Proc. Nail. Acad. Sci. USA Vol. 89, pp. 2504-2508, March 1992 Genetics Down-regulation of a member of the S100 gene family in mammary carcinoma cells and reexpression by azadeoxycytidine treatment (cell cycle/chromosome 1/subtractive hybridization/tumor suppressor/demethylation) SAM W. LEE*t, CATHERINE TOMASETTO*, KAREN SWISSHELM*, KHANDAN KEYOMARSIt, AND RUTH SAGER*§ *Division of Cancer Genetics and tDivision of Cell Growth and Regulation, Dana-Farber Cancer Institute and Harvard Medical School, 44 Binney Street, Boston, MA 02115 Contributed by Ruth Sager, November 25, 1991

ABSTRACT A cDNA clone, designated CaN19 (originally tumor development. The gene is cell-cycle-regulated as called clone 19), isolated by subtractive hybridization, contains shown by increased expression as cells enter in S phase and sequences that are preferentially expressed in normal mam- induction by growth factors in early G1 phase. Its expression mary epithelial cells but not in breast tumor cells. Comparison can be altered by A23187 and by 5-aza-2'-deoxycytidine of its deduced amino acid sequence with sequences in the (aza-dCyd). The presence of calcification, an important GenBank data base revealed similarity with the S100 protein marker in early breast cancer, may be a consequence of family, a group of small Ca2+-binding modulator proteins impaired Ca2' metabolism, perhaps influenced by loss ofthis involved in cell cycle progression and cell differentiation. Ca2' binding protein. CaN19 expression is down-regulated in normal cells by A23187, a calcium ionophore, suggesting that its regulation is calcium- dependent. We have assigned CaN19 to human chromosome MATERIALS AND METHODS lq2l-q24, a region containg four other S100-related genes. Cells and Cell Cultures. NMECs (70N, 76N, and 81N) used In contrast to CaN19 mRNA expression, most members of the in this study were established in this laboratory (6) and were S100 protein family are activated or overexpressed in tumor derived from reduction mammoplasty tissues, as were the cells. Synchronization experiments by growth-factor depriva- 21T series (7, 8) and 18-2p-1 (9). Tumor cell lines were tion demonstrated a biphasic induction of CaN19 expression in obtained from American Type Culture Collection (T47D, normal cells, =2-fold in early G, phase and another 2- to 3-fold SKBR3, ZR75-1, MDA-MB-157, MDA-MB-231, MDA-MB- at the G1/S boundary. Exposure of mammary tumor cells to 436, BT20, BT549, Hs578T, and normal Hs578BST). 184N 5-aza-2'-deoxycytidine, an inhibitor of DNA methylation, re- cells (10) were from M. Stampfer (University of California, activated the expression of CaN19 mRNA. Berkeley). The MCF7 line was obtained from the Michigan Cancer Foundation. All mammary cell lines were maintained The process oftumorigenesis involves multiple alterations in in DFCI-1 complete medium (6) or in a-modified minimum gene structure and organization. Genomic changes result in essential medium supplemented with insulin, hydrocorti- altered expression of two classes of genes related to cancer sone, epidermal growth factor, and 10%o (vol/vol) fetal calf development: oncogenes and tumor-suppressor genes (1-3). serum (Hyclone) (7, 8). Other cells used for RNA preparation Identification of genes whose expression is lost in tumor are skin fibroblasts (FS2), mesoendothelial cells (LP-9) (11), cells compared to normal cells should include genes with keratinocytes (J2EP) (11), lymphoma B cells (LS102), hy- tumor-suppressor activity. To isolate such genes, we have bridoma T cells (8A12), macrophages (P388), melanoma cells used subtractive hybridization techniques (4, 5) to screen for (A2058), colon carcinoma cells (CCL228), and PC12 cells. mRNA sequences preferentially expressed in normal human For subculture, cells were washed once with solution A (9) cells. For this purpose, it is necessary to use two closely and trypsinized using 0.0125% trypsin/0.005% EDTA. Tryp- related cell populations and to grow them under the same sin digestion was stopped with 0.0375% soybean trypsin conditions. Recent advances in culture of human mammary inhibitor in solution A. Cells were grown at 37C in a cells and introduction of DFCI-1 medium make possible humidified atmosphere of 6.5% C02/93.5% air. uniform