De Novo Developed Microsatellite Markers in Gill Parasites

Posted on Authorea 21 Jul 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162683878.89695015/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. tde.Hwvr huhte aefudapiaini eerhit aiu lthlit aa they taxa, platyhelminth various into research population-genetic in modern application for found standard have gold they the though considered However, are markers studies. microsatellite using Approaches Abstract [email protected] e-mail: author’s *corresponding Slovakia Bratislava, 15 842 Ilkoviˇcova 6, 2 Republic Czech 1 Benovics monogeneans Michal for markers parasite Microsatellite generalist the title: in Running structure population of vistulae pattern phylogeographic Dactylogyrus the revealing generalist nea): for even flow, novo gene to De barrier the a of represent regions in may observed hosts was these population that associated parasite is indicating the subsequent vistulae of species, species. D. the partition parasite host of addition, two of In structure of results population hosts. occurrence the the cyprinoid however, sympatric The that their clusters; north. of suggesting Exceptionally diversification the major might subpopulations, into the locus. various three region expanded with per of into this parasites alleles existence of Dactylogyrus specimens that 6.958 the where investigated each suggesting of revealed from all Balkans, at number analyses Europe, southern divided genotyped mean in a the were analysis genus with in clustering the specimens 16, of individuals initial 159 to diversification vistulae of of 2 D. total center from among the investigate A ranged represent observed 13 locus to was peninsulas. from per used diversity Balkan collected alleles was genetic were and of markers specimens high number Apennine microsatellite parasite the the analyzed 24 and in The loci of sites vistulae. the set 11 D. in newly-developed from species underutilized a monogenean species substantially study, However, generalist cyprinoid remained present the they of studies. the taxa, diversity In population-genetic platyhelminth genetic various the modern monogeneans. into for of research standard study in gold application the the found have considered they are though markers microsatellite using Approaches Abstract 2021 21, July 1 Benovics Michal parasite generalist the vistulae in Dactylogyrus structure population phylogeographic of the the pattern of revealing parasites (Monogenea): gill Dactylogyrus in genus markers microsatellite developed novo De eateto olg,Fclyo cecs oeisUiest nBailv,Mlynská dolina, Bratislava, in University Comenius Sciences, of Brno, Faculty Kotláˇrská Zoology, 37, University, of 611 Masaryk Department 2, Science, of Faculty Zoology, and Botany of Department aay University Masaryk eeoe irstliemresi ilprstso h genus the of parasites gill in markers microsatellite developed 1,2 1 ek Gettová Lenka , ,LnaGettová Lenka *, 1 n nraSimková Andrea and , 1 Andrea , 1 Simková ˇ 1 1 Dactylogyrus (Monoge- Posted on Authorea 21 Jul 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162683878.89695015/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. oevr eoise l 21)soe togcreainbtentegntcdsacsadgeographical and distances species. genetic host the same between the correlation strong of a of populations showed distant distances (2018) geographically al. host with et different Benovics associated Central with Moreover, (representing associated populations Republic populations parasite Czech parasite the or i.e. in species variants populations, genetic different two representing and samples) Balkans European the in variants genetic 13 found of Leucisci- which diversity and between molecular Cyprinidae 2021), the families 2018; Desdevises, Benovics, the al., by to et (suggested Benovics belonging of 2001; genera range (Moravec, i.e., host dae genera the of lineages, cyprinoid related majority divergent phylogenetically phylogenetically the from to hosts comparison the In only 2019). Abdul-Ameer, & Southwest al- (1992), was Valtonen and species and Dlapka This Koskivaara 2018). ta, countries; al., Nordic et (e.g., (Benovics Seifertová, regions Europe Vyskoˇcilová,Europe; European Central other and and Balkans from the Morand reported in so genera different six of to species belonging cyprinoid hosts i.e. vistulae species Dactylogyrus host distant phylogenetically related through parasitizing ( closely species, families generalists parasitizing host single specialists true phylogenetic a to and parasitize which hosts, hosts specialists congeneric strict parasitizing from specialists range intermediate They specificity. of levels different 2020a; one al., least et at Vukić, Pugachev, Desdevises, for Vukić, Benovics, 1999; & host 2017; Simková, Rahmouni Hoffman, a Benovics, (e.g., as Europe serves of and potentially America, species 2009; Khotenowsky, North cyprinoid & Asia, Ergens Africa, Gussev, in Gerasev, documented was cyprinoids (classification to Cyprinoidei belonging suborder of Schönhuth, species Vukić, and tion the of (2018), of majority Armbruster fish The and freshwater Tan than (2018)). underestimated – of more strongly studies hosts is includes recent number common genus the this However, their this following of parasites. (1996), diversity gill Gerasev are the and majority considering the Timofeeva which Gibson, of by species, nominal compiled 900 checklist the to cording genus monogenean The parasites Host-specific dispersion, Introduction Historical Cyprinoidei, markers, Polymorphic barrier genetics, a in Population represent observed may was hosts population these species. that parasite parasite indicating Keywords the generalist species, of for host even partition two flow, of addition, gene existence occurrence to In of the sympatric per revealed structure the hosts. alleles of analyses population cyprinoid subsequent regions 6.958 the the their of that of of number results suggesting diversification the mean the subpopulations, however, of from a various clusters; Europe, each with of in major genus at 16, three the genotyped of into to diversification were specimens among of 2 center specimens observed from the represent was 159 ranged might where diversity region of locus this genetic total that per suggesting high A Balkans, alleles Exceptionally monogenean of peninsulas. generalist number locus. Balkan the the of and and diversity Apennine genetic loci the the newly-developed investigate in a to study, sites present used the was In markers species microsatellite monogeneans. of 24 study of the set in underutilized substantially remained ˇ Dactylogyrus Dactylogyrus .vistulae D. Dactylogyrus ikva ena,Gla oad 06 uhae l,2020). al., et Kuchta 2006; Morand, & Gelnar Simková, Verneau, ˇ .vistulae D. Rehulková, Benovics, ˇ ikva 01 n h ideEs eg,Adgu lue idrma,20;Mhaisen 2001; Yildirimhan, & Altunel Aydogdu, (e.g., East Middle the and Simková, 2021) aaiiedvreths iegs(e.g., lineages host divergent parasitize ˇ h nlzdprst pcmn eecletdfo 3cpiodseisfo 11 from species cyprinoid 13 from collected were specimens parasite analyzed The . aaie xaddit h ot.Teiiilcutrn nlssdvddalinvestigated all divided analysis clustering initial The north. the into expanded parasites ocr ihtedsrbto ftercpiodfihhss sterocrec nnative in occurrence their as hosts, fish cyprinoid their of distribution the with concurs rs,16 stems tiigeapeo generalist of example striking most the is 1967 Prost, Dactylogyrus ouain,sgetn htgorpia eaainpae oeciia oein role critical more a played separation geographical that suggesting populations, .vistulae D. ikva 00.I epc oterhosts, their to respect In Simková, 2020). ˇ ad,Vukić and Sanda, ´ nteBlasuigpril1S T1 n ata 8 DA They rDNA. 28S partial and ITS1, 18S, partial using Balkans the in isn,15 stems pcoetxnaogPayemnhs Ac- Platyhelminthes. among taxon speciose most the is 1850 Diesing, ikva(08,Aenn eisl;Bnvc,Francová, Benovics, Vol- Peninsula; Apennine Simková (2008), ˇ Dactylogyrus Rehulková, Seifertová, Pˇrikrylová Each Francová, 2018). & ˇ 2 ikva(00) eoise l 21)investigated (2018) al. et Benovics Simková (2020b). ˇ ikva oad oe,Gla ena,2004; Verneau, & Gelnar Jobet, Simková, Morand, ˇ Dactylogyrus r ilprsts h igorpia distribu- biogeographical The parasites. gill are Dactylogyrus .vistulae D. .vistulae D. .vistulae D. pce,wihgnrlyparasitize generally which species, .vistulae D. ad & Sanda ˇ Dactylogyrus Dactylogyrus pce,addffrn lineages different and species, rsmbyotnhost-switch often presumably niiul ntesouthern the in individuals ad,Yn n Mayden and Yang Sanda, ˇ nopse ait of variety a encompasses Simková, Benovics 2018; ˇ sascae ihthe with associated is vdne rm24 from evidenced , aaie exhibit parasites Posted on Authorea 21 Jul 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.162683878.89695015/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. sn ihrmrhmtis(.. aiilo ri,DAei erra 04 inn&Ssl 2010; Sasal, Pettersen, González, Teresa 2019; Sepúlveda & & Baeza, Antonio Vignon Junge, 2017; Volckaert; and 2016; 2004; & Larmuseau intra- Lim, Petrarca, & Oeyen, Vanhove Huyse, & the Steenberge, & Van Tan on Rahmouni, D’Amelio Soo, 2016; pattern Mendelian Ortis, al., Kmentová Khang, mating et and Mariniello, 