sign in sign up
<<
Home , Calgranulin, Neurogranin, S100A8, S100G, S100P, S100 protein

NEW MECHANISMS MODULATING

EXPRESSION

By

Yasumi Endoh

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

Faculty of Medicine

The University of New South Wales

2008

Dedicated to my wife, Ikuko, who shared the good and bad times with me during my PhD project

ii ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

COPYRIGHT STATEMENT

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………......

iii TABLE OF CONTENTS

TABLE OF CONTENTS...... iv LIST OF TABLES...... vii LIST OF FIGURES...... viii ABBREVIATIONS ...... x ACKNOWLEDGEMENTS...... xv PUBLISHED WORK FROM THIS THESIS...... xvi ABSTRACT ...... xvii 1. INTRODUCTION...... 1

1.1. BINDING ...... 1 1.2. S100 PROTEINS...... 2 1.2.1. Discovery of S100 proteins ...... 2 1.2.2. Evolution of S100 proteins...... 3 1.2.3. Structure of S100 proteins ...... 6 1.3. FUNCTIONS OF S100 PROTEINS ...... 9 1.3.1. Intracellular functions ...... 11 1.3.2. Extracellular functions ...... 20 1.4. S100 PROTEINS AND HUMAN DISEASE...... 23 1.5. S100 PROTEINS AND ANIMAL MODELS...... 26 1.6. S100A8 AND ...... 28 1.6.1. Purification and characterization...... 28 1.6.2. Molecular genetics and structure of S100A8 and S100A9...... 30 1.6.3. Polymerization of S100A8/S100A9 ...... 33 1.6.4. binding properties...... 35 1.6.5. Post-translational modifications...... 35 1.6.5.1. Modification of S100A8...... 36 1.6.5.2. Modification of S100A9...... 37 1.6.6. Distribution of S100A8/S100A9 complexes in cells and tissues...... 38 1.6.7. Possible mechanisms of S100A8/S100A9 secretion and potential clinical relevance...... 46 1.7. FUNCTIONS OF S100A8 AND S100A9...... 48 1.7.1. Intracellular functions ...... 50 1.7.1.1. Modulation of intracellular calcium...... 50 1.7.1.2. Arachidonic acid transport...... 51 1.7.1.3. Differentiation and development ...... 52 1.7.1.4. Modulation of the cytoskeleton ...... 56 1.7.1.5. Regulation of NADPH oxidase...... 57 1.7.2. Extracellular functions of S100A8 and S100A9...... 58 1.7.2.1. S100A8/S100A9 receptors ...... 59 1.7.2.2. Cytostatic and pro-apoptotic roles ...... 61 1.7.2.3. Effects of S100A8/S100A9 on leukocyte adhesion, chemotaxis and cell migration ...... 63 1.7.2.4. Oxidant-scavenging properties ...... 69 1.7.2.5. Inhibition of immunoglobulin synthesis ...... 70 1.7.2.6. Interactions with matrix metalloproteinases (MMPs)...... 70 1.8. DISEASES ASSOCIATED WITH ELEVATED S100A8/S100A9 EXPRESSION...... 71 1.9. TRANSCRIPTION OF THE S100A8 GENE...... 80 1.9.1. Proximal promoter elements of S100 ...... 82 1.9.2. Distal enhancer/suppressor elements ...... 84 1.9.2.1. Enhancer elements...... 84 1.9.2.2. Repressor elements...... 87 1.9.3. Deletion analysis of the murine S100A8 promoter region...... 88 1.10. MECHANISMS REGULATING S100A8 ...... 89 1.10.1. Different S100A8 inducers among cell types ...... 91 1.10.2. Mechanisms mediating S100A8 induction ...... 91 1.10.2.1. Toll-like receptor signalling...... 92 1.10.2.2. Lipopolysaccharide-mediated activation ...... 98 1.10.2.3. DNA and single-stranded RNA mediated activation...... 102 1.10.2.4. Fibroblast growth factor-2 mediated activation ...... 103 1.10.3. Enhancers of S100A8 gene induction...... 104

iv 1.10.3.1. Interleukin-10 ...... 104 1.10.3.2. Modulation of macrophage response by cAMP and PGE2 ...... 110 1.10.3.3. Steroid influence S100A8 gene expression ...... 111 1.10.4. Suppressors of S100A8 expression ...... 112 2 GENERAL METHODS ...... 116

2.1 GENERAL CELL CULTURE...... 116 2.2 RNA PURIFICATION ...... 120 2.3 REAL-TIME QUANTITATIVE PCR...... 121 2.4 DUAL LUCIFERASE REPORTER ASSAY...... 122 2.5 PREPARATION OF POLYCLONAL ANTIBODIES ...... 122 2.6 WESTERN BLOT ANALYSIS ...... 123 2.7 ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA)...... 123 2.8 STATISTICAL ANALYSIS ...... 124 3 KNOCKDOWN OF S100A8 WITH RNA INTERFERENCE ...... 125

3.1 INTRODUCTION ...... 125 3.1.1 Small interfering RNA (siRNA) ...... 126 3.1.2 History of siRNA and microRNA...... 126 3.1.3 Mechanism of siRNA and miRNA function...... 127 3.1.4 Application of siRNA for S100A8 silencing...... 131 3.2 MATERIAL AND METHODS ...... 132 3.2.1 Design of siRNAs to reduce murine S100A8 ...... 132 3.2.2 Production of siRNA...... 138 3.2.3 Construction of pcDNA 6.2/ EmGFP-mA8 expression vector...... 140 3.2.4 Transfection of siRNAs and plasmids...... 140 3.2.5 Design and production of miRNA lentiviral expression vectors...... 141 3.2.6 Proliferation assay ...... 145 3.3 RESULTS ...... 145 3.3.1 Delivery of siRNAs to NIH3T3 cells...... 145 3.3.2 Transfection of murine S100A8 siRNA into NIH3T3 cells ...... 147 3.3.3 Delivery of siRNAs to RAW cells...... 149 3.3.4 Enzymatically-synthesized siRNA transfection induces S100A8 ...... 151 3.3.5 Suppression of S100A8 induction by chemically-synthesized siRNA ...... 153 3.3.6 Establishment of cell lines stably silencing the S100A8 gene...... 155 3.3.7 THP-1 and MCF-7 cell lines expressing miRNAs for human S100A8 ...... 155 3.3.8 Expression of S100A8 in transfected cells...... 158 3.3.9 Silencing the S100A8 gene did not affect MCF-7 growth ...... 160 3.3.10 S100A8 induction in MCF-7 cells is PKR-mediated ...... 160 3.4 DISCUSSION ...... 161 3.4.1 siRNA system to suppress murine S100A8 ...... 161 3.4.2 Enzymatically-synthesized siRNAs ...... 164 3.4.3 miRNA_HuA8 did not suppress LPS- induced S100A8 in THP-1 cells...... 165 3.4.4 Oncostatin M induces S100A8 in MCF-7 cells and is suppressed by miRNA ...... 167 3.4.5 Inhibition of S100A8 mRNA did not affect OSM-induced growth inhibition...... 168 3.4.6 miRNA and tumor cell lines...... 169 4. GENE REGULATION OF S100A8 BY DSRNA...... 170

4.1. INTRODUCTION ...... 170 4.1.1. Double-stranded RNA and cell signalling...... 171 4.2. MATERIAL AND METHODS...... 176 4.2.1. Monocyte isolation of from human peripheral blood...... 177 4.2.2. Murine peritoneal ...... 177 4.2.3. Influenza virus infection to BALB/c mice ...... 178 4.2.4. Immunohistochemistry...... 178 4.3. RESULTS ...... 179 4.3.1. Synthetic double stranded RNA induces S100A8, but not S100A9 ...... 179 4.3.2. Characterization of poly(I:C) – induced S100A8 expression...... 181 4.3.3. R mediates poly(I:C)-induced IL-10 and S100A8 mRNA ...... 183 4.3.4. IFN- enhanced S100A8 induced by poly(I:C) ...... 184 4.3.5. Identification of poly(I:C)-responsive regions in the S100A8 promoter ...... 185 v 4.3.6. Influenza A virus induced S100A8 in epithelial cells in murine lung in vivo...... 186 4.3.7. Poly(I:C)-induces S100A8/S100A9 and in human monocytes...... 188 4.3.8. S100A8/S100A9 and S100A12 expression in SARS ...... 190 4.4. DISCUSSION...... 191 4.4.1. S100A8 is induced by an IL-10-dependent pathway ...... 192 4.4.2. Pathways involved in signalling to induce IL-10 and S100A8...... 193 4.4.3. Transcription factors involved in dsRNA signalling...... 195 4.4.4. Induction of S100 proteins by viral infection in vivo ...... 197 4.4.5. Summary ...... 199 5. GENE REGULATION OF S100A8 VIA MITOCHONDRIA ...... 200

5.1. INTRODUCTION...... 200 5.1.1. Reactive oxygen and nitrogen species ...... 201 5.1.2. Regulation of cell signalling by ROS ...... 204 5.1.3. Mitochondrial electron transport chain and generation of ATP ...... 205 5.1.4. Purinergic receptor signalling...... 206 5.2. MATERIAL AND METHODS ...... 208 5.3. RESULTS...... 209 5.3.1. Does H2O2 regulate S100A8 gene induction? ...... 209 5.3.2. Does NADPH oxidase regulate S100A8 induction by LPS?...... 211 5.3.3. Involvement of mitochondrial ROS and ATP in S100A8 induction...... 212 5.3.4. The mitochondrial pathway is involved in IL-10 induction by LPS ...... 214 5.3.5. S100A8 is suppressed by a COX-2 metabolite produced in the resolution phase of inflammation ...... 216 5.3.6. Exogenous ATP enhances S100A8 mRNA induction by LPS...... 217 5.3.7. Identification of the promoter region involved ...... 217 5.4. DISCUSSION...... 219 5.4.1. Involvement of H2O2 in S100A8 regulation...... 219 5.4.2. Are flavin-containing enzymes involved in S100A8 induction? ...... 220 5.4.3. Involvement of the mitochondrial electron transport chain in S100A8 induction ...... 222 5.4.4. Extracellular ATP enhances IL-10 and S100A8 production...... 225 5.4.5. Mitochondrial electron transport chain regulates S100A8 promoter activity ...... 226 5.4.6. Potential involvement of intracellular ATP in S100A8 induction...... 227 5.4.7. Anti-inflammatory pathways in macrophages ...... 228 5.4.8. Summary ...... 230 6. GENERAL DISCUSSION...... 231

6.1. “TWO PATHWAYS” MODEL FOR LPS- INDUCED S100A8 EXPRESSION ...... 232 6.2. THE “DANGER THEORY” AND S100A8 ...... 237 6.3. FUNCTIONS THAT MAY BE MEDIATED BY S100A8...... 239 6.4. CONCLUDING REMARKS ...... 241 7. REFERENCES...... 243 APPENDIX I: CHEMICALS AND REAGENTS...... 307 APPENDIX II: EQUIPMENT...... 311

vi LIST OF TABLES

TABLE 1- 1: DISCOVERY OF S100 PROTEINS ...... 2 TABLE 1- 2: NOMENCLATURE AND ACRONYMS OF THE S100 CALCIUM BINDING PROTEIN GENES .4 TABLE 1- 3: CHROMOSOMAL LOCATION OF THE S100 GENES IN HUMAN AND MOUSE ...... 5 TABLE 1- 4: ALTERED EXPRESSION OF SOME S100 PROTEINS IN RESPONSE TO STIMULATION .... 11 TABLE 1- 5: -DEPENDENT PROTEIN PHOSPHORYLATION ...... 13 TABLE 1- 6: S100 PROTEIN-DEPENDENT REGULATION OF ENZYME ACTIVITIES ...... 15 TABLE 1- 7: INTERACTIONS BETWEEN S100 PROTEINS AND CYTOSKELETAL CONSTITUENTS...... 17 TABLE 1- 8: EXTRACELLULAR FUNCTION OF S100 PROTEINS ...... 21 TABLE 1- 9: S100 PROTEINS IN HUMAN DISEASE ...... 24 TABLE 1- 10: GENETICALLY ENGINEERED S100 MURINE MODELS ...... 26 TABLE 1- 11: MONOCLONAL ABS AGAINST HUMAN S100A8/S100A9 HETERODIMER COMPLEXES ...... 29 TABLE 1- 12: GENERAL STRUCTURAL PROPERTIES OF HUMAN AND MURINE S100A8 AND S100A9 ...... 32 TABLE 1- 13: POST-TRANSLATIONAL MODIFICATIONS OF S100A8 AND S100A9 ...... 35 TABLE 1- 14: DISTRIBUTION OF S100A8/S100A9 IN NORMAL TISSUE...... 38 TABLE 1- 15: DISTRIBUTION OF S100A8/S100A9 ...... 39 TABLE 1- 16: SECRETION OF S100A8/ S100A9 FROM ACTIVATED CELLS IN VITRO ...... 46 TABLE 1- 17: S100A8/S100A9 CONCENTRATIONS IN VARIOUS BODY FLUIDS...... 48 TABLE 1- 18: FUNCTIONS OF S100A8/S100A9...... 50 TABLE 1- 19: CHEMOTACTIC S100 PROTEINS ...... 64 TABLE 1- 20: COMPARISONS OF FUNCTIONAL RESPONSES OF MURINE NEUTROPHILS TO CHEMOATTRACTANTS...... 65 TABLE 1- 21: S100A8/S100A9 AND HUMAN DISEASE...... 72 TABLE 1- 22: HUMAN CANCER CELL LINES AND S100A8/S100A9 EXPRESSION ...... 79 TABLE 1- 23: INDUCERS AND ENHANCERS OF S100A8 GENE EXPRESSION ...... 90 TABLE 1- 24: EXOGENOUS LIGANDS OF TLRS ...... 93 TABLE 1- 25: PUTATIVE ENDOGENOUS LIGANDS OF TLRS ...... 93 TABLE 1- 26: TIR-DOMAIN-CONTAINING ADAPTOR PROTEINS ...... 96 TABLE 1- 27: MYD88-DEPENDENT AND INDEPENDENT TLR SIGNALLING PATHWAYS...... 96 TABLE 1- 28: SUPPRESSORS OF S100A8 GENE INDUCTION/EXPRESSION...... 113 TABLE 2- 1: CULTURE CONDITIONS OF CELL LINES ...... 117 TABLE 2- 2: SPECIFIC AND NON-SPECIFIC INHIBITORS UNSED INTHIS PROJECT ...... 117 TABLE 2- 3: PRIMERS AND CONDITIONS USED FOR REAL-TIME RT-PCR AMPLIFICATION ...... 122 TABLE 3- 1: (A) CANDIDATES OF SIRNA FOR MURINE S100A8 BASED ON SIRNA TARGET FINDER AND DESIGN TOOL ...... 135 TABLE 3- 1: (B) COMPATIBILITY OF MOUSE S100A8 SIRNAS WITH UI-TEI’S AND REYNOLDS’ CRITERIA ……………………………………………………………………………………….....135 TABLE 3- 2: CONDITIONS OF SIRNA/PLASMID TRANSFECTION...... 140 TABLE 3- 3: OLIGONUCLEOTIDE TEMPLATES OF MIRNA TO TARGET THE HUMAN S100A8 GENE ...... 143 TABLE 4- 1: CULTURE CONDITIONS OF PRIMARY CELLS ...... 177 TABLE 5- 1: PURINERGIC RECEPTOR SUBTYPES AND PHYSIOLOGIC LIGANDS/IMMUNE CELL DISTRIBUTION ...... 208 TABLE 6- 1: S100A8 IN FEATURES OF DAMPS ...... 239

