fig. 4. Effect of CIT exposure on medaka behavior. (A) Latency to enter top half of the tank. (B) Number of transitions between the top half and bottom half of the tank. Time spent at the bottom half (C) and the top half (D) of the tank. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05. effective in fish. Therefore, fish were exposed to 107 M sagittal planes (15 lm) and mounted onto a polyethylene and 108 M of CIT in this study to investigate the associa- naphthalate membrane (PEN, Leica Microsystems, tion of the serotonergic system with rnf38 gene expression. Wetzlar, Germany) attached slide glasses and stored at 80 °C until use. The sections were briefly fixed in 70% ethanol and Anxiety-like behavior test stained with Cresyl Violet to identify brain nuclei. The After 14-day exposure to CIT, the fish (control: N = 9; CIT brains were divided into five regions (Fig. 2) by a laser (108 M): N = 8; CIT (107 M): N = 9) were subjected to microdissection system (ArcturusXT, Applied Biosystems, the anxiety-like behavior test. Anxiety-like behavior was Foster, CA). Region I (telencephalic region) included the tested following our previously published method (Khor telencephalon, preoptic area and the olfactory bulbs, et al., 2013). In brief, a tank with dimensions of 280 mm Region II (optic tectum) included the optic tectum, Region (L) 210 mm (W) 180 mm (H) was filled with 7 L of III (hypothalamic region) included the hypothalamus and RO water. A camera was set at the side of the tank, the midbrain, Region IV (cerebellum) included the approximately 1 m away. After 14-day exposure, each cerebellum and Region V (hindbrain) included the fish was transferred into the tank, and behavioral hindbrain and the spinal cord. The procedure for the laser response to novel environment was recorded for 10 min. microdissection has been described in detail by Ogawa For the behavior analysis, the tank was marked into two et al. (2012). The laser-dissected tissues of each brain equal top and bottom halves. Parameters analyzed in this region attached to PEN membrane were pooled into a micro- study were latency to enter into the top half of the tank, tube containing 200 ll of TRIzol (Invitrogen, Carlsbad, CA), the number of transitions between top and bottom halves and total RNA was isolated according to the manufacturer’s and the time spent in the bottom half and top half. instructions. The entire isolated total RNA was subjected to cDNA synthesis with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) in Gene expression analysis of rnf38 and 5-HT-related 20-ll volume according to the manufacturer’s genes instruction.mRNA levels of b-actin, pet1, slc6a4, tph2 and After completion of behavioral test, fish (control: N =9; rnf38 genes were examined by real-time PCR. Real-time CIT (108 M): N = 8; CIT (107 M): N = 8) were PCR was performed in 10-ll reaction mixtures containing anesthetized by immersing in a 0.01% solution of 1 POWER SYBR Green PCR Master Mix (Applied benzocaine (Sigma) and killed by decapitation. Fresh Biosystems), 0.2 lM each forward and reverse primer, brains were dissected, and embedded in Tissue Tek OCT and 1-ll cDNA. The primers used are shown in Table 1. compound (Sakura Finetechnical, Tokyo, Japan), and Real-time PCR was performed using a StepOnePlus frozen in powdered dry-ice. Brain sections were cut into (Applied Biosystems) with conditions of 95 °C for 10 min, S. Moriya et al. / Neuroscience 294 (2015) 109–115 113 followed by 40 cycles of 95 °C for 15 s and 60 °Cfor1min followed by a dissociation step. The levels of each mRNA type were normalized to b-actin mRNA with the ddCt method and the gene expression level in the control sample was defined as 1.0 for each brain region.

Data analysis Statistical analysis was performed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons using SPSS 18. P < 0.05 was considered as signiﬁcant.

RESULTS Full length rnf38 mRNA sequence The identified full length rnf38 mRNA (Genbank accession No. KF431968) consisted of 2726 nucleotides spanning 12 exons when compared to the medaka genome. The coding region starts at the first base of exon 3 and extends to the 60th base of the exon 12. The deduced protein sequence region consisted of 518 amino acid residues including a RING finger domain, identified as RING-H2 (C-X2-C-X14- C-X-H-X2-H-X2-C-X10-C-X2-C) (Fig. 3A). In addition to the RING finger domain, a KIL motif (K-X2-I/L-X2-I/L) and a coiled-coil domain was also seen in the deduced sequence (Fig. 3A). The RING-H2 sequence of Rnf38 is conserved among the human, rat, mouse, drosophila and Arabidopsis (Fig. 3B).