2015; conducted or codominance, often (e.g., Balbuena, hybridization, Rodr´ıguez-González, are variance, tandem & morphometrics monogeneans rate, M´ıguel-Lozano, allelic Llopis-Belenguer short in either flow variability high polymorphic using interpopulation gene investigating (e.g., highly infer Studies characteristics levels. These to interpopulation unique studies. applied their population-genetic usually to have most inheritance), DNA) due for mitochondrial are, with standard (together repeats markers gold microsatellite the using approaches become decades, (Pugachev few features last important the Over taxonomically of simplicity and size monogeneans. promote the dactylogyrid which and 2009), size, al., body et large relatively range, its distribution to and range host wide of divergence the n al 21) hrfr,teamo hssuyws()t einasto irstliepiesfrthe for primers microsatellite of set a Harris design Oosterhout, to (1) Lazarus, was Faria, primers study by species designing this monogenean this study of generalist one conducted, aim distributed only the been widely date, Therefore, has to (2011). Microsatellite gyrodactylids and, Cable hosts. in group, and the platyhelminth of repeats between this populations contacts polymorphic (or in secondary for species underutilized indicate cyprinoid still alternatively, different are or, between markers species) isolation study, cyprinoid geographical our the same reveal in the either – parasites may of hosts – structure their Europe population the with Studying in dactylogyrids. association structure on population in studies revealing for for identified useful been markers have genetic monogeneans no now, until However, 2020a;b). Kmentová al., et nerpe,ad(i eetdsqecswr o ffihoii ae nBATrslsi h GenBank the in results BLAST on based origin fish of than not temperatures more annealing were of the 57 sequences stretch (iv) between selected mononucleotide repetitions, product fall two a PCR (vi) 100 to contain the than and optimized more not of interrupted, were of did length motifs pairs regions the pair primer following base flanking (ii) of the di-hexa (iii) repetitions, any to bp, seven or according bases, 300 least microsatellites four and target at (Meglécz with 100 had QDD sequences between microsatellites The 104 was target CZ). select the Brno, to University, Miseq (i) used Kit (Masaryk using was conditions: Preparation CEITEC (Illumina) program by platform LTP 2010) Blood provided Miseq KAPA al., Illumina were DNEasy et using an (Illumina) using preparation on v2 isolated sequencing library Kit was and Subsequently, Reagent SA) DNA City, DE). Genomic Century Hilden, Biosystems, analyses. (Qiagen, (Kapa further Kit the from Tissue on omitted data & were history, Republic geographic containing intertwined Czech sample an the with pooled regions the European from southern performed was from repeats sequencing collected tandem polymorphic genomic of whole identification The and NGS included for All study. samples this of in Preparation included were Peninsula Apennine of fewer the which species in two at site sites one However, and vistulae Balkans Peninsulas. D, the Apennine in and sites Balkan 11 the from across of sites 5 range 29 than distribution at the hosts within cyprinoid regions from distant geographically cover To investigate Material to order species. in Methods this variability and of genetic Material populations interpopulation the revealing of to structure respect geographical the with functionality their test Ø .vistulae D. ty,M V & Mo stbye, niiul eecletdfo 3hs pce i pce of species six – species host 13 from collected were individuals Phoxinellus, qaiscephalus Squalius .vistulae D. niiul eecletdwr icre rmtefia aae;teeoe individuals therefore, dataset; final the from discarded were collected were individuals ø lsa,22) rtecmiaino ohmtos(.. us ocar,2002; Volckaert, & Huyse (e.g., methods both of combination the or 2021), llestad, and ouain hnterhss hlgntcrltosis eie t remarkably its Besides relationships. phylogenetic hosts’ their than populations .vistulae D. hnrsoaphoxinus Chondrostoma rmteDj ie CehRpbi) u otefcso h ae on paper the of focus the to Due Republic). (Czech River Dyje the from .vistulae D. steotmlcniaeseisfrpplto-eei tde in studies population-genetic for species candidate optimal the as atlgrsvistulae Dactylogyrus .vistulae D. ° n 63 and C sas aiydsigihbefo te ognr due congeners other from distinguishable easily also is 3 Tbe1). (Table ° sn etgnrto eunig n 2 to (2) and sequencing, generation next using ,()mcoaeltswr o opudor compound not were microsatellites (v) C, ikva 00,mtcodilmres(e.g., markers mitochondrial Simková, 2020), ˇ soitdwt yrnismil in mainly cyprinoids with associated .vistulae, D. Squalius, .vistulae D. orseisof species four aaie eecollected were parasites .vistulae D. ouainfrom population individuals Telestes , Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ihama ubro .5 lee e ou.I epc oseicgorpi ie rpeetn different (representing sites in geographic recorded specific was to polymorphism respect genetic In of Greek locus. level north-western per highest alleles the 6.958 species), of host number mean a with di- Shannon’s (Ne), alleles effective GenBank. of the number in the (H deposited vagina). (NA), observed sequences and alleles rDNA the the of organ 28S to index, and number copulatory comparison versity rDNA the subsequent 18S male markers, coding and of microsatellite genes (2018)), partial For parts al. the sclerotized et of amplification Benovics and by (following evaluated bar, were identities connective species hooks, Their marginal anchors, of 159 total, 52 In of 10 temperature multiplex of annealing volume five an analyses total and (Applied the Genetic cycles a into 4.0 35 in pooled with version out were DE) carried Software Hilden, microsatellites were GeneMapper (Qiagen, reactions polymorphic ABI using PCR an 24 sets. on scored Finally, (Applied PCR analyzed Standard CA). were Size and above, City, FAM) LIZ Genotypes Foster described or 500 CA). Biosystems, using VIC as CA) City, NED, City, conditions Foster PET, Foster further PCR Biosystems, (i.e. were Biosystems, (Applied dye same host, Analyzer fluorescent fish the Genetic by the 3130 produced under labeled of PRISM that primer DNA tested forward by Microsatellites were represented the electrophoresis. microsatellites sample with gel control remaining agarose the The for 2% bands excluded. by positive visualized or were bands, unreliable products PCR The 94 at min). volume denaturation initial final follows: 94 a as at were in reaction 0.2 PCR performed the and of reactions MA), conditions Waltham, PCR (Invitrogen, in polymerase separately DNA tested first 10 were of primers loci microsatellite microsatellite Selected of selection and sequencing, amplification, PCR database. et,2 eedtce ob oyopi n eecoe o ute ouainaaye.Tegenetic (TN The locus per analyses. alleles population of number further total for alleles, sequencing of chosen (N and range H population were amplification including per and PCR site, alleles collection of of polymorphic per number results be locus the each to to of detected according diversity were selected were 24 which tests, loci, candidate all From loci microsatellite in diversity Allelic Harvester CLUMPAK Structure using the visualized using 2015). were Results Mayrose, graphs selected plot was & and Rosenberg likelihood) 10 2012) Jakobsson, highest vonHoldt, with Mayzel, & the runs Earl (Kopelman, with independent 2005; (i.e., Gould, ten K & of Regnaud optimal (Evanno, series most A The host 15. K. single to a tested basis sites). within increased the (MC collection even was on 12 Carlo or estimated, K of expected hosts, Monte was total of sympatric The range (a number between K site 2.3.4. occurs the Basically collection fragmentation v population, 15. individual further to an whether Structure 1 with test in of associated to However, was range analysis the population expected clustering within parasite with each tested the multivariate model that was and for admixture (K) 2007) An clusters applied Pritchard, of 6.5. was number & v frequencies GenAlEx Stephens Falush, in allele implemented 2000; uncorrelated in (PCoA) Donnelly, In structure Analysis & 2012). population Coordinate Stephens 2006; of Principal (Pritchard, Smouse, identification 2.3.4 & the (Peakall v for 6.5 ture suitable v are GenAlEx markers program microsatellite vistulae whether the test using to computed order were differences) eigen of F homozygotes), of E r rsne nTbe3 h ubro lee e ou agdfo lcs7)t 6(ou 73) (locus 16 to 75) (locus 2 from ranged locus per alleles of number The 3. Table in presented are ) ° μ 6 ) neln t51-63 at annealing s), (60 C ,cmrsn 0.5 comprising l, ooeen,tomtoswr sd aeincutrn nlss hc a odce nStruc- in conducted was which analysis, clustering Bayesian used: were methods two monogeneans, .vistulae D. 2 trtos h nta 10 initial the iterations, ) ST qaisprespensis Squalius ie,gntcvrac nall rqece) n h e-itne ie,tenumber the (i.e., Nei-distances the and frequencies), allele in variance genetic (i.e., niiul eeietfidiiilyuigmrhlgclcaatr saeadsizes and (shape characters morphological using initially identified were individuals μ ftmlt N,02m