vii LIST OF FIGURES

FIGURE 1- 1: S100 CHROMOSOMAL CLUSTERS...... 3 2+ FIGURE 1- 2: STRUCTURE OF THE CA -LOADED NON-COVALENT DIMER...... 7 FIGURE 1- 3: S100 DIMER WITH TARGET PROTEINS...... 8 FIGURE 1- 4: EXON/INTRON STRUCTURES OF THE HUMAN S100A8 AND S100A9 GENES ...... 31 FIGURE 1- 5: SEQUENCE SIMILARITY AMONG S100A8, S100A9 AND S100A12 ...... 33 FIGURE 1- 6: PROPOSED STRUCTURE AND MECHANISM OF FORMATION OF LYS35-CYS41 SULFINAMIDE BOND ...... 36 FIGURE 1- 7: DIFFERENTIATION AND DISTRIBUTION OF MONONUCLEAR PHAGOCYTES ...... 40 FIGURE 1- 8: MACROPHAGE POLARIZATION PARADIGM...... 41 FIGURE 1- 9: MURINE S100A8 OXIDIZATION AND CHEMOTACTIC ACTIVITY...... 67 FIGURE 1- 10: COMPARISON OF PROMOTER ELEMENTS IN THE HUMAN AND MURINE S100A8 GENES ...... 81 FIGURE 1- 11: PUTATIVE PROMOTER ELEMENTS IDENTIFIED IN THE MURINE S100A8 GENE ...... 82 FIGURE 1- 12: TLR3, TLR4, TLR7/8 AND TLR9 SIGNALLING PATHWAYS...... 95 FIGURE 1- 13: SIGNALLING PATHWAYS ACTIVATED BY FGF-2...... 104 FIGURE 1- 14: INTERFERENCE OF LPS-INDUCED TRANSCRIPTION OF PRO-INFLAMMATORY MEDIATORS BY IL-10 ...... 108 FIGURE 3- 1: RNA INTERFERENCE...... 128 FIGURE 3- 2: A MODEL FOR MIRNA BIOGENESIS AND FUNCTION...... 130 FIGURE 3- 3: THE TARGET REGIONS OF SIRNAS FOR MURINE S100A8 ...... 137 FIGURE 3- 4: RELATIONSHIP BETWEEN LUCIFERASE SIRNA SEQUENCE AND LUCIFERASE GENES ...... 137 FIGURE 3- 5: SIRNA CONSTRUCTION PROCEDURE ...... 139 FIGURE 3- 6: TARGET REGIONS OF MIRNA FOR HUMAN S100A8...... 141 FIGURE 3- 7: STRUCTURAL FEATURES OF PRE-MIRNAS AND MIRNAS ...... 142 FIGURE 3- 8: GENERATION OF LENTIVIRUS ...... 144 FIGURE 3- 9: DELIVERY OF SIRNA TO NIH3T3 FIBROBLASTS...... 146 FIGURE 3- 10: ENZYMATICALLY-SYNTHESIZED LUCIFERASE SIRNA SUPPRESSED LUCIFERASE GENES...... 146 FIGURE 3- 11: EFFECTS OF SIRNA ON S100A8 MRNA EXPRESSION IN NIH 3T3 CELLS ...... 147 FIGURE 3- 12: CONFLUENCE-DEPENDENT INDUCTION OF S100A8 MRNA IN NIH3T3 FIBROBLASTS...... 149 FIGURE 3- 13: EFFECTS OF ENZYMATICALLY-SYNTHESIZED GAPDH AND MA8_61 SIRNA IN NIH 3T3 CELLS...... 149 FIGURE 3- 14: TRANSFECTION METHODS TO DELIVER SIRNA TO RAW CELLS ...... 150 FIGURE 3- 15: TRANSFECTION OF ENZYMATICALLY-SYNTHESIZED SIRNA ENHANCED S100A8 INDUCTION ...... 151 FIGURE 3- 16: EFFECTS OF CHEMICALLY AND ENZYMATICALLY-SYNTHESIZED GAPDH SIRNA ON S100A8 MRNA EXPRESSION ...... 152 FIGURE 3- 17: EFFECTS OF IFN- ON S100A8 MRNA INDUCTION BY LPS...... 153 FIGURE 3- 18: EFFECTS OF CHEMICALLY-SYNTHESIZED SIRNA ON S100A8 MRNA EXPRESSION DRIVEN BY A MURINE S100A8-GFP EXPRESSION VECTOR IN NIH3T3 CELLS ...... 153 FIGURE 3- 19: EFFECTS OF CHEMICALLY-SYNTHESIZED SIRNA ON S100A8 MRNA IN ACTIVATED CELLS154 FIGURE 3- 20: EXPRESSION OF EMGFP IN THP-1 CELLS ...... 156 FIGURE 3- 21: EXPRESSION OF EMGFP IN MCF-7 CELLS ...... 157 FIGURE 3- 22: EXPRESSION OF S100A8 IN MIRNA-TRANSFECTED THP-1 CELLS ...... 158 FIGURE 3- 23: S100A8 MRNA IS INDUCED BY OSM IN MCF-7 CELLS ...... 159 FIGURE 3- 24: EXPRESSION OF S100A8 IN MIRNA-TRANSFECTED MCF-7 CELLS ...... 159 FIGURE 3- 25: S100A8 MIRNA DID NOT ALTER GROWTH OF MCF-7 CELLS ...... 160 FIGURE 3- 26: PKR IS INVOLVED IN S100A8 INDUCTION IN MCF-7 CELLS ...... 160 FIGURE 4- 1: TLR3 SIGNALLING ...... 172 FIGURE 4- 2: DOMAIN MAP FOR THE DSRNA-DEPENDENT PROTEIN KINASE, PKR...... 173 FIGURE 4- 3: ACTIVATORS OF PKR ...... 174 FIGURE 4- 4: INDUCTION OF S100A8 MRNA BY POLY(I:C), POLY C AND POLY I ...... 180 FIGURE 4- 5: POLY(I:C)-INDUCED S100A8 MRNA IS LATER THAN IL-10 MRNA INDUCTION ...... 181 FIGURE 4- 6: PATHWAYS INVOLVED IN POLY(I:C)-ACTIVATED S100A8 ARE DIFFERENT TO THAT OF LPS ...... 181 FIGURE 4- 7: S100A8 INDUCTION IS IL-10-DEPENDENT ...... 182 FIGURE 4- 8: PKR IS IMPLICATED IN S100A8 MRNA UPREGULATION...... 183 FIGURE 4- 9: IFN- INVOLVED IN S100A8 INDUCTION BY POLY(I:C)...... 184 FIGURE 4- 10: IDENTIFICATION OF POLY(I:C)-RESPONSIVE REGIONS IN THE MURINE S100A8 PROMOTER.185

viii FIGURE 4- 11: S100A8 IMMUNOSTAINING OF LUNG TISSUES FROM BALB/C MICE INFECTED WITH INFLUENZA A VIRUS ...... 187 FIGURE 4- 12: POLY(I:C) INDUCES S100 MRNA IN HUMAN MONOCYTES ...... 188 FIGURE 4- 13: PKR AND IL-10 ARE INVOLVED INDSRNA-INDUCED S100 MRNA IN HUMAN MONOCYTES ...... 189 FIGURE 4- 14: BRAIN SECTIONS FROM A PATIENT WITH SARS INFECTION EXPRESS S100 PROTEINS ...... 191 FIGURE 5- 1: PUTATIVE MODEL OF ROS-INDUCED SIGNALLING PATHWAYS ...... 204 FIGURE 5- 2: PRODUCTION OF SUPEROXIDE BY THE MITOCHONDRIAL ELECTRON-TRANSPORT CHAIN...... 206 FIGURE 5- 3: HYDROGEN PEROXIDE INVOLVEMENT IN REGULATION OF S100A8 INDUCTION...... 210 FIGURE 5- 4: NADPH OXIDASE INHIBITORS SUPPRESSED S100A8 MRNA INDUCTION ...... 211 FIGURE 5- 5: NO IS NOT INVOLVED IN S100A8 INDUCTION...... 212 FIGURE 5- 6: MITOCHONDRIAL ELECTRON TRANSPORT IS REQUIRED FOR S100A8 INDUCTION BY LPS .... 213 FIGURE 5- 7: ATP GENERATED BY THE MITOCHONDRIAL ELECTRON TRANSPORT IS INVOLVED IN S100A8 GENE INDUCTION...... 213 2+ FIGURE 5- 8: THE MITOCHONDRIAL CA EXCHANGER DOES NOT MAKE A MAJOR CONTRIBUTOR TO S100A8 INDUCTION BY LPS...... 214 FIGURE 5- 9: MITOCHONDRIAL TRANSPORT CHAIN IS INVOLVED IL-10 INDUCTION BY LPS ...... 215 FIGURE 5- 10: THE MITOCHONDRIAL TRANSPORT CHAIN IS NOT INVOLVED IN COX-2 INDUCTION BY LPS ...... 216 FIGURE 5- 11: S100A8 IS SUPPRESSED BY THE LATE PHASE COX-2 METABOLITE PGJ2 ...... 216 FIGURE 5- 12: EXOGENOUS ATP AND ITS METABOLITES INCREASE S100A8 INDUCTION ...... 217 FIGURE 5- 13: IDENTIFICATION OF DPI-RESPONSIVE REGIONS IN THE MURINE S100A8 PROMOTER...... 218 FIGURE 5- 14: ANTIMYCIN A, ROTENONE AND DPI INHIBIT THE MITOCHONDRIAL ELECTRON-TRANSPORT CHAIN ...... 222 FIGURE 5- 15: EFFECTS OF INHIBITING THE UNCOUPLING PROTEIN (UCP) ON MITOCHONDRIAL ELECTRON TRANSPORT ...... 223 FIGURE 5- 16: PROPOSED MODEL FOR INTERACTION OF ATP IN LPS-SIGNALLING...... 228 FIGURE 5- 17: PROPOSED MODEL OF S100A8 GENE REGULATION ...... 230 FIGURE 6- 1: TWO PATHWAYS MODEL FOR LPS-INDUCED S100A8 EXPRESSION...... 233 FIGURE 6- 2: S100A8 IN THE DANGER MODEL...... 238 FIGURE 6- 3: PUTATIVE MODEL FOR S100A8 INDUCTION IN LPS-ACTIVATED MACROPHAGES...... 242

ix ABBREVIATIONS AA arachidonic acids ACD acid citrate-dextrose AP-1 activator protein 1 2-AP 2-aminopurine ATCC American Type Culture Collection ATP adenosine triphosphate BMC bone marrow cell ºC degree Celsius Ca calcium 2+ [Ca ]i intracellular calcium concentration CaBP calcium binding proteins CaM KII Ca2+/-dependent protein kinase II CaSR Ca2+ -signaling receptor cAMP cyclic AMP cDNA complementary DNA CF cystic fibrosis CFTR cystic fibrosis transmembrane conductance regulator CGD chronic granulomatous disease ChIP chromatin immunoprecipitation CHX cycloheximide CICR Ca2+-induced Ca2+ release CpG cytosine guanine dinucleotide CRE CREB binds the response element CREB cAMP-response element binding protein CRP C-reactive protein Cu copper CHX cycloheximide COX-2 cyclooxygenase-2 DAMP damage-associated molecular pattern DC dendritic cells ddH2O double-autoclaved distilled water DEX dexamethasone DMSO dimethylsulphoxide dsRNA double-stranded RNA DTH delayed-type hypersensitivity DTT dithriothrietol

x EC endothelial cells ECM EDC epidermal differentiation complex EDTA ethylene-diamine-tetraacetate eIF2 eukaryotic initiation factor 2 EmGFP emerald green fluorescent protein EMSA electrophoretic mobility shift assays eNOS endothelial nitric oxide synthase EPC ectoplacental cone ER endoplasmic reticulum ERK extracellular signal-regulated kinase EmGFP emerald green fluorescent protein FAD flavin adenine dinucleotide FGF fibroblast growth factors fMLP N-formyl-Met-Leu-Phe GAP-43 growth associated protein-43 GAPDH glyceraldehyde-3-phosphate dehydrogenase GC glucocorticoid GCSF granulocyte colony-stimulati ng factor GFAP glial fibrillary acidic protein GM-CSF granulocyte- macrophage colony-stimulating factor GRE glucocorticoid response element HMGB1 high mobility group box 1 HMWK high molecular weight kininogen HIV human immunodeficiency virus

H2O2 hydrogen peroxide HPRT hypoxanthine phosphoribosyltransferase HSPG heparan sulphate proteoglycans ICaBP intestinal Ca2+-binding protein IF intermediate filament IFN interferon IFN- interferon- IFN- interferon- IFN- interferon- IgG Immunoglobulin G IKK IB kinase IL-1 interleukin-1 xi IL-10 Interleukin-10 IRF IFN regulatory factor ISG IFN-stimulated genes ISRE IFN-sensitive response element iNOS inducible nitric oxide synthase JAK Janus tyrosine kinase JIA juvenile idiopathic arthritis JNK c-jun NH2-terminal kinase LPS lipopolysaccharide mAb monoclonal antibody MAPK mitogen-activate d protein MARCKS myristoylated alanine-rich C kinase substrate MDA5 differentiation-associated gene 5 MF filament/microfilament miRNA microRNA MIP-1 membrane inflammatory protein-1 MMP matrix metalloproteinases MPO myeloperoxidase mRNA messenger RNA mtNOS mitochondrial nitric oxide synthase MRP migration inhibitory factor-related protein MT microtubules MyD88 myeloid differentiation factor 88 NAC N-acetylcysteine NADPH nicotinamide adenine dinucleotide phosphate NDR2 Nuclear Dbf2-related protein kinase 2 NF-B nuclear factor-B NIF neutrophil-immobilizing factor nNOS neuronal nitric oxide synthase NO nitric oxide NOD nucleotide-binding oligomerization domain NOS nitric oxide synthase OCl- hypochlorite oligo oligonucleotide OONO peroxynitrite ORF open reading frame OSM Oncostatin M

xii PAF platelet-activating factor PAGE polyacrylamide gel electrophoresis PAMP pathogen-associated molecular pattern PBMC peripheral blood mononuclear cells PDGF platelet-derived growth factor PG prostaglandin

PLA2 phospholipase A2 PKC protein kinase C PKR dsRNA-activated protein kinase R PMA phorbol 12-myristate 13-acetate PMN polymorphonuclear Poly(I:C) polyinosinic acid-polycytidylic acid pri-miRNA primary miRNAs PRR pattern recognition receptor PsA psoriatic arthritis PTH parathyroid PTPN1 protein tyrosine phosphatase nonreceptor type 1 RA rheumatoid arthritis RAGE receptor for advanced glycation end products RANTES regulated on activation, normal, T-cell expressed and secreted RAR retinoic acid receptor RIG-I retinoic acid-inducible gene I RISC RNA-induced silencing complex RLH RNA helicase receptor RSNO S-nitrosothiols RNAi RNA interference RNI reactive nitrogen intermediates RNS reactive nitrogen species ROI reactive oxygen intermediates ROS reactive oxygen species SARS severe acute respiratory syndrome SDS sodium dodecyl sulphate siRNA small interfering RNA SLE systemic lupus erythematosis SOCS suppressor of cytokine signaling SOD superoxide dismutase SP1 specificity protein 1

xiii SPF specific-pathogen free SR sarcoplasmic reticulum ssRNA single-stranded RNA STAT signal transducer and activator of transcription Syn-1 -1 TBP TATA binding protein TG Thioglycollate TGF- transforming growth factor TIR Toll–IL-1 receptor TLR Toll-like receptor TRIF TIR domain-containing adaptor-inducing IFN- TNF- tumor necrosis factor- TPA 12-O-tetradecanoyl-13-phorbolacetate t-PA tissue-type plasminogen activator UCP uncoupling protein

Vitamine D3 1, 25-dihydroxy vitamin D3 Zn zinc 2+ [Zn ]i intracellular zinc concentration

xiv ACKNOWLEDGEMENTS

I would like to sincerely and cordially express my immense indebtedness to so many of my kind teachers, colleagues, collaborators and friends. Firstly, I am profoundly obliged to my supervisor, Professor Carolyn Geczy and my joint- supervisor, Dr Kenneth Hsu for giving me the opportunity to undertake my PhD under their excellent expertise and valuable guidance; I am thankful for their invaluable discussions and advice, insightful comments and warmhearted encouragement. I am very grateful to Professor Ian C Clark and Ms Alison Budd in School of and Molecular Biology, Australian National University for their collaboration and for allowing me to present their unpublished data. I am grateful to Professor Roland Stocker in Vascular Research Laboratory, University of Sydney and Dr Shane Thomas in Centre for Vascular Research, University of New South Wales for help, valuable discussions and advice on experiments concerning redox signalling and provision of valuable reagents; Dr Mark Hill in Cell Biology Laboratory, University of New South Wales for allowing us to use their PC2 facility for experiments using viral vectors. Special thanks go to Drs Farid Rahimi, Nicodemus Tedla, Taline Hampartzoumian and Zheng Yang for their guidance in method related to tissue culture, cell biology and molecular biology; Mr Jesse Goyette and Ms Esther Lim for their advice and help with the experimental techniques in protein chemistry and for provision and upkeep of a friendly, comfortable, informal and professional work place. I am thankful to Mr Lincoln Gomes and Ms Yuen Ming Chung for their support, encouragement and company. I am unable to express my indebtedness to all the past members of Cytokine Research Unit, University of New South Wales. I also thank every member of the Inflammatory Diseases Research Unit, University of New South Wales. I also appreciate the support from various members of the School of Medical Sciences, the University of New South Wales; in particular, I am especially grateful to Ms Soo Han Chup and Lai Nguyen. I also thank Drs Akihiro Nakagomi, Kensuke Ishii, Professor Hirotsugu Atarashi and Professor Teruo Takano in the first Department of Internal Medicine, Nippon Medical School for giving me the great opportunity to study under Professor Carolyn Geczy. Lastly, I thank my family for their support, love, and embrace, for the wings they provided me to grow under, through all my years, here and there. I would like to acknowledge the Australian Government for the financial support (Postgraduate research scholarship (IPRS); 2004 New South Global Scholar) during my PhD candidature.

xv PUBLISHED WORK FROM THIS THESIS

Kenneth Hsu, Robert J. Passey, Yasumi Endoh, Farid Rahimi, Peter Youssef, Tina Yen, and Carolyn L. Geczy. Regulation of S100A8 by glucocorticoids. J Immunol 2005, 174: 2318–2326

Farid Rahimi, Kenneth Hsu, Yasumi Endoh, Carolyn L. Geczy. FGF-2, IL-1 and TGF- regulate fibroblast expression of S100A8. FEBS J 2005; 272: 2811–2827