Behavior analysis After 14-day exposure to CIT, the fish (control group, 108 M group and 107 M group) were subjected to the behavioral test (Fig. 4). The latency to the top half of the tank was significantly high in the 107 M group compared to the control group. The number of transitions was significantly low in the 107 M group. The 108 M group revealed no significant difference in the latency and the number of transitions. The time spent at the bottom half and top half showed no significant difference in both groups.

Gene expression analysis Fig. 5. Effect of CIT exposure on 5-HT-related gene expression in 7 the medaka brain. pet1 (A), slc6a4 (B) and tph2 (C) gene expressions The pet1 mRNA levels were significantly low in the 10 M were examined. The gene expression in the relevant region of control 7 group of the hypothalamic region and the 10 M group sample was defined as 1.0. All of data are presented as and 108 M group of the hindbrain (Fig. 5A). The mRNA mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post ⁄ levels of slc6a4 and tph2 were significantly low in the hoc test for multiple comparisons. P < 0.05. 107 M group of the hindbrain and no significant difference was observed in the hypothalamic region (Fig. 5B,C). rnf38 gene expression was examined in all domain of medaka Rnf38 is conserved among a wide of the five regions (Fig. 6). rnf38 gene expression was range of eukaryotes, which include the human, rat, significantly increased in the 107 M group in the mouse, drosophila and Arabidopsis. The KIL motif telencephalic region and hypothalamic region. In the (Eisenberg et al., 2002) is present in a subset of the other regions and concentration, no significant difference RING-H2 domain and is located shortly upstream of the was observed. RING-H2 domain (Macdonald et al., 1999). The coiled- coil domain (Lupas et al., 1991) is also characterized close to the RING finger domain region of the human, DISCUSSION rat and mouse (Eisenberg et al., 2002). The coiled-coil Full length cDNA of medaka rnf38 was identified and domain is involved in protein–protein/DNA interaction, compared with other species. The RING finger domain, which is observed in functional proteins, like some tran- the KIL motif and the coiled-coil domain were predicted scription factors, c-fos and tropomyosin (Zuo et al., from the deduced amino acid sequence. The RING-H2 2010; Moore et al., 2011). mPY motif and SH2 binding 114 S. Moriya et al. / Neuroscience 294 (2015) 109–115

where pet1 expressing 5-HT neurons send projections in the zebraﬁsh (Lillesaar et al., 2009). This suggests that the rnf38 gene in the telencephalic and hypothalamic region is induced by the decline of 5-HT levels. Induction of Rnf38 may be involved in the anxiety-like behavior or non-cell autonomous by the decline of 5-HT levels. Furthermore, the Rnf38 may play a common role in 5-HT-related physiologies through protein–protein/ DNA interactions among vertebrates because of con- servation of the amino acid sequence.