NP 1 dNTP, mM 0.2 DNA, template of l O n xetd(H expected and ) ° 3 ) netnina 72 at extension an s), (30 C A ,adosre n xetdall eeoyoiyprpplto (H population per heterozygosity allele expected and observed and ), st 1.Idvdasfo hsst xiie h ihs mean highest the exhibited site this from Individuals G1). (site 6 trtosdsadda uni,wr odce o each for conducted were burn-in, a as discarded iterations E eeoyoiy h xto ne ie ,proportion F, (i.e. index fixation the heterozygosity, ) 4 μ fec ftefradadrvrepies The primers. reverse and forward the of each of M ° 2mn,adafia xeso t72 at extension final a and min), (2 C × C ue,20m MgCl mM 2.0 buffer, PCR μ sn h ignMlilxPRKit PCR Multiplex Qiagen the using l ° 2mn,3 ylso denaturation of cycles 35 min), (2 C .vistulae D. ° Tbe2). (Table C niiul parasitizing individuals 7 Markov-chain 2 . Taq U 0.5 , ° (10 C A D. O ), , Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. iest a bevdi niiul rmtetormiigsts(w aaieppltos;Ao in Aoos populations); parasite (two sites remaining two the generalist from the individuals of in populations observed of was diversity where the diversity molecular peri-Mediterranean, study the north-eastern to investigate the known to markers markers species). molecular microsatellite host parasite of 24 no range used were wide We a generalist there of (including study, study range interpopulation present this distributional the we wide in to paper, a applied this Prior we in which Therefore, dactylogyrids, monogeneans. for (2018). gill of genetics al. population et Benovics by of of K suitability The separation estimated higher partial with the analysis analysis supported PCoA clustering the 3 Bayesian Discussion Subsequent Moreover, by and suggested 2 x-axis. 4a). was segments the as Figure in 4b). on C3, C1-C3, (Figure cluster and G2, I1 with latter B4 G1, site together the from C5, from B1-B4 subpopulations from C4, subpopulations sites individuals populations the from only of separated individuals including separation visibly of the grouping also (i.e. the analysis analysis and clustering I, Bayesian and (H by also (H subpopulations revealed I1a I1b I1 structure population population of the in to separation heterozygosity comparison The observed in the species. lower host whereas = respective drift, (K the genetic Croatia with flow indicates and associated gene Herzegovina, ( each document and K – clearly Bosnia estimated subpopulations analyses parasitizing in higher clustering sites the population both At collection Apennine from seven 8). results representing the the populations separated however, these C1-C3; later between and and B1-B4 sites G2), the from increasing and Gradually (G1 clusters. site muticellus three collection Greek all separated respective parasitizing with first individuals the associated K ambiguously and estimated cluster genetically C5), of third were and number the (I1a) lower Finally, (C4 Italy initial G2. Croatia in The and central site 3. G1 in sites Figure muticellus sites Greek in (C1- from T. from 8 Croatia individuals collected = southern all and K individuals encompassed (B1-B4), and encompassed Herzegovina cluster 5, and second = Bosnia The in K particular C3). sites 3, a from = to collected K belonging individuals investigated for individual encompassed all each shown divided of are K genome Structure estimated estimated the the the of = from However, proportion K resulting 2A). the at cluster visualizing peaked (Figure plots analyses clusters Bar clustering population Bayesian populations. by 8 tested encompassing K dataset all Δ structured from a runs ten revealing of 8, likelihood estimated the mean for The revealed was pattern similar A structure C3. Population and and C2 C4 C1, the B2, of B1, each population. populations: Nei- and following C5 G1. population the G2 in and the 96 C4 The between locus found population sites. F was were Pairwise distances site collection greatest populations. collection 12 the single C5 and the a 1.731 of from to interpopulation 0.022 individuals five only from all at and across F present populations amplify and all were not distances did almost individuals which In in Homozygotic 4. locus monomorphic Table observed. only mean were in homozygotic were indicating reported of loci are lengths proportion statistics of sites high allele descriptive majority a collection encompassed the The the and to 2.662). i.e. variability respect genetic individuals, = in low exhibited loci (Ne population all alleles each for general, effective parameters population of basic number for mean values highest (H the loci and all across heterozygosity ekda Fgr B,sgetn htmjrgntcsrcuaini bevdfr3estimated 3 for observed is structuration genetic major that suggesting 2B), (Figure 3 = K at peaked K .vistulae D. K=5) = (K nIay(emda 1) The I1b). as (termed Italy in ST .vistulae D. eecmue o ahpplto aradaerpre nTbe5 e-itne ranged Nei-distances 5. Table in reported are and pair population each for computed were . efudlwall ainei l tde akr ttnoto h 2stsin sites 12 the of out ten at markers studied all in variance allele low found We . nadto,teeitneo he uppltoswssgetdamong suggested was subpopulations three of existence the addition, In ST o ouaingntcsuiso ooeenprstswspeiul suggested previously was parasites monogenean of studies population-genetic for agdfo .0 o099adtegets itne eeosre between observed were distances greatest the and 0.959 to 0.103 from ranged < O ) lseigaayi iie h niiul rmIayit w separate two into Italy from individuals the divided analysis clustering 7), .5) h ihs ubro lee e niiul(a=3.917), = (Na individual per alleles of number highest the 0.453), = .vistulae D. O .9,Tbe4.Terslso CAwr ogun with congruent were PCoA of results The 4). Table 0.192, = .vistulae D. .vistulae D. .vistulae D. niiul notremjrcutr K=3.Tefis one first The 3). = (K clusters major three into individuals 5 niiul notocutr,ec soitdwith associated each clusters, two into individuals niiul parasitizing individuals a olce rm1 otseis ihallelic High species. host 13 from collected was Dactylogyrus enovo de O .squalus S. .0)i significantly is 0.004) = irstliemarkers microsatellite pce exhibiting species rmtesame the from .vistulae D. T. Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. aknppltos(Nei-distances populations Balkan F 2014). and al., of Nei-distances the et species pairwise in Geiger endemic in polymorphism to 2010; genetic polymorphism low host-switched al., genetic the later et of parasite Perea level this high 2010; where A al., Peninsula. et Apennine (Buj that to also Sea Balkans would Adriatic the connection the from a of time, Such sides this 2004). both During Calamari, on & (e.g., systems living Zaccara fauna river Po cyprinoid species Balkan Crosa, the that and of Galli, fact Italian expansion Stefani, the isolated the explain currently 2002; 2002), the al., al., of et et fauna Waelbroeck (Waelbroeck freshwater 1990; of between Bianco, origin contact 1979; putative facilitated (Pielou, the basin regressed be drastically might level polymorphism sea genetic in difference observed vistulae the for explanation possible between of variability parasitizing syntopy population individuals genetic the divergent by of genetically explained a comparison be harbors can species Italy species, host in cyprinoid two polymorphism of from of level collected hosts high co-occurring the of two hypothesis. populations, of analyses a Greek such population to validate contrast particular, to In required in is including, Dessaretes. species, former communities, the parasite communities of parasite distributed parasite region widely the share of in may investigation cyprinoids species endemic thorough this therefore, other that However, of and, communities assume parasite species can to we host related therefore, diversified genetically 2007); between Freyhof, & populations present, (Kottelat parasite At basin species diversity. of Albrecht rich genetic by mixing suggested increased recent gradually the (as gradually to facilitated level drainages neighboring (2008)) leading water and al. and lakes the et closing divided fauna R already the Dessaretes, fish between & after connections and (Steininger freshwater hydrological Later, Lakes Paratethys the Great in 2011). between the in Wilke, Wilke, speciation connections diversity & & allopatric and Bossneck Wagner Albrecht, promoting depression 2009; Schultheiss, decreased, Fouache, 2008, Korca Wildon, Wilke, & of (Suˇsnik, the Snoj, & Brewer border II) Albrecht Lezine, of the War 2008; Lake World on Peyron, al., covered Prespa of during (located Bordon, et Mikri and evaporated Lake speciation Abell 2008; Macedonia), Pliocene (Albania, Ohrid 2007; North the Weiss, Lake i.e., the and & in Maliq Peninsula; in Greece, Mrdak Balkan and role (Albania, originated the Greece), Lake essential of and bodies Prespa Lakes an (Albania water Macedonia), Great the played North of present of and and the connection formation Albania all region large historical of This this the area Balkans. potentially in is the that the Greece occurred factor of north-western in other which isolation in cyprinoids The system, subsequent populations peninsula. and lake Peloponnese parasite diversification the of Dessaretes