Kenneth Hsu, Yasumi Endoh, and Carolyn L Geczy. Bacterial DNA induces S100A8 in macrophages through IL-10 and PGE2-dependent pathways (Submitted to J Immunol)

Yasumi Endoh, Carolyn L Geczy, Ian C Clark, Kenneth Hsu. S100A8 is induced in macrophages by dsRNA via IL-10- and PKR-dependent pathway (in preparation)

Yasumi Endoh, Kenneth Hsu, Shane Thomas, Yuen Ming Chung, Roland Stocker, Carolyn L Geczy. Involvement of a mitochondrial pathway in S100A8 gene induction by LPS-activated macrophages (in preparation)

ABSTRACTS (presenting authors' names underlined) Carolyn L. Geczy, Kenneth Hsu, Ikuko Endoh, Wei Xing Yan, Yasumi Endoh and Nicodemus Tedla. S100 proteion: potential regulators of mast cell and monocyte function in asthma.8th World Congress on Inflammation, Copenhagen, 2007

Yaumi Endoh, Kenneth Hsu, P. Youssef, Carolyn. L Geczy. Corticosteroids upregulate S100A8 gene expression (The Australian Health and Medical Research Congress, Sydney, November 2004)

Yasumi Endoh, Kenneth Hsu, Carolyn. L Geczy. Common and distinct signaling cascades regulate induction of the anti-inflammatory protein S100A8 by dsRNA and LPS in monocytes/ macrophages (The 30th Annual Conference of the Australasian Society for Immunology Conference, Auckland, December 2006)

Yasumi Endoh, Kenneth Hsu, Carolyn L. Geczy. Common and distinct signaling cascades regulate induction of the anti- inflammatory protein S100A8 by ds-RNA and LPS in monocytes/ macrophages (The Australian Society for Medical Research NSW Scientific Meeting 2007, Sydney, June 2007)

xvi ABSTRACT

S100A8 is a highly-expressed calcium-binding protein in neutrophils and activated macrophages, and has proposed roles in myeloid cell differentiation and host defense. Functions of S100A8 are not fully understood, partly because of difficulties in generating S100A8 knockout mice. Attempts to silence S100A8 gene expression in activated macrophages and fibroblasts using RNA interference (RNAi) technology were unsuccessful. Despite establishing validated small interfering RNA (siRNA) systems, enzymatically- synthesized siRNA targeted to S100A8 suppressed mRNA levels by only 40% in fibroblasts activated with FGF-2+heparin, whereas chemically-synthesized siRNAs suppressed S100A8 driven by an S100A8-expression vector by ~75% in fibroblasts. Suppression of the gene in activated macrophages/fibroblasts was low, and some enzymatically-synthesized siRNAs to S100A8, and unrelated siRNA to GAPDH, induced/enhanced S100A8 expression in macrophages. This indicated that S100A8 may be upregulated by type-1 interferon (IFN). IFN- enhanced expression, but did not directly induce S100A8. Poly (I:C), a synthetic dsRNA, directly induced S100A8 through IL-10 and IFN-dependent pathways. Induction by dsRNA was dependent on RNA-dependent protein kinase (PKR), but not cyclooxygenase-2, suggesting divergent pathways in LPS- and dsRNA-induced responses. New mechanisms of S100A8 gene regulation are presented, that suggest functions in anti-viral defense. S100A8 expression was confirmed in lungs from influenza virus-infected mice and from a patient with severe acute respiratory syndrome (SARS). Multiple pathways via mitochondria mediated S100A8 induction in LPS-activated macrophages; Generation of reactive oxygen species via the mitochondrial electron transport chain and de novo synthesis of ATP may be involved. This pathway also regulated IL-10 production, possibly via PKR. Extracellular ATP and its metabolites enhanced S100A8 induction. Results support involvement of cell stress, such as transfection, in S100A8 expression. A tumor cell line (MCF-7) in which the S100A8 gene was silenced, was established using micro RNA technology; S100A8 induction by oncostatin M was reduced by >90% in stably-transfected cells. This did not alter MCF-7 growth. The new approach to investigate the role of S100A8 in a human tumor cell line may assist in exploring its functions and lead to new studies concerning its role in cancer.

xvii

1. INTRODUCTION

The S100 proteins belong to a large Ca2+-binding protein family implicated in various cellular processes including Ca2+ homeostasis, protein phosphorylation, cell proliferation and migration. Among the S100 proteins a heterodimer of two of these, S100A8 and S100A9, originally discovered as macrophage migration inhibitory factor-related proteins (MRP) expressed by neutrophils, have emerged as important inflammation-associated mediators in acute and chronic inflammation. Recently, increased S100A8 and S100A9 levels were detected in various human cancers, presenting abundant expression in neoplastic tumor cells and infiltrating immune cells. Although numerous functions are proposed for S100A8/S100A9, their true biological roles in vivo are still being defined. In this section, their structural characteristics, gene structure, cellular expression, calcium-induced translocation to cellular compartments and release from cells is reviewed. Recent developments regarding intra- and extracellular functions of S100A8 and a brief review of the clinical relevance of these proteins will be discussed.

1.1. Calcium binding proteins

Calcium-coupled responses initiated by binding of ligands to cell surface receptors

2+ results in rises in [Ca ]i. Increased calcium binds intracellular calcium-binding proteins such as calmodulin which contain EF-hand motifs to alter structure and facilitate interactions with target proteins such as protein kinases, phosphatases, and ion transport proteins. These target proteins regulate numerous intracellular signalling pathways, leading to the complex activation of transcription factors responsible for cellular responses to external stimuli. Thus, diverse processes are influenced by calcium binding to a variety of intracellular calcium-binding proteins. There are four major classes of intracellular calcium-binding proteins distinct from phospholipase C and protein kinase C (PKC); the EF-hand family, which are calcium- modulated signalling proteins, the family which are calcium- and phospholipid-binding proteins, cytoskeletal calcium-binding and actin-modulating proteins, and high-capacity calcium storage proteins within the endoplasmic reticulum (ER) (reviewed in (1)).

The EF-hand superfamily includes calmodulin, , troponins, calcium-

1 binding protein (CaBP), profillagrin, and S100s, which share the structurally- related modular Ca2+ binding motif (reviewed in (2-4)). Profillagrin and trichohyalin (5) are larger proteins containing an S100/intestinal Ca2+-binding protein (ICaBP)-type motif and represent ‘‘fused genes’’ of S100 protein followed at the 5’ end by tandem peptide repeats typical of multifunctional epidermal matrix proteins (5, 6). Among the EF-hand superfamily,

S100 proteins comprise the largest group (7), and based on functional evidence, it is widely believed that these proteins are calcium responsive in cells.

1.2. S100 proteins

1.2.1. Discovery of S100 proteins

The history of discovery in S100 proteins is shown in Table 1-1. In 1965, Moore described the first members of the S100 protein family from a mixture of previously unknown proteins purified from bovine brain. These were called ‘‘S100’’ because of their solubility in 100% ammonium sulphate solution at neutral pH (8). Subsequent studies demonstrated that this protein mixture contained predominantly two polypeptides, S100Al and S100B (9, 10).

Table 1- 1: Discovery of S100 proteins

Year of S100 protein discovery Source References / S100B 1965 Bovine brain tissue (8) 1989 Bovine lung (11) / 1993 Sequence analysis of S100 gene cluster (12) 1983 cDNA isolated from growth-factor-stimulated cells (13, 14) 1986 cDNA isolated from growth-factor-stimulated (15) fibroblasts 1991 Psoriatic skin (16) S100A8 / S100A9 1980 Purified from granulocytes (17) 1985 Bovine intestinal (18) 1991 Chicken gizzard smooth muscle (19) S100A12 1994 Porcine granulocytes (20) 1996 cDNA discovered by database searches for S100 (21) members 2002 Human cell line subtraction cDNA (22) library / / 2003 Transcriptome database searches of human, mouse (2) S100A17 and rat genome 1967 Rat intestinal mucosa (23) 1992 Human placenta (24) S100Z 2001 Human prostate tissue (25) 1997 mRNA isolated from murine skin papillomas (6)

2 Since the isolation and characterization of these proteins, new S100 proteins were found and a number of acronyms were used. In 1995, a new nomenclature was established (26). S100 genes located within the cluster on human 1q21 are designated by consecutive

Arabic numbers placed behind the stem symbol S100A, and S100 genes from other chromosomal regions carry the stem symbol S100 followed by a single letter, such as S100B and S100P. Nonfunctional pseudogenes identified recently are designated by the symbol of the functional homologue suffixed with P. Genes that are highly similar to a known gene, and whose functional relevance is unknown, should be assigned the suffix L, such as S100A7L1 to

L4 which represent newly-identified copies of the S100A7 gene ((27), reviewed in (28)). Table

1-2 summarizes nomenclature and acronyms of S100 proteins. Now, the terms S100A8 and

S100A9 are commonly used although MRP8 and 14, A and B or are still often used for these.

1.2.2. Evolution of S100 proteins

Most S100 proteins are encoded within the same chromosomal cluster, and are evolutionarily related (2). Of the 22 human S100 genes, 20 are located within the epidermal differentiation complex (EDC) in a cluster on chromosome 1q21.3 (3) (Figure 1-1). Of the 19 murine S100 genes, 16 are located on chromosome 3f2 (2, 29, 30).

+ A 1.5 Mb S100A9 S100A1 S100A1 S100A10 S100A17 S100A8 S100A7 S100A2 S100A13 S100A14 S100A15 S100A11 S100A16 S100A12 S100A3 S100A3 - S100A4 S100A2 S100A5 S100A6

200 kb 220 kb

212.5 kb 320 kb B + S100A6 S100A5 S100A3 S100A17 S100A10 S100A13 S100A14 S100A16 S100A8 S100A16 S100A11 S100A4 3 Mb

S100A9 - S100A11

Figure 1- 1: S100 chromosomal clusters.

(A) Human chromosome 1q21 S100 gene clusters. (B) Murine chromosome 3f3 S100 gene clusters. The figures are graphical representations of S100 cluster organization; The arrows indicate the direction of the loci from the 5’ UTR to the 3’ UTR (modified from (2)).

3 Table 1- 2: Nomenclature and acronyms of the S100 calcium binding protein genes

Gene symbol Gene name Previous symbols and aliases S100A1 S100A1 S100A, S100-alpha, S100 S100A2 S100A2 S100L, CaN19 S100A3 S100A3 S100E S100A4 S100A4 Calvasculin, metastasin, murine placental homolog, calcium placental protein (CAPL), MTSI, p9Ka, 18A2, pEL98, 42A, fibroblast-specific protein (fsp) S100A5 S100A5 S100D S100A6 S100A6 Calcyclin (CACY), 2A9, PRA, CABP, 5B10 S100A7 S100A7 Psoriasin 1 (PSOR1), S100A7c, S100A15 (RefSeq NM_176823: identity with S100A7c) S100A7L1 S100A7A S100A15, S100A7a S100A7L2 S100A7-like 2 S100A7b S100A7P1 S100A7 pseudogene 1 S100A7L3, S100A7d S100A7P2 S100A7 pseudogene 2 S100A7L4, S100A7e S100A8 S100A8 Calgranulin A (CAGA), CGLA, P8, MRP8, cystic fibrosis antigen (CFAg), LIAg, 60B8Ag, B8Ag, CP-10 (murine), L1 Ag L1 light chain (L1L), p7 (bovine A8), S100A8/S100A9 complex, calprotectin S100A9 S100A9 Calgranulin B (CAGB), CGLB, P14, MRP14, cystic fibrosis antigen (CFAg), LIAg, 60B8AG, B8Ag, L1 heavy chain (L1L), BEE22 and p23 (bovine), calprotectin S100A10 S100A10 Annexin II ligand (ANX2LG), calpactin I, light polypeptide(CAL1L), p10, p11, CLP11, 42C, CAL12 S100A11 S100A11 Calgizzarin, S100C S100A11P S100A11 pseudogene pseudogene S100A14 S100A12 S100A12 Calgranulin C (CAGC), CaBP in amniotic fluid-1 (CAAF1), calgranulin-related protein (CGRP), p6, MRP-6, cornea- associated antigen (CoAg), extracellular newly identified RAGE-binding protein (EN-RAGE) S100A13 S100A13 S100A14 S100A14 BCMP84, S100A15 S100A15 S100A15 2300002L21Rik, S100F, DT1P1A7, MGC17528 S100A16 S100A16 A530063N20Rik S100A17 S100A17 5430400H23Rik S100B S100B S100-beta, neural extension factor (NEF), S100 S100G S100G 3 (CALB3), CaBP9K, CABP1 S100P S100P S100Z S100Z S100-zeta Repetin Repetin (adapted and modified from (2, 31))

4 Table 1-3 indicates the chromosomal locations and shows the exceptions, S100A11P,

S100B, S100G, S100P and S100Z. S100 proteins are structurally related to calmodulin, which contains four canonical EF hands and is the most ancient protein of the EF-hand superfamily (2,

29, 32). S100 proteins may have evolved from a calmodulin-type ancestor by domain swapping

(2, 33, 34) and subsequent loss of two EF hands. Interestingly, the S100 gene family is found only in vertebrates. The lowest organism expressing an S100 protein is the Chondricthyes

Squalus acanthias, and the most closely-related protein to this is S100A1, suggesting that

S100A1 is the ancestral member of S100 family (2). Moreover, the sequence divergence, such as seen in the S100A8 and S100A9 genes in mouse and human, suggests rapid evolution of

S100 genes, despite their presumed recent origin (2). This rapid evolution and expansion could

Table 1- 3: Chromosomal location of the S100 genes in human and mouse

Gene symbol Human Human Orthologous Mouse sequence chromosomal mouse gene Chromosomal accession ID location location S100A1 NM_006271 1q21 S100A1 3f2 S100A2 NM_005978 1q21 Not in mouse S100A3 NM_002960 1q21 S100a3 3f2 S100A4 NM_002961 1q21 S100a4 3f2 S100A5 NM_002962 1q21 S100a5 3f2 S100A6 NM_014624 1q21 S100a6 3f2 S100A7a XM_048124 1q21 Not in mouse S100A7b XM_060509 1q21 Not in mouse S100A7c NM_002963 1q21 Not in mouse S100A7d XM_060508 1q21 Not in mouse S100A7e (27) 1q21 Not in mouse S100A8 NM_002964 1q21 S100a8 3f2 S100A9 NM_002965 1q21 S100a9 3f2 S100A10 NM_002966 1q21 S100a10 3f2 S100A11 NM_005620 1q21 S100a11 3f2 S100A11P – 7q22–q31 Not in mouse S100A12 NM_005621 1q21 Not in mouse S100A13 X99920 1q21 S100a13 3f2 S100A14 NM_020672 1q21 S100a14 3f2 S100A15 NM_080388 1q21 2300002L21Rik 3f2 S100A16 AL356504 1q21 A530063N20Rik 3f2 S100A17 XM_060104 1q21 5430400H23Rik 3f2 S100B NM_006272 21q22 S100b 10b5.3 S100G NM_004057 Xp22 Calbindin D-9k Xf3 S100P NM_005980 4p16 Not in mouse S100Z NM_130772 5q13 Calb3 Xf4 Repetin AL589986 1q21 Repetin 3f2 (adopted and modified from (2, 28))

5 account for the lack of orthologues of S100A2, S100A7, S100A12 and S100P in the mouse and rat genomes (2, 35, 36). Furthermore, five gene copies for human S100A7 (S100A7a-

S100A7d) are located on the same locus (27). S100A7a, S100A7b, and S100A7c have clear open reading frames that reach 90% , whereas those of S100A7d and

S100A7e are fragmented and may be non-coding. Human S100A2 is most closely related to

S100A4 in all species, and its chromosomal location adjacent to the S100A4 locus, suggests

S100A2 may have arisen through gene duplication (2). S100 proteins are thought of as having rapidly evolved by modular evolution, whereby conserved domains were swapped by homologous recombination of exons, and by gene duplication (37, 38). Duplicated genes, such as the human S100A7 genes, may diverge to create new family members in the future.

1.2.3. Structure of S100 proteins

S100 proteins are a family of highly homologous proteins containing two EF-hand calcium binding sites. They are characterized by a relatively low mass (in the range 10-14 kDa)

The amino- and carboxy-terminal regions contain the calcium-binding domains separated by a

“hinge” region. The EF hands consist of helix E, followed by a loop co-ordinating the Ca2+-ion and a second helix F (helix-loop-helix calcium-binding domains). The canonical C-terminal EF- hand, which comprises 12 amino acids, binds calcium with a 100-fold higher affinity than the

N-terminal, non-conventional, EF-hand which comprises 14 amino acids (39-41). The carboxy- terminal domains and the "hinge" regions are structurally variable (42-44), and thought to contain sites responsible for selective interaction of each individual S100 protein with specific target proteins (42, 44-46). In human, the sequences of the S100 are between 79 and 114 amino acid residues in length (28, 47).