conditions for long-term growth of both normal and In drug tests, exponentially growing cells were treated over tumor-derived mammary epithelial cells (NMECs and a 24-h period with the following agents: 1 mM N6,02'- TMECs, respectively) (6, 7). A subtraction experiment was dibutyryladenosine 3',5'-cyclic monophosphate, 10 ,M for- performed between NMECs (76N) and TMECs (21MT-2) (4). skolin, phorbol 12-myristate 13-acetate at 100 ng/ml, 1 ,uM These cells have been characterized in detail by cellular, retinoic acid, 0.5 ,M A23187, actinomycin D at 5 gg/ml, cytogenetic, and molecular analyses (6-8). cycloheximide at 10 pg/ml, okadaic acid at 5 ng/ml, trans- Here we describe the isolation and initial characterization forming growth factor P at 1 ng/ml, prolactin at 1 mg/ml, 2 ofa gene, CaN19,1 that is preferentially expressed in NMECs nM 8-estradiol, and 1-100 A&M aza-dCyd; all from Sigma compared to TMECs. The predicted amino acid sequence of except transforming growth factor P3 which was from Col- CaN19 cDNA has similarity with members of the S100 gene laborative Research (12). Cells were sampled at intervals and family encoding small calcium binding proteins. The CaN19 total RNA was analyzed by Northern blot hybridization. To gene maps to chromosome 1q21-q24, a region in which four study the effect of aza-dCyd, cells were plated at low density other S100-related genes are also localized. CaN19 is of particular interest because, unlike the other Abbreviations: EGF, epidermal growth factor; HPV, human papil- described S100 genes, it is down-regulated in tumor cells, loma virus; aza-dCyd, 5-aza-2'-deoxycytidine; NMEC, normal rather than being overexpressed. Its loss may be useful in human mammary epithelial cell; TMEC, tumor-derived human mam- monitoring tumorigenesis as a marker for early detection of mary epithelial cell. tPresent address: Division of Cancer Biology, The University of Michigan Medical School, Ann Arbor, MI 48109. The publication costs of this article were defrayed in part by page charge §To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" IThe sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. M87068).

2504 Downloaded by guest on September 24, 2021 Genetics: Lee et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2505 (-25% confluency) and incubated in the presence of various A concentrations of drug for 2 days. Cells were washed, re- 1 2 3 4 5 6 7 8 91011 12 13 1415 treated with drug in fresh medium for another 2 days, and then harvested for RNA analysis (-70% confluency). In a separate experiment, cells were exposed to drug (50 AM) only S once for the first 2 days of the treatment. Synchronization of Normal Cells by Growth-Factor Depri- vation. Cells were plated in 24-well plates at 1 x 104 cells per well. Thirty-six to 48 h after plating, cells were washed, incubated in DFCI-3 medium (7) (DFCI-1 medium omitting B fetal calf serum, bovine pituitary extract, cholera toxin, 1 2 3 4 5 6 7 8 9 10 1112 triiodothyronine, insulin, hydrocortisone, and epidermal growth factor) for another 48 h. Under these conditions, cells - 5.5 become quiescent (3G0) as determined by lack of Ki-67 anti- 'S body staining and [ H]thymidine incorporation (13). At time C 0, cells were stimulated by the addition of DFCI-1 complete 1 2 3 4 5 6 7 8 9 10 medium. DNA synthesis rate was estimated by measuring the V - 6.6 incorporation of [3H]thymidine (13). - 4.2 DNA and RNA Analysis. Genomic DNA or total RNA was isolated from human mammary epithelial cells as described 2.3 (4). Poly(A)+ RNA was purified by selecting over oligo(dT)- cellulose (Collaborative Research). cDNA was synthesized FIG. 1. Characterization of a CaN19/clone 19 in NMECs and TMECs. (A) Gel electrophoresis of total RNA (20 ,Ag per lane) from with the Moloney murine leukemia virus reverse transcrip- exponentially growing cells, transferred, and hybridized with a tase according to BRL instructions. Southern blot analysis of 32P-labeled CaN19 cDNA (upper lanes) and a 36B4 probe (18) as a DNAs was carried out according to Maniatis et al. (14). For loading control (lower lanes), showing a 0.55-kb transcript in normal Northern blot analysis, total RNA (20 ,ug per lane) was (70N, 76N, and 81N) and human papilloma virus-transformed