CONCLUSION Fig. 6. Effect of CIT on rnf38 gene expression in the medaka brain. The gene expression in the relevant region of control sample was In this research, the full length sequence of medaka rnf38 defined as 1.0. All of data are presented as mean ± SEM and mRNA was identified and the RING finger domain and the analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple KIL domain which is accompanied by RING finger domain ⁄ comparisons. P < 0.05. was identified. Medaka exposed to CIT exhibited anxiety- like behavior, suppression of the serotonergic system- motif, which are key domains for ubiquitination, were not related genes mainly in the hindbrain, and increase of present. Therefore, Rnf38 may not be involved in ubiqui- the rnf38 gene expression in the telencephalic and the tination as observed in many RING finger proteins, but hypothalamic region. It suggests that rnf38 expression is may be involved in other functions such as a transcription negatively regulated by the serotonergic system. factor (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). Furthermore, since all functional domains of Rnf38 Acknowledgments—We thank Dr. Tomoko Soga, Dr. Takashi including the RING finger domain, the KIL motif and the Kitahashi and Dr. Satoshi Ogawa for their constructive comments coiled-coil domain are highly conserved among species, and Ms. Jalilah Idris and Ms. Asha Thanabalan for their excellent the role of Rnf38 could also be conserved. technical assistance. To evaluate the effect of CIT treatment, anxiety-like This work was supported by grants from Monash University behavior test was performed by transferring the fish to Sunway Campus (SM-10-01) and Malaysian Ministry of the novel tank after CIT exposure. Behavioral analysis Higher Education (FRGS/2/2010/SG/MUSM/03/3, FRGS/1/2013/ 7 revealed anxiety-like behavior in the 10 M group. The SKK01/MUSM/03/1, and FRGS/1/2013/SKK01/ MUSM/03/6). latency to the top half was increased and the number of transitions was decreased compared to the control REFERENCES group. Similar behavioral changes have been observed in other fish (Blaser and Gerlai, 2006; Levin et al., 2007; Blaser R, Gerlai R (2006) Behavioral phenotyping in zebrafish: Lister et al., 2009; Cachat et al., 2010). In the bluehead comparison of three behavioral quantification methods. Behav wrasse, chronic administration of FLU causes reduction Res Methods 38:456–469. of aggressive behavior (Semsar et al., 2004). In the pre- Borden KL (2000) RING domains: master builders of molecular sent study, medaka exposed to CIT had low pet1 scaffolds? J Mol Biol 295:1103–1112. mRNA levels in the hypothalamic region and pet1, slc6a4 Cachat J, Stewart A, Grossman L, Gaikwad S, Kadri F, Chung KM, Wu N, Wong K, Roy S, Suciu C, Goodspeed J, Elegante M, and tph2 mRNA levels in the hindbrain. In zebrafish, sev- Bartels B, Elkhayat S, Tien D, Tan J, Denmark A, Gilder T, Kyzar eral populations of pet1 expressing 5-HT neurons have E, DiLeo J, Frank K, Chang K, Utterback E, Hart P, Kalueff AV been reported in the hypothalamus and the hindbrain (2010) Measuring behavioral and endocrine responses to novelty (Lillesaar, 2011). This suggests that 5-HT synthesis and stress in adult zebrafish. Nat Protocols 5:1786–1799. transport in pet1 expressing 5-HT neurons is suppressed Eisenberg I, Hochner H, Levi T, Yelin R, Kahan T, Mitrani- by CIT exposure. The decreased presynaptic 5-HT could Rosenbaum S (2002) Cloning and characterization of a novel cause anxiety-like behavior. Furthermore, the pet1 human gene RNF38 encoding a conserved putative protein with a RING finger domain. Biochem Biophys Res Commun expressing 5-HT neurons in the hindbrain may also be 294:1169–1176. involved in the behavioral changes, since mRNA levels Freemont PS (1993) The RING finger. A novel protein sequence of the slc6a4 and tph2 were suppressed only in the hind- motif related to the zinc finger. Ann N Y Acad Sci 684:174–192. brain of the 107 M group. On the other hand, behavioral Freemont PS (2000) RING for destruction? Curr Biol 10:R84–R87. changes were not observed in the 108 M group. This Freemont PS, Hanson IM, Trowsdale J (1991) A novel cysteine-rich result is comparable with goldfish experiment exposed sequence motif. Cell 64:483–484. Gaworecki KM, Klaine SJ (2008) Behavioral and biochemical to FLU (Mennigen et al., 2010). This is probably due to responses of hybrid striped bass during and after fluoxetine no change of 5-HT synthesis and transport. In fact, there exposure. Aquat Toxicol 88:207–213. are no changes in mRNA levels of slc6a4 and tph2 in both Henry TB, Black MC (2008) Acute and chronic toxicity of fluoxetine the hypothalamic region and hindbrain of the 108 M (selective serotonin reuptake inhibitor) in western mosquitofish. group. Arch Environ Contam Toxicol 54:325–330. The rnf38 was ubiquitously expressed in all regions of Jacobs BL, Azmitia EC (1992) Structure and function of the brain serotonin system. Physiol Rev 72:165–229. the brain. The rnf38 expression was increased by CIT Kabayama M, Sakoori K, Yamada K, Ornthanalai VG, Ota M, only in the telencephalic and the hypothalamic region, Morimura N, Katayama K, Murphy NP, Aruga J (2013) Rines E3 S. Moriya et al. / Neuroscience 294 (2015) 109–115 115