One hallmark of S100 proteins is their ability to form dimers or higher-order complexes and dimerization seems to be fundamental for function (48). Most S100 proteins exist as anti- parallel homodimers in which the monomers are held together by non-covalent interactions and are oriented by a 2-fold axis of rotation to create a hydrophobic interface that may bind target protein (49-52). Some also assemble as complex heteromers; as is the case for S100A1/S100B

6 (10), S100A8/S100A9 (53, 54), S100B/S100A6 (55, 56), S100A1/S100A4 (57, 58),

S100B/S100A11 (56) dimers. The S100A8/S100A9 heterodimer is the most abundant naturally- occurring example. This also forms trimers (L1 antigen) (59, 60) and tetramers (54, 61).

Interestingly, S100A12 forms a hexameric assembly which is arranged as a trimer of dimers, with each dimer having architecture and structure similar to that of the dimer (62).

It is unlikely that the monomers exist in solution. Figure 1-2 shows that each monomer in the dimer displays two helix-loop-helix motifs; the -helices I and IV (dimer subunit 1) which flank the EF-hands, and I’ and IV’ (dimer subunit 2), forming an X-type four-helix bundle which constitutes the dimer interface (63, 64). The central groove is delineated by the antiparallel helices IV and IV’. Dimerization can occur in the presence or absence of calcium

(63). Thus, S100 proteins are likely to exist in cells as pre-assembled dimers (41).

Figure 1- 2: Structure of the Ca2+-loaded S100B non-covalent dimer.

One S100B monomer is in yellow and the other one is in blue. Helices are indicated by Roman numerals (I- IV in one monomer, and I’- IV’ in the other monomer). Binding of Ca2+ to each S100B monomer causes a reorientation of helix III relative to all other helices, with consequent re-orientation of the hinge region (H). These changes result in exposure to the solvent of a surface defined by residues (in magenta) in helices III and IV, the hinge region and the C-terminal extension. Residues in helix I of the other monomer (I’) could also take part in the generation of the binding surface. Calcium ions are represented by light-pink dots within Ca2+-binding loops (L1, L2 in one monomer, and L1’, L2’ in the other monomer). (adapted from (64, 65)) 7 Upon Ca2+ binding, helix III in each monomer becomes more perpendicular to helix IV. As a consequence of the altered interhelical angle between these two helices, the hinge region of each monomer swings out from the central linkers of the dimer, forming a cleft which is buried in

S100 monomers, thereby unmasking hydrophobic patches in the dimer. This cleft is important for Ca2+-dependent recognition of target proteins, and may explain why most S100 members form dimers; one S100 monomer may not be sufficient for binding a target protein or, alternatively, target protein binding to S100 occurs with reduced strength (reviewed in (3)).

Upon unmasking hydrophobic patches in the dimer, target protein monomers can bind on opposite ends of the S100 protein dimer, forming an anti-parallel structure. Thus, the S100 protein dimer may crossbridge two target proteins, as shown in Figure 1-3. In summary it is thought that a calcium-dependent S100 protein conformational change is required for interaction with target proteins (66). However, there is no direct evidence that calcium causes a change in

S100 conformation in the intracellular compartment because of the difficulty in predicting the intracellular affinity for calcium, which can be influenced by a variety of other ions and proteins.

Figure 1- 3: S100 dimer with target proteins

Binding surfaces are located on opposite sides, and are composed of regions in both monomers of the dimer, to recognize target proteins. The S100 dimer could functionally cross-bridge two homologous or heterologous target proteins. (adapted from (66))

The functional possibilities are increased by different types of structural modifications such as dimerization (monomeric, homo-/heterodimeric). Under non-reducing conditions, like those found in the extracellular space, S100B also forms disulfide-cross-linked homodimers (67,

68), which is facilitated by high Ca2+ concentrations and/or lipids (69). Neurotrophic activity of

8 S100B depends on disulfide-linked dimerization (69). S100A10, S100A2, S100A6 and S100A8 also form disulfide dimers ((11, 70-73), reviewed in (65)).

Some S100 proteins bind Zn2+ and/or Cu2+ and these may also contribute to their diversified functions through modulation of Ca2+ affinities at different ionic strengths (74-77).

Activation of some target proteins is Zn2+-dependent (78). The Zn2+ and Ca2+ binding sites are distinct and Zn2+ may modify the affinity for Ca2+, although affinities suggest that binding of

Zn2+ within the cytoplasm is unlikely, as shown for S100B and S100A6 (79). S100B and

S100A5 also bind Cu2+ (80, 81). The S100B dimer binds 4 Cu2+ ions which occupy the same binding sites as Zn2+, and this inhibits Cu2+-catalyzed oxidation of L-ascorbate, supporting the notion that variable cation binding may regulate diverse intra- and extracellular functions of

S100 proteins. However, further studies are required to elucidate the contributions of post- translational modifications and/or metal binding to the diverse functions of these proteins (28).

1.3. Functions of S100 proteins

S100 proteins have important functions including protein phosphorylation, enzyme activity, cell proliferation and differentiation, dynamics of cytoskeletal constituents and inflammation (reviewed in (82), (83)). They regulate a variety of intra- and extracellular processes through modulating Ca2+-signalling or Ca2+-buffering. Therefore, altered Ca2+ affinities of S100 proteins and post-translational modifications, together with a variety of target proteins adds additional complexity to understanding the pleiotropic cellular events regulated by

S100 proteins (reviewed in (40)).

A large number of target proteins of S100 have been described (see Table 1-5, 1-6, 1-7), but many are not identified, in particular, those for S100A3, S100A5, S100A14, S100A15,

S100A16, S100A17, S100P and S100Z, probably because these are recent additions to the family. In fact, S100A15, S100A16, S100A17 were discovered in 2004 using transcriptome database searches of the human, mouse and rat genomes (2) (Table 1-1). The functional relevance of many S100-target protein interactions in vivo is unclear. Interestingly, some target proteins interact with multiple S100 family members possibly reflecting their sequence

9 similarities, whereas others may only interact with a single family member (Table 1-5, 1-6, 1-7).

Thus, there could be functional redundancy between some S100 proteins. Some may function through interaction with non-protein molecules, such as S100A8/S100A9 which binds poly- unsaturated fatty acids (84), heparan sulfate proteoglycans (85), and carboxylated N-glycans

(86). Further studies are necessary to characterise target molecules of S100 proteins and correlate these with their functional relevance in vivo.

Calmodulin, a member of EF-hand superfamily, is ubiquitously expressed and is a universal intracellular Ca2+ receptor (87). In contrast, the subcellular distribution and dynamically-regulated tissue and/or cell-specific expression in normal mature tissues may underlie a variety of functions of S100s (reviewed in (2, 28, 40, 88, 89)). For example, expression of S100A3 is restricted to human hair cuticle (90, 91). S100A8 and S100A9 are highly expressed in neutrophils and expression is normally restricted to these and to monocytes, trophoblasts and osteoblasts (92-96). Numerous S100 genes are induced in a variety of cell- types and expression may strongly depend on environmental factors. One example is S100B which is not expressed in normal rat cardiomyocytes, but its mRNA increases up to day 35 post- myocardial infarction, concomitant with down-regulation of skeletal -actin (97). Other examples are given in Table 1-4. The human S100B gene may be constitutively repressed in all cell types by negative regulatory elements, and its expression requires induction of an appropriate factor that counters the action of that element (98). Thus, S100B may be regulated by positive and negative regulatory elements which would allow its controlled expression in specific cell types in response to appropriate environmental stimuli. More detailed characterization of gene regulation of individual S100 proteins in a variety of circumstances is required.

Some cell types co-express several S100 proteins. For example, human smooth muscle cells co-express at least four (99), and human monocytes at least four (2). These are just a few examples supporting a view for cell type-specific expression. There are only a few examples of quantitation of S100 protein levels in cells, or those secreted, and concentration may be another factor that that is important in particular functional roles.

10 Table 1- 4: Altered expression of some S100 proteins in response to stimulation

S100 proteins Stimulation Cells Expression References S100B cAMP Rat glioma cells Increase (100-103) Dexamethasone Rat astrocytes Increase (104) FGF-2 Rat astrocytes Decrease (short-term) (105) Increase (long-term) Interleukin-1 Rat astrocytes Decrease (mRNA) , (105) No change (protein) FGF-2 + IL-1 Rat astrocytes Synergistic effect (105)

- Rat glioma cells, Increase (106) primary astrocytes Norepinephrine Rat neonatal Increase (107) cardiac myocytes S100A6 Retinoic acid cells Increase (108) PDGF, phenylephrine, Rat neonatal Increase (109) angiotensin II cardiac myocytes S100A12 LPS, TNF- Human monocytes Increase (110) FGF-2, Fibroblast growth factor-2; IL-1, Interleukin-1; PDGF, platelet-derived growth factor

Some S100 proteins are located in particular subcellular compartments. For example,

S100A6 is mainly associated with a network-like structure around the nucleus (99, 111), and

S100A2 is exclusively located in the nucleus, possibly regulating fundamental nuclear functions

(99). Furthermore, specific relocations of some S100 proteins occur in response to a rise in

2+ 2+ [Ca ]i. In smooth muscle cells, upon elevation of [Ca ]i sarcoplasmic reticulum (SR)- associated S100A1, S100A4, and S100A6 relocate to vesicle-like structures in the central region around the cell nucleus, whereas S100A1 bound to F-actin remains firmly attached (99).

S100A8 and S100A9 in human monocytes translocate from the cytoplasm to the upon stimulation (112). During translocation, S100 proteins may attach/detach from various target proteins.

Further studies are necessary to confirm the target proteins of all S100 family members, and their functional relevance in vivo. Nonetheless, the in vitro studies described in the following sections provide important insights into their functions.

1.3.1. Intracellular functions

Ca2+ homeostasis

S100G (Calbindin D9k) is the only S100 member that does not form dimers and does

11 not interact with target proteins because of its small hydrophobic surface. It inhibits Ca2+ release from the SR by binding the Ca2+ release channel (113). Thus, it acts as a Ca2+ modulator, rather than a Ca2+ sensor (114, 115), implying roles in Ca2+ homeostasis, transport and . S100A1 localizes to membranes of the SR in striated muscle cells and perinuclear membranes in several cell types (82, 116, 117), and stimulates Ca2+-induced Ca2+ release

(CICR) in skeletal muscle cells (118). Binding of S100A1 to the increases the affinity of ryanodine binding in the presence of Ca2+ (119), thereby regulating intracellular

Ca2+ homeostasis. S100A1 is down-regulated in failing human heart (120), whereas it is selectively upregulated in the hypertrophic right ventricle in chronic pulmonary hypertension

(121), suggesting that its clinical relevance which may due to reduced CICR from SR in heart failure, or to a compensatory response in chronic pulmonary hypertension, respectively (120,

121). In a post-infarction rat heart failure model, adenoviral S100A1 gene delivery normalized

S100A1 protein expression and reversed contractile dysfunction of failing myocardium in vivo and in vitro. S100A1 gene transfer to failing cardiomyocytes restored diminished intracellular

Ca2+ transients and SR Ca2+ load, mechanistically due to increased SR Ca2+ uptake and reduced

SR Ca2+ leak (122, 123), supporting a critical role in the regulation of Ca2+ homeostasis.

In addition, Ca2+-stimulated activity of adenylate cyclase from skeletal muscle increases with addition of S100A1 and S100B (124), supporting a role of S100 proteins in Ca2+ homeostasis.

Regulation of phosphorylation

Protein phosphorylation is a post-translational modification in which a serine, a threonine or a tyrosine reside is covalently modified by a protein kinase enzyme by the addition of a phosphate group. Regulation of proteins by phosphorylation generally results in activation or inhibition of target proteins. S100 proteins have numerous effects through regulating phosphorylation, most of which are inhibitory by blocking availability of phosphorylation motifs rather than acting as alternative substrates. Table 1-5 provides some examples in which

12 Table 1- 5: S100 protein-dependent protein phosphorylation

S100 protein Target protein Effect Functional correlates References S100B MARCKS Inhibition Unknown (125, 126) Annexin II Inhibition Unknown (127) GAP-43 (neuromodulin) Inhibition Unknown (126, 128, 129) Inhibition Unknown (126) MARCKS-like retinal Inhibition Unknown (130) phosphoprotein p80 Caldesmon Inhibition Reversal of caldesmon-dependent inhibition of actomyosin ATPase activity (131-133) tau proteins Inhibition Inhibition of protein hyperphosphorylation (134, 135) GFAP, Inhibition Regulation of intermediate filaments assembly (136, 137) p53 Inhibition Protection of p53 from thermal denaturation and aggregation; stimulation of p53-dependent (138-143) cell growth arrest and apoptosis (tumor-suppressor activity); inhibition of p53-dependent transcription activation (tumor-promoting activity) via disruption of the p53 tetramer An unknown substrate Inhibition Inhibition of the hypertrophic response following myocardial infarction (97, 144) of PKC NDR1, 2 Stimulation Regulation of cell division and cell morphology through autophosphorylation stimulation (145, 146) MKK6-p38 MAPK Inhibition Regulation of proliferation and differentiation (147, 148) Ras-MEK-ERK1/2 Stimulation Regulation of proliferation and differentiation (147) Src Kinase Stimulation Regulation of migration (149) S100A1 proteins Inhibition Unknown (135, 150) MyoD Inhibition Unknown (151) S100A4 Myosin heavy chain Inhibition Modulation of the cytoskeleton dynamics in metastatic cells (152, 153) p53 Inhibition Tumor promoting activity via inhibition of p53 activity (154) S100A8/S100A9 Human papillomavirus Inhibition Inhibition of human papillomavirus oncogenic activity. (155) type 16 E7 S100A10 Annexin II Inhibition Regulation of annexin II association with membranes (70, 127, 156) S100A11 Annexin I Inhibition Regulation of annexin I association with membranes (46, 157) GAP-43, growth associated protein-43; GFAP, glial fibrillary acidic protein; MARCKS, myristoylated alanine-rich C kinase substrate; NDR2, Nuclear Dbf2-related protein kinase 2 (modified from (3, 65, 83))

13 S100 proteins inhibit phosphorylation. As examples, Sl00B dimer blocks phosphorylation of the kinase substrates pp80 and tau proteins that regulate polymerization by inhibiting protein kinase C and calmodulin kinase activities (134, 135). Similarly, S100B inhibits glial fibrillary acidic protein (GFAP) phosphorylation in response to cAMP or Ca2+/calmodulin (137).

Binding blocks access to PKA, Ca2+/calmodulin-dependent protein kinase II (CaM KII), and

PKC (158-160). Also, S100A10 inhibits serine and tyrosine phosphorylation of annexin II (156,

161, 162). In most cases, inhibitory effects on protein phosphorylation are Ca2+-dependent

(reviewed in (83)). S100B’s stimulatory effect on ERK1/2 results in stimulation of myoblast proliferation via cyclin D1 induction and Rb phosphorylation and this protects against apoptosis via activation of NF-kB transcriptional activity. Inhibition of p53 phosphorylation by S100B and S100A4 may inhibit p53-dependent transcription and thereby reducing the tumor suppressor activity of p53 (143, 154). Several S100 proteins may have a role in signal transduction, as elevation of cytosolic Ca2+ concentrations appears to be correlated with the phosphorylation state of several S100 target proteins.

Regulation of enzyme activities

Table 1-6 summarizes some of the enzymes regulated by S100 proteins. To date, no enzymatic activity has been attributed to any S100 protein. Some may regulate energy metabolism by virtue of their interactions with various enzymes including fructose-1,6- bisphosphate aldolase, glycogen phosphorylase, glyceraldehyde 3-phosphate dehydrogenase, and malate dehydrogenase. S100A1 and S100B interact with brain fructose-1,6-bisphosphate aldolase (163), suggesting a direct regulatory role in glycolytic energy production (163).

S100A1, but not S100B, binds and inhibits glycogen phosphorylase (164) and S100A1 inhibits, and S100B stimulates, phosphoglucomutase (65, 165, 166), suggesting their involvement in mobilization of glucose. S100A1 is abundantly expressed in slow-twitch skeletal muscle cells and cardiomyocytes (88, 166, 167) and may have a role in preventing fatigue of slow-twitch skeletal muscle cells by reducing glycogen breakdown (165).

14 Table 1- 6: S100 protein-dependent regulation of enzyme activities

S100 protein Enzyme Effect Suggested functions Reference S100B Fructose-1,6-bisphosphate aldolase Stimulation Regulation of energy metabolism (163) Phosphoglucomutase Stimulation Regulation of energy metabolism (165) Twitchin kinase activity Stimulation Unknown (168) NDR1, 2 Stimulation Regulation of the cell cycle (145, 146, 169) Membrane-bound guanylate cyclase Stimulation Dark-adaptation of photoreceptors (130, 170-173) Akt Stimulation Promotion of cell proliferation and differentiation (174) S100A1 Fructose-1,6-bisphosphate aldolase Stimulation Regulation of energy metabolism (163) Phosphoglucomutase Inhibition Regulation of energy metabolism (165) Titin Inhibition Regulation of intrinsic elastic properties in myocarium (175) Glycogen phosphorylase Inhibition Regulation of energy metabolism (164) F1-ATPase Stimulation Regulation of energy metabolism (176) Twitchin kinase activity Stimulation Unknown (168) Membrane-bound guanylate cyclase Stimulation Dark-adaptation of photoreceptors (171, 173) S100A8/S100A9 Casein kinase I and II Inhibition Myeloid cell maturation (177) NF-B, MAPK Stimulation Regulation of cell migration (178) S100A10 Phospholipase A2 Inhibition Anti-inflammatory activity (166) Plasminogen activator Stimulation Anti-coagulant (179) S100A11 Actomyosin ATPase Inhibition Unknown (180) ECM, extracellular matrix (modified from (3, 65, 83))

15 Some S100 proteins may regulate dark-adaptation of photoreceptors and are implicated in phototransduction (181, 182). In the outer segments of photoreceptors, S100A1 and S100B

Ca2+-dependently stimulate membrane-bound guanylate cyclase activity in vitro (170-172), activation of which increases the range of intensities to which the rod can respond. S100A1 and

S100B stimulate membrane-bound guanylate cyclase that is localized to photoreceptor disc membranes, photoreceptor cell bodies, and retinal Müller cells (173). Activation of the enzyme by either S100 protein in the outer segment of photoreceptors requires dark adaptation (170, 171,

173), whereas activation of the enzyme in photoreceptor cell bodies and retinal Müller cells is independent of light-/dark-adaptation (173) (reviewed in (65)). Thus S100B and S100A1 may play a role in dark-adaptation of photoreceptors and may transduce different signals in photoreceptors and Müller cells via stimulation of a membrane-bound guanylate cyclase.