cells denatured, fractionated on an agarose/formaldehyde gel (1- (18-2P-1) (lanes 1-3 and 15, respectively), a weak signal in 21PT and 1.3%), and transferred to Zeta-Probe nylon membrane (Bio- 21NT (primary tumors; lanes 4 and 5, respectively), and none in nine Rad). Hybridization conditions were as described (4). tumor cell lines (lanes 6-14). (B) Expression of CaN19 mRNA in Isolation of a CaN19 cDNA Clone. Subtractive hybridiza- different types of cells. Total RNA (20 j&g) hybridized with a 32P-labeled CaN19 cDNA probe. Expression (5.5-kb band) is limited tion was performed to isolate sequences preferentially ex- to NMECs and keratinocytes. Lanes: 1, 81N; 2, skin fibroblasts; 3, pressed in NMECs, as described (4). CaN19 was recovered mesoendothelial cells; 4, keratinocytes; 5, lymphoma B cells; 6, as a full-length cDNA clone from the 76N library and hybridoma T cells; 7, macrophages; 8, myoepithelial cells; 9, mela- sequenced using standard dideoxynucleotide sequencing noma cells; 10, colon carcinoma cells; 11, PC12 cells; 12, PC12 cells techniques (15). GenBank data bases (September 24, 1991) plus nerve growth factor. (C) Analysis of genomic DNA isolated were used (16) for subsequent sequence analysis and se- from NMECs and TMECs. High molecular weight genomic DNA (10 quence comparison. ,ug) was digested with BamHI restriction enzyme, size-fractionated In Situ Chromosomal Hybridization. Metaphase chromo- by electrophoresis, transferred to a nylon membrane (Nytran, Schlei- somes were prepared from phytohemagglutinin-stimulated cher & Schuell), and hybridized with 32P-labeled CaN19 cDNA. A single band (3.2 kb) was detected in all cell lines used. Lanes: 1, 70N; male peripheral blood lymphocytes grown for 72 h in RPMI 2, 76N; 3, 18-2P-1; 4, 21NT; 5, MCF7; 6, ZR75-1; 7, T47D; 8, 1640 medium/20% (vol/vol) fetal calf serum. Cells were HBL100; 9, MDA-MB-436; 10, MDA-MB-468. incubated in Colcemid at 0.1 gg/ml (GIBCO) for 2 h, cen- trifuged, resuspended in 0.075 M KCI (hypotonic) at 37°C for papilloma virus-immortalized cell line (18-2p-1) and faintly 12 min, and fixed in methanol/acetic acid, 3:1 (vol/vol). For expressed in patient-derived primary TMEC lines (21PT and in situ hybridization well-spread metaphases were hybridized 21NT). No detectable RNA was found in the TMEC lines of to 3H-labeled CaN19 probe (specific activity = 3.7 x 107 metastatic origin. cpm/,g) as described (17). Approximately 30,000 cpm (1-2 A labeled CaN19 cDNA probe was hybridized to a North- ng) were hybridized per slide. Emulsion-coated slides were ern blot of RNA from NMECs (81N), skin fibroblasts, exposed at 4°C for 7-12 days. After development, slides were B stained with quinacrine mustard and chromosomes were mesoendothelial cells, keratinocytes, lymphoma cells, identified for Q banding by fluorescence photomicroscopy. hybridoma T cells, macrophages, myoepithelial cells, mela- The silver grains were colocalized by transmitted light. noma cells, colon carcinoma cells, PC12 cells, and PC12 cells treated with nerve growth factor. CaN19 mRNA was de- tected only in NMECs and keratinocytes (Fig. 1B), indicating RESULTS that the expression of CaN19 mRNA is restricted to a subset Identification of a cDNA Clone (CaN19) from Subtractive of epithelial cells. Hybridization Between NMECs and TMECs. The single- To examine the possibility of deletion or gross rearrange- stranded subtracted cDNA enriched for sequences expressed ment in the CaN19 gene, genomic DNA was isolated from in normal cells was labeled and used to screen -40,000 various NMECs and TMECs, digested with restriction en- recombinant plaques of a 76N cDNA library. Several hun- zymes (BamHI, Bgl I, or Taq I), and subjected to Southern dred of the most intensely hybridizing plaques were then blot analysis. The same restriction patterns of CaN19 DNA screened by differential hybridization with the subtracted with each enzyme were observed in both NMECs and cDNA probe vs. the tumor-specific cDNA. Fifty clones were TMECs. A single band was detected in digests of various recovered, and 2 clones corresponded to an mRNA of 0.55 NMECs and TMECs (-3.2 kb in the BamHI digest, Fig. 1C; kilobase (kb) (CaN19). data not shown for Bgl I or Taq I digests), indicating that Characterization ofa CaN19 Clone. A test set ofRNAs from CaN19 is present and shows no detectable gross rearrange- NMECs and TMECs was used to determine the pattern of ment in tumor cells. expression of CaN19. As shown in Fig. 1A, Northern blot Sequence Analysis Identifies CaN19 as a Member of the S100 analysis revealed a mRNA species of 0.55 kb, abundantly Protein Family. Both strands of the full-length CaN19 cDNA expressed in NMECs (70N, 76N, and 81N) and in human were sequenced. The nucleotide sequence and the predicted Downloaded by guest on September 24, 2021 2506 Genetics: Lee et al. Proc. Natl. Acad. Sci. USA 89 (1992)