in ancestral formation species) more the host the impacted their reflect (or simply populations might parasite it Peloponnesian populations, of of diversity Balkan molecular heterozygosity the observed south explain from the to occurred of though applied Peninsula diversity Balkan be the molecular might into argument the bridge dispersion similar continental R subsequent therefore, case, the & and, a via (Steininger north, such cyprinoids landmass In to 2010). for Anatolian al., and proposed this et Balkan hosts, route Perea phylogeographic the their 1990; dispersion the of connecting ancestral historical that phylogeography and the more the Assuming Paratethys by with relatively dividing populations. linked supported a Balkan intimately also are other suggest is parasites of may claim of case dispersion population the historical in Greek and than the origin population in this diversity for genetic origin Italy. in high drainage) exceptionally (Tiber The Stream Cerfone the and Greece, north-west .squalus S. fteAenn eisl.I a enhpteie htdrn h atGailMxmm hnthe when Maximum, Glacial Last the during that hypothesized been has It Peninsula. Apennine the of evda anhs pce o h iprino hsprst nteAenn Peninsula, Apennine the in parasite this of dispersion the for species host main a as served .squalus S. .muticellus T. .vistulae D. ST o t netr ipre oehrwt te yrnisadterparasites their and cyprinoids other with together dispersed ancestor) its (or h ouainfrom population The . < .vistulae D. eetdahg ee fplmrhs nyi h omrpplto.A population. former the in only polymorphism of level high a detected .squalus S. .0,F 0.509, ntergo.I h orneCerfone, Torrente the In region. the in .squalus S. .vistulae D. g,18;Abeh ik,20) oee,ps underground past However, 2008). Wilke, & Albrecht 1984; ¨ ogl, ST ouainhroe by harbored population and < .prespensis S. .vistulae D. .8)ta otepplto from population the to than 0.388) .muticellus T. 6 hw oo eyltl oeua iegnebetween divergence molecular little very or no shows ) .vistulae D. .squalus S. niiul parasitizing individuals .vistulae D. Telestes. smc oe u otefudrseet A effect. founder’s the to due lower much is sa nei pce flkso h Prespa the of lakes of species endemic an is ouain shge hnta fcentral of that than higher is populations sgntclymr iia otecentral the to similar more genetically is lseigaaye eeldta each that revealed analyses Clustering . hshptei sas upre by supported also is hypothesis This Fgr ) oee,tesubsequent the However, 3). (Figure .vistulae D. .muticellus T. .vistulae D. .squalus S. ntePlpnee Even Peloponnese. the in .vistulae D. n ytecalculated the by and .muticellus T. g,18;Doadrio, 1984; ¨ ogl, niiul were individuals and a suggest may .vistulae D. (Nei- D. Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. o h criyo ulse irstliesuiso ooeen adpplto akr ngeneral) in markers population (and monogeneans reason on main The studies 2012). microsatellite of Cable, & published amplification Oosterhout the of utilizing Johnson, Faria, for scarcity studies (Schelkle, set genetic the genus primer population this for in no the reproduction study, for though of our Even designed modes to monogeneans. was prior on loci However, performed microsatellite 2006). been al., had et population microsatellites (Criscione molecular in hosts distribution wide as usefulness their a their with microsatellites, of parasites demonstrated of that also routes have migratory shown ( historical They range have and mtDNA. structure studies and 2020) genetic population Goater, rDNA above the & than revealing The Gilleard discriminative Paridon, more published. van are Criscione, been 2017; markers, Criscione, Gilleard, far Valdivia, & 2011; so Goater Colwell, Blouin, have Vásquez Paridon, Juhásová 2006; & 2016; van 2015; Blouin, al., 2016; Paniagua Dreyfuss, on al., et & Vilas, & et focusing Cooper Rondeland Criscione, Criscione, Vignoles, papers 2010; Dar, 2006; Jokela, few 2014; Blouin, Cárdenas, & Oliva, a Durán & 2003; & Rellstab only Criscione Wang, Karvonen, (i.e., as & Louhi, digeneans Yao wildlife, or Zhang, in 2020) platyhelminths Nie, al., Bazsalovicsová et medically parasitic Luo, of of (i.e., structures studies cestodes population in the underutilized These of studies strongly parasites. (e.g., in of parasites employed studies human previously population-genetic important were in that repeats tool assume tandem the molecular can powerful with polymorphic we a heterozygosity associated represent of is markers degree origin. structure Microsatellite low recent population the relatively observed from of the and, are Balkans, that subpopulations the doubt geograph- in the no from hosts is endemic hosts Palandaˇcić, opposite. there of between by However, the distribution contacts Bravniˇcar, proposed suggest Zupanˇciˇc, recent (2015). be connections analyses from Snoj should 2007). underground clustering result and Freyhof, well, via of could & as regions results populations Kottelat parasites ”isolated” the parasite their 1990; ically and of between (Bianco, variance mixing karst and genetic partial distri- the fish low The limited freshwater in the extremely of stream Nonetheless, an populations river have minimal. between district single flow Dalmatian a the gene to in Therefore, limited species often cyprinoid range, endemic bution all almost general, In example, for streams; karstic nearby While range. 4b) Both between Figure Croatia. flow K8, from gene those 3; indicated (Figure clearly analyses also clustering it subsequent of Croatian The of individuals range southern species. distribution separated cyprinoid three the endemic with and corresponds encompasses Herzegovina which vely range, and district’s Bosnia Dalmatian the in svallize with sites accordance middle in four the is from in sites the diverged individuals why ancestor explains encompassing which corresponds whose cluster 2017), Balkans, essentially two al., the district these et in this Moreover, and (Buj congeners of period. Miocene remaining range the glacial from River The of the lineage the Dalmatia. during distant from in a basin region Krka present the Po River covers aforementioned the which the to district, Padano-Venetian with Italy the central of essentially in range each Vomano the clusters, follows and major respectively) Peninsula C5, three Apennine into ( the populations regions ichthyogeographical from studied Kottelat different the the (see all with overlap species). associated separated host strongly analyses of habitats distribution clustering and even and Initial requirements populations, biology biological parasite the between and for syntopy, flow (2007) in Freyhof gene and live the reducing species of hosts barrier host current a when the represent genera, apparently close Cerfone phylogenetically Torrente representing species between switching host F 0.794, = distance .fontinalis T. tfae l,20;Jhao´ ta. 06 aslvco´ ta. 00,adas irtr patterns migratory also and 2020), al., Bazsalovicsová et 2016; Juhásová al., 2009; et al., et Stefka ˇ Bac,19;Ktea ryo,2007) Freyhof, & Kottelat 1990; (Bianco, .tenellus S. r iegn rmother from divergent are ST .4,Tbe4.Dsietefc httehsoia iprinof dispersion historical the that fact the Despite 4). Table 0.447, = .tenellus S. spiaiyedmct h eiaRvr oeppltoscnas efudin found be also can populations some River, Cetina the to endemic primarily is .tenellus S. citsm haematobium, Schistosoma .vistulae D. st 4 and B4) (site Gyrodactylus .turskyi T. and .turskyi T. .vistulae D. .vistulae D. fteBalkan the of srsrce othe to restricted is . .turskyi T. h amta ctygorpi ititams exclusi- almost district ichthyogeographic Dalmatian The Frae l,21) hi oeapiainwst assess to was application sole their 2011), al., et (Faria r ihyedmcwt togylmtddistribution limited strongly a with endemic highly are 7 ouain ntewsenBlas hs h second the Thus, Balkans. western the in populations tfa yˇa&Shl,20;Uhn ta. 2018; al., et Umhang 2009; Scholz, Hypˇsa & Stefka, ˇ ouain ape nBsi n ezgvn,and Herzegovina, and Bosnia in sampled populations sensu .vistulae D. C)it niiulsbouain;however, subpopulations; individual into (C3) oe ta. 21).Hwvr hyaestill are they However, (2011)). al., et Gower .croaticus T. ino 90.Tecutrn findividuals of clustering The 1990). Bianco, ioaRvr(otlt&Fehf 2007). Freyhof, & (Kottelat River Cikola ˇ ouain abrdby harbored populations and .fontinalis T. Telestes .vistulae D. pce lore- also species stsC and C4 (sites .vistulae D. .croaticus T. included Sanda ˇ S. in Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ooe hpsidct ie fcleto fpriua niiul.Pretg fvrainepandby explained variation of Percentage individuals. particular 6. of Table in collection presented of is sites axes indicate shapes (B) individuals. Colored only particular C1-C3 of within sites and line collection B1-B3, horizontal indicate sites Each right representing particular shown. the a are on to 4. 8 Labels membership Figure and of colors. 5, proportion different estimated 3, by The (K) indicated individuals. is clusters analyzed cluster of 159 number of estimated one 2.3.4 represents the brackets v. for Στρυςτυρε plots ιν bar αναλψζεδ δατασετ Only τηε φορ ξ-αξις) ον 3. σηοων Figure ις (Κ ςλυστερς οφ νυμβερ τεστεδ εαςη 2. Figure (doi:XXX). 