S100 proteins may also regulate enzymes involved in signal transduction. S100B increased in the neuronal cell line PC12 (normally does not express S100B), activated the Akt pathway leading to promotion of proliferation and interference differentiation (174). In human cells, transiently-transfected S100A8 and S100A9 activated MAP kinase and

NF-B signaling pathways (178).

Interactions with the cytoskeleton

S100 proteins regulate the three major components of the cytoskeleton; microtubules, intermediate filaments/microfilaments, and tropomyosin/myosin. Table 1-7 lists some interactions between S100 proteins and cytoskeletal constituents that may regulate cytoskeletal re-arrangements by inhibiting polymerization of cytoskeletal constituents. Most interactions are

Ca2+-dependent. S100A1 and S100B bind tubulin and inhibits brain microtubule assembly (137,

167). S100B associates with axonal microtubules, centrioles, basal bodies, mitotic spindles, centrosomes, and MT nucleation centers as well as with cytoplasmic microtubules (reviewed in

(3, 65)). Thus S100B may regulate tubulin polymerization to avoid excess production of tubulin-dependent stimulation of ATPase activity (183), or modulate tubulin-dependent signalling pathways (184). In particular, S100B in MT nucleation centers may regulate 16 Table 1- 7: Interactions between S100 proteins and cytoskeletal constituents

S100 Protein Cytoskeleton element Suggested functions References S100B Microtubules Inhibition of assembly via sequestration of tubulin and stimulation of Ca2+-sensitivity of preformed (137, 185-187) microtubules Type III intermediate Inhibition of assembly and stimulation of disassembly via sequestration of unassembled intermediate (188-190) filaments filament subunits Caldesmon Reversal of caldesmon-dependent inhibition of actomyosin ATPase activity (131-133) Calponin Reversal of calponin-dependent inhibition of actomyosin ATPase activity (191) S100A1 CapZ Unknown (192, 193) Microtubules Inhibition of assembly via sequestration of tubulin and stimulation of Ca2+- sensitivity of preformed (185-187) microtubules Type III intermediate Inhibition of assembly and stimulation of disassembly via sequestration of unassembled intermediate (188-190) filaments filament subunits Microfilaments Unknown (99) Titin Reduction of titin-based tension before active muscle contraction (175) S100A2 Tropomyosin Organization of the actin cytoskeleton in microvilli via its interaction with tropomyosin (194) S100A4 Myosin IIA Regulation of the dynamics of myosin filaments in relation to invasiveness of metastatic cells (195-200) Tropomyosin Regulation of Ca2+- sensitivity to tropomyosin modulation of actomyosin ATPase activity (201) Microfilaments Unknown (202) S100A6 Tropomyosin Unknown (72) Caldesmon Reversal of caldesmon-dependent inhibition of actomyosin ATPase activity (203) Tubulin Regulation of differentiation via CacyBP/SIP, a ligand of S100A6 (Direct interaction of S100A6 and (204) tubulin is not shown) Microtubules Regulation of transendothelial migration (205, 206) Keratin filaments Modulation of wound repair (207) S100A10 Stimulation of annexin II translocation onto the cortical cytoskeleton and of F-actin bundling activity of (208-213) annexin II during exocytosis, and enhancement of ANXA2 stimulation of GFAP polymerization S100A11 F-actin Inhibition of actin-activated myosin ATPase activity (180) Microtubules Formation of cornified envelope (214) S100A12 Undefined Modulation of Ca2+-dependent interactions between cytoskeleton elements and membranes (215) S100P Filamentous actin Increase in cancer invasion and metastasis (216) Repetin Keratin intermediate filaments Regulation of lateral interaction of keratin intermediate filaments (6) (modified from (3, 65, 83))

17 nucleation.

S100A1/S100B bind and glial fibrillary acidic protein (GFAP), inhibiting their formation of type III intermediate filaments specific to muscle and glial cells, respectively (188-

190). This may reduce excess intermediate filament assembly and contribute to their appropriate orientation. These S100 proteins may also participate in remodeling intermediate filaments in mitosis, cell locomotion and shape change in skeletal muscle cells during cycles of contraction and relaxation (65).

S100A4 might promote cell migration and tumor metastasis by directly interacting with the myosin IIA heavy chain to reduce filament formation (198, 199). Moreover, S100A4 disrupts existing myosin IIA filaments in vitro (199) and in tumor cells, this may promote dissemination by affecting membrane protrusion and cell polarization without altering other aspects of cell migration that are dependent on myosin II-based contractility (217). Therefore,

S100A4 is proposed to have a strong association with tumor progression (218, 219).

High levels of S100P are expressed in , and its overexpression led to changes in levels of several cytoskeletal proteins, resulting in disorganization of the actin cytoskeleton network. These S100P-overexpressing cells showed increased invasion, suggesting potential involvement in tumor invasion by interacting with cytoskeletal proteins (216).

S100A1/S100B binds the actin-associated proteins, caldesmon and calponin (131, 132,

191, 220) (Table 1-7). When caldesmon is phosphorylated by PKC (221, 222), it inhibits

ATPase activity of actomyosin, thereby preventing the sliding of actin and myosin filaments.

S100A1/S100B reverses the inhibitory action of caldesmon on ATPase, resulting in cell contraction (131, 132, 220, 222). Similarly, S100B binds calponin and relieves the calponin- dependent inhibition of actomyosin ATPase activity (191). S100A6 and calmodulin have similar effects on caldesmon phosphorylation (203, 223). Thus, caldesmon is an example of a target protein that is common to several S100 proteins.

S100A1 stimulates the sarcomeric, myosin-associated giant kinase twitchin in a Ca2+- and Zn2+-dependent manner in vitro (224). Twitchin regulates muscle contraction and the mechano-elastic properties of the sarcomere in invertebrates. The corresponding vertebrate

18 protein is titin, which also interacts with S100A1. S100A1 may release thin filaments from titin, thereby reducing titin-based tension before active muscle contraction (175).

Taken together, S100 proteins may regulate cell morphology and the dynamics of certain cytoskeletal components through their direct and/or indirect interactions with microtubules, intermediate filaments, microfilaments, myosin, and/or tropomyosin. In addition, the dimeric structure of S100 proteins may enable crossbridging between individual cytoskeletal components and may anchor some target proteins to the cytoskeleton (3).

Regulation of cell growth and tumor progression

S100B has long been a marker of some tumors, particularly melanoma. S100B interacts with the tumor suppressor protein p53 (138) and proposed functional outcomes are listed in

Table 1-5. It is proposed to co-operate with p53 to cause cell growth arrest and apoptosis (142), although this interpretation is questioned because of structural and functional analyses of

S100B-p53 interactions (141, 225). These authors suggests that S100B would block p53, and inhibition of S100B synthesis decreases proliferation rates (226).

A link between cancer progression and overexpression of S100A4 was demonstrated in transgenic animal models (227, 228). Effects on metastasis may be via its regulation of a variety of intracellular target proteins, including components of the cytoskeleton, E-, p53, thrombospondin 1 and matrix metalloproteinases (MMP), suggesting that S100A4 may regulate cell motility, adhesion and detachment, proliferation and apoptosis (229) (reviewed in (230)).

Other S100 proteins including S100A6 regulate pulmonary fibroblast proliferation (231).

S100A11 is phosphorylated in confluent, normal fibroblasts, but not immortalized cells, its translocation into the nucleus diminishes proliferation, suggesting potential involvement in contact inhibition of cell growth (232). These reports point to a role of several S100 proteins in regulation of cell and/or tumor growth, although, little is known concerning detailed molecular mechanisms.

19 1.3.2. Extracellular functions

Some S100 proteins have extracellular roles and Table 1-8 shows some extracellular effects. They are released from cells despite the absence of a conventional signal peptide sequence essential for conventional endoplasmic reticulum (ER)-Golgi mediated secretion. To date, secretion is documented only for S100B, S100A4, S100A8/S100A9, S100A12, and

S100A13, although the mechanism is obscure. A mechanism proposed for secretion of

S100A8/S100A9 complex from activated monocytes is discussed in Section 1.6.7. Secretion of

2+ 2+ S100B by astrocytes depends on elevation of the [Ca ]i or decrease in [Zn ]i (233).

In murine fibroblasts, FGF-1 is associated with the extra-vesicular P40 domain of synaptotagmin-1 (Syn-1) in vivo (234), and S100A13 binds the latter near the inner surface of the plasma membrane before their stress-induced secretion as a complex (235). Secretion requires energy, and an intact actin filament network (234). This type of pathway is worthy of investigation in relation to other members of the S100 family.

Little is known about concentrations of S100 proteins in the extracellular space, the nature of S100 receptor(s), subsequent interactions and signalling pathways triggered in target cells. These elements are critical in defining the physiological relevance of extracellular activities of these proteins. In particular, the search for high-affinity receptors is still at its infancy.

Murine S100A8 (236), human S100A12 (237) and S100A2 (238) may mediate their chemotactic activities via G-protein coupled responses. Some S100 proteins bind to the receptor for advanced glycation end products (RAGE) and activate different intracellular signalling pathways, including MAP kinase or NF-B (148, 239-241). Recently S100A8 was shown to mediate pro-inflammatory functions via Toll-like receptor 4 (TLR4) (242).

20 Table 1- 8: Extracellular function of S100 proteins

S100 protein Effect Suggested mechanism References S100B Neurite extension activity, pro-survival Nuclear translocation of NF-B via RAGE-dependent activation of the Ras/MAP kinase (67, 68, 243- effects, proliferation, apoptosis, IL-6 and NO and the cdc42/Rac pathways, stimulation of Bcl-2 expression, cytochrome c-mediated 259) secretion, modulation of synaptic plasticity, activation of caspase-3, stimulation of Ca2+-influx in neurons and upregulation of inhibition of myogenesis expression of c-fos, c-jun, bax, bcl-x, p-15, and p-21, inactivation of ERK1/2, Akt and p38 in a RAGE- independent manner S100A1 Neurite extension activity and pro-survival Nuclear translocation of NF-B via RAGE- dependent activation of the Ras/MAP kinase (251) effects on neurons and the cdc42/Rac pathways S100A2 Chemotactic for eosinophils, and inhibition of Unknown (238) tumor cell motility S100A4 Neurite extension activity, stimulation of Activation of the ERK1/2 signaling pathway in neurons (receptor unknown), upstream of (260, 261) angiogenesis, inhibition of apoptosis, caspase 3 cleavage and DNA fragmentation, MMP expression promotes growth, survival of cardiac myocytes S100A7 Chemotactic for CD4+ lymphocytes, Interaction with Jab 1 (262, 263) tumor progression, fatty-acid binding protein S100A8/ For extracellular functions of S100A8, S100A9 and the complex, refer to Sections 1.7.2. S100A9 S100A10 Inhibition of the extrinsic pathway of blood Binding to plasminogen and stimulation of tissue-type plasminogen activator (t-PA)- (179) coagulation dependent plasminogen activation S100A12 Pro-inflammatory activity on endothelial cells Binding to RAGE on inflammatory cells, NF-B-dependent secretion of cytokines; (237, 240, 264) and inflammatory cells, neurite extension activation of the MAP kinase pathway and stimulation of PLC and Ca2+/ calmodulin- activity, activation of mast cells, dependent kinase II activities in neurons, RAGE- independent G-protein-coupled receptor chemoattractant for monocytes and mast cells (from (3, 65, 83, 259)

21 Neurotrophic activity

Extracellular activities of S100 proteins are mainly described in the context of trophic effects on the central nervous system or regulatory effects on inflammatory cells. Table 1-8 lists some of the extracellular functions reported. One well-studied example is S100B. S100B is secreted by glial and pituitary folliculostellate cells, and treated with stimulators of lipolysis (reviewed in (65)). ATP and glutamate release from damaged/dead cells promote release of S100B (248), and in co-culture with neuronal and glial cells, S100B is released by mechanical stretch (265), which continues for 48 hours post-stimulation (266, 267).

Extracellular S100B in vitro exerts a dual effect on neurons depending on its concentration. It stimulates neurite outgrowth and survival at nM doses but causes death via apoptosis at M doses through increased conductance in L-type Ca2+ channels (253) and upregulation of apoptosis-associated genes (254, 257).

Various post-translational modifications, particularly by oxidation, may modulate extracellular functions of S100A8 proteins. Disulfide-cross-linked S100B dimer promotes neurite extension (67), and neurotrophic activity may depend on pre-formation of this dimer

(68).

Interaction of S100B with the RAGE mediates neurotrophic (via activation of the Ras-

MAP kinase-NFB and cdc42/Rac pathways) and neurotoxic (via accumulation of reactive oxygen species (ROS) and persistent activation of the Ras-MAP kinase pathway) effects (251).

However, RAGE interactions are more important for neuronal survival than for neurite outgrowth (268), suggesting that S100B may induce neuronal differentiation through alternative surface molecules and/or signalling pathways. However, RAGE is not the sole receptor for

S100B (83).

S100B enhances survival of neurons during development (243, 269, 270) and after injury (246). It prevents motor neuron degeneration in newborn rats after sciatic nerve injury

(247) and its local administration stimulates their regeneration in vivo (245). These observations support a physiological role of secreted S100B as a neurotrophic factor possibly at nanomolar concentrations. 22 Collectively, these data suggest that S100B may play important roles contributing to neuronal development, differentiation and brain repair. Genetically-manipulated mice have provided some clues to function (see Section 1.5).

Regulation of inflammation

Functions of S100A8 and S100A9 in inflammation will be reviewed in Section 1.7.2.

Blood coagulation and fibrinolysis

The C-terminal tail of S100A9 has homology with the contact domain of high molecular weight kininogen (HMWK) involved in contact activation of coagulation by binding to negatively-charged surfaces such as kaolin (271). S100A9 also binds kaolin and is competitively inhibited by HMWK and C-terminal S100A9 tail peptides and HMWK 'contact' regions. Importantly S100A9 and the C-terminal peptide inhibit coagulation in vitro.

S100A10 is suggested to be located on the endothelial cell surface and may stimulate fibrinolysis by binding plasminogen and stimulating tissue-type plasminogen activator (t-PA)- dependent plasminogen activation either alone or as a complex with annexin II (179) (Table 1-

8). S100A10 protects plasmin and t-PA from inactivation by 2-antiplasmin and plasminogen activator inhibitor type 1, respectively (179).