ubiquitin ligase regulates MAO-A levels and emotional responses. Park JW, Heah TP, Gouffon JS, Henry TB, Sayler GS (2012) Global J Neurosci 33:12940–12953. gene expression in larval zebrafish (Danio rerio) exposed to Khor YM, Soga T, Parhar IS (2013) Caffeine neuroprotects against selective serotonin reuptake inhibitors (fluoxetine and sertraline) dexamethasone-induced anxiety-like behaviour in the Zebrafish reveals unique expression profiles and potential biomarkers of (Danio rerio). Gen Comp Endocrinol 181:310–315. exposure. Environ Pollut 167:163–170. Letunic I, Doerks T, Bork P (2012) SMART 7: recent updates to the Saurin AJ, Borden KL, Boddy MN, Freemont PS (1996) Does this protein domain annotation resource. Nucleic Acids Res have a familiar RING? Trends Biochem Sci 21:208–214. 40:D302–D305. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple Levin ED, Bencan Z, Cerutti DT (2007) Anxiolytic effects of nicotine in modular architecture research tool: identification of signaling zebrafish. Physiol Behav 90:54–58. domains. Proc Natl Acad Sci U S A 95:5857–5864. Lillesaar C (2011) The serotonergic system in fish. J Chem Semsar K, Perreault HA, Godwin J (2004) Fluoxetine-treated male Neuroanat 41:294–308. wrasses exhibit low AVT expression. Brain Res 1029:141–147. Lillesaar C, Stigloher C, Tannhauser B, Wullimann MF, Bally-Cuif L Sillaber I, Panhuysen M, Henniger MH, Ohl F, Ku¨ hne C, Pu¨ tz B, Pohl (2009) Axonal projections originating from raphe serotonergic T, Deussing J, Paez-Pereda M, Holsboer F (2008) Profiling of neurons in the developing and adult zebrafish, Danio rerio, using behavioral changes and hippocampal gene expression transgenics to visualize raphe-specific pet1 expression. J Comp in mice chronically treated with the SSRI paroxetine. Neurol 512:158–182. Psychopharmacology 200:557–572. Lister A, Regan C, Van Zwol J, Van Der Kraak G (2009) Inhibition of Stanley JK, Ramirez AJ, Chambliss CK, Brooks BW (2007) egg production in zebrafish by fluoxetine and municipal effluents: Enantiospecific sublethal effects of the antidepressant fluoxetine a mechanistic evaluation. Aquat Toxicol 95:320–329. to a model aquatic vertebrate and invertebrate. Chemosphere Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman 69:9–16. AM (1999) RING fingers mediate ubiquitin-conjugating enzyme Takano Y, Adachi S, Okuno M, Muto Y, Yoshioka T, Matsushima- (E2)-dependent ubiquitination. Proc Natl Acad Sci U S A Nishiwaki R, Tsurumi H, Ito K, Friedman SL, Moriwaki H, Kojima 96:11364–11369. S, Okano Y (2004) The RING finger protein, RNF8, interacts with Lucki I (1998) The spectrum of behaviors influenced by serotonin. retinoid X receptor alpha and enhances its transcription- Biol Psychiatry 44:151–162. stimulating activity. J Biol Chem 279:18926–18934. Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coils from Tan Y, Yu F, Pereira A, Morin P, Zhou J (2011) Suppression of Nrdp1 protein sequences. Science 252:1162–1164. toxicity by Parkin in Drosophila models. Biochem Biophys Res Macdonald DH, Lahiri D, Sampath A, Chase A, Sohal J, Cross NC Commun 416:18–23. (1999) Cloning and characterization of RNF6, a novel RING finger Yamada M, Yamada M, Yamazaki S, Takahashi K, Nishioka G, Kudo gene mapping to 13q12. Genomics 58:94–97. K, Ozawa H, Yamada S, Kiuchi Y, Kamijima K, Higuchi T, Mennigen JA, Lado WE, Zamora JM, Duarte-Guterman P, Langlois Momose K (2000) Identification of a novel gene with RING-H2 VS, Metcalfe CD, Chang JP, Moon TW, Trudeau VL (2010) finger motif induced after chronic antidepressant treatment in rat Waterborne fluoxetine disrupts the reproductive axis in sexually brain. Biochem Biophys Res Commun 278:150–157. mature male goldfish, Carassius auratus. Aquat Toxicol Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang 100:354–364. H, Yoshimura A, Baron R (1999) Ligand-induced ubiquitination of Moore JR, Li X, Nirody J, Fischer S, Lehman W (2011) Structural the epidermal growth factor receptor involves the interaction of the implications of conserved aspartate residues located in c-Cbl RING finger and UbcH7. J Biol Chem 274:31707–31712. tropomyosin’s coiled-coil core. Bioarchitecture 1:250–255. Yu P, Chen Y, Tagle DA, Cai T (2002) PJA1, encoding a RING-H2 Morett E, Bork P (1999) A novel transactivation domain in parkin. finger ubiquitin ligase, is a novel human X chromosome gene Trends Biochem Sci 24:229–231. abundantly expressed in brain. Genomics 79:869–874. Nalepa G, Rolfe M, Harper JW (2006) Drug discovery in the ubiquitin- Zuo Z, Gandhi NS, Mancera RL (2010) Calculations of the free proteasome system. Nat Rev Drug Discov 5:596–613. energy of interaction of the c-Fos-c-Jun coiled coil: effects of the Ogawa S, Ng KW, Ramadasan PN, Nathan FM, Parhar IS (2012) solvation model and the inclusion of polarization effects. J Chem Habenular Kiss1 neurons modulate the serotonergic system in the Inf Model 50:2201–2212. brain of zebrafish. Endocrinology 153:2398–2407.

(Accepted 5 March 2015) (Available online 12 March 2015)