1. repository Figure data Dryad the Figures in and accessible Tables are that data genotypes and microsatellite results The the interpreted MB Availability analyzed Data analyses. MB statistical and A and LG from molecular contributions protocols. all manuscript. with laboratory manuscript performed performed the MB and wrote protocols data. and genomic primers the designed LG parasites. number A (project Foundation Science Czech the Contribution by Author funded thank was kindly study We The work. for draft. for field final Nicholls Centre with GA20-13539S). the Matthew help (Hellenic of their and revision Zogaris for interpretation, English and Stamatis data permits regarding and Papeˇz´ık fishing Mikul´ıˇcek discussion Croatia), Peter arranging Peter Croatia), for for and Marić Osijek, Zagreb, Greece) of Marˇcić Dario of Research, University Italy), Zoran Strossmayer Marine (University (Arezzo, Jujar and Porcelloti (Josip Stefano Bogut Buj Ivan to Ivana Herzegovina), and and collection, Bosnia fish Radek b., for and (Dobriˇc b. Republic) Republic) Czech Czech We Prague, work. Prague, Jasná University, laboratory Museum, Vukić Kristýna to with (Charles and Hejlová help indebted collection, for also parasite and are dissection fish with help their Tomáˇs Eva Pakosta, eaegaeu oKateˇrina to grateful are We the parasites, reflect of might variability group population diversified Acknowledgements genetic highly their hosts. this specificity, their of used host of case variability narrow it the remarkable the extremely utilize because in exhibit and study Particularly often provide this which monogeneans. to obtained dactylogyrid in able the employed in were rendering studies was we samples, of technique Therefore, pooled set species. pooling of the first monogenean The number in identifiable contamination process. considerable optical easily cross-species magnifying to a morphologically of without challenging pool difficult risk data rather high to DNA is genomic a is identification genomic monogeneans is species that option the there correct considering of one However, that methods, quality 2018). and insufficient, Huyse, small-sized and be generally & quantity are Littlewood may the Jorissen, As parasite Briscoe, (Vanhove, NGS. small-sized specimens for a material from appropriate isolated of collection the remains uevsd n oehrwt Gdsge h td.A study. the designed LG with together and supervised, S ˇ eut fPo optdi eAE .65fralaaye ouain A,adfrpopulations for and (A), populations analyzed all for 6.5 v. GenAlEx in computed PCoA of Results ενετμτδλ ιειοδποαιιιςφο 0ιδvδα υς()αδvλε φΔ Β φορ (Β) ΔΚ οφ vαλυες ανδ (Α) ρυνς ινδιvιδυαλ 10 φρομ προβαβιλιτιες λικελιηοοδ λν εστιματεδ Μεαν eut fBysa lseiganalyses clustering Bayesian of Results Balkans the and Peninsula Apennine the in sites collection of Map enovo de eeoe irstliemresta ih pnpsiiiisfrpopulation-genetic for possibilities open might that markers microsatellite developed eukvaadPtaZhanıco´ MsrkUiest,Bn,CehRpbi)for Republic) Zahradn´ıˇcková Czech Petra Rehulková Brno, and University, (Masaryk ˇ Cermáková, Jaroslav ˇ .Alatosra n prvdtefia eso fthe of version final the approved and read authors All S. ˇ evna ia enr ai Lujza Maria Gelnar, Milan Cervenka, ˇ 8 n Bpoesdfihadcletdthe collected and fish processed MB and S ˇ evnaKiˇcinja,Cervenka ˇ ad (National Sanda ˇ Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ihdvriyo s coaaii ooeen ( monogeneans radiation? ectoparasitic fish of diversity Y., High Desdevises, M., Benovics, Reports host-specific Scientific of richness Vukić, species J., and Y., Desdevises, M., Benovics, tapeworms fish monozoic markers. of analysis described Comparative recently (2020). J. Bazsalovicsová, Králová-Hromadová, E., Turkey. lake, Chub, Juhásová, dam in I., helminths (Bursa) Mikul´ıˇcek, of 246–251 L., Doganci Occurence Oravcová, (2001). & Minárik, the P., S. G., A., H. of Yildirimhan, , & N., F. Altunel, Pacific. A., South-East Aydogdu, the in Valenciennes 490. lalandi 12, Seriola , kingfish yellowtail of and the species genome cryptic infecting mitochondrial new complete evolution. a The (2019). González, of and Teresa M. description Biodiversity & A., Sepúlveda, F. J., Ohrid: Baeza, Lake Antonio Ancient conservation. (2008). biodiversity T. freshwater Wilke, for 103–140. Fresh- units & (2008). P. biogeographic C., Petry, of Albrecht, . map . . new N., A Bogutskaya, M., world: Kottelat, BioScience the M., Bryer, of C., ecoregions Revenga, water L., M. Thieme, R., Abell, References I alleles; of 4 number Figure effective = 6. Table Ne individual; per alleles 5. Table for of only number data = = I1a Na H index; index; alleles; diversity of Shannon’s number = total = N site H site; 4. particular at Table alleles of number = vistulae Na D. locus; of alleles H of gosity; number total = TNA site analyzed 3. Table and sets collected PCR of number five = into N plexing figures. and 2. tables Table following the in used are vistulae ID as labeled Codes coordinates with sites collection respective 1. Table niiul rmtersetv host. respective the from individuals aaiooyResearch, Parasitology E ecito fd oodvlpdmcoaeltsmresfrD itleadcniin o multi- for conditions and vistulae D. for markers microsatellites developed novo de of Description ecnaeo aito xlie ytefis he xsuigPo nmcoaelt akr in markers microsatellite on PCoA using axes three first the by explained variation of Percentage arws e-itne n F and Nei-distances Pair-wise umr fbscpplto-eei ttsia aaeesfr2 irstlielc ycollection by loci microsatellite 24 for parameters statistical population-genetic basic of Summary ito otseisivsiae o rsneo atlgrsvsua niiul nldn their including individuals vistulae Dactylogyrus of presence for investigated species host of List Parasitology ecitv ttsisidctn envle o ai aaeesfrallc yec collection each by loci all for parameters basic for values mean indicating statistics Descriptive siae eeoyoiy 1 aaol for only data = I1a heterozygosity; estimated = from 8 403–414. 58, , .muticellus T. ,13006. 8, , aypyleschondrostomi Caryophyllaeus 4,418–430. 147, , .vistulae D. ad,R,Vk´,J,Shie,M,Daro . . . . I., Doadrio, M., Scheifler, Vukić, J., R., Sanda, ˇ . 1,3995–4004. 119, O bevdhtrzgst;H heterozygosity; observed = Dactylogyrus from Benedenia ST ad,R,& R., Sanda, ˇ ewe niiul rmec ouainpair population each from individuals between .squalus S. ultno h uoenAscaino ihPathologists Fish of Association European the of Bulletin aˇ ´ k rs azlva coz 07 sn microsatellite Barˇcák, using 2017, Hanzelová, Scholz, Oros, Dactylogyrus isn,15 Mngna aslde,amjrpathogen major a Capsalidae), (Monogenea: 1858 Diesing, aaie hpdb h igorpyo akncyprinids. Balkan of biogeography the by shaped parasites 9 1 aaol for only data = I1b ; ikva .(08.Tepyoeei relationships phylogenetic The (2018). Simková, A. ˇ .vistulae D. nteIeinPnnua aeo adaptive of case a Peninsula: Iberian the in ) E aypyleslaticeps Caryophyllaeus siae eeoyoiy fixation = F heterozygosity; estimated = from .vistulae D. .squalus S. O ikva .(2020a). Simková, A. ˇ bevdheterozy- observed = 1 aaol for only data = I1b ; Hydrobiologia from aaie Vectors & Parasites Pla,18)and 1781) (Pallas, ecsu cephalus Leuciscus .muticellus T. Stefka, ˇ 615, , 21, , D. Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. egr .F,Hre,F,Mnga,M . laa . abei . aih,M,...FehfJ (2014). J. Freyhof . . freshwater . its M., of Bariche, accuracy R., barcoding Barbieri, affects V., hotspot Almada, biodiversity T., Mediterranean fishes. mi- the M. polymorphic in Monaghan, First heterogeneity F., Spatial Herder, (2011). F., J. M. Cable, Geiger, & pathogens. D., fish multilocus P. of Harris, group using important C., structure an Resources Oosterhout, (Monogenea), population van gyrodactylids the of M., for C. Inference crosatellites the Lazarus, using J., (2007). P. individuals alleles. K. Faria, null of J. and clusters markers Pritchard, of dominant & number data: M., genotype the Stephens, Detecting D., (2005). Falush, J. study. Gould, simulation a & STRUCTURE: visualizing S., software for Regnaut, program and G., website Evanno, a method. HARVESTER: Evanno STRUCTURE the genus (2012). implementing the M. and output B. of STRUCTURE vonHoldt, species & Palearctic A., western D. Earl, of classification and relationships Phylogenetic snail Barbus lymnaeid (1990). of I. Role Doadrio, cotransmission Clonemate (2015). G. (2020). Dreyfuss, P. & 699–706. C. D., Goater, Rondelaud, & parasite. P., lumnela detecting puppeteer S., Vignoles, a J. Y., eye: in Gilleard, Dar, selection the kin J., meets for B. than role Paridon, More a cycle. van supports life D., (2011). complex C. S. a Criscione, M. with of Blouin, parasite populations & a source in E., 2510–2524. identify structure 20, Paniagua, genotypes population R., Parasite microgeographic Vilas, cryptic (2006). D., S. C. genotypes. M. Criscione, fish Blouin, structure than & genetic accurately among-host more B., no fish Cooper, and migratory clones, D., few propagation. C. larval selfing, Criscione, asexual Minimal with (2006). parasite S. hermaphroditic M. a Blouin, in & genus D., the of C. history Criscione, evolutionary the from revealed watersheds Cypriniformes). and (Actinopterygii; rivers European among nections Marˇcić, I., Z., Buj, Zoologica Folia and ( Late-Glacial bleaks Pollen-inferred of (2009). comparison Vukić, E. J., Fouache, I., & Maliq). Buj, S., (Lake Balkans Brewer, southern M., on in A. basins climate Lezine, Parathethys Holocene O., and Peyron, Mediterranean A., Bordon, the fishes. of freshwater paleohistory Mediterranean the Euro of of 167–184. role dispersal Potential early (1990). the four of G. description P. a Bianco, and monogeneans, ectoparasitic on remarks with Peninsula, new Apennine the & of V., cyprinoids Dlapka, P., Volta, Francová, K., M., Benovics, region. Mediterranean Y., between Desdevises, M., Benovics, Dactylogyrus oeua clg Resources Ecology Molecular Otihhe,Cyprinidae). (Osteichthyes, Dactylogyrus ntetasiso ftelvrfluke liver the of transmission the on ,177–180. 3, , 9 129–141. 59, , isn,15 species. 1850 Diesing, ad,R,Pra S., Perea, R., Sanda, ˇ aea M., Caleta, ˇ Mngna coaaie n nei yrniso h ot-atr uoenperi- European north-eastern the of cyprinoids endemic and ectoparasites (Monogenea) Alburnus ora fZooia ytmtc n vltoayResearch Evolutionary and Systematics Zoological of Journal ad,R,Vk´,J,& Vukić, J., R., Sanda, ˇ yrnde rmteArai ai ihtedsrpino e species. new a of description the with Basin Adriatic the from Cyprinidae) , ad,R,Gie,M . ryo,J,...Vk´,J 21) nin con- Ancient (2017). Vukić, J. . . . J., Freyhof, F., M. Geiger, R., Sanda, ˇ LSONE PLoS qai iigResources Living Aquatic 4 1210–1221. 14, , Parasitology aea . aˇi,Z,...MaoˇicM 21)Morphological Mrakovˇcić (2010) M. . . . Marˇcic, Z., M., Caleta, ´ oeua Ecology Molecular 2 e0187366. 12, , acoahepatica Fasciola oeua clg Notes Ecology Molecular 10 Ecology utrayInternational Quaternary ikva .(01.Hlit omnte fendemic of communities Helminth (2021). Simková, A. ˇ 01 1–16. 2021, , ikva .(00) ohlgntcrelationships Cophylogenetic (2020b). Simková, A. ˇ PNAS 7 823–828. 87, , ctylgclEpoaino Freshwaters of Exploration Ichthyological osrainGntcResources Genetic Conservation ,265–282. 3, , Evolution 4 2611–2620. 14, , 1,5970–5976. 117, , nEgypt. in 0 553–562. 60, , ora fHelminthology of Journal ,574–578. 7, , 0,19–30. 200, , 8 1–21. 58, , osrainGenetics Conservation oeua Ecology Molecular suoucnacol- Pseudosuccinea ,359–361. 4, , Telestes 89, , 1, , , Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. u,H . i,P,Zag .A,Yo .J,&Wn,G .(03.Gntcdffrnito npopulations in differentiation Genetic (2003). T. G. Wang, & J., W. Yao, A., cestode Y. host? the Zhang, motile P., of most Nie, Y., the complex H. of of Luo, structure range genetic geographic population the the Is by (2010). determined Evolution J. Jokela, parasites & cycle C., life Rellstab, A., Karvonen, K.-R., Louhi, continents. two across fishes 771–786. cypriniform 50, in tapeworms and genans R., Kuchta, (2007). J. Freyhof. Freyhof, & M., Kottelat, Finland. (1992). Central in T. lakes E. three Valtonen, & M., Koskivaara, K”. program across a inferences CLUMPAK: structure (2015). I. population Mayrose, packaging & and Resources A., modes N. clustering Rosenberg, identifying M., Jakobsson, for J., of Mayzel, case M., N. the Kopelman, Lakes: Great African in diverge to Failure Research (2020b). M. P. M. lacustre Vanhove, . . . T., Koblm Kmentová, N., monogenean the of Parasitology expansion for demographic recent and structure population parasite Weak (2020a) M. P. by M. Vanhove, morphometry: evidenced anchor cichlids Tanganyika Monogenean Lake Kmentová, Koblm non-littoral N., (2016). diversity. infecting Koblm genetic S. parasite and M., H. a morphological Steenberge, L. intraspecific in Van host-specificity Lim, Reduced & Mendlová, M., (2016). B., M., W. Gelnar, Tan, Kmentová, N., evolution. M., and Y. signal, O. phylogenetic value, Soo, systematic F., parasite T. invasive Khang, an of routes Europe. dispersal and and America structure Population (2016). M. the of study Juhásová, Co-phylogeographic Králová-Hromadová, (2017). L., M. A. Minárik, Bazsalovicsová, G., F. E., Volckaert, I., 119–125. & molecu- D., H. using M. flatworm Larmuseau, complex M., species Oeyen, T., host-associated Huyse, of a description of the Identification with (2002). analyses, Monogenea). A., morphometric F. and Volckaert, lar & T., Huyse, Press. (1999). (2011). P. L. J. Webster, G. Hoffman, . Mali. . . in M., control A. schistosomiasis Emery, to R., application Golan, Dembelé, R.., of M., Sacko, genetics F., monogeneans Population A. the of Gabrielli, species M., nominal C. the Gower, of Catalogue (1996). I. P. Gerasev, genus & of A., T. Timofeeva, I., D. Gibson, Kapentagyrus e.nv,cm.nv Mngna ilcaia)ifcigltdhosts. latid infecting Diplectanidae) (Monogenea, nov. comb. nov., gen. Dactylogyrus yoatlsgondae Gyrodactylus 6 1113–1130. 46, , 0 1271–1277. 10, , 5 1179–1191. 15, , eukva . rno´,K,Shl,T,Mrn,S,& S., Morand, T., Scholz, Francová,Rehulková, K., E., ˇ nentoa ora o Parasitology for Journal International ohicpau acheilognathi Bothriocephalus 0 471–486, 50, , le,S,VnSeneg,M,Remees .A . ros . eKye,E .R,... . . R., L. E. Keyzer, De T., Artois, M., A. J. Raeymaekers, M., Steenberge, Van S., uller, ¨ isn,15 n hi otgenera. host their and 1850 Diesing, le,S,VnSeneg,M,Ati,T,Mtrz uig,F,Mlmw N’sibula, Mulimbwa F., Bukinga, Muterezi T., Artois, M., Steenberge, Van S., uller, ¨ aaie Vectors & Parasites p.ifcigcuedfihso aeTnayk,Es Africa. East Tanganyika, Lake of fishes clupeid infecting spp. citsm haematobium Schistosoma aaie fNrhAeia rswtrfishes freshwater American North of Parasites n t oyhost goby its and Parasitology adoko uoenfehae fishes freshwater European of Handbook ,547. 9, , Dactylogyrus 0,263–272. 104, , Csoa suohlie)a eeldb ih microsatellite eight by revealed as Pseudophyllidea) (Cestoda, Parasitology cetfi Reports Scientific oaocitsminutus Pomatoschistus eeomn fnvlmcoaelt akr n their and markers microsatellite novel of development : 2 907–919. 32, , 11 PeerJ yoatlsrugiensoides Gyrodactylus Mngna omnte nteglso oc in roach of gills the on communities (Monogenea) 3,978–994. 138, , ytmtcParasitology Systematic ,e1668. 4, , nentoa ora o Parasitology for Journal International ,39605. 6, , ikva .(00.Dvriyo mono- of Diversity (2020). Simková, A. ˇ tfa . iu´ˇe,P,...Pybus, Mikul´ıˇcek, . . J., . Stefka, P., 2de) taa onl University Cornell Ithaca: ed). (2nd ˇ le,S,&Vnoe .P M. P. M. Vanhove, & S., uller, ¨ . aaiooyInternational Parasitology acoodsmagna Fascioloides eln otlt onland Cornol Kottelat, Berlin: . netos eeisand Genetics Infections, 5 3–48. 35, , ora fGetLakes Great of Journal .s.(Gyrodactylidae, sp. n. nentoa Journal International Dolicirroplectanum oeua Ecology Molecular nNorth in , 66, , , Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ceke . ai,P . ono,M . a otrot . al,J 21) ie netosand infections Mixed (2012). J. Cable, & C., Oosterhout, van B., M. parasites. Johnson, monogenean J., in hybridisation P. Faria, B., Schelkle, Phenotypic (2015). of A. ( structures J. haptoral in Balbuena, plasticity & C., Llopis-Belenguer, Rodr´ıguez-González, M´ıguez-Lozano, R., A., hi hlgn n otprst soitosi igorpi context. of biogeographic species a new in Peninsula: associations Balkan host-parasite the and of phylogeny fishes their cypriniform endemic on thes) & M., Benovics, Rehulková, (Eds.), E., AbcTaxa. M. Brussels: Gelnar, 185–243). & (pp. Z., Jayasundera, . N., Smit, M. M., Vanhove, P. T., Scholz, In Monogenea. Pˇrikrylová, Seifertová,Rehulková, Francová, (2018). M., E., & K. I., ieetdseslcapacities. & dispersal M., different P. M. Vanhove, in M., variation Steenberge, Van Regions C., (2009). Amur Rahmouni, I. and Khotenowsky, & Palearctic R., of Ergens, fish V., multilocus A. freshwater using Gussev, of structure I., P. population Gerasev, N., of O. Inference Pugachev, (2000). J. P. Donnelly, & data. M., genotype Stephens, K., J. Pritchard, structure (1979). population C. Genetic E. (2021). Pielou, A. L. Vøllestad, lake. & Norwegian A., large T. a Mo, parasite K., monogenean Østbye, the C., of Junge, A., data. R. nuclear Pettersen, (Teleostei, and Leuciscinae mitochondrial subfamily both Circum-Mediterranean from in inferred patterns Cyprinidae) biogeographical for software and genetic relationships Population netic excel. B in S., analysis Perea, genetic 6.5: for GenAlEx software update. research—an genetic (2012). Population and E. teaching P. Excel. Smouse in & analysis R., genetic Peakall, 6: GenAlEx research. (2006). and E. P. teaching Smouse, & R., Peakall, Evolution of complex tispecies Zupanˇciˇc,Palandaˇcić, Bravniˇcar, J., P., A., (1873–2000) (2001) F. of Moravec, Checklists (2019). N. a projects. K. QDD: sequencing Iraq. Abdul-Ameer, (2010). of large & F. from T., J. F. primers Martin, Mhaisen, design & and N., markers Pech, T., microsatellite Malausa, select Bioinformatics A., to Gilles, program V., user-friendly Dubut, C., Costedoat, Meglécz, E., within and between variability Morphometric Parasitology (2004). Systematic V. Petrarca, & of S., D’Amelio, species M., Ortis, L., Mariniello, markers. ˇ ˇ ui cephalus Mugil ilgcladApidEvrnetlResearch Environmental Applied and Biological Parasitology 2 118–123. 92, , Ligophorus he . uaˇic . ryo,J., Zupanˇciˇc, Freyhof, M., P., ¨ ohme, Cichlidogyrus rge Academia. Prague: . Genetics 6 403–404. 26: , :agoercmrhmti approach. morphometric geometric a ): hcls ftemtza aaie ffihso zc eulcadSoa Republic Slovak and Republic Czech of fishes of parasites metazoan the of Checklist Phoxinus Biogeography ue uin,17 Mngna nyoehlde nteMdtraenSea. Mediterranean the in Ancyrocephalidae) (Monogenea: 1977 Suriano, & Euzet oeua clg Notes Ecology Molecular 2,493–501. 126, , Hydrobiologia 7 183–190. 57, , 5,945–959. 155, , yoatlsthymalli Gyrodactylus Mngna aaiiigtoccldhssfo aeTnayk exhibiting Tanganyika Lake from hosts cichlid two parasitizing (Monogenea) Hydrobiologia Cpiia)i h etr aknPeninsula. Balkan Western the in (Cyprinidae) ikva .(00.Ucvrn h iest fmngnas(Platyhelmin- monogeneans of diversity the Uncovering (2020). Simková, A. ˇ iohrscephali Ligophorus e ok Wiley. York: New . Bioinformatics 4,547–561. 848, , LSONE PLoS 22)doi:10.1007/s10750-020-04429-1. (2020) ad,R,&So,A 21) oeua aasgetamul- a suggest data Molecular (2015). A. Snoj, & R., Sanda, ˇ ,288–295. 6, , ad,R., Sanda, ˇ n t otErpa ryig( grayling European host its and ia:LdzoeLd Publishing. Ledizione-Ledi Milan: . 8 2537–2539 28, , ,e39506. 7, , 12 Mngna atlgrde ntefltedmullet flathead the on Dactylogyridae) (Monogenea: nentoa ora o Parasitology for Journal International ,1–36. 3, , ud oteprstso fia rswtrfishes freshwater African of parasites the to guide A ikva .(00.Itapcfi morphological Intraspecific (2020). Simková, A. ˇ Dactylogyrus zl˘ ,M,...Daro .(00.Phyloge- (2010). I. Doadrio, . . . Ozulu˘g, M., ¨ M vltoayBiology Evolutionary BMC pce Mngna rmFishes from (Monogenea) species Parasite Dactylogyrus oeua hlgntc and Phylogenetics Molecular hmlu thymallus Thymallus 7 66. 27, , ud oMonogenoidea to Guide n omnson comments and 0 265. 10, , 5 295–303. 45, , in ) Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. a aio,B . owl,D . otr .P,&Gler,J .(07.Pplto eei nlssinforms analysis The genetic (2018). Population (2017). T. S. J. trematode Huyse, Parasitology Gilleard, emerging for & & the P., of C. J., Goater, history invasion T. D., the D. D. Colwell, J., parasites Littlewood, B. monogenean Paridon, P., African van W. of phylogeny M. Dactylogyridae). mitochondrial and Jorissen, the Gyrodactylidae to G., (Platyhelminthes: approach A. sequencing Briscoe, next-generation first M., of variability P. shape M. understanding Vanhove, in morphometrics variability. biogeographic geometric facultati- into insights of International a with use (Platyhelminthes) Parasitology monogeneans Does The of (2010). structures (2014). P. haptoral sclerotized E. Sasal, & M. M., Oliva, trematode Vignon, & marine P., the species? Durán, C. host predispose Cárdenas, L., among cycle differentiation D., life C. precocious Criscione, ve M., I. Inves- Valdivia, (2018). Boué, order F. . the . . of M., Oudni-M’Rad, fishes B., Research of of Balot, diversity S., genera genetic M’Rad, the extant V., tigating Bastid, of F., classification Grenouillet, G., Phylogenetic Umhang, (2018). W. Ostariophysi). J. (Teleostei: Armbruster, Cypriniformes ( & trout M., brown of Tan, demography Historical (2007) Evolution S. and Weiss & genetics D. Mrdak F., trutta I. Wilson A., Snoj Suˇsnik S., Mediterranean eastern Paratethys R and & Mediterranean F., population F. the in Steininger, of biogeography study and microsatellite specificity host endoparasite: of Ecology cosmopolitan Interplay deter- a (2009). barriers of T. Apennine structure Scholz, and & Hypˇsa, Alpine V., J., Stefka, (2004). D. ( Calamari, rudd & the Fish S., Freshwater of Zaccara, fish. differentiation G., cyprinid the Crosa, mining Iberian P., Galli, and F., African Stefani, Northwest of biogeography historical congeneric the Vectors Host-specific of on (2017). Vukić, specialization insights J & and new I., Specificity Rahmouni, M., (2006). Benovics, Simková, S. A., Morand, fish. & cyprinid congeneric M., parasitizing of monogeneans phylogeny Gelnar, Molecular O., (2004). Verneau, O. Simková, A., Verneau, & M., ( Prespa. Gelnar, parasites and E., ancientmonogenean Ohrid Jobet, in lakes S., speciation in Morand, of Simková, side A., taxon neglected mollusc The conspicuous (2008). in T. an 141–156. Wilke, of & Phylogeography U., Bossneck, lakes: C., Albrecht, R., Schultheiss, Cyprinoidei). (Cypriniformes: Leuciscidae family Evolution Holarctic the of classification Sch ( fish Seifertová, Vyskoˇcilová, & M., S., Morand, M., ˇ ˇ ˇ ˇ nuh . Vukić, J., S., ¨ onhuth, ecsu cephalus Leuciscus nteArai riaeicuigteputative the including drainage Adriatic the in ) 0 589. 10, , 8 1187–1206. 18, , 1,2743–2755. 117, , 2,781–799. 127, , 7 845–856. 47, , 3 168–175. 13, , g,F (1984). F. ¨ ogl, p.6968.Ofr:Blackwell. Oxford: 659–668). (pp. . Dactylogyrus 4 63–76. 44: :tsigboegah yohsso pce diversity. species of hypotheses biogeography testing ): ad,R,Yn,L,&Mye,R .(08.Pyoeei eainhp and relationships Phylogenetic (2018). L. R. Mayden, & L., Yang, R., Sanda, ˇ 9 183–191. 59, , nDxn .E,&Rbrsn .H (Eds.), H. A. Robertson, & E., J. Dixon, In . cioocu rnlsssnustricto sensu granulosus Echinococchus nentoa ora o Parasitology for Journal International :acs fitaotspeciation. intrahost of case a ): aegorpyadplnpsi eosrcino h egn fthe of Neogene the of reconstruction palinspastic and Paleogeography Evolution criiserythrophthalmus Scardinius Zootaxa ikva .(08.Mtza aaie ffehae cyprinid freshwater of parasites Metazoan Simková, (2008). A. ˇ irceimdendriticum Dicrocoelium 0 1023–1037. 60, , 46 006–039. 4476, , 13 M Genomics BMC .letnica S. rcocsc.lintoni cf. Proctoeces nei oLk Ohrid. Lake to endemic iuaintestinalis Ligula . nteIainpeninsula. Italian the in L.) Evolution ihnwmicrosatellites. new with 9 520. 19, , noCanada. into 4 183–188. 44, , Dactylogyrus h elgcleouino the of evolution geological The Parasitology oeua hlgntc and Phylogenetics Molecular 8 1001–1018. 58, , oibedn n genetic and inbreeding to (Cestoda). nentoa Journal International Hydrobiologia aaie revealing parasites oeua Phylo- Molecular 3,1417–1435. 135, , Parasitology aaie & Parasites clg of Ecology Molecular Salmo 615, , Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. I1b I1a G2 G1 C5 C4 at5 :CTCAGAACGA (AG) (AG) CTTCCAAGGGACAACAGGAG F: Dacty54 (AG) AACACCATGAGAATGGAGCG F: Dacty52 (AG) GCCCACGCTTGTCTTAACAT F: Dacty50 (AAT) ACACGAGATGGTGCTTGATG F: Dacty44 CAAGTGGACTCGCAACAGAC F: (AG) Dacty38 (AT) CCGGTTCTTAGTTTAATGGGC F: Dacty36 AGACATGCTCTGCTCACGAT F: Dacty34 (5 sequence Primer coordinates Locus analyzed sets and PCR collected five of number into = multiplexing N for figures. and 2. tables Table following the in used are vistulae ID as labeled Codes coordinates with sites collection respective 1. Table Locality Country N C3 C2 C1 B4 B3 B2 Labrache- isotopic species . B1 . Host . foraminifera benthic K. from Lambeck, derived F., ID changes J. temperature McManus, water C., deep J. and Duplessy, Sea-level records. E., (2002). Prespa. Michel, and M. L., Ohrid rie, lakes Labeyrie, Balkan the C., of Waelbroeck, history geological and Evolutionary (2011). Biogeosciences T. Wilke, & B., Wagner, and Genetic (2016). Hurtrez-Bousséz, S. & A., logy fluke Milesi, liver the A., of Alba, diversity Sánchez,infective J., M., Lounnas, A., Vásquez, A. 0 719–725. 90, , eetsmuticellus Telestes squalus Squalius peloponensis Squalius prespensis Squalius fontinalis Telestes croaticus Telestes eetsturskyi Telestes svallize Squalius illyricus Squalius tenellus Squalius pseudalepidotus Phoxinellus alepidotus Phoxinellus phoxinus Chondrostoma utraySineReviews Science Quaternary niiul rmtersetv host. respective the from individuals ecito fd oodvlpdmcoaeltsmresfrDcyoyu itleadconditions and vistulae Dactylogyrus for markers microsatellites developed novo de of Description ito otseisivsiae o rsneo atlgrsvsua niiul nldn their including individuals vistulae Dactylogyrus of presence for investigated species host of List :TTGTCGATTTCAGCTCATGG R: AATAGAGGGAGGGAAGGTGG R: GTATGTCAACGCGCTCAATG R: TACGCTACAAGTGCTACAAGGAR: CGGCACAATGAAAGGCTAT R: TGTGCACTGTTCCATCATGT R: TGATTCTAAGATGCGGGCAC R: ,995–998. 8, , ´ acoahepatica Fasciola -3 1Gec os aiha40 37 43 43 44 Intoppo Cerfone, Torrente Intoppo Cerfone, Torrente Italy Vasiliko Pamisos, Italy 11 Kalithea 44 Aoos, gaj Greece 5 Laudonov Obsenica polje, rieka Liˇcko Krbavsko Cerje, a Greece 18 Rok Sveti medzi Croatia 11 12 Croatia 10 rai oaocc,Gue42 43 43 44 rieka Konavoˇcica, Grude Kosore Croatia river, Cetina Croatia 30 Croatia 6 Liˇstica, Polog river Korana Grahovo, Bosnia 7 Bosansko Bosnia 32 Bosnia 7 Bosnia 5 5 ´ 1 295–305. 21, , eetmtfMlilxPRst utpe C esMlilxPRsets PCR Multiplex sets PCR Multiplex sets PCR Multiplex motif Repeat ) Teaoa iee)fo Cuba. from Digenea) (Trematoda: 14 uia43 Sujica Sujica, ˇ ˇ ioa43 Cikola ˇ 9 7 8 12 10 9 uic oPle43 Sujiˇcko Polje ˇ 8 .5FAM NED VIC FAM 0.15 NED 0.1 0.15 VIC 0.1 3 0.1 4 0.15 1 2 2 1 Set .5PET 0.15 1 ora fHelmintho- of Journal μμ ° ° ° ° ° ° ° ° ° ° ° ° ° 61.3N11 26’12.03”N 11 26’12.03”N 21 15’17.39”N 20 01’16.67”N 15 38’14.33”N 15 21’03.64”N 82.9N16 48’22.09”N 13.6N18 31’33.86”N 16 56’29.78”N 17 20’32.09”N 16 10’37.00”N 20.7N17 42’05.07”N 17 49’41.43”N D.

° ° ° ° ° ° ° ° ° ° ° ° ° 58’33.00”E 58’33.00”E 53’45.15”E 41’40.19”E 40’05.65”E 40’40.00”E 17’24.53”E 22’04.16”E 26’23.37”E 41’37.04”E 23’03.61”E 15’50.05”E 10’48.20”E Dye Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. at6 1-3 - - - - - 1 - - 1 - - - 1 ------1 - - 1 1 1 - 1 - 1 1 - 1 - 1 ------1 - - 1 1 - - 1 1 1 0.337 - - 1 1 - - 0.143 1 - - 2 ------1 - - 1 1 - 0.342 - - He 1 1 - 1 1 - Ho - - - 1 - Na - 1 2 - - - - He - - - 1 Ho 1 - - - - Na 1 1 - 1 1 - He - - - 2 - - 1 Ho 1 - - - - - Na - - - 1 1 1 - - He - - 1 1 - - 1 - Ho 1 - - Na 1 1 ------He - - 1 1 1 - - - - Ho 1 1 - Na - 1 - 1 9 - 1 5 1 - - He 215-239 - 10 - Ho Dacty65 245-253 - 1 10 Na Dacty64 186-212 1 6 - Dacty54 134-158 1 10 He Dacty52 90-110 1 4 Ho Dacty50 226-252 9 Na Dacty44 231-240 6 TNA Dacty38 179-211 (bp) Dacty36 204-218 Size Dacty34 Locus site. 3. Table (AAC) (AGC) AACATGGAATAGGAGTGGGC F: Dacty99 (ACTG) GGACAAGTTGAGTTGCTCGG F: Dacty96 (AAGGT) ATTTGCCAATCTGTGCATGA F: (AGC) Dacty93 CTTGCTTCAAACTCGGCTGT F: Dacty92 (AG) AAACATAGCCGCCAACCAG F: Dacty87 GGTCGACGCTTCTCTTTGAT F: (AG) Dacty85 (AT) AAGGTTGTAGCCTTGGTCAATC F: Dacty84 (CG) GCAGTTTGTCCTGGCATTTC F: (AG) Dacty79 CATGACCATGACAACCAACG F Dacty75 (ATC) AATTGAAGCGCTCCTCCG F: Dacty73 (AAAC) AATGCTGCCGAATTAACAGG F Dacty70 (AGG) TAGAGGGAAGGCAAGTGTCC F: Dacty69 AGGCATTTGCAACTCGATTA F: (AT) Dacty68 TCATGAAAGAGAACGAAACGAA (AG) F: (AC) Dacty67 TGCAGCATCGATTAAGTCTCA F: Dacty66 (AG) TTGCATTGCGTGATGGAC F: Dacty65 AGACCAGCAAACGAAGTTGG F: (5 sequence Primer Dacty64 Locus umr fbscpplto-eei ttsia aaeesfr2 irstlielc ycollection by loci microsatellite 24 for parameters statistical population-genetic basic of Summary :TCAATTGTACACGGACGAGC R: GCGATACCATGTAGGGCAAGR: GGGTTGGGTTGTTGGTAAAGT R: CATGCATTCCCATCATTCACR: TGTACACGAGCATTGAAGAGC R: GTCTCTAGAATTCGCCCGGA R: CAGCCAGTTGATCATCAGTTC R: CACCAACTCGCCCTATGAGT R: ATGCACCACGCATCTATTTGR: TCAATATCCAGTCTCGCAGC R: TTGAGTGGGCTAGGTGTAGAAA R: GCCATAGAAGCCAGCGAA R: GCCAATCGCTGAGTTTGAA R: TGGGTCAGACTGGATTTCCT R: CCACTTGCATTCCCAGCTA R: TTGTACGTGTTGGTGCGATT R: TTGGTCATTGCTAAGGTTTCC R: 1B 1B 2B 3B 3B 4B 1C 1C 2C 3C C3 C3 C3 C2 C2 C2 C1 C1 C1 B4 B4 B4 B3 B3 B3 B2 B2 B2 B1 B1 B1 ´ -3 ´ eetmtfMlilxPRst utpe C esMlilxPRsets PCR Multiplex sets PCR Multiplex sets PCR Multiplex motif Repeat ) 15 6 7 7 6 6 6 7 7 7 7 6 6 6 7 7 6 6 . PET FAM FAM VIC 0.3 FAM 0.2 PET 0.2 VIC 0.3 PET 0.15 1 0.25 VIC 5 0.15 4 NED 5 0.4 4 0.15 3 3 0.35 2 2 3 .5FAM VIC FAM 0.15 0.25 0.2 1 4 3 NED PET 0.35 0.25 3 4 .5PET VIC 0.25 0.15 5 5 Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. .3 .6 .6 .2 ------1 - 1 - 0.320 1 0.480 - 1 - 0.087 0.640 - - - 0.496 1 0.091 0.400 - 2 1 - 3 2 - 0.461 0.560 2 - - - 0.492 - 0.600 0.305 1 - 1 0.125 2 - - 0.740 3 - 0.600 - 4 - 0.200 0.484 - - - 0.400 3 - 1 0.188 1 - 0.360 - 4 2 - 1 5 - - 1 0.235 0.373 4 - - - 1 0.699 0.180 - 0.063 - - 0.061 0.125 - 2 - - 0.200 - 1 1 - - 0.063 - 4 - - 0.660 6 - 1 2 - 1 - 0.364 1 - 1 0.200 2 - - 0.340 - 0.061 - 1 0.560 0.463 0.463 1 - - 1 - 0.400 0.063 0.560 4 - 1 - 1 0.545 1 - 0.305 - - 0.494 - 0.420 - 1 0.678 1 3 0.430 2 - - 0.250 1 2 0.063 - 0.200 - - 3 0.397 0.545 0.540 0.420 - - - 0.480 - 1 3 - - - 0.541 0.364 2 0.400 0.125 - 5 - 2 2 0.400 4 - - 1 3 0.484 0.364 1 0.463 - - 0.170 0.320 - 2 3 3 1 0.540 1 0.484 1 0.417 0.364 - - 2 2 - 0.063 - - 4 0.482 0.180 0.600 0.430 - - 0.574 0.545 - 1 - 0.219 - 0.647 - 2 0.125 0.200 - 1 0.455 - 2 - - 1 - 0.125 - 0.444 1 3 - 3 1 He - 1 - - 4 - 4 0.760 2 0.504 - - - 3 1 - 1 - 2 2 I1b 0.384 3 - 4 - 0.106 0.400 - - 0.061 0.200 Ho 1 1 - - 0.461 0.346 - 0.364 0.318 - 2 - 1 1 - - 0.056 0.063 - 1 Na I1b - 0.111 - 0.364 - 1 5 4 0.054 - 0.566 ------1 4 1 I1b - 3 - - 0.504 2 0.056 - 1 0.273 - - - - - He 2 0.789 4 1 - - 1 1 0.826 - - 1 0.125 - 1 - - I1a - 0.570 0.909 1 1 - - 2 4 - 0.756 0.727 1 - - 3 - - - Ho 1 - 0.125 1 1 - 6 1 - - 0.569 0.727 1 0.550 - - 1 I1a 7 - - 0.278 - - Na 9 1 1 - - 1 0.793 0.455 - - 1 I1a 3 0.375 - - - 1 - - 7 - 1 - 1 - 0.546 0.843 0.909 - - - 1 - 0.153 - - - - He - 4 1 1 - 0.033 1 0.636 - - 0.245 - 1 1 - 3 - I1 - 6 1 1 2 - 1 0.814 - - - - 1 - 0.420 Ho - - - 7 - - 8 2 1 1 - 0.483 0.909 - - - 1 - - Na I1 1 2 1 - 0.064 - - - 0.545 1 - - 1 - 1 1 - - - - 1 7 1 1 1 - I1 0.667 - - - He - - 2 1 - 0.087 3 1 2 - 1 0.667 - - 1 - - - - 0.091 1 1 - G2 - - - - - Ho - 1 - - - - 4 1 1 - 2 - - Na - 1 - 2 - - - - 1 G2 - 1 1 1 - 1 - - - - G2 1 1 - - 0.031 1 He - - 1 1 - - - - 1 1 - - - 0.031 - - 1 - - - - G1 1 1 1 Ho - - 1 - 1 - 2 - - 1 1 - Na - 1 - 0.153 - G1 - - 1 1 - - - - 1 - 0.167 G1 - 1 1 He 1 - 1 - - - 0.180 - - 1 - 1 - 1 Ho 2 - C5 - - 0.561 1 - Na - 1 1 - 1 C5 0.125 - - - 1 - - 0.404 1 - 0.219 C5 - - 1 - He 2 5 1 - - 1 - 1 Ho 1 1 C4 0.133 - - - - Na - - 1 1 - C4 0.143 - - 1 1 - C4 - 2 2 1 - - 2 1 number - 0.133 = 0.320 - Na - - locus; 0.143 - of - 1 - - alleles - of 1 - number - - total - 1 - = 2 1 2 TNA - - - IDs; H 1 0.320 site site; for 2 1 particular collection - at - - represent - alleles row - of first 1 1 1 the - in - - - Codes - 1 1 - - 1 7 - 2 - - - 5 1 - - 185-203 - 1 - 4 - Dacty99 174-189 1 1 - 1 - - 6 1 Dacty96 110-122 1 6 0.720 - - - Dacty93 126-151 1 1 5 - - Dacty92 92-107 1 - - 1 8 Dacty87 181-196 - 4 4 - Dacty85 143-175 - 1 2 Dacty84 189-203 1 - - 16 1 Dacty79 198-204 5 - Dacty75 108-148 1 6 Dacty73 148-163 8 1 Dacty70 109-133 3 Dacty69 92-119 13 Dacty68 105-109 Dacty67 160-200 Dacty66 ycleto site. collection by (continue). 3 Table .vistulae D. from .squalus S. umr fbscpplto-eei ttsia aaeesfr2 irstlieloci microsatellite 24 for parameters statistical population-genetic basic of Summary O 1B 1B 2B 3B 3B 4B 1C 1C 2C 3C C3 C3 C3 C2 C2 C2 C1 C1 C1 B4 B4 B4 B3 B3 B3 B2 B2 B2 B1 B1 B1 1 aaol for only data = I1b ; bevdhtrzgst;H heterozygosity; observed = .vistulae D. 16 E siae eeoyoiy 1 aaonly data = I1a heterozygosity; estimated = from .muticellus T. Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. iue4. F Figure side; left the 6. on Table are Nei-distances values; zero represent Dashes effective = Ne 5. individual; Table for per only alleles data of = number I1a = H index; from Na index; fixation alleles; diversity = of Shannon’s F number = gosity; total I = alleles; N of ID; number site collection = Pop H site; particular at alleles of number = Na locus; of alleles H of gosity; number total = TNA site. 4. Table vistulae D. 1 .9 .1 .8 .0 .9 .0 .4 .4 .5 .1 .8 0.447 - 0.828 0.794 0.506 0.539 - 1.345 0.800 0.304 1.181 1.703 0.859 0.561 0.474 - 1.014 0.860 0.838 0.574 0.866 1.284 1.152 0.951 0.855 0.388 0.884 0.523 1.716 - 1.149 0.882 0.834 0.373 0.841 0.538 1.731 1.481 0.442 0.889 0.748 0.363 0.849 0.484 0.344 - 1.273 1.590 0.400 0.883 0.768 0.383 0.843 0.487 0.909 0.072 1.255 1.143 0.399 0.776 0.854 0.356 0.806 0.482 0.905 0.957 - 1.380 1.286 1.134 0.509 0.880 0.815 0.377 0.765 0.494 0.897 0.958 1.544 1.330 1.279 1.134 0.482 0.888 0.354 0.850 0.477 0.834 0.946 0.664 - 1.517 1.379 1.312 1.405 0.415 0.873 0.819 0.487 0.809 0.882 0.442 0.070 1.544 1.236 1.280 1.361 0.391 I1b 0.467 0.909 0.850 0.369 0.322 - 0.080 1.387 1.346 1.233 1.141 I1a 0.890 0.959 0.364 0.270 0.048 0.120 1.494 1.384 1.091 G2 0.939 0.619 0.278 0.207 - 0.079 0.117 1.549 1.363 G1 0.415 0.527 0.281 0.059 0.083 0.060 1.534 C5 0.194 0.103 0.197 - 0.085 0.045 0.055 C4 0.195 0.224 0.086 0.005 0.022 C3 0.263 0.281 - 0.057 0.033 C2 0.226 0.084 0.069 C1 0.231 - 0.068 B4 0.031 B3 - B2 B1 .muticellus T. 1B 3B 1C 3C 5G 2IaI1b I1a G2 G1 C5 C4 C3 C2 C1 B4 B3 B2 B1 E ecnaeo aito xlie ytefis he xsuigPo nmcoaelt akr in markers microsatellite on PCoA using axes three first the by explained variation of Percentage arws e-itne n F and Nei-distances Pair-wise ecitv ttsisidctn envle o ai aaeesfrallc yec collection each by loci all for parameters basic for values mean indicating statistics Descriptive siae eeoyoiy 1 aaol for only data = I1a heterozygosity; estimated = from .muticellus. T. . 1 11151010040040040.651 0.443 0.044 0.370 0.424 0.004 0.192 0.083 0.091 0.064 0.636 1.000 0.499 0.048 1.081 1.911 1.000 0.046 0.453 0.153 1.125 2.458 0.939 0.025 0.000 0.966 1.171 11 1.000 0.023 0.000 0.075 2.662 1.417 5 I1b 0.788 0.012 0.001 0.039 1.088 3.917 18 I1a F 0.024 0.000 0.794 0.049 1.039 1.167 10 G2 0.351 0.006 0.019 0.068 1.050 1.083 12 G1 He 1.000 0.045 0.039 1.016 0.007 1.250 10 C5 1.000 0.013 0.019 1.035 1.042 0.115 30 Ho C4 0.043 0.000 0.075 1.083 1.119 6 C3 0.000 0.021 1.063 1.375 7 C2 0.076 1.020 1.208 I 32 C1 1.127 1.042 7 B4 1.167 Ne 5 B3 5 B2 Na B1 N Pop ST ewe niiul rmec ouainpair. population each from individuals between .vistulae D. O 17 bevdhtrzgst;H heterozygosity; observed = from .vistulae D. .squalus S. ST r ntergtside. right the on are from 1 aaol for only data = I1b ; .squalus S. E O siae heterozy- estimated = bevdheterozy- observed = 1 aaol for only data = I1b ; .vistulae D. Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Italy iueAi 3 2 1 Axis Figure 03 38 9.53 13.81 40.32 9.22 19.76 38.57 % % B A u 03 41 63.66 54.13 67.55 40.32 58.33 % Cum 38.57 % Cum Croatia 18 Herzegovina Bosnia and Greece Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. B Mean of est. Ln prob of data A 8000 7000 6000 5000 4000 3000 Delta K 4 0 3 5 2 1 0 2 4 5 6 19 K K 8 10 10 12 14 15 Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. K=3 K=5 K=8 20 I1b I1a B4 B3 B2 B1 G2 G1 C5 C4 C3 C2 C1 Posted on Authorea 21 Jul 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.162683878.89695015/v1 — This a preprint and has not been peer reviewed. Data may be preliminary.

Coord. 2 Coord. 2 B A Principal Coordinates (PCoA) Coord. 1 Coord. 1 21 I1b I1a G2 G1 C5 C4 C3 C2 C1 B4 B3 B2 B1 C3 C2 C1 B4 B3 B2 B1