1.4. S100 proteins and human disease

Alterations in S100 function are implicated in a large number of diseases including cancer, Down’s syndrome, Alzheimer’s disease, cardiomyopathy, psoriasis, cystic fibrosis, amyotrophic lateral sclerosis, and epilepsy (reviewed in (48)). Table 1-9 summarizes some important disease associations. Numerous human diseases are associated with dysregulated expression of S100 genes (272). For example, in some cancer cells, a variety of re-arrangements

(deletions, translocations and/or duplications) occur in human chromosome 1q21 where S100 genes are clustered, possibly affecting their differential expression, particularly of S100A2,

S100A4 and S100A6. An in-depth understanding of the molecular mechanisms whereby

23 Table 1- 9: S100 proteins in human disease

S100 Postulated functions Disease association References Protein S100B Cell motility, proliferation, apoptosis, inhibition of Alzheimer’s disease, Down’s syndrome, melanoma, ALS (259, 273-277) phosphorylation, inhibition of microtubule assembly, (amyotrophic lateral sclerosis), epilepsy interaction with transcription, regulation of nuclear kinase, neurite extension, NO secretion, modulation of synaptic plasticity, S100A1 Regulation of cell motility, muscle contraction, Cardiomyopathies, acute myocardial ischemia, right (120, 121, 278, 279) phosphorylation, Ca2+ release channel, transcription ventricular hypertrophy, lung S100A2 Tumor suppression, nuclear functions, chemotactic for Squamous cell lung carcinoma, non-small lung cancer, (239, 279-290) eosinophils, inhibition of tumor cell motility Barrett’s adenocarcinomas, gastric cancer, panaceas cancer, , , melanoma, epithelial tumours of the skin, , pilomatrixoma, S100A3 Hair shaft formation, tumor suppression, secretion, and Hair damage, cancer, branchial cysts, craniopharyngiomas, (289, 291) extracellular functions pilomatrixoma S100A4 Regulation of cell motility, neurite extension activity, Lung carcinoma, breast cancer (228, 260, 279, 292-294) stimulation of angiogenesis, inhibition of apoptosis, promotes growth and survival of cardiac myocytes S100A5 Ca2+-, Zn2+-, and Cu2+-binding protein in the CNS, unknown Meningioma (295-297) function, hypoxic preconditioning on brain S100A6 Regulation of insulin release, prolactin secretion, Ca2+ Acute renal failure, progressive lung cancer, gastric (111, 239, 279, 289, 291, homeostasis, tumor progression, cell cycle, cytoskeleton cancer, Barrett’s adenocarcinomas, colorectal 298-309) rearrangement, and ubiquitinylated proteolytic degradation adenocarcinoma, pancreatic cancer, , melanoma, breast cancer, osteosarcoma, pilomatrixoma, branchial cysts, craniopharyngiomas S100A7 S100A7-fatty acid binding protein complex regulates Psoriasis, atopic dermatitis, mycosis, fungoides, Darier’s (262, 310-314) differentiation of keratinocytes, chemotactic for CD4+ disease, lichen sclerosus et atrophicus lymphocytes, tumor progression, aniti-microbial activity S100A8/ For extracellular functions of S100A8, S100A9 and the complex, refer to Sections 1.7.2 and Section 1.8 S100A9

24 Table 1-9: S100 proteins in human disease (continued)

S100 Postulated functions Disease association References Protein

S100A10 Inhibition of phospholipase A2, neurotransmitter release, in Inflammation, depression (315, 316) connection with annexin II regulates membrane traffic, ion currents, interactions with 5-HT1B receptors, inhibition of the extrinsic pathway of blood coagulation S100A11 Organization of early endosomes, inhibition of annexin I Skin diseases, ocular melanoma, pancreatic cancer, (89, 160, 317-321) function, regulation of phosphorylation, physiological role prostate cancer, breast cancer in keratinocyte cornified envelope S100A12 Host-parasite interaction, differentiation of squamous Mooren’s ulcer (autoimmune disease), Kawasaki disease, (237, 322-327) epithelial cells, pro-inflammatory activity on endothelial acute respiratory distress syndrome, juvenile idiopathic cells and inflammatory cells, neurite extension activity, mast arthritis, allergic inflammation, bronchial asthma cell activator, chemotaxisis S100A13 Regulation of FGF–1 and synaptotagmin-1 release, Unknown (328, 329) neoangiogenesis, endometriotic development S100A15 Anti-microbial activity Unknown (313) S100G Ca2+ buffer and Ca2+ transport deficiency, abnormal mineralization (4) S100P Function in the placenta Breast cancer, pancreatic tumors, lung adenocarcinomas (239, 279, 330) (modified from (4, 28))

25 individual family members interact with their target proteins is essential for development of

S100-specific agonists/antagonists needed to dissect the function of these proteins in normal and diseased conditions.

1.5. S100 proteins and animal models

Generation of animal models will ultimately be required to study the physiological impact of S100 proteins. Since no S100 proteins are detected in lower organisms, the model of choice is the mouse. Ectopic expression of a gene through pronuclear injection (transgenic mice) and genetic inactivation via homologous recombination (knockout mice) in embryonic stem cells are being used to unravel S100 protein functions in vivo. Table 1-10 summarizes murine models carrying genetically-manipulated S100 loci.

Table 1- 10: Genetically engineered S100 murine models

Knockout mice Transgenic mice S100B Enhanced memory function Enhanced astrocytosis and neurite proliferation Enhanced epileptogenesis Inhibitory effect on cardiac hypertrophy Impaired learning and memory Altered explorative activity S100A1 Impaired cardiac contractility Increased cardiac contractility Slightly enhanced heart parameters Alterations in behavior S100A4 Enhanced spontaneous tumors Enhanced metastasis in a tumor mouse model S100A8 Embryonic lethal ND S100A9 No obvious abnormalities ND Reduced myeloid cell chemotaxis S100A10 Depression-like phenotype Reduced thigmotaxis S100A11 No obvious abnormalities ND ND, not determined (modified from (28, 315))

There are 4 different models for S100B; two transgenic and two knockout mice. Neither targeted inactivation nor overexpression caused obvious abnormalities in murine development.

S100B transgenic mice exhibit positive effects on astrocytosis and neurite proliferation (331); mice has enhanced explorative activity, reduced anxiety, and impaired learning and memory

(332-334). S100B-/- mouse exhibited enhanced spatial and fear memory, suggesting a role for

S100B in information processing in the brain (80).

26 One transgenic and two knockout models were generated to analyze functions of

S100A1, a prominant S100 protein in mammalian heart. Overexpression in the heart increases myocardial performance under baseline conditions (122), whereas S100A1-/- mice reduced contraction and relaxation rates associated with reduced Ca2+ sensitivity were observed in response to -adrenergic stimulation, suggesting a role for S100A1 in cardiac reserve (335).

In mammary tumor models, overexpression of S100A4 enhanced their metatstatic capacity (152, 228). Interestingly, S100A4-/- mice developed more spontaneous tumors than wild-type controls (336), probably because S100A4 interacts with, and stabilizes the tumor suppressor p53 (154). Surprisingly, S100A5 was up-regulated in S100A4-/- mice, probably due to a compensatory mechanism (336).

Two S100A9-/- models were generated independently (337, 338). These mice were apparently normal but leukocytes exhibit reduced responses to chemoattractants. S100A8-/- mice die via early resorption of the embryo, and a role in prevention of maternal rejection of the implanting embryo is proposed (339). This is the first evidence of a non-redundant function of an S100 protein. These are discussed more fully in Section 1.7.2.3.

Overexpression of S100A10 in mice increases their general activity and mobility and response to physical stimulants. In contrast, S100A10-/- mice have reduced responsiveness to stimulation of 5-HT1B receptors and exhibit a depression-like phenotype (315, 316), suggesting a possible involvement of S100A10 in pathogenesis of depression.

In summary, in vitro studies suggest that there are partial overlaps among the target molecules with which S100 proteins interact, indicating possible redundancies of function.

Some discrepancies regarding interactions with particular target proteins were evident in the literature. However, functional redundancy, compensatory mechanisms and/or alternative developmental trajectories to compensate for the loss of a gene by performing an essential function in a different manner (adaptive development) must be considered in explaining altered phenotypes, particularly as S100s can form various hetero-complexes and usually more than one is expressed in some cell types (2, 99). Clearly, more murine models in which single S100 proteins, as well as relevant overexpressed/deleted combinations are needed to determine their

27 physiological roles.

1.6. S100A8 and S100A9

The S100A8/S100A9 complex is referred to by several acronyms: calprotectin, 27E10 antigen, macrophage inhibitory factor related protein (MRP) 8/14(340), L1L and L1H proteins

(341), calgranulin A/B (342), p8/p14 (343) (Table 1-2). S100A8/S100A9 was first isolated from granulocytes and named L1 protein (17). The name calprotectin was proposed because of its calcium binding and antimicrobial activity by protecting neutrophils (344). In 1987 Odink et al. described the MRP proteins, because S100A8 and S100A9 were purified from human peripheral blood mononuclear cell supernatants using a monoclonal antibody (mAb) directed against macrophage migration inhibitory factor, although the proteins themselves did not exhibit migration inhibitory properties (345). In 1988 a computer-based homology search revealed that

MRP8 was identical to the sequence of the cystic fibrosis (CF) antigen and the name calgranulin given, indicative of the presence of calcium binding protein in the cytosol of granulocytes (346).

In 1995 it was proposed that these proteins be called S100A8/S100A9, according to the nomenclature based on chromosomal location of the S100 proteins (26). In 1999 murine

S100A8 was purified as chemotactic protein (CP), called “CP-10” according to its relative molecular mass of 10.3 kDa. (44). In this thesis S100A8/S100A9 is used to avoid any preconceived ideas concerning functions.

1.6.1. Purification and characterization

S100 proteins vary in their structural and metal-binding properties, and different purification and detection protocols may generate structurally-different components.

Conventionally, the S100A8/S100A9 complex was isolated from the cytosol of neutrophils in the presence of EDTA, is anionic, and migrates in electrophoresis as an 2-globulin, whereas in the presence of calcium it is slightly basic and migrates as a -globulin (92, 347). Monomers are detected only after dissociation, typically by heating in sodium dodecyl sulphate (SDS) and 8 M urea, then separate by SDS polyacrylamide gel electrophoresis (PAGE). Reactive sulphydryl

28 groups are exposed after dissociation, and unless these are blocked or alkylated, various homo- or heterodimers may form (60, 348). Practically, in the presence of calcium S100A8/S100A9 is extremely hydrophobic and adheres to glass surfaces and filters used for concentration.

It is noteworthy that preparations of recombinant S100A8/S100A9 complexes may vary between investigators. In most publications, recombinant complexes are formed by mixing each in equimolar concentrations. However, with the recent reports of polymerization, a denaturing- renaturing cycle may be essential for formation of a more stable native-like S100A8/S100A9 complex (206). Although these complexes are heat-resistant, structural analysis was not performed. However, differences in preparations may generate divergent data and need to be considered.

Numerous mAbs against the human S100A8/S100A9 heterodimer have been produced and these are shown in Table 1-11. These were raised against the subunits, recombinant proteins or synthetic polypeptide analogs, and it is possible to detect subunit epitopes by immunoreactivity. However, some mAbs may be unsuitable for studying molecular configurations, because some epitopes may be hidden in the intact oligomeric protein, particularly after divalent cation binding, or by complex formation with other tissue components.

Until recently, when more recombinant proteins became available, the potential cross-reactivity of many of the Abs with other S100 proteins was not established, raising questions of specificity in some studies.

Table 1- 11: Monoclonal Abs against human S100A8/S100A9 heterodimer complexes

Monoclonal Abs Year of publication References Mac387 1988 (349, 350) S 36.48 1988 (351) CF145, CF557 1989 (352) S 32.2, 8-5C2 1990 (353) 27E10 1992 (354) Fl1, F3, A1 1996 (193)

Calcium makes the heterodimer complex of S100A8/S100A9 remarkably resistant to proteolysis (355) and this may be important in immunodetection. Only a few proteinase K-

29 resistant proteins are known, such as the pathological form of the prion protein (PrPSc). In contrast, homodimers of S100A8 and S100A9 are more readily degraded by (355).

This is a suggested explanation for the absence of S100A8 in granulocytes from S100A9-/- mice, although S100A8 mRNA is abundant (337, 338). However, this is unlikely as S100A8, but not

S100A9, is produced by activated murine macrophages ((94), Section 1.6.6). S100A8/S100A9 are secreted from activated phagocytes at sites of inflammation where numerous proteases are found, and their resistance was proposed to facilitate their various functions in inflammation and tissue remodelling (356). However, recently S100A8/S100A9 were identified as substrates of MMP-2 and MMP-9 (357). Further studies are required to elucidate functional relevance of protease resistance of these proteins.

Human S100A8/S100A9 has elevated thermal stability upon Ca2+ binding (347, 358) and at pH levels from 7.0 (physiological pH) to 8.0 (intestinal pH) (359). A role for

S100A8/S100A9 in the gut is suggested as the complex is stable in faeces and proposed as a useful clinical marker in the diagnosis of inflammatory conditions of the digestive tract (359)

(see Section 1.8).

1.6.2. Molecular genetics and structure of S100A8 and S100A9

Like most S100 genes, the human, mouse, and rat S100A8 and S100A9 genes contain three exons (351). Figure 1-4 shows exon/intron structures of the human S100A8 and S100A9 genes. Human S100A8 genes consist of three exons of different lengths (33, 164, and 211 bp) separated by two introns (484 and 150 bp); human S100A9 also has three exons (28, 165, and

380 bp) separated by two introns (292 bp and ~2 kb). The first exon of both proteins is short and contains the 5’ untranslated sequences. The second contains the ATG start codon and encodes the N-terminal 47 amino acids of S100A8, and 50 of S100A9. The third exon encodes the carboxy-terminal 46 amino acids of S100A8 and 64 of S100A9 (4, 351, 360). Each of the second and the third exon encodes one of the two Ca2+-binding domains and are interrupted between codons in the hinge region by the second intron. This exon-intron organization supports the hypothesis that EF-hand type proteins arose from an ancestral peptide with one Ca2+-binding

30 domain, by gene duplications and deletions ((361), see Section 1.2.2). Thus, the second intron may contribute to the divergence of the hinge region, which relates to specific interactions of

S100 proteins with target proteins (42, 44, 237) (see Section 1.2.3).

S100A8 S100A9

S100A8 protein S100A9 protein

Figure 1- 4: Exon/intron structures of the human S100A8 and S100A9 genes

(from (1))

The general structural properties of S100A8 and S100A9 are summarized in Table 1-12.

The gene sequence of human S100A8 contains an open reading frame (ORF) of 279 nucleotides,

93 amino acids and molecular mass 10,835 Da: S100A9 contains an ORF of 352 nucleotides, predicting a protein of 114 amino acids of 13,242 Da (345). Human S100A9 has a naturally- occurring “deletion derivative”, the so-called S100A9* isoform (362), the molecular mass of which are 13,242 Da and 13,154 Da. S100A9* lacks the first four amino acids owing to an alternative translation start site at the second methionine at position five (363); S100A9* lacks the single cysteine residue at position 3 (362).

The relative masses of S100A8 and S100A9 separated by SDS-PAGE are 8,000 Da and

14,000 Da (8 K and 14 K), respectively, which lead to them being known as MRP-8 and MRP-

14 (345). Human S100A8 and S100A9 have a single cysteine residue (Table 1-12), no signal or membrane anchor sequence, and they lack consensus sequences for N-linked glycosylation (345,

364). Murine S100A8 and S100A9 were cloned in 1992 (365). Murine S100A8 (89 amino acids, mass 10,295 Da) and S100A9 (113 amino acids, mass 13,049 Da) share sequence homologies,

31 Table 1- 12: General structural properties of human and murine S100A8 and S100A9

Human Murine S100A8 S100A9 S100A9* (A95-114) S100A8 S100A9 Open reading 279 (345) 352 (345) Alternative translation at 267 (365) 339 (365) frame (bp) position 5 due to the AUG codon functioning as a starting Met(362) Number of 93 (345) 114 (362) 110 (362) 89 (365) 113 (365) amino acids MW (Da) Calculated 10,835 (345) Calculated 13,242; Calculated 12,690, Calculated 10,295 (365), Calculated 13,049 (365), Measured 13,157±3 (362) Measured 12,693±3 (362) Measured 10,164 ± 2 (366) Measured 12,972±2 (366) Cysteine Cys42(345) Cys3 (362) None (362) Cys41 (365) Cys79, Cys90, Cys110 (365) residues Methionine and Met1, Met78; Met1, Met5, Met63, Met81, Met5, Met63, Met81, Met83, Met36, Met73; Met8, Met23, Met40, Met41, number of 12 lysine residues (345) Met83, Met94; Met94; 10 lysine residues 7 lysine residues (365) Met43, Met90, Met99; lysine residues 11 lysine residues (345) (345, 362) 8 lysine residues (365) Dimerization Covalent dimers (367), Covalent dimerization Non-covalent homodimers Covalent homodimers, non- Covalent homodimers, non- Non-covalent homodimers (367), Non-covalent and possible complexes with covalent homodimers (369) covalent homodimers and and S100A8/ S100A9 S100A9 homodimer and S100A8 (54) and non-covalent non-covalent complexes heterodimer and higher S100A8/ S100A9 complexes with S100A9 with S100A8 (370) complexes (60, 345, 367, heterodimer and higher (370) 368) complexes (60, 345, 367, 368) Relevance references are given in brackets throughout Table.

32 particularly within the EF-hand domain and neighbouring -helices. Amino acid sequence similarities between S100A8/S100A9 and S100A12 are summarized in Figure 1-5.

Human S100A8 shows relatively low sequence homology with murine S100A8 (64% at the cDNA level, 59% at the amino acid level) and in S100A9 there is only 59% sequence homology between the murine and human proteins (371). In contrast, most other members of the family such as S100B, S100A10, and S100G, share 98, 92, and 88% homology, respectively, across species (372-374). This low homology may be reflected in evolving functional differences between the human and murine proteins.

Human S100A12 65% (40%) 70% (46%) (375) (375)

Human Human

S100A8 72.8% (28.3%) S100A9 (1)

59% (33%) 76% (58%) (375) (59%) (365) (351)

Murine Murine S100A8 S100A9

Figure 1- 5: Amino acid sequence similarity among S100A8, S100A9 and S100A12

Relevance references are given in brackets throughout Figure.

1.6.3. Polymerization of S100A8/S100A9

S100 proteins typically constitute tightly-packed homodimers characterized by perfect symmetry (Section 1.2.3), although human S100A8 and S100A9 are different. These have a strong preference to form non-covalent heterodimers with better complementarity of the interface than seen with homodimers (53). The carboxy-terminus of S100A9 plays a prominent role in interaction of S100A8 and S100A9, determining the specificity of dimerization, and this is the same region implicated in target protein binding of the complex (54).