amino acid sequence of CaN19 cDNA are shown in Fig. 2A. A 36.3- B An open reading frame of 297 nucleotides was identified that encodes a putative protein of 99 amino acid residues with a 36- predicted molecular mass of -10 kDa. Comparison of the peptide sequence of CaN19 with the GenBank data base 32 -

(September 24, 1991) (16) revealed its homology to the S100 - gene family (Fig. 2B). CaN19 and 18A2/mtsl/pEL98 show the highest degree of similarity (63%). Significant similarity is 22 - also found with SlOOa and -13 (53%), with calcyclin/2A9/ 21- f 5B10/PRA (48%), with P11/calpactin and MRP8/CFAg (37%). *- 11- Based on hydropathy plots and secondary structure pre- 12 - dictions, hydrophobic regions at 5' and 3' termini, which are 21 - _ a common structural motif of S100 family proteins (20, 21), are present in the CaN19 amino acid sequence. The inferred 24-- peptide of CaN19 contains two calcium-binding domains, EF - hands (Fig. 2B), which are a common structural feature of 31-fl S100 family proteins and different from members of the calmodulin family, which has four EF hands (20-22). 32- De Chromosomal Location of CaN19 by in Situ Mapping. 41-I

CaN19 was mapped on human metaphase chromosomes by - - in situ hybridization with a 3H-labeled cDNA probe. Sixty- 44 eight metaphases were analyzed for the presence of the silver grains. A total of 87 grains were unambiguously identified for FIG. 3. In situ mapping of CaN19 gene. (A) Distribution of silver localization. Seventeen out of 87 grains (20%) were found on grains over chromosome 1. The majority hybridize to 1q21-24. (B) In chromosome 1. Twelve out of 17 (71%) were localized to situ hybridization. (Upper) Transmitted light image to visualize silver 1q21-32, with the majority (53%) in the region of lq21-q24 grains. (Low) Fluorescent image used to identify chromosome bands. (Fig. 3A). As shown in Fig. 3B, most cells exhibited one grain on a single chromosome. A number of studies have reported The CaN19 mRNA increased -2-fold within 2 h after that the chromosome lq region, particularly 1q12-ter, has growth-factor stimulation (Go/G1 phase). This first increase structural and numerical aberrations in human breast carci- was maintained at a steady-state level until the beginning of nomas (23-26). S phase, when a second increase occurred from 10 to 20 h, in Expression of CaN19 mRNA in Synchronized Cells. Fig. 4 parallel with DNA synthesis. After cessation of DNA syn- shows the regulated expression of CaN19 mRNA NMECs thesis, the high steady-state level of CaN19 mRNA was (70N) synchronized by growth-factor deprivation. After 48 h maintained in G2 phase. of growth-factor starvation, cells were restimulated to pro- Effect ofDrug Treatments or CaN19 mRNA Expression. The liferate by adding back the growth factors and samples were steady-state levels of mRNA were examined by Northern taken at indicated times for Northern blot analysis of CaN19 blot analysis with RNA extracted from NMECs and TMECs gene expression. The progress of the cells through the cell at various time points (0, 1, 3, 6, 12, and 24 h) after each drug cycle was monitored both by [3H]thymidine incorporation treatment. Additions of N6,02'-dibutyryladenosine 3',5'- and by the levels of histone H4 mRNA in Northern blot cyclic monophosphate, forskolin, phorbol 12-myristate 13- analysis. Histone H4 was induced dramatically at 16 h in S acetate, retinoic acid, actinomycin D, cycloheximide, or phase. The time of appearance of the histone H4 mRNA okadaic acid were without noticeable effect on the level of coincided with the peak period of DNA synthesis, 16-20 h, expression of CaN19 mRNA in NMECs and TMECs (data as measured by [3H]thymidine incorporation (Fig. 4). not shown). However A23187, a calcium ionophore, down- A 1 CTGGGTCTGTCTCTGCCACCTGGTCTGCCACAGATCCATGATGTGCAGTTCTCTGGAGCAGGCGCTGGCTGTGCTGGTC 1 M M C S S L E Q A L A V L V 80 ACTACCTTCCACAAGTACTCCTGCCAAGAGGGCGACAAGTTCAAGCTGAGTAAGGGGGAAATGAAGGAACTTCTGCACA 15 T T F H K Y S C Q E G D KF K L S K G E M K E L L H K 159 AGGAGCTGCCCAGCTTTGTGGGGGAGAAAGTGGATGAGGAGGGGCTGAAGAAGCTGATGGGCAACCTGGATGAGAACAG 42 E L P S F V G EK V D E E G L KK L M G N L D E N S 238 TGACCAGCAGGTGGACTTCCAGGAGTATGCTGTTTTCCTGGCACTCATCACTGTCATGTGCAATGACTTCTTCCAGGGC 67 D Q Q V DF 0 E Y A V F L A L I T V M C N D F F Q G 317 TGCCCAGACCGACCCTGAAGCAGAACTCTTGACTCCCTGCCATGGATCTCTTGGGCCCAGGACTGTTGATGCCTTTGAG 94 C P D R P - 396 TTTTGTATTCAAIAACTTTTTTTGTCTGTTGAAAAAAAAAAAAUAA

B FIG. 2. (A) Nucleotide and predicted 99- CaN19 MCSSLEQALAVL VTTFHKYSCQ EGDKFKLSKG EMKELLHKEL PSFVGEKVDE amino acid sequence of CaN19 cDNA. The S100a -G-E--T-MET- INV--AH-GK ----Y----K -L----QT-- SG-LDAQK-A presumptive start and stop codons are in bold- SlOOb -A-E--K-VVA- IDV--Q--GR ---- H--K-S -L--- INN-- SH-LE- IKEQ 18A2 -ARP--E--D- I -S------GK ------N-T -L----TR-- --- LFKRT-- faced type and the putative polyadenylylation 2A9 -ACP-D-- IGL- -AI-----GR ----HT---K -L--- IQ--- TIGSKLQDA- signal is underlined (AATAAA). (B) Compari- P1l -P-QM-H-METM ML---RFA.. ..---DH-T-E DLRV-MER-F -G-LENQK-P amino acid of MRP8 -LTE--K--NSI IDVY----LI K-NFHAVYRD DL-K--ET-C -QYIRK-GAD son of the predicted sequences ICaBP -A-. - KSPEEM KSI-Q--AAK ---PNQ---E -L-L-IQS-F -NLLKASSTL CaN19 (clone 19), S100a and -13, 18A2/mtsl/ pEL98/PRA/42A, 2A9/5B10/calcyclin, p1l, CaN19 EGLKKLMGNL DENSDQQVDF QEYAVFLALI TVMCNDFFQG CPDRP MRP8/CFAg, and ICaBP (intestine calcium- SlOa DAVD-V-KE- --DG-GE------V-LV-AL --A--N--WE NS binding protein) (19). The identical amino acid SlOOb -VVD-V-ET- -SDG-GEC-- --FMA-V-M- TTA-HE--EH E 1 8A2 AAFQ-V-S-- -S-R-NE------C---SC- AM---E--E- ---KE-RKK residues are indicated as dashes; gaps have been 2A9 IARLMED..- -R-K--E-N- ---VT--GAL ALIY-EALK- added for alignment. Asterisks indicate the P1l LAVD-I-KD- -QCR-GK-G- -S...--S-V AGLTIACNDY FVVNMKQKGK K amino acid residues involved in the interaction MRP 8 VWF-E.....- - I-T-GA-N- --FLILVIKM AWQPTKKAMK KATKSS ICaBP DN-FEE.. .- -K-D-GE-SY E-FE--FKKL SQ with calcium ion. Downloaded by guest on September 24, 2021 Genetics: Lee et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2507 A days. These results suggest that DNA methylation plays a 0 2 4 6 8 10 12 16 2024 28 hrs direct negative role in suppressing CaN19 gene expression in tumor cells. ft i._ UC a CaN 19 DISCUSSION

* X Clone 19, now called CaN19, was isolated by subtractive _ -* H4 hybridization between NMECs and TMECs. The level of CaN19 was shown to correlate inversely with tumor progres- O *a* - ---36B4 sion, since primary tumor cells had a trace of expression whereas metastatic tumor cells had none. Southern blot analysis showed no detectable deletion or rearrangement in B the genomic region of either NMECs or TMECs. 0 These and similar results with other genes isolated by

a.- T- 0:L - subtractive hybridization (4) have led to a hypothesis distin- - b- guishing two classes of tumor suppressor genes. Genes of '5 2 CO 2*_ classI, such as RB, p53, and Wilms tumor (WTI), are mutated L. or deleted in tumor cells, whereas candidate suppressor . QL genes of class II, such as Cx26, NB-1, and GSTII, are .0C) E U down-regulated in tumor cells, presumably by mutations of a 0) > S regulatory gene, leaving their structure intact (4). We show here that CaN19 is a class II candidate tumor LL. suppressor gene on the basis of two lines of evidence: (i) its 0 4 8 12 16 20 24 28 Time, h expression correlates with tumor progression and (ii) it can be reexpressed in tumor cells by treating cells with aza-dCyd, FIG. 4. Cell-cycle-specific expression of CaN19 in NMECs (70N) presumably by decreasing methylation. synchronized by growth-factor deprivation. (A) Northern blot anal- CaN19 as a Calcium-Binding Protein. Comparison of the ysis of RNA from cells synchronized by growth-factor deprivation. deduced amino acid sequence of CaN19 cDNA revealed Total RNA was extracted at indicated times (0-28 h); 5 ug of RNA similarities with the S100 protein family. Structural organi- was loaded per lane. Blot was hybridized with CaN19, 36B4 (used as zation ofthe CaN19 protein based on hydropathy plots is also internal loading control) (18), or histone 4 (H4) probe (13). (B) Levels similar to members of the S100 protein family (20). These of expression of CaN19 mRNA in synchronized and restimulated proteins have two EF-hand calcium-binding domains that cells (M) and DNA synthesis rate measured by[3H]thymidine incor- contain invariant amino acid residues forming a loop with an poration (o). The CaN19 bands from each indicated time point in A were scanned with a laser densitometer, normalized to 36B4 loading a-helical structure (20,21). Also N- and C-terminal regions of control bands. these proteins contain conserved hydrophobic amino acid domains (20, 21), demonstrating that the overall hydropho- regulated the expression of CaN19 in normal cells (Fig.5A), bicity of this family including CaN19 is well conserved. suggesting that expression of CaN19 mRNA is regulated in a The calcium concentration is an important regulator of Ca2+-dependent manner. Exposure of TMECs to aza-dCyd many eukaryotic cell functions, participating in signal trans- induced the reexpression of CaN19-specific RNA (Fig.5B), duction, differentiation, growth control, and other processes (20). Thus the proteins that bind calcium are important in whereas the level of expression of CaN19 in normal cells was many biochemical and physiological regulatory processes. not affected by aza-dCyd treatment. Although the last three The best characterized Ca2+ binding proteins are calmodulin lanes were underloaded (as shown by the 18S loading control) and troponin C, which are primary mediators of cellular expression of CaN mRNA was induced even by 1,M responses to Ca2+ signals through direct interaction with aza-dCyd within 4 days of treatment and by 50 AM within 2 particular enzymes (27). There are several abundant small Ca2' binding proteins A 76N whose roles are poorly understood. They may function to 0 1 3 6 12 24 h protect against excess calcium in cells. Since CaN19 DNA contains two EF-hand consensus regions for calcium binding, CaN19 we postulate that the CaN19 gene product may act as a modulator against excess calcium accumulation in NMECs. -18S Calcification, an important marker in mammography, is often regarded as an early indicator of breast cancer. The loss of B 76N 21 MT-2 CaN19 expression in tumor cells may contribute to calcifi- 0 50100 0 1 10255010050 pM cation.

*t CaN19 In contrast to our findings, it is important to note that the levels of expression of other members of the S100 protein ~ -18S group increase with the metastatic potential of tumor cells: (i) mtsl/18A2/pEL98 (63% homology to CaN19) shows in- creased expression with a higher degree of metastasis in FIG. 5. Effect of drugs on expression of CaN19. (A) CaN19 mouse mammary carcinoma or leukemia cells whereas nor- mRNA expression in Ca2" ionophore (A23187)-treated or untreated mal or transformed cells have very low expression levels (20, NMECs (76N). At each time point, RNA was extracted and analyzed 28-30); (ii) SlOca and -,8 proteins are expressed in brain on a Northern blot (20 Ag of total RNA per lane). The ethidium tumor progression (31, 32); (iii) calcyclin/2A9/5B10/PRA, bromide-stained 18S RNA from each lane is shown as loading associated with cell-cycle expression or differentiation, also control. (B) Expression of CaN19 RNA in aza-dCyd-treated or shows enhanced expression with tumor untreated NMECs (76N) and TMECs (21MT2). RNA was extracted progression (20, from exponentially growing cells treated with various concentrations 33-35); (iv) MRP8/CFAg is expressed at high levels and of aza-dCyd and subjected to Northern blot analysis. deregulated in leukemic leukocytes (36); (v) P11/calpactin is *Treatment at ,uM50 only for the first 2 days. a substrate for phosphorylation by tyrosine kinase pp60src Downloaded by guest on September 24, 2021 2508 Genetics: Lee et al. Proc. Natl. Acad. Sci. USA 89 (1992)

(37). These findings suggest that the expression patterns of 3. Stanbridge, E. J. (1990) Annu. Rev. Genet. 24, 615-657. 4. Lee, S. W., Tomasetto, C. & Sager, R. (1991) Proc. Natl. Acad. Sci. various members of this Ca2l binding protein family are USA 88, 2825-2829. altered in tumor development. 5. Yancopoulos, G. D., Oltz, E. M., Rathbun, G., Berman, J. E., Smith, In addition, selective inhibition of S100(3 protein by an- R. K., Lansford, R. D., Rothman, P., Okada, A., Lee, G., Morrow, M., tisense constructs has demonstrated important in vivo roles Kaplan, K., Prockop, S. & Alt, F. W. (1990) Proc. Nadl. Acad. Sci. USA 87, 5759-5763. ofthe S100(3 gene in glial cells and resulted in three alterations 6. Band, V. & Sager, R. (1989) Proc. Natl. Acad. Sci. USA 86, 1249-1253. in cellular phenotype characteristic of normal cells: a de- 7. Band, V., Zajchowski, D., Swisshelm, K., Trask, D., Kulesa, V., Cohen, crease in cell growth, a flattened cell morphology, and a more C., Connolly, J. & Sager, R. (1990) Cancer Res. 50, 7351-7357. 8. Band, V., Zajchowski, D., Stenman, G., Morton, C. C., Kulesa, V., organized microfilament network (31). More recent studies Connolly, J. & Sager, R. (1989) Genes Chromosomes Cancer 1, 48-58. showed that treating serum-starved glioma tumor cells with 9. Band, V., Zajchowski, D., Kulesa, V. & Sager, R. (1990) Proc. Natl. S100,3 protein stimulated proliferation and increased the Acad. Sci. USA 87, 463-467. levels of mRNA expression of c-myc and c-fos protoonco- 10. Hammond, S. L., Ham, R. G. & Stampfer, M. R. (1984) Proc. Natl. Acad. Sci. USA 81, 5435-5439. genes, suggesting that SlOOp, protein has mitogenic activity 11. Connell, N. D. & Rheinwald, J. D. (1983) Cell 34, 245-253. on selected cell types (32). In contrast, CaN19 shows a 12. Lee, T. H., Lee, G. W., Ziff, E. B. & Vilcek, J. (1990) Mol. Cell. Biol. significant reduction of expression with tumor progression, 10, 1982-1988. 13. Keyomarsi, K., Sandoval, L., Band, V. & Pardee, A. B. (1991) Cancer implying that CaN19 product may play a role in suppressing Res. 51, 3602-3609. tumor cell growth. 14. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A We have mapped the location of CaN19 gene to chromo- Laboratory Manual(Cold Spring Harbor Lab., Cold Spring Harbor, NY). some Four 15. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nat!. Acad. Sci. lq21-q24. other genes involved in calcium func- USA 74, 5463-5467. tion have been localized to this region: calcyclin/2A9 (1q21- 16. Pearson, W. R. & Lipman, D. J. (1988) Proc. Natl. Acad. Sci. USA 85, q25) (38), calgranulins A and B (lql2-q22) (39), and MRP8/ 2444-2448. CFAg (lql2-q22) (40). This region has been of interest in 17. Kranz, D. M., Saito, H., Disteche, C. M., Swisshelm, K., Pravtcheva, D., recent cytogenetic studies on breast cancer Ruddle, F. H., Eisen, H. N. & Tonegawa, S. (1985) Science 227, 941-945. because of the 18. Laborda, J. (1991) Nucleic Acids Res. 19, 3998. frequent loss of heterozygosity or deletions in chromosome 19. Wasserman, R. & Talor, A. (1966) Science 152, 791-793. 1 (q21-qter) (23-26). Also, SlOa and calpain have been 20. Kligman, D. C. & Hilt, D. C. (1988) Trends Biochem. Sci. 13, 437-443. mapped but not localized to chromosome 1 (41, 42). 21. Heizmann, C. W. & Hunziker, W. (1991) Trends Biochem. Sci. 16, 98-103. Cell Cycle Regulation. Synchronization experiments by 22. Kretsinger, R. (1980) CRC Crit. Rev. Biochem. 8, 119-174. growth-factor deprivation showed a biphasic induction of 23. Kovacs, G. (1981) Cancer Genet. Cytogenet. 3, 125-129. CaN19 in mRNA in NMECs in G phase and in S phase: 2-fold 24. Trent, J. M. (1985) Breast Cancer Res. Treat. 5, 221-229. in early G1 phase perhaps a proliferation stimulus response 25. Ferti-Passantonopoulou, A. D. & Panani, A. D. (1987) Cancer Genet. Cytogenet. 27, 289-298. (4) and 2.5-fold increase at the start of S phase, which is 26. Chen, L.-C., Dollbaum, C. & Smith, H. (1989) Proc. Natl. Acad. Sci. probably cell-cycle-regulated, because its increase occurs USA 86, 7204-7207. after the growth-factor-induced effects have taken place. In 27. Cheung, W. Y. (1980) Science 207, 19-27. other studies with these NMECs, it is shown that cdc2, cyclin 28. Ebralidze, A., Tulchinski, E., Grigorian, M., Afanasyeva, A., Senin, V., Revazova, E. & Lukanidin, E. (1989) Genes Dev. 3, 1086-1093. A, and cyclin B mRNAs are elevated in G2 phase (K.K., 29. Barraclough, R., Savin, J., Dube, S. K. & Rudland, P. S. (1987) J. Mol. unpublished data), a time when CaN19 is at its highest Biol. 198, 13-20. steady-state level. The timing is consistent with a require- 30. Goto, K., Endo, H. & Fujiyoshi, T. (1988) J. Biochem. 183, 48-53. ment for CaN19 expression prior to the G2 activity of cdc2. 31. Selinfreund, R. H., Barger, S. W. &Welsh, M. J. (1990)J. CelBiol. 111, 2021-2028. Some members of the S100 protein family are also serum- 32. Selinfreund, R. H., Barger, S. W., Pledger, W. J. & Van Eldik, L. J. inducible (43). They are, however, deregulated and consti- (1991) Proc. Natl. Acad. Sci. USA 88, 3554-3558. tutively expressed in malignant cells. 33. Calabretta, B., Kaczmarek, L., Mars, W., Ochoa, D., Gibson, C. W., Aza-dCyd Induces CaN19 Expression in Tumor Cells. De- Hirschhorn, R. R. & Baserga, R. (1985) Proc. Natl. Acad. Sci. USA 82, 4463-4467. creased DNA methylation is a consistent feature of tumori- 34. Murphy, L. C., Murphy, L. J., Tsuyuki, D., Duckworth, M. L. & Shiu, genesis (44), but local sites of hypermethylation have also R. P. C. (1988) J. Biol. Chem. 263, 2397-2401. been found in tumor cells (44, 45). Elevated expression ofthe 35. Guo, X., Chambers, A. F., Parfett, C. L. J., Waterhouse, P., Murphy, DNA methyltransferase gene has been described in progres- L. C., Reid, R. E., Craig, A. M., Edwards, D. R. & Denhardt, D. T. a mech- (1990) Cell Growth Differ. 1, 333-338. sion stages of colon cancer (46), suggesting general 36. Dorin, J., Novak, M., Hill, R., Brock, D., Secher, D. & van Heyningen, anism for hypermethylation but not explaining the specificity L. J. V. (1987) Nature (London) 326, 614-617. seen on particular genes. Hypermethylation provides a po- 37. Hagiwara, M., Ochiai, M., Owada, K., Tanaka, T. & Hidaka, H. (1988) tential means for the silencing of tumor suppressor genes J. Biol. Chem. 13, 6438-6441. 38. Ferrari, S., Calabretta, B., DeRiel, J., Battni, R., Ghezzo, F., Lauret, E., during oncogenesis. The inhibition ofCaN19 gene expression Griffin, C., Emanuel, B., Gurrieri, F. & Baserga, R. (1987) J. Biol. Chem. and its reexpression induced by aza-dCyd reported here may 262, 8325-8332. be an example. Since aza-dCyd is a well-established DNA 39. Dorin, J. R., Inglis, J. D. & Porteous, D. J. (1989) Science 243, 1357-1360. demethylating agent, it is very likely that treatment with this 40. Ohno, S., Minoshima, S., Kudoh, J., Fukuyama, R., Shimuzu, Y., Ohmi-Imajoh, S., Shimuzu, N. & Suzuki, K. (1990) Cytogenet. Cell drug demethylated transcription binding sites in CaN19 and Genet. 53, 225-229. possibly in other unidentified genes as well. Hypermethyla- 41. Dorin, J. R., Emslie, E. & van Heyningen, V. (1990) Genomics 8, tion of tumor suppressor genes poses a challenging thera- 420-426. peutic question: how to alter methylation and, thereby, 42. Morii, K., Tanaka, R., Takahashi, Y., Minoshima, S., Fukuyama, R., Shimizu, N. & Kuwano, R. (1991) Biochem. Biophys. Res. Commun. 175, restore gene expression at specific sites. Systemic treatment 185-191. with aza-dCyd itself is toxic and tumorigenic (47, 48). 43. Hafbauer, R. & Denhardt, D. T. (1991) Crit. Rev. Eukaryotic Gene Exp. 1, 247-300. We thank Anthony Anisowicz for fruitful advice; Drs. J. Rhein- 44. Jones, P. A. & Buckley, J. D. (1990) Adv. Cancer Res. 54, 1-23. wald, K. Rock, L.-B. Chen, and J. Wagner for providing cells; and 45. Baylin, S. B., Fearon, E. R., Vogelstein, B., de Bustros, A., Sharkis, A., Susan Harper for preparing the manuscript. C.T. is a recipient of Burke, P. J., Staal, S. P. & Nelkin, B. D. (1987) Blood 70, 412-417. 46. El-Deiry, W. S., Nelkin, B. D., Celano, P., Yen, R.-W. C., Falco, J. P., French Institut National de la Sante et de la Recherche Medicale Hamilton, S. R. & Baylin, S. B. (1991) Proc. Natl. Acad. Sci. USA 88, fellowship. This work was supported by National Institutes of Health 3470-3474. Grant CA39814 to R.S. 47. Harrison, J. J., Anisowicz, A., Gadi, I. K., Raffeld, M. & Sager, R. (1983) Proc. Nat!. Acad. Sci. USA 80, 6606-6610. 1. Sager, R. (1989) Science 246, 1406-1412. 48. Carr, B. I., Reilly, J. G., Smith, S. S., Winberg, C. & Riggs, A. (1984) 2. Marshall, C. J. (1991) Ce!! 64, 313-326. Carcinogenesis 5, 1583-1590. Downloaded by guest on September 24, 2021