DOCSLIB.ORG

Mouse Pclo Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Pclo Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Pclo Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Pclo conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Pclo gene (NCBI Reference Sequence: NM_011995 ; Ensembl: ENSMUSG00000061601 ) is located on Mouse chromosome 5. 25 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 25 (Transcript: ENSMUST00000030691). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Pclo gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-35C9 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. Exon 2 starts from about 1.58% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 5381 bp, and the size of intron 2 for 3'-loxP site insertion: 17085 bp. The size of effective cKO region: ~1983 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 25 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Pclo Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8483bp) | A(30.89% 2620) | C(18.88% 1602) | T(32.15% 2727) | G(18.08% 1534) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr5 + 14517593 14520592 3000 browser details YourSeq 31 769 806 3000 83.4% chr18 - 66210547 66210582 36 browser details YourSeq 31 783 818 3000 85.3% chr2 + 104103348 104103381 34 browser details YourSeq 29 766 806 3000 94.2% chr2 + 31679124 31679167 44 browser details YourSeq 28 770 797 3000 100.0% chr17 - 65579921 65579948 28 browser details YourSeq 23 773 796 3000 100.0% chr1 + 16205376 16205401 26 browser details YourSeq 22 297 321 3000 95.9% chr3 - 11231950 11231976 27 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr5 + 14522576 14525575 3000 browser details YourSeq 294 814 1580 3000 82.8% chr3 - 56173229 56407715 234487 browser details YourSeq 260 774 1409 3000 81.7% chr13 - 101648988 101649617 630 browser details YourSeq 250 760 1682 3000 77.3% chr14 + 40398770 40399695 926 browser details YourSeq 248 760 1596 3000 82.6% chr8 + 61033206 61457488 424283 browser details YourSeq 238 805 1688 3000 80.2% chr4 - 21590862 21591740 879 browser details YourSeq 228 777 1620 3000 82.1% chr5 + 64305526 64306520 995 browser details YourSeq 225 891 1362 3000 76.3% chr19 + 11369691 11370404 714 browser details YourSeq 224 748 1423 3000 81.0% chr4 - 35234418 35235080 663 browser details YourSeq 222 774 1542 3000 79.2% chr4 + 48120989 48121735 747 browser details YourSeq 214 937 1665 3000 81.2% chr13 - 90706689 90707443 755 browser details YourSeq 208 780 1278 3000 76.6% chr11 + 30332028 30332532 505 browser details YourSeq 202 774 1278 3000 81.4% chr13 + 48521324 48521848 525 browser details YourSeq 197 760 1542 3000 84.4% chr16 - 13062561 13063337 777 browser details YourSeq 192 806 1298 3000 78.0% chr19 - 20318863 20319352 490 browser details YourSeq 190 904 1414 3000 82.7% chr7 - 67582214 67582700 487 browser details YourSeq 190 1180 1626 3000 82.3% chr14 + 56971409 56971839 431 browser details YourSeq 190 1055 1546 3000 80.0% chr1 + 94613793 94614299 507 browser details YourSeq 185 799 1278 3000 82.6% chr16 + 12376675 12502113 125439 browser details YourSeq 183 832 1710 3000 78.3% chr16 - 5275846 5276689 844 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Pclo piccolo (presynaptic cytomatrix protein) [ Mus musculus (house mouse) ] Gene ID: 26875, updated on 12-Aug-2019 Gene summary Official Symbol Pclo provided by MGI Official Full Name piccolo (presynaptic cytomatrix protein) provided by MGI Primary source MGI:MGI:1349390 See related Ensembl:ENSMUSG00000061601 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Acz; Pico Expression Biased expression in cerebellum adult (RPKM 10.3), cortex adult (RPKM 8.0) and 5 other tissues See more Orthologs human all Genomic context Location: 5; 5 A1 See Pclo in Genome Data Viewer Exon count: 25 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 5 NC_000071.6 (14514906..14863465) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 5 NC_000071.5 (14514918..14863459) Chromosome 5 - NC_000071.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Pclo ENSMUSG00000061601 Description piccolo (presynaptic cytomatrix protein) [Source:MGI Symbol;Acc:MGI:1349390] Gene Synonyms Acz, Pico Location Chromosome 5: 14,514,918-14,863,459 forward strand. GRCm38:CM000998.2 About this gene This gene has 4 transcripts (splice variants), 294 orthologues, 1 paralogue, is a member of 1 Ensembl protein family and is associated with 9 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Pclo-201 ENSMUST00000030691.16 20084 5068aa ENSMUSP00000030691.9 Protein coding CCDS51415 Q9QYX7 TSL:5 GENCODE basic APPRIS P1 Pclo-202 ENSMUST00000182407.7 16846 4863aa ENSMUSP00000138419.1 Protein coding CCDS59667 Q9QYX7 TSL:5 GENCODE basic Pclo-204 ENSMUST00000182915.1 6738 1592aa ENSMUSP00000138607.1 Protein coding - S4R2E0 CDS 5' incomplete TSL:1 Pclo-203 ENSMUST00000182426.2 17063 No protein - Retained intron - - TSL:2 Page 6 of 8 https://www.alphaknockout.com 368.54 kb Forward strand 14.6Mb 14.7Mb 14.8Mb Genes (Comprehensive set... Pclo-201 >protein coding Pclo-202 >protein coding Gm43665-201 >TEC Pclo-203 >retained intron Gm42446-201 >TEC Gm42445-201 >TEC Gm43663-201 >TEC Gm43662-201 >TEC Gm42447-201 >TEC Pclo-204 >protein coding Gm42448-201 >TEC Gm42444-201 >TEC Contigs < AC125043.4 AC125533.4 > Genes < Gm26918-201lncRNA < Gm26954-202lncRNA (Comprehensive set... < Gm26954-201lncRNA Regulatory Build 14.6Mb 14.7Mb 14.8Mb Reverse strand 368.54 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000030691 348.54 kb Forward strand Pclo-201 >protein coding ENSMUSP00000030... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily Zinc finger, FYVE/PHD-type SSF49562 PDZ superfamily SMART C2 domain PDZ domain Pfam Zinc finger, piccolo-type PDZ domain C2 domain PROSITE profiles PDZ domain C2 domain PANTHER Protein piccolo PTHR14113 Gene3D Zinc finger, RING/FYVE/PHD-type 2.30.42.10 C2 domain superfamily CDD cd15774 cd15776 cd00992 cd04031 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend frameshift variant inframe insertion missense variant splice region variant synonymous variant Scale bar 0 600 1200 1800 2400 3000 3600 4200 5068 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Piccolo, a Presynaptic Zinc Finger Protein Structurally Related to Bassoon
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Neuron, Vol. 25, 203±214, January, 2000, Copyright 2000 by Cell Press Piccolo, a Presynaptic Zinc Finger Protein Structurally Related to Bassoon Steven D. Fenster,*# Wook Joon Chung,*# presynaptic cytoskeletal matrix (PCM) (Landis et al., Rong Zhai,*# Claudia Cases-Langhoff,*# Britta Voss,² 1988; Hirokawa et al., 1989; Gotow et al., 1991) that is Abigail M. Garner,² Udo Kaempf,§ Stefan Kindler,³ thought to play a role in maintaining the neurotransmitter § Eckart D. Gundelfinger, and Craig C. Garner*k release site in register with the postsynaptic reception *Department of Neurobiology apparatus, regulating the mobilization of SVs and the University of Alabama at Birmingham refilling of release sites. Mechanistically, the PCM may Birmingham, Alabama 35294 define sites where SVs fuse and recycle through the ² Center for Molecular Neurobiology clustering of the exo- and endocytotic machinery. ³ Institute for Cellular Biochemistry SV cycling is a multistep process that involves vesicle and Clinical Neurobiology mobilization from a reserve pool, docking at active University of Hamburg zones, and calcium-dependent fusion (SuÈ dhof, 1995; D-20246 Hamburg Hanson et al., 1997). The latter two steps require the § Leibniz Institute for Neurobiology formation of a complex composed of the vesicle SNARE D-39118 Magdeburg VAMP2/Synaptobrevin and two target SNAREs, syn- Federal Republic of Germany taxin and SNAP-25 (SuÈ dhof, 1995; Hanson et al., 1997). In addition, a family of low molecular weight GTPases are likely to be involved in SV cycling with rab3 and rab5 Summary regulating exocytotic and endocytotic events, respec- tively (Ferro-Novick and Novick, 1993; Hess et al., 1993; Piccolo is a novel component of the presynaptic cy- SuÈ dhof, 1995).
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]
  • Identification of Key Genes and Pathways for Alzheimer's Disease
    Biophys Rep 2019, 5(2):98–109 https://doi.org/10.1007/s41048-019-0086-2 Biophysics Reports RESEARCH ARTICLE Identification of key genes and pathways for Alzheimer’s disease via combined analysis of genome-wide expression profiling in the hippocampus Mengsi Wu1,2, Kechi Fang1, Weixiao Wang1,2, Wei Lin1,2, Liyuan Guo1,2&, Jing Wang1,2& 1 CAS Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy of Sciences, Beijing 100101, China 2 Department of Psychology, University of Chinese Academy of Sciences, Beijing 10049, China Received: 8 August 2018 / Accepted: 17 January 2019 / Published online: 20 April 2019 Abstract In this study, combined analysis of expression profiling in the hippocampus of 76 patients with Alz- heimer’s disease (AD) and 40 healthy controls was performed. The effects of covariates (including age, gender, postmortem interval, and batch effect) were controlled, and differentially expressed genes (DEGs) were identified using a linear mixed-effects model. To explore the biological processes, func- tional pathway enrichment and protein–protein interaction (PPI) network analyses were performed on the DEGs. The extended genes with PPI to the DEGs were obtained. Finally, the DEGs and the extended genes were ranked using the convergent functional genomics method. Eighty DEGs with q \ 0.1, including 67 downregulated and 13 upregulated genes, were identified. In the pathway enrichment analysis, the 80 DEGs were significantly enriched in one Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, GABAergic synapses, and 22 Gene Ontology terms. These genes were mainly involved in neuron, synaptic signaling and transmission, and vesicle metabolism. These processes are all linked to the pathological features of AD, demonstrating that the GABAergic system, neurons, and synaptic function might be affected in AD.
    [Show full text]
  • Biological Pathways, Candidate Genes, and Molecular Markers Associated with Quality-Of-Life Domains: an Update
    Qual Life Res (2014) 23:1997–2013 DOI 10.1007/s11136-014-0656-1 REVIEW Biological pathways, candidate genes, and molecular markers associated with quality-of-life domains: an update Mirjam A. G. Sprangers • Melissa S. Y. Thong • Meike Bartels • Andrea Barsevick • Juan Ordon˜ana • Qiuling Shi • Xin Shelley Wang • Pa˚l Klepstad • Eddy A. Wierenga • Jasvinder A. Singh • Jeff A. Sloan Accepted: 19 February 2014 / Published online: 7 March 2014 Ó Springer International Publishing Switzerland 2014 Abstract (depressed mood) and positive (well-being/happiness) Background There is compelling evidence of a genetic emotional functioning, social functioning, and overall foundation of patient-reported quality of life (QOL). Given QOL. the rapid development of substantial scientific advances in Methods We followed a purposeful search algorithm of this area of research, the current paper updates and extends existing literature to capture empirical papers investigating reviews published in 2010. the relationship between biological pathways and molecu- Objectives The objective was to provide an updated lar markers and the identified QOL domains. overview of the biological pathways, candidate genes, and Results Multiple major pathways are involved in each molecular markers involved in fatigue, pain, negative QOL domain. The inflammatory pathway has the strongest evidence as a controlling mechanism underlying fatigue. Inflammation and neurotransmission are key processes On behalf of the GeneQol Consortium. involved in pain perception, and the catechol-O-methyl- transferase (COMT) gene is associated with multiple sorts Electronic supplementary material The online version of this article (doi:10.1007/s11136-014-0656-1) contains supplementary of pain. The neurotransmitter and neuroplasticity theories material, which is available to authorized users.
    [Show full text]
  • Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral
    www.nature.com/scientificreports OPEN Role of PDZ‑binding motif from West Nile virus NS5 protein on viral replication Emilie Giraud1*, Chloé Otero del Val2, Célia Caillet‑Saguy2, Nada Zehrouni2, Cécile Khou5, Joël Caillet4, Yves Jacob3, Nathalie Pardigon5 & Nicolas Wolf2 West Nile virus (WNV) is a Flavivirus, which can cause febrile illness in humans that may progress to encephalitis. Like any other obligate intracellular pathogens, Flaviviruses hijack cellular protein functions as a strategy for sustaining their life cycle. Many cellular proteins display globular domain known as PDZ domain that interacts with PDZ‑Binding Motifs (PBM) identifed in many viral proteins. Thus, cellular PDZ‑containing proteins are common targets during viral infection. The non‑structural protein 5 (NS5) from WNV provides both RNA cap methyltransferase and RNA polymerase activities and is involved in viral replication but its interactions with host proteins remain poorly known. In this study, we demonstrate that the C‑terminal PBM of WNV NS5 recognizes several human PDZ‑ containing proteins using both in vitro and in cellulo high‑throughput methods. Furthermore, we constructed and assayed in cell culture WNV replicons where the PBM within NS5 was mutated. Our results demonstrate that the PBM of WNV NS5 is important in WNV replication. Moreover, we show that knockdown of the PDZ‑containing proteins TJP1, PARD3, ARHGAP21 or SHANK2 results in the decrease of WNV replication in cells. Altogether, our data reveal that interactions between the PBM of NS5 and PDZ‑containing proteins afect West Nile virus replication. Arboviruses include numerous human and animal pathogens that are important global health threats responsible for arboviroses.
    [Show full text]
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
    [Show full text]
  • Patterns of Sequence Conservation in Presynaptic Neural Genes
    University of Pennsylvania ScholarlyCommons Departmental Papers (CIS) Department of Computer & Information Science November 2006 Patterns of Sequence Conservation in Presynaptic Neural Genes Dexter Hadley University of Pennsylvania Tara Murphy University of Pennsylvania Otto Valladares University of Pennsylvania Sridhar Hannenhalli University of Pennsylvania Lyle H. Ungar University of Pennsylvania, [email protected] See next page for additional authors Follow this and additional works at: https://repository.upenn.edu/cis_papers Recommended Citation Dexter Hadley, Tara Murphy, Otto Valladares, Sridhar Hannenhalli, Lyle H. Ungar, Junhyong Kim, and Maja Bucan, "Patterns of Sequence Conservation in Presynaptic Neural Genes", . November 2006. Reprinted from Genome Biology, Volume 7, Issue 11, November 2006, pages R105.1-R105.19. Publisher URL: http://genomebiology.com/2006/7/11/R105 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/cis_papers/282 For more information, please contact [email protected]. Patterns of Sequence Conservation in Presynaptic Neural Genes Abstract Background: The neuronal synapse is a fundamental functional unit in the central nervous system of animals. Because synaptic function is evolutionarily conserved, we reasoned that functional sequences of genes and related genomic elements known to play important roles in neurotransmitter release would also be conserved. Results: Evolutionary rate analysis revealed that presynaptic proteins evolve slowly, although some members of large gene families exhibit accelerated evolutionary rates relative to other family members. Comparative sequence analysis of 46 megabases spanning 150 presynaptic genes identified more than 26,000 elements that are highly conserved in eight vertebrate species, as well as a small subset of sequences (6%) that are shared among unrelated presynaptic genes.
    [Show full text]
  • Role of Bassoon and Piccolo in Assembly and Molecular Organization of the Active Zone
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector REVIEW published: 12 January 2016 doi: 10.3389/fnsyn.2015.00019 Role of Bassoon and Piccolo in Assembly and Molecular Organization of the Active Zone Eckart D. Gundelfinger 1,2,3,4*, Carsten Reissner 5 and Craig C. Garner 6,7* 1 Department Neurochemistry and Molecular Biology, Leibniz Institute for Neurobiology, Magdeburg, Germany, 2 Center for Behavioral Brain Sciences, Magdeburg, Germany, 3 Medical Faculty, Otto von Guericke University, Magdeburg, Germany, 4 German Center for Neurodegenerative Diseases (DZNE) Site Magdeburg, Magdeburg, Germany, 5 Institute of Anatomy and Molecular Neurobiology, Westfälische Wilhelms University, Münster, Germany, 6 German Center for Neurodegenerative Diseases (DZNE) Site Berlin, Berlin, Germany, 7 Charité Medical University, Berlin, Germany Bassoon and Piccolo are two very large scaffolding proteins of the cytomatrix assembled at the active zone (CAZ) where neurotransmitter is released. They share regions of high sequence similarity distributed along their entire length and seem to share both overlapping and distinct functions in organizing the CAZ. Here, we survey our present knowledge on protein-protein interactions and recent progress in understanding of molecular functions of these two giant proteins. These include roles in the assembly of 2 active zones (AZ), the localization of voltage-gated Ca C channels (VGCCs) in the vicinity of release sites, synaptic vesicle (SV) priming and in the case of Piccolo, a role in the dynamic assembly of the actin cytoskeleton. Piccolo and Bassoon are also important for the maintenance of presynaptic structure and function, as well as for the assembly Edited by: of CAZ specializations such as synaptic ribbons.
    [Show full text]
  • Unbalanced Translocations Arise from Diverse Mutational Mechanisms Including Chromothripsis
    Downloaded from genome.cshlp.org on June 15, 2015 - Published by Cold Spring Harbor Laboratory Press Research Unbalanced translocations arise from diverse mutational mechanisms including chromothripsis Brooke Weckselblatt, Karen E. Hermetz, and M. Katharine Rudd Department of Human Genetics, Emory University School of Medicine, Atlanta, Georgia 30322, USA Unbalanced translocations are a relatively common type of copy number variation and a major contributor to neurodeve- lopmental disorders. We analyzed the breakpoints of 57 unique unbalanced translocations to investigate the mechanisms of how they form. Fifty-one are simple unbalanced translocations between two different chromosome ends, and six rearrange- ments have more than three breakpoints involving two to five chromosomes. Sequencing 37 breakpoint junctions revealed that simple translocations have between 0 and 4 base pairs (bp) of microhomology (n = 26), short inserted sequences (n = 8), or paralogous repeats (n = 3) at the junctions, indicating that translocations do not arise primarily from nonallelic homol- ogous recombination but instead form most often via nonhomologous end joining or microhomology-mediated break-in- duced replication. Three simple translocations fuse genes that are predicted to produce in-frame transcripts of SIRPG-WWOX, SMOC2-PROX1, and PIEZO2-MTA1, which may lead to gain of function. Three complex translocations have inversions, inser- tions, and multiple breakpoint junctions between only two chromosomes. Whole-genome sequencing and fluorescence in situ hybridization analysis of two de novo translocations revealed at least 18 and 33 breakpoints involving five different chro- mosomes. Breakpoint sequencing of one maternally inherited translocation involving four chromosomes uncovered mul- tiple breakpoints with inversions and insertions. All of these breakpoint junctions had 0–4 bp of microhomology consistent with chromothripsis, and both de novo events occurred on paternal alleles.
    [Show full text]
  • Whole-Genome Mutational Landscape of Liver Cancers Displaying Biliary Phenotype Reveals Hepatitis Impact and Molecular Diversity
    ARTICLE Received 30 May 2014 | Accepted 17 Dec 2015 | Published 30 Jan 2015 DOI: 10.1038/ncomms7120 Whole-genome mutational landscape of liver cancers displaying biliary phenotype reveals hepatitis impact and molecular diversity Akihiro Fujimoto1,2,*, Mayuko Furuta1,*, Yuichi Shiraishi3, Kunihito Gotoh4, Yoshiiku Kawakami5, Koji Arihiro6, Toru Nakamura7, Masaki Ueno8, Shun-ichi Ariizumi9, Ha Hai Nguyen1,10, Daichi Shigemizu2, Tetsuo Abe2, Keith A. Boroevich2, Kaoru Nakano1, Aya Sasaki1, Rina Kitada1, Kazihiro Maejima1, Yujiro Yamamoto1, Hiroko Tanaka11, Tetsuo Shibuya11, Tatsuhiro Shibata12, Hidenori Ojima13, Kazuaki Shimada14, Shinya Hayami8, Yoshinobu Shigekawa8, Hiroshi Aikata5, Hideki Ohdan15, Shigeru Marubashi4, Terumasa Yamada4, Michiaki Kubo16, Satoshi Hirano7, Osamu Ishikawa4, Masakazu Yamamoto9, Hiroki Yamaue8, Kazuaki Chayama5,17, Satoru Miyano3,11, Tatsuhiko Tsunoda2 & Hidewaki Nakagawa1 Intrahepatic cholangiocarcinoma and combined hepatocellular cholangiocarcinoma show varying degrees of biliary epithelial differentiation, which can be defined as liver cancer displaying biliary phenotype (LCB). LCB is second in the incidence for liver cancers with and without chronic hepatitis background and more aggressive than hepatocellular carcinoma (HCC). To gain insight into its molecular alterations, we performed whole-genome sequen- cing analysis on 30 LCBs. Here we show, the genome-wide substitution patterns of LCBs developed in chronic hepatitis livers overlapped with those of 60 HCCs, whereas those of hepatitis-negative LCBs diverged. The subsequent validation study on 68 LCBs identified recurrent mutations in TERT promoter, chromatin regulators (BAP1, PBRM1 and ARID2), a synapse organization gene (PCLO), IDH genes and KRAS. The frequencies of KRAS and IDHs mutations, which are associated with poor disease-free survival, were significantly higher in hepatitis-negative LCBs. This study reveals the strong impact of chronic hepatitis on the mutational landscape in liver cancer and the genetic diversity among LCBs.
    [Show full text]
  • Mutant Screen for Reproduction Unveils Depression-Associated Piccolo's Control Over Reproductive Behavior
    bioRxiv preprint doi: https://doi.org/10.1101/405985; this version posted March 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Mutant screen for reproduction unveils depression-associated Piccolo's control over reproductive behavior Gerardo A. Medrano1&, Manvendra Singh11,12,&, Erik J. Plautz6, Levi B. Good6, Karen M. Chapman1, Jaideep Chaudhary1, Priscilla Jaichander1, Heather M. Powell1, Ashutosh Pudasaini2, John M. Shelton3, James A. Richardson4,5, Xian-Jin Xie7, Zoltán Ivics9, Christine Braun10, Frauke Ackermann10, Craig C. Garner10, Zsuzsanna Izsvák11,* and F. Kent Hamra1, 2, 8,* Department of 1Pharmacology, 2Obstetrics & Gynecology, Internal Medicine - Division of 3Cardiology, 4Pathology, 5Molecular Biology, 6Neurology and Neurotherapeutics, 7Simmons Comprehensive Cancer Center, 8Cecil H & Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center in Dallas, USA; 9Paul-Ehrlich-Institute, Division of Medical Biotechnology, Langen, Germany, German Center for Neurodegenerative Diseases (DZNE), 10Charité Medical University, Charitéplatz, Berlin, Germany, 11Max Delbrück Center for Molecular Medicine in the Helmholtz Society, Berlin, Germany, 12Department of Molecular Biology & Genetics, 526 Campus Road, Cornell University, Ithaca, NY 14853 & Equal contributions *Correspondence: F. Kent Hamra [email protected] (Sperm stem cell lines/Rat models) and Zsuzsanna Izsvák www.mdc-berlin.de/izsvak (Transposon Mutagenesis) 1 bioRxiv preprint doi: https://doi.org/10.1101/405985; this version posted March 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]