The heterodimer is abundant naturally within the neutrophil cytoplasm (54, 61, 376) and is biologically relevant (60, 376, 377). There are numerous reports of only S100A8 or S100A9

33 expression in cells (94, 378), indicating distinct functions of the homodimers. The 27E10 mAb reacts with human S100A8/S100A9 complexes only after their non-covalent association in vitro

(340). However, the most specific mAbs to S100A8/S100A9 do not react with circulating monocytes or neutrophils (343), although 27E10 detects surface expression under certain circumstances (340) where it reacts with a subset of monocytes/macrophages in acute but not chronic inflammatory disorders (379), possibly associated with the cell membrane.

The ability to homodimerize was suggested to be restricted to the murine proteins.

However a mAb antibody against murine S100A8 which cross-reacts with the human S100A8 homodimer, but not the monomer or the heterodimer, detects homodimeric S100A8 in the cytoplasm of human neutrophils, suggesting that hetero-complex formation of S100A8 and

S100A9 is not exclusive. Its expression rapidly diminishes upon activation (380).

Heterotrimers and calcium-induced heterotetramers may also be functionally relevant

(60, 206). Initially, heterodimerization was thought to be Ca2+-dependent. However now it is accepted that S100A8 and S100A9 form stable heterodimers in absence of Ca2+ but with calcium, these form heterotetramers (206). The complex stability in S100A8/S100A9* is less.

These combinations of tetramers: (S100A8/S100A9)2, (S100A8/S100A9)2, (S100A8/S100A9)-

(S100A8/S100A9*) and (S100A8/S100A9*)2 have been described (381). The S100A9* containing complex may have different functions (363). Different murine S100A9 isoforms were seen by 2D-PAGE of murine cell lysates and N-terminally-deleted murine recombinant

S100A99-113, potentially murine S100A9*, also forms homo- and heterodimers (54).

Calprotectin (L1) purified from neutrophils and plasma was reported to have a mass of

~36 kDa, consisting of subunit polypeptide chains, L1Light and L1Heavy of masses of ~8 and 14 kDa, respectively (59, 382). Based upon these masses, the functional anti-microbial complex was proposed as S100A8/S100A92. In addition to the heterodimer and tetramer, highly abundant

S100A82/S100A9 trimer (34.0 kDa) was also reported in human granulocytes and monocytes

(60). However, trimers of S100A8/S100A92 are controversial, because their existence is not supported by current available structural data (53, 61, 376).

34 1.6.4. Zinc binding properties

S100A8 and S100A9 contain Zn2+-binding sequences (His-X-X-X-His motif), the capacity of which is higher than many other S100 proteins, and binding is not affected by calcium. Recently, the crystal structure of the (S100A8/S100A9)2 heterotetramer showed that a major contribution to tetramer association is made by the canonical calcium binding loops in the

C-terminal halves of the two proteins. Furthermore, His83 and His87 from the HXXXH motif of

S100A8 in the heterotetramer are complemented by His20 from the opposite S100A9 molecule, and with the side-chain containing Asp30 in spatial proximity, would allow formation of a

2+ 2+ 2+ His3Asp Zn binding motif (383), homologous to the Zn and Cu -binding sites in S100A7

(384) and S100A12 (62). Zn2+ binding regulates important intracellular and extracellular functions of S100A8/S100A9 such as anti-microbial activity (385) and apoptosis-inducing activities, both of which are reversed by addition of Zn2+ (see Section 1.7.2.2). By sequestration of Zn2+, S100A8/S100A9 also inhibits MMPs (386) (see Section 1.7.2.6). This property may be potentially important in reducing local concentrations of Zn2+.

1.6.5. Post-translational modifications

Modifications of S100A8/S100A9 and/or S100A9* are phosphorylation, methylation and oxidization, as shown in Table 1-13. These may influence their metal-binding properties, interactions with target proteins, activation of enzymes, and their relocation in cells upon stimulation, resulting in a broader spectrum of biochemical and functional properties.

Table 1- 13: Post-translational modifications of S100A8 and S100A9

Proteins Human Murine S100A8 Oxidation (387) Oxidation (monomers, disulfide-linked Phosphorylation (1, 388) homodimer, sulfinamide bonds) (73, 389, 390) Possible N-linked glycosylation site (Asn17-Tyr18-Ser19) but no indication of glycosylation from amino acid analysis (44) S100A9 Oxidation (391) Removal of the N-terminal Met Phosphorylation of Thr113 N-terminal acetylation (363, 388, 392, 393) Disulfide bond formation (Cys79-Cys90) 1-Methylation of His106 (366) S100A9* Phosphorylation of Thr 113 (363, 392), Not determined Removal of Met5 and consequent acetylation of Ser6 (60)

35 1.6.5.1. Modification of S100A8

Intracellular S100 proteins exist mainly as non-covalent complexes with free reduced sulfhydryl groups on cystine residues that are prone to oxidation. Neutrophils release granular enzymes and oxygen metabolites formed via NADPH oxidase in response to activation (394).

The respiratory burst produces superoxide anion corresponding to a maximal blood concentration of ~200 M, which dismutates to H2O2. Subsequently in the presence of halides

H2O2 is converted by myeloperoxidase (MPO) to the powerful two electron (non-radical) oxidant HOCl that can modify proteins and lipids involved in inflammatory processes, and can kill invading pathogens (395, 396). However, HOCl can also be toxic in inflammatory processes

(397) such as HOCl-oxidized LDL identified in human atheroma (398).

Cys42 of human S100A8 and Cys41 of murine S100A8 are in the -helix immediately preceding the hinge region. Murine S100A8 is oxidized by H2O2 to the covalent disulfide-linked homodimer and is exquisitely sensitive to oxidation by HOCl which generates various oxidation products (389, 390). For example, Met36/73 are converted to Met36/73 sulfoxides, and Cys41 conjugates with -amine group on Lys6, Lys34/35, or Lys87 to form stable intra-chain or inter- molecular sulfinamide covalent bonds, in a reaction detailed in Figure 1-6 (389, 390). This was the first demonstration of this novel modification in any protein. Sulfinamides are resistant to

Figure 1- 6: Proposed structure and mechanism of formation of Lys35-Cys41 sulfinamide bond

HOCl rapidly oxidizes Cys41 to Cys41(O), which is partially stabilized, possibly by hydrogen bonding with amines on neighboring Lys residues. The sulfenic acid may then undergo nucleophilc substitution by the -amine of Lys, followed by loss of dihydrogen to yield sulfinamides. (from (389))

36 reduction by DTT and conventional reductases and so are unlikely to be regenerated in vivo

(389). Formation of sulfenamides, sulfinamides and sulfonamides, and inter-/intramolecular cross-links in HOCl-treated synthetic peptides was recently described and cross-linking of mural proteins by an unsuspected MPO-mediated pathway was proposed (399). PMA-activated neutrophils also generate these products (389).

In human S100A8, equimolar levels of HOCl generate DTT-resistant S100A8 dimers and trimers within 10 minutes in vitro, and DTT-resistant complexes were found in human atheroma ((368), see Section 1.8), suggesting formation of sulfinamide cross-linked complexes in vivo but these modifications have not been characterized in proteins from inflammatory lesions.

Whether S100A8 is phosphorylated is a point of controversy (1, 363, 388).

Phosphorylated human S100A8 was not found in neutrophil lysates following activation with

PMA (392, 393), whereas another study reports a phosphorylated acidic isoform from the cytosol of PMA-activated neutrophils (388). This discrepancy may be due to sensitivities of detection methods, purification processes or concentration of PMA used for neutrophil activation.

1.6.5.2. Modification of S100A9

S100A9 from supernatant of activated murine spleen cells, has a mass of 12972±2 Da by electrospray ionization mass spectrometry, whereas the theoretical mass derived from the cDNA sequence, after removal of the initiator Met, is 12918 Da. Four post-translational modifications of murine S100A9 are identified: removal of the N-terminal Met, N-terminal acetylation, a disulfide bond between Cys79 and Cys90, and 1-methylation of His106 (366).

Disulfide bond formation would influence the tertiary structure, although its relevance to the function of S100A9 is unknown. Methylation of His is a rare post-translational modification

(400); 1- or 3- methyl-His is found in actin, myosin and rhodopsin (401, 402).

Phosphorylation of human S100A9 is reported (60, 392); this is a protein kinase C

2+ (PKC)-independent, Ca -dependent phosphorylation of the C-terminal Thr113 residue. This is

37 proposed to play a role in intracellular signalling (392), and may also influence translocation of the protein to the cell membrane during human neutrophil activation (388). The kinase responsible for this phosphorylation is not identified (392). In contrast to human S100A9, murine S100A9 lacks a Thr residue in this position and no phosphorylation is reported.

Oxidation of recombinant human S100A9 by HOCl was reported as methionine sulfoxide (73, 391).

1.6.6. Distribution of S100A8/S100A9 complexes in cells and tissues

Table 1-14 shows the distribution of S100A8/S100A9 in normal tissues. These are frequently co-expressed, such as in bone marrow, spleen, and bone (60); the expression in spleen and kidney may reflect neutrophils. S100A9 expression in skin, lymph nodes and uterus, implies divergent regulation in normal tissue. However, interpretation of immunohistology should be done with caution as neutrophils within blood vessels would invariably exhibit reactivity, and double-staining would be required to negate these.

Table 1- 14: Distribution of S100A8/S100A9 in normal tissue

Tissue S100A8/ S100A9 expression Brain Negative (346) Gastrointestinal tract Buccal smear Positive (patchy) (346) Tongue Positive (346) Esophagus Positive (346) Jejunum Negative (346) Colon Negative (89, 346) Liver Positive in monocyte-like cells (403), negative (89, 346) Spleen Positive in endothelial cells in red pulp (403); positive (89) Pancreas Negative (346) Lung Negative (346, 403) Tracheal gland cells Positive (404) Urinary tract Kidney (cortex, medulla) S100A8 positive, no S100A9 (89) Bladder Negative (346) Lymph node S100A9 positive, no S100A8 (89) Bone Marrow Positive (365) Uterine cervix S100A9 positive, no S100A8 (89) Placenta Negative (346) Skin S100A9 positive, no S100A8 (89), negative (346) Breast Negative (89) Bone S100A8/S100A9 is positive in osteoclasts (96), S100A8 is positive in hypertrophic chondrocytes (96)

38

Table 1-15 shows the reported cell type-differences in S100A8/S100A9 expression and induction. S100A8/S100A9 seems to be regulated through common pathways in numerous cell types (see Section 1-9, 1-10), and their expression may be dependent on cell type to some extent, but also may be stimulant-specific.

Table 1- 15: Distribution of S100A8/S100A9

Mouse Human S100A8 S100A9 S100A8 S100A9 References Neutrophils Constitutive Constitutive Constitutive Constitutive (17, 59, 382) Monocytes/macrophages Inducible Nil Inducible Inducible (17, 93, 94, 367, 405-407) Dendritic cells ND ND Constitutive Constitutive (408) Osteoclasts Constitutive Constitutive Constitutive Constitutive (96) Microglia ND ND Nil Inducible (409, 410) Eosinophils, Basophils ND ND Nil Nil (343) Lymphocytes ND ND Nil Nil (403) Platelets ND ND Constitutive Constitutive (411) Endothelial cells Inducible Inducible Inducible Inducible (95, 368) Keratinocytes Inducible Nil Inducible Inducible (66, 412-415) Fibroblasts Inducible Nil ND ND (378) Hypertrophic chondrocytes Constitutive Constitutive Constitutive Constitutive (96) Cytotrophoblasts Transient Nil ND ND (339) ND; not determined

Around 55% of total bone marrow cells strongly express human S100A8/S100A9

(365); expression is first observed at the metamyelocyte stage of neutrophil development. Up to

50% of bone marrow monoblasts express S100A8/S100A9 (367). In murine bone marrow,

S100A8/S100A9 expression overlaps that of the leukocyte integrin CD11b/Mac-1, suggesting that these are rather mature myeloid cells (365). S100A8 and S100A9 are constitutive proteins in bone marrow and circulating neutrophils (reviewed in (1, 356)) and make up an estimated cytosolic concentration of 5-15 mg/ml (362, 416, 417) equivalent to ~40-49% of the cytoplasmic protein and ~5% of total neutrophils protein (17, 59, 362). S100A8/S100A9 is also expressed in the cytosol of cells of monocytes, although amounts are less (~1% of cytosolic protein) (367). They are not usually present in lymphocytes, basophils or eosinophils.

Associations with myeloid cell differentiation are presented in Section 1.7.1.3.

39 Figure 1-7 shows the differentiation and distribution of monocytes/macrophages.

Monocytes differentiate from progenitor cells in the bone marrow prior to release into the blood.

Monocytes can differentiate further into macrophages or dentritic cells (DCs) as they migrate into tissues, such as Kupffer cells in liver, alveolar macrophages in lung, osteoclasts in bone, and microglia in the central nervous system (reviewed in (418)). Human S100A8 and S100A9 are expressed in circulating monocytes, but not in resident tissue macrophages (60). Newly- recruited monocytes in perivascular locations also express S100A8/S100A9, but not mature

(non-migrating) macrophages such as those within gout tophi (419). Thus, their expression pattern indicates down-regulation during differentiation. The S100A8 gene is not expressed, and the S100A9 gene only weakly, in immature DC, whereas both are highly expressed in mature

DC, suggesting a role in DC maturation (408).

Figure 1- 7: Differentiation and distribution of mononuclear phagocytes

Distinct subpopulations of circulating monocytes may give rise to resident tissue macrophages, DC and osteoclasts compared with cells recruited by an inflammatory or immunologic stimulus. Further phenotypic heterogeneity arises from microenvironmental stimuli such as cytokines and microbial products (from (420)).

During an inflammatory response, resident tissue macrophages are activated to produce a variety of inflammatory and effector reactions, the pattern of which is differentially regulated by the microenvironment of particular tissues. Early immunohistochemical studies found

S100A8/S100A9 in macrophages in human tissues such as gingivitis, psoriasis, neurodermatitis, erythrodermia (345), and in rejecting renal allografts (340, 421). S100A9 is expressed in

40 microglia in brains of patients with cerebral infarction and other neurological disorders (409,

410, 422). Thus, expression of these proteins may be a result of macrophage activation in inflammation. This is now thought to be the case, and this thesis will address some mechanisms.

Unstimulated murine primary macrophages express little detectable S100, but activated macrophages express S100A8 in the absence of S100A9 (93, 94). Similarly, in murine monocyte/macrophage-like WEHI 265 and RAW 264.7 cell lines, S100A8, but not S100A9, is upregulated in response to LPS stimulation (93, 406), indicating important differences in murine and human macrophage responses. S100A8 gene induction in macrophages is reviewed in detail in Section 1.10.

Figure 1-8 shows the macrophage polarization paradigm that may explain some of

S100A8 gene regulation in macrophages. Macrophages are activated in response to extrinsic stimuli including cytokines, viruses, viral particles, bacteria and by intrinsic stimuli such as changes in calcium and IFN- to trigger various effector functions (423). Activated macrophages display different functional phenotypes which are generated under the influence of specific mediators and which can be antagonistic. Interestingly, this polarization is somewhat similar to type 1 and type 2 responses characteristic of Th-1 T cells; IFN- and IL-4, have cross-

Figure 1- 8: Macrophage polarization paradigm

(from (432))

41 regulatory properties and co-ordinate two fundamentally-opposite immune responses (424, 425).

Similarly, macrophages can secrete IL-12 which is crucial for IFN- production by Th-1 cells, or IL-10, which can induce IL-4/IL-13 production by Th-2 cells (426, 427).

Initially, activation of macrophages by IL-4 or IL-13 was called “alternative macrophage activation” and produced a distinctive phenotype different to that of the “classical activation” phenotype generated by IFN- or LPS/microbes (428). This preferential production of IL-12 or IL-10 is the basis of the M1/M2 polarization paradigm (429-433). In 2002, M2 polarization was further subdivided (434). M2a activation is obtained by stimulating macrophages with IL-4 or IL-13, produced mainly by Th-2 cells, mast cells, and basophils (435).

M2b cells are generated by stimulation with LPS/IL1 and activation of Fc receptor for immunoglobulin G (FcRI) (436, 437), and produce low levels of IL-12 and high amount of IL-

10 important in developing type II adaptive immune responses (438). These also produce TNF-

, IL-1 and IL-6, indicating that they are not anti-inflammatory. M2c is functionally heterogeneous and includes macrophages stimulated with IL-10, TGF-, or glucocorticoids

(GCs). Their common feature is down-regulation of pro-inflammatory cytokines, increased scavenging capacity, and a pro-healing functional program.

Taken together, macrophage activation can be either pro-inflammatory or anti- inflammatory, contributing to tissue destruction or regeneration and wound healing, and co- ordinated switching between these phenotypes may regulate inflammatory processes (426, 429,

439). Interestingly, S100A8 is upregulated by IL-10, TGF-, or GCs in LPS-activated macrophages (93, 94). According to this classification, S100A8 may be a gene expressed in

M2c-like macrophages although activation is also dependent on LPS or other stimulants.

