Integrated Analysis of Methylome and Transcriptome Following Developmental

Total Page:16

File Type:pdf, Size:1020Kb

Load more

bioRxiv preprint doi: https://doi.org/10.1101/2020.01.28.922179; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Integrated Analysis of Methylome and Transcriptome Following Developmental Atrazine Exposure in Zebrafish Reveals Aberrant Gene-Specific Methylation of Neuroendocrine and Reproductive Pathways Chris Bryan1, Li Lin2, Junkai Xie2, Janiel Ahkin Chin Tai3, Katharine A. Horzmann3,a, Kyle Wettschurack2, Min Zhang1, Jennifer Freeman3,4, Chongli Yuan2,4* 1 Department of Statistics, Purdue University, West Lafayette, IN, 47906, U.S.A. 2 Davidson School of Chemical Engineering, Purdue University, West Lafayette, IN, 47906, U.S.A. 3 School of Health Science, Purdue University, West Lafayette, IN, 47906, U.S.A. 4 Purdue University Center for Cancer Research, Purdue University, West Lafayette, IN, 47906, U.S.A. aCurrent affiliation: Department of Pathobiology, Auburn University College of Veterinary Medicine, Auburn, AL * To whom correspondence should be addressed. Tel:+ 1 765 494 5824; Fax: + 1 765 494 0805; Email: [email protected] Present Address: Chongli Yuan, Davidson School of Chemical Engineering, Purdue University, West Lafayette, IN, 47906, U.S.A. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.28.922179; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Atrazine (ATZ) is one of the most commonly used herbicides in the United States. Previous studies have hypothesized the role of ATZ as an endocrine disruptor (EDC), and developmental exposure to ATZ has been shown to lead to behavioral and morphological alterations. Specific epigenetic mechanisms responsible for these alterations, however, are yet to be elucidated. In this study, we exposed zebrafish embryos to 0.3, 3, and 30 ppb (µg/L) of ATZ for 72 hours post fertilization. We performed whole-genome bisulfite sequencing (WGBS) to assess the effects of developmental ATZ exposure on DNA methylation in female fish brains. The number of differentially methylated genes (DMG) increase with increasing dose of treatments. DMGs are enriched in neurological pathways with extensive methylation changes consistently observed in neuroendocrine and reproductive pathways. To assess the effects of DNA methylation on gene expression, we integrated our data with transcriptomic data. Four genes, namely CHD9, FRAS1, PID1, and PCLO, were differentially expressed and methylated in each dose. Overall, this study identifies specific genes and pathways with aberrant methylation and expression following ATZ exposure as targets to elucidate the molecular mechanisms of ATZ toxicity and presents ATZ-induced site-specific DNA methylation as a potential mechanism driving aberrant gene expression. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.28.922179; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. INTRODUCTION Atrazine (6-chloro-N-ehtyl-N-(1-methylethyl)-1,3,5-triazine-2,4-diamine. ATZ) is a widely used agriculture herbicide that controls the growth of broadleaf and weeds. The estimated total annual usage of atrazine is ~ 76.5 million pounds in the U.S., making it the second most commonly used herbicide in the country(1). ATZ has a relatively high water solubility(2) , and thus can be easily traced in surface and ground water by rainfalls and tile drainages(3–5). ATZ intake from contaminated water supplies has a wide range of adverse health outcomes, including disruption of the hypothalamic-related axis in the brain by inhibiting the luteinizing hormone production and decreasing testosterone production in rats and humans and is thus known to be a potential endocrine disrupter(6–8). Studies have also shown that ATZ exposure can demasculinize and feminize males while disrupting ovarian function in female rats(9). Recent studies also suggest that ATZ disrupts endocrine function by altering the hypothalamic-pituitary-gonadal (HPG) axis(10). For example, a recent work utilizing a female zebrafish animal model has found that ATZ exposure can disrupt the production of luteinizing hormone, follicle stimulating hormone and gonadotropin-releasing hormone, all of which are essential for female reproductive function(11). In addition to its endocrine disruption functions, ATZ exposure has also been associated with several neurological disorders. Studies using a zebrafish animal model have found that ATZ exposure can introduce significant alterations to neurotransmission pathways resulting in significant decreases of serotonin metabolites in female fish(12). Similar observations were made in mouse models, but ATZ exposure was found to primarily impact dopaminergic neurons(13– 16). Interestingly, a recent epidemiological study shows that agricultural workers are at high risk of developing depression and anxiety symptoms compared to other occupational groups(17), and the production of serotonin are associated with depression and anxiety in humans(18). Increasing evidence indicates that ATZ-induced neurotoxicity is sex-specific, with females having a higher chance of developing non-motor symptoms(19). Few studies, however, exist using female animal models, and the mechanisms of sex-specific neurotoxicity remain unclear. The toxic effects of ATZ can persist after removal of exposure source and can be inherited trans-generationally(20), suggesting the existence of underlying molecular “memory” and thus alluding to the involvement of an epigenetic mechanism. Epigenetics, including DNA methylation, histone post-translational modifications, and RNA-assisted regulation(21), refer to reversible and inheritable changes in gene expression without altering the underlying DNA sequence. Among these, the alteration of DNA and histone methylation profiles has been the most well-studied due to its abundance and relative stability compared to other types of epigenetic modifications(22–24). Specifically, a mouse bioRxiv preprint doi: https://doi.org/10.1101/2020.01.28.922179; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. study has found that ATZ exposure can result in deregulation of tissue-specific RNA transcription up to the third generation by inheritable decreases in H3K4me3, a transcription activation marker(25). Similar observations were also made in a rat model(20, 26). Our recent work has demonstrated that ATZ exposure in zebrafish can decrease global DNA methylation levels by inhibiting the activity of maintenance DNMTs and the expression level of DNMT4 and DNMT5, a zebrafish ortholog for DNMT3b(27), but that global methylation in the adult female zebrafish brain was not changed (manuscript in review). There is, however, no genome-wide studies revealing the impact of ATZ exposure on the epigenome in the brain. In this study, we used zebrafish as an animal model and performed whole-genome bisulfite sequencing using brains harvested from 9 month-old fish that were exposed to ATZ only during embryogenesis (1-72 hour post fertilization; hpf) to reveal permanent DNA methylome changes arising from embryonic ATZ exposure. Our results suggest that genes involved in key pathways related to observed behavioral changes resulting from low-dose ATZ, such as neuroendocrine function, are differentially methylated in the brain of zebrafish exposed to ATZ. After integrating the methylation data with transcriptomic data, we suggest the ATZ-induced site-specific DNA methylation as a potential mechanism driving the aberrant expression of neurological genes. MATERIAL AND METHODS Zebrafish husbandry and treatment Aliquots of a 10 parts per million (ppm; mg/L) stock solution of technical grade (98.1% purity) ATZ (CAS 1912-24-9; Chem Service, West Chester, PA) were diluted with filtered aquaria water to make exposures of 0.3, 3, and 30 ppb ATZ as previously described, with filtered aquaria water serving as the 0 ppb control(12, 28). Embryos were collected from a breeding colony of AB wild-type zebrafish (Danio rerio) maintained in a Z-Mod System (Aquatic Habitats, Apopka, FL) with a 14:10 light-dark cycle, temperature of 26-28°C, pH 7.0-7.3, and conductivity 470-550 µS. Fish and aquaria were monitored twice daily and fed a mixture of brine shrimp (Artemia franciscana; Artemia International LLC., Fairview, Texas), Zeigler adult zebrafish food (Zeigler Bros Inc., Gardners, PA), and Golden Pearls 500-800 µm (Artemia International LLC., Fairview, Texas). To obtain embryos, adult zebrafish were bred in spawning tanks according to established protocols(29, 30). Embryos were collected at the 4-8 cell stage, randomly sorted into the 0, 0.3, 3, or 30 ppb ATZ exposure groups, and incubated in petri dishes with 20 mL of exposure solution at 28.5°C. At 72 hpf, the larvae were rinsed in filtered aquaria water to end
Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Piccolo, a Presynaptic Zinc Finger Protein Structurally Related to Bassoon

    Piccolo, a Presynaptic Zinc Finger Protein Structurally Related to Bassoon

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Neuron, Vol. 25, 203±214, January, 2000, Copyright 2000 by Cell Press Piccolo, a Presynaptic Zinc Finger Protein Structurally Related to Bassoon Steven D. Fenster,*# Wook Joon Chung,*# presynaptic cytoskeletal matrix (PCM) (Landis et al., Rong Zhai,*# Claudia Cases-Langhoff,*# Britta Voss,² 1988; Hirokawa et al., 1989; Gotow et al., 1991) that is Abigail M. Garner,² Udo Kaempf,§ Stefan Kindler,³ thought to play a role in maintaining the neurotransmitter § Eckart D. Gundelfinger, and Craig C. Garner*k release site in register with the postsynaptic reception *Department of Neurobiology apparatus, regulating the mobilization of SVs and the University of Alabama at Birmingham refilling of release sites. Mechanistically, the PCM may Birmingham, Alabama 35294 define sites where SVs fuse and recycle through the ² Center for Molecular Neurobiology clustering of the exo- and endocytotic machinery. ³ Institute for Cellular Biochemistry SV cycling is a multistep process that involves vesicle and Clinical Neurobiology mobilization from a reserve pool, docking at active University of Hamburg zones, and calcium-dependent fusion (SuÈ dhof, 1995; D-20246 Hamburg Hanson et al., 1997). The latter two steps require the § Leibniz Institute for Neurobiology formation of a complex composed of the vesicle SNARE D-39118 Magdeburg VAMP2/Synaptobrevin and two target SNAREs, syn- Federal Republic of Germany taxin and SNAP-25 (SuÈ dhof, 1995; Hanson et al., 1997). In addition, a family of low molecular weight GTPases are likely to be involved in SV cycling with rab3 and rab5 Summary regulating exocytotic and endocytotic events, respec- tively (Ferro-Novick and Novick, 1993; Hess et al., 1993; Piccolo is a novel component of the presynaptic cy- SuÈ dhof, 1995).
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
  • DIPPER, a Spatiotemporal Proteomics Atlas of Human Intervertebral Discs

    DIPPER, a Spatiotemporal Proteomics Atlas of Human Intervertebral Discs

    TOOLS AND RESOURCES DIPPER, a spatiotemporal proteomics atlas of human intervertebral discs for exploring ageing and degeneration dynamics Vivian Tam1,2†, Peikai Chen1†‡, Anita Yee1, Nestor Solis3, Theo Klein3§, Mateusz Kudelko1, Rakesh Sharma4, Wilson CW Chan1,2,5, Christopher M Overall3, Lisbet Haglund6, Pak C Sham7, Kathryn Song Eng Cheah1, Danny Chan1,2* 1School of Biomedical Sciences, , The University of Hong Kong, Hong Kong; 2The University of Hong Kong Shenzhen of Research Institute and Innovation (HKU-SIRI), Shenzhen, China; 3Centre for Blood Research, Faculty of Dentistry, University of British Columbia, Vancouver, Canada; 4Proteomics and Metabolomics Core Facility, The University of Hong Kong, Hong Kong; 5Department of Orthopaedics Surgery and Traumatology, HKU-Shenzhen Hospital, Shenzhen, China; 6Department of Surgery, McGill University, Montreal, Canada; 7Centre for PanorOmic Sciences (CPOS), The University of Hong Kong, Hong Kong Abstract The spatiotemporal proteome of the intervertebral disc (IVD) underpins its integrity *For correspondence: and function. We present DIPPER, a deep and comprehensive IVD proteomic resource comprising [email protected] 94 genome-wide profiles from 17 individuals. To begin with, protein modules defining key †These authors contributed directional trends spanning the lateral and anteroposterior axes were derived from high-resolution equally to this work spatial proteomes of intact young cadaveric lumbar IVDs. They revealed novel region-specific Present address: ‡Department profiles of regulatory activities
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications

    Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications

    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
  • Identification of Key Genes and Pathways for Alzheimer's Disease

    Identification of Key Genes and Pathways for Alzheimer's Disease

    Biophys Rep 2019, 5(2):98–109 https://doi.org/10.1007/s41048-019-0086-2 Biophysics Reports RESEARCH ARTICLE Identification of key genes and pathways for Alzheimer’s disease via combined analysis of genome-wide expression profiling in the hippocampus Mengsi Wu1,2, Kechi Fang1, Weixiao Wang1,2, Wei Lin1,2, Liyuan Guo1,2&, Jing Wang1,2& 1 CAS Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy of Sciences, Beijing 100101, China 2 Department of Psychology, University of Chinese Academy of Sciences, Beijing 10049, China Received: 8 August 2018 / Accepted: 17 January 2019 / Published online: 20 April 2019 Abstract In this study, combined analysis of expression profiling in the hippocampus of 76 patients with Alz- heimer’s disease (AD) and 40 healthy controls was performed. The effects of covariates (including age, gender, postmortem interval, and batch effect) were controlled, and differentially expressed genes (DEGs) were identified using a linear mixed-effects model. To explore the biological processes, func- tional pathway enrichment and protein–protein interaction (PPI) network analyses were performed on the DEGs. The extended genes with PPI to the DEGs were obtained. Finally, the DEGs and the extended genes were ranked using the convergent functional genomics method. Eighty DEGs with q \ 0.1, including 67 downregulated and 13 upregulated genes, were identified. In the pathway enrichment analysis, the 80 DEGs were significantly enriched in one Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, GABAergic synapses, and 22 Gene Ontology terms. These genes were mainly involved in neuron, synaptic signaling and transmission, and vesicle metabolism. These processes are all linked to the pathological features of AD, demonstrating that the GABAergic system, neurons, and synaptic function might be affected in AD.
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024

    Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024

    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
  • Biological Pathways, Candidate Genes, and Molecular Markers Associated with Quality-Of-Life Domains: an Update

    Biological Pathways, Candidate Genes, and Molecular Markers Associated with Quality-Of-Life Domains: an Update

    Qual Life Res (2014) 23:1997–2013 DOI 10.1007/s11136-014-0656-1 REVIEW Biological pathways, candidate genes, and molecular markers associated with quality-of-life domains: an update Mirjam A. G. Sprangers • Melissa S. Y. Thong • Meike Bartels • Andrea Barsevick • Juan Ordon˜ana • Qiuling Shi • Xin Shelley Wang • Pa˚l Klepstad • Eddy A. Wierenga • Jasvinder A. Singh • Jeff A. Sloan Accepted: 19 February 2014 / Published online: 7 March 2014 Ó Springer International Publishing Switzerland 2014 Abstract (depressed mood) and positive (well-being/happiness) Background There is compelling evidence of a genetic emotional functioning, social functioning, and overall foundation of patient-reported quality of life (QOL). Given QOL. the rapid development of substantial scientific advances in Methods We followed a purposeful search algorithm of this area of research, the current paper updates and extends existing literature to capture empirical papers investigating reviews published in 2010. the relationship between biological pathways and molecu- Objectives The objective was to provide an updated lar markers and the identified QOL domains. overview of the biological pathways, candidate genes, and Results Multiple major pathways are involved in each molecular markers involved in fatigue, pain, negative QOL domain. The inflammatory pathway has the strongest evidence as a controlling mechanism underlying fatigue. Inflammation and neurotransmission are key processes On behalf of the GeneQol Consortium. involved in pain perception, and the catechol-O-methyl- transferase (COMT) gene is associated with multiple sorts Electronic supplementary material The online version of this article (doi:10.1007/s11136-014-0656-1) contains supplementary of pain. The neurotransmitter and neuroplasticity theories material, which is available to authorized users.
  • Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral

    Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral

    www.nature.com/scientificreports OPEN Role of PDZ‑binding motif from West Nile virus NS5 protein on viral replication Emilie Giraud1*, Chloé Otero del Val2, Célia Caillet‑Saguy2, Nada Zehrouni2, Cécile Khou5, Joël Caillet4, Yves Jacob3, Nathalie Pardigon5 & Nicolas Wolf2 West Nile virus (WNV) is a Flavivirus, which can cause febrile illness in humans that may progress to encephalitis. Like any other obligate intracellular pathogens, Flaviviruses hijack cellular protein functions as a strategy for sustaining their life cycle. Many cellular proteins display globular domain known as PDZ domain that interacts with PDZ‑Binding Motifs (PBM) identifed in many viral proteins. Thus, cellular PDZ‑containing proteins are common targets during viral infection. The non‑structural protein 5 (NS5) from WNV provides both RNA cap methyltransferase and RNA polymerase activities and is involved in viral replication but its interactions with host proteins remain poorly known. In this study, we demonstrate that the C‑terminal PBM of WNV NS5 recognizes several human PDZ‑ containing proteins using both in vitro and in cellulo high‑throughput methods. Furthermore, we constructed and assayed in cell culture WNV replicons where the PBM within NS5 was mutated. Our results demonstrate that the PBM of WNV NS5 is important in WNV replication. Moreover, we show that knockdown of the PDZ‑containing proteins TJP1, PARD3, ARHGAP21 or SHANK2 results in the decrease of WNV replication in cells. Altogether, our data reveal that interactions between the PBM of NS5 and PDZ‑containing proteins afect West Nile virus replication. Arboviruses include numerous human and animal pathogens that are important global health threats responsible for arboviroses.
  • A Causal Gene Network with Genetic Variations Incorporating Biological Knowledge and Latent Variables

    A Causal Gene Network with Genetic Variations Incorporating Biological Knowledge and Latent Variables

    A CAUSAL GENE NETWORK WITH GENETIC VARIATIONS INCORPORATING BIOLOGICAL KNOWLEDGE AND LATENT VARIABLES By Jee Young Moon A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Statistics) at the UNIVERSITY OF WISCONSIN–MADISON 2013 Date of final oral examination: 12/21/2012 The dissertation is approved by the following members of the Final Oral Committee: Brian S. Yandell. Professor, Statistics, Horticulture Alan D. Attie. Professor, Biochemistry Karl W. Broman. Professor, Biostatistics and Medical Informatics Christina Kendziorski. Associate Professor, Biostatistics and Medical Informatics Sushmita Roy. Assistant Professor, Biostatistics and Medical Informatics, Computer Science, Systems Biology in Wisconsin Institute of Discovery (WID) i To my parents and brother, ii ACKNOWLEDGMENTS I greatly appreciate my adviser, Prof. Brian S. Yandell, who has always encouraged, inspired and supported me. I am grateful to him for introducing me to the exciting research areas of statis- tical genetics and causal gene network analysis. He also allowed me to explore various statistical and biological problems on my own and guided me to see the problems in a bigger picture. Most importantly, he waited patiently as I progressed at my own pace. I would also like to thank Dr. Elias Chaibub Neto and Prof. Xinwei Deng who my adviser arranged for me to work together. These three improved my rigorous writing and thinking a lot when we prepared the second chapter of this dissertation for publication. It was such a nice opportunity for me to join the group of Prof. Alan D. Attie, Dr. Mark P. Keller, Prof. Karl W. Broman and Prof.
  • Genomic Landscape of Paediatric Adrenocortical Tumours

    Genomic Landscape of Paediatric Adrenocortical Tumours

    ARTICLE Received 5 Aug 2014 | Accepted 16 Jan 2015 | Published 6 Mar 2015 DOI: 10.1038/ncomms7302 Genomic landscape of paediatric adrenocortical tumours Emilia M. Pinto1,*, Xiang Chen2,*, John Easton2, David Finkelstein2, Zhifa Liu3, Stanley Pounds3, Carlos Rodriguez-Galindo4, Troy C. Lund5, Elaine R. Mardis6,7,8, Richard K. Wilson6,7,9, Kristy Boggs2, Donald Yergeau2, Jinjun Cheng2, Heather L. Mulder2, Jayanthi Manne2, Jesse Jenkins10, Maria J. Mastellaro11, Bonald C. Figueiredo12, Michael A. Dyer13, Alberto Pappo14, Jinghui Zhang2, James R. Downing10, Raul C. Ribeiro14,* & Gerard P. Zambetti1,* Paediatric adrenocortical carcinoma is a rare malignancy with poor prognosis. Here we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing. Most cases (91%) show loss of heterozygosity (LOH) of chromosome 11p, with uniform selection against the maternal chromosome. IGF2 on chromosome 11p is overexpressed in 100% of the tumours. TP53 mutations and chromosome 17 LOH with selection against wild-type TP53 are observed in 28 ACTs (76%). Chromosomes 11p and 17 undergo copy-neutral LOH early during tumorigenesis, suggesting tumour-driver events. Additional genetic alterations include recurrent somatic mutations in ATRX and CTNNB1 and integration of human herpesvirus-6 in chromosome 11p. A dismal outcome is predicted by concomitant TP53 and ATRX mutations and associated genomic abnormalities, including massive structural variations and frequent background mutations. Collectively, these findings demonstrate the nature, timing and potential prognostic significance of key genetic alterations in paediatric ACT and outline a hypothetical model of paediatric adrenocortical tumorigenesis. 1 Department of Biochemistry, St Jude Children’s Research Hospital, Memphis, Tennessee 38105, USA. 2 Department of Computational Biology and Bioinformatics, St Jude Children’s Research Hospital, Memphis, Tennessee 38105, USA.
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;