Fibroblasts are heterogeneous stromal resident cells, and are the predominant cell type in connective tissue. Fibroblasts produce, metabolise and regulate connective-tissue components.

All other resident and recruited cells are surrounded by fibroblasts and move about, on, and within a meshwork of fibroblast-derived products. Fibroblasts participate in wound healing, fibrosis/scarring and immune/inflammatory processes (440, 441) by contributing to leukocyte recruitment/accumulation, angiogenesis, matrix metabolism, and protection against oxidative

42 damage (442, 443). Depending on the nature of the mediators present, they also contribute to granulation tissue, wound healing, scar formation (47, 400, 440) and the pathogenesis of interstitial fibrosis (441, 444). Numerous factors including ECM components, some cytokines, prostaglandins, reactive oxygen species (ROS), and growth factors (445) modulate fibroblast function.

Unstimulated murine primary fibroblasts express little S100A8, but following activation, it is expressed in the absence of S100A9 (378). However, the human proteins are generally co- expressed (446). Fibroblast-like cells in rat granulation tissue express S100A8 2-4 days after dermal injury, and this decreases 7 days post injury (378). In NIH3T3 fibroblasts, S100A8 is upregulated by IL-1 and FGF-2 which promote proliferation (447, 448), whereas induction is downregulated by TGF- which promotes differentiation to myofibroblasts (449) and antagonizes the IL-1- and FGF-2-induced proliferative phenotypes (450, 451). These patterns of gene regulation suggest that S100A8 may be involved in fibroblast-to-myofibroblast differentiation at sites of inflammation and repair/remodeling. Interestingly, activated NIH3T3 cells do not secrete S100A8, and only intracellular S100A8 dimer, a structural modification induced in S100A8 by oxidants such as H2O2 was detected (73). This suggests a function analogous to S100A2, which forms disulfide bonds in response to H2O2 and is sensitive to early cellular responses to oxidative stress (452, 453). Given that S100A8 is an efficient scavenger of

ROS (73, 389), it may regulate intracellular redox-mediated pathways involved in fibroblast growth/differentiation.

Keratinocytes actively participate in immunological events in a variety of inflammatory disorders and upregulation of cytokines such as IL-1, IL-6 and TNF- reflect inflammatory activation in dermatological disorders (454) where S100A8/S100A9 are induced in keratinocytes (341, 352). For example, S100A8/S100A9 complexes are highly expressed in abnormally-differentiated keratinocytes in psoriasis (455), and activated human keratinocytes

(HaCaT cells) secreted the S100A8/S100A9 dimer (456). Keratinocytes are located in the outermost layer of the skin, and contain high levels of anti-oxidants and enzymes involved in anti-oxidant defense. Nevertheless, high levels of ROS generated by stressors such as sunburn

43 can overwhelm normal defenses to oxidative damage, so that additional protective responses are provoked (412). Roles of S100A8/S100A9 in hyperproliferative responses such as occur in psoriasis (457) and in wound healing (456) are proposed. In a murine model, S100A8, but not

S100A9, is strongly induced in keratinocytes by UVA irradiation in vivo or in vitro (412).

PAM212 cells (a murine keratinocyte cell line) secrete ~15% of UVA-induced S100A8.

Although their exact roles in keratinocytes are unclear, S100A8/S100A9 may be involved in

Ca2+-dependent reorganization of cytoskeletal filaments that affect keratinocyte proliferation and differentiation (207, 456, 458) or in anti-oxidant defense (412) (see Section 1.7.1.4 and

Section 1.7.2.4).

Human tracheal epithelial cells from patients with cystic fibrosis (CF) also express

S100A8/S100A9. However, these are not normally expressed in cells from healthy subjects (see

Section 1.8).

Endothelial cells (EC) have multi-functional roles in inflammation. Factors such as LPS,

IL-1, or TNF- activate EC to produce chemokines and other chemoattractants and to express adhesion molecules (reviewed in (459-461)). These molecules mediate many other EC functions, including the pro-coagulant balance, nitric oxide release, and production of proliferative and angiogenic mediators (reviewed in (459, 462)). Immunohistochemical studies show that EC in non-inflamed tissues express no S100A8/S100A9, whereas these are found associated with the of venules in sites of inflammation (85, 343). However whether EC synthesize the proteins was contentious and one group claimed that the proteins seen on EC in vivo were derived from transmigrating leukoctes (85). However, recently, human S100A8 and S100A9 mRNA in neovessels in human atheroma, but not larger vessels, was reported (368), implying regulation of EC function in the microcirculation. Expression may be particularly relevant to vessel wall diseases such as atherogenesis, deep venous thrombosis, inflammatory-related vasculitides and in micro-ischaemic events typical of chronic inflammation (95).

Murine brain, thymus, and skin microvascular EC lines do not express S100A8/S100A9 constitutively, but high levels of mRNA are induced by LPS. Their major components in cell lysates are monomers and homodimer of S100A8; no S100A8 was secteted (95). S100A8 was

44 also induced by IL-1 but not TNF-, whereas S100A9 was induced by TNF-. This different induction pattern indicates different regulation pathways in EC and possibly different functions, and contrasts with the generally co-ordinated expression of S100A8/S100A9 in human myeloid cells (463). S100A8 induction in microvascular EC is confluence-dependent (95), a requirement similar to fibroblasts (378). Reasons for this requirement have not been clarified.

In murine placenta formation, following initial attachment and implantation of the embryo, the polar trophectoderm proliferates to form the ectoplacental cone (EPC) and extra- embryonic ectoderm, from which the various differentiated secondary trophoblast cell types arise; EPC-derived trophoblasts resemble granulocytes and macrophages. These cells in the vicinity of the EPC express S100A8, but not S100A9, at 6.5 to 7.5 days postcoitum (339), whereas S100A9 is expressed later.

In addition to their expression in osteoclasts, S100A8 and S100A9 are expressed in murine and human bone and cartilage cells. S100A8 is expressed in hypertrophic chondrocytes, but not in proliferating chondrocytes within the growth plate where the cartilaginous matrix is calcifying. S100A9 was only evident in the invading vascular osteogenic tissue penetrating the degenerating chondrocytic zone adjacent to the primary spongiosa, where S100A8 is also expressed (96). Weak S100A8/S100A9 expression was also seen in osteoblasts. Expression patterns suggest that S100A8 is associated with chondrocyte differentiation, whereas S100A8 and S100A9 may both contribute to calcification of the cartilage matrix and its replacement with trabecular bone, and to regulation of redox in bone resorption (96). In rheumatoid arthritis, the expression of S100A8/S100A9 mimics monocyte invasion at the cartilage-pannus junction where cartilage erosion is seen (464) and in human atheroma S100A9 was associated with dystrophic calcification (368).

Some other cells are reported to express S100A8 and/or S100A9, including platelets

(411). Given that platelets are anuclear, expression of the mRNAs in platelets may correspond to that in bone marrow megakaryocytes. Our laboratory has noted positive expression of both in all murine megakaryocytes in bone marrow (Geczy CL unpublished data). The S100A8/S100A9 complex is associated with eosinophils located in the crypts beneath the villous epithelium in

45 normal human ileal lamina propria (465) and recent studies in our laboratory have detected the proteins in eosinophils in human asthmatic lung (Geczy CL unpublished data).

1.6.7. Possible mechanisms of S100A8/S100A9 secretion and potential clinical relevance

S100A8 and S100A9 have numerous extracellular functions, such as anti-microbial, cytostatic, chemotactic activities, regulation of MMP activity and as an oxidant sink. Thus

S100A8/S100A9 must be released to the extracellular space (456, 466). S100A8/S100A9 in sera from patients with inflammatory disorders strongly suggests secretion from stimulated phagocytes and not merely a consequence of neutrophil death/necrosis. S100A8/S100A9 complexes are secreted by activated phagocytes during inflammatory process such as seen on contact with inflamed endothelium (85, 467), and also from leukocytes during inflammatory events (42, 380, 468, 469), indicating an alternative secretory pathway to that discussed in

Section 1.3.2.

Table 1-16 shows patterns of secretion from some cells activated in vitro. Secretion is not generally associated with death of activated cells, although human S100A8/S100A9 is released from neutrophils as a consequence of disruption/death, because extracellular levels in response to stimulation correlate directly with a proportional decrease in viability (416).

Table 1- 16: Secretion of S100A8/ S100A9 from activated cells in vitro

Intracellular expression Extracellular Cell line S100A8 S100A9 secretion Reference Murine Neutrophils 32D* Inducible Inducible S100A8/ S100A9 (370) Monocytes/macrophages RAW Inducible Nil S100A8 (93, 406) 264.7 Endothelial cells bEND3 Inducible Inducible Nil (95) Keratinocytes PAM212 Inducible Nil S100A8 (low) (412) Fibroblasts NIH3T3 Inducible Nil Nil (378) Human Neutrophils HL60* Inducible Inducible S100A8/S100A9 (470) THP-1* Inducible Inducible S100A8/S100A9 (470) Monocytes/macrophages THP-1 Inducible Inducible Nil (470) Keratinocytes HaCat Inducible Inducible S100A8/S100A9 (456) *; differentiated cells

46 In TPA-treated human monocytes, S100A8/S100A9 are secreted via a mechanism that requires an intact microtubule network, is energy-dependent, and involves PKC activation (112), but details are unclear. IL-1, also lacks a leader sequence and is found in small intracellular vesicles shed after monocyte activation (471). However, the secretory pathway for IL-1 is different from the alternative pathway proposed for S100A8/S100A9 because electron microscopy failed to detect endosomes or vesicles containing any S100A8 and S100A9 in the cytosol (362). Murine macrophages secrete S100A8 in response to various stimulants (93, 406), confirming secretion that is not dependent on S100A9.

S100A8/S100A9 is found in body fluids, including plasma, urine, body secretions, intestinal fluid and faeces. Table 1-17 shows levels of the proteins in various pathological conditions. It is noteworthy that no S100A8/S100A9 deficiency has been found (among more than 5000 individuals tested) to date, suggesting the vital importance of these proteins (347).

S100A8/S100A9 is proposed as a sensitive marker of inflammation of various conditions rather than being diagnostic indicators of specific diseases (Section 1.8). In most diseases associated with inflammation, functions have been associated with this condition.

Generally, S100A8/S100A9 levels are elevated in sera of patients with systemic inflammation, whereas Zn2+ levels are reduced (472), implying that S100A8/S100A9 may regulate Zn2+ concentrations through its Zn2+-binding properties. Interestingly, hyperzincaemia with elevated serum S100A8/S100A9 levels was reported as a new clinical entity (473). These cases are characterized by recurrent infections, hepatosplenomegaly, anaemia, cutaneous vasculitis and evidence of systemic inflammation. Underlying inflammation may contribute to the extraordinarily high abundance of these proteins (plasma concentrations is 1400-6500

g/ml), compared to many inflammatory disorders (347, 354), that are generally <10 g/ml

(normal range; <0.85 g/ml) (473). Another explanation for their accumulation could be defective catabolism, reduced clearance due to unknown structural changes, or changes in a specific cellular receptor (381). Interestingly, a case of hyperzincaemia with elevated serum

S100A8/S100A9 levels had normal levels of the proteins in urine and faeces (473).

Production by kidney cells is proposed to prevent formation of calcium oxalate stones

47 (474), but the clinical relevance is still unknown.

Table 1- 17: S100A8/S100A9 concentrations in various body fluids

Reference

controls Cases Comment/references Serum/plasma Infectious disease Healthy subjects 0.09-0.66 (475) Bacterial infection 0.1- 0.6 0.6- 11.0 (476) 0.303- 1.660 up to 6.230 (477) Viral infection 0.1- 0.6 0.1- 1.4 (476) HIV infection 1.2- 9.4 (478) Autoimmune diseases Rheumatic arthritis 0.8- 0.91 1- 46 (479, 480) Juvenile rheumatoid arthritis 0.5- 0.8 2- 24 Osteoarthritis vs cases (481) Systemic lupus erythematosus 3.6 (482) Others Crohn’s disease 5 ± 2 17 ± 6 Inactive vs active (483, 484) Cystic fibrosis (children) 0.3- 1.6 0.4- 26 (485) Kawasaki disease 0.220 ± 0.0 40 4.220 ± 2.699 (486) Leukemia 0.4 0.4-13.3 Blood donors vs cases (193) Acute myocardial infarction 2.1 (1.2–3.4) 2.7 (1.6–4.6) (411) Major surgery 0.5-0.9 7-15 Preoperative vs postoperative (4 hrs) (487) Cardiopulmonary bypass 0.3 5.2±1.3 Preoperative vs postoperative (488) Transplant rejection 0.052–0.468 0.117- 3.300 (489) Hyperzincaemia <1 1400- 6500 (473) Cerebrospinal fluid HIV infection 0-37* 30- 350* (490) Oral fluids Healthy subjects 22.0 Stimulated whole saliva (491) Sjøgren’s syndrome 23.6 Stimulated whole saliva (492) HIV infection 0.06-0.41 (493) Urine Cystitis 24(5-650)* 182 (18-992)* Infants and children (494) Pyelonephritis 24(5-650)* 1000 (360-7000)* Infants and children (494) Faeces Healthy subjects 2 (0.5-8) (495) Crohn's disease 10.5 (1.1-80) 43 (8-2000) (495) Ulcerative colitis 10.5 (1.1-80) 19.5 (2.4-866.4) (495) 10.5 (1.1-80) 50.0 (4.5-950) (496) Right side 0-9 55.1±58.9 (497) Left side 0-9 79.3±58.2 (497) Synovial fluid Rheumatoid arthritis 0.9 (0.2-2) 18 (2-375) Osteoarthritis vs cases (480) * Concentrations in cerebrospinal fluid and urine given as ng/ml, all others given as g/ml, Median (range) (modified from (347))

1.7. Functions of S100A8 and S100A9

S100A8/S100A9 are attracting much current interest because of their emerging

48 importance in inflammation and oncogenesis (reviewed in (364, 498)), particularly as these are proposed as damage-associated molecular pattern (DAMP) molecules (Section 6.2). Like other

DAMPs, these proteins exhibit a “double life”: as intracellular calcium-binding molecules, they have roles in leukocyte migration and cytoskeletal rearrangement. After release into the extracellular space from damaged cells or activated phagocytes, they can influence leukocyte and vascular endothelial function. Intracellular and extracellular functions of S100A8/S100A9 have been described, although there are difficulties in studying the function of the complex.

Many assays have examined the roles of the S100A8/S100A9 heterodimer, because this is the most abundant naturally-occurring S100 form (53, 60, 362, 499). Direct interactions between different S100 members can alter particular functions. For example, S100A1 reduces S100A4- mediated cell motility, growth of a mammary tumor cell line in vitro, and metastasis in vivo

(500). There is evidence that the functions of S100A8/S100A9 are not identical to those of

S100A8 and S100A9 alone. For example, S100A8 inhibits adhesion of human neutrophils induced by S100A9 through the formation of the heterodimer (377), and S100A9 inhibits

S100A8-induced activation of TLR4 (242).

One approach to reveal function of S100A8 protein is genetic modification. Targeted disruption of the murine S100A8 gene is embryonic lethal (339), whereas deletion of S100A9 is not, confirming a distinctly selective function for S100A8 in development, although its exact role is unclear. There are no reports of the successful generation of cells which overexpress

S100A8. An alternative approach is induction of S100A8 in cells which express S100A8, but not S100A9, such as in activated murine macrophages (93, 94, 406). However, since other proteins are also induced, it is difficult to define particular functions of S100A8, or S100A9 as distinct from the heterodimer.

Taken together, the functions of S100A8 and S100A9 in inflammation- and oncogenesis-associated processes are not conclusively identified. Nonetheless, the in vitro and in vivo functional studies described in the following sections and listed in Table 1-18 will provide important insights into the clinical relevance of these proteins.

49 Table 1- 18: Functions of S100A8/S100A9

Intracellular function Extracellular function Anti-oxidant effects (380) Anti-oxidant effects (73, 368, 389) Arachidonic acid transport (501) Anti-coagulant (271) Modulation of cytoskeleton and cell migration Increases Mac1 affinity (377) (206, 338, 502) Arachidonic acid transport (505) Inhibition of casein kinase I and II (177) Apoptosis(506) Regulation of NADPH oxidase (503) Cytostatic/antimicrobial effects (344) Cell differentiation (504) (456) Recruitment of granulocytes (205) Modulation of intracellular calcium (367) Activation of ECs (507) Embryo development (339) Chemoattractant in mouse (44) ? Inhibition of immunoglobulin synthesis (492) TLR4 activation (242)

1.7.1. Intracellular functions

1.7.1.1. Modulation of intracellular calcium

S100A8/S100A9 is the most abundant Ca2+-binding protein complex in neutrophils,

2+ implying a role in maintenance of calcium homeostasis by modifying [Ca ]i levels. This abundance may act as a “calcium sink,” whereby these proteins may protect cells from harmful effects of prolonged elevations of Ca2+ by providing a buffer for intra-compartmental Ca2+ levels (508). This would be necessary in neutrophils that are required to respond rapidly to environmental signals (367). The variant N-terminal EF hand, which binds Ca2+ with low

2+ 2+ affinity, may be engaged only when [Ca ]i levels rise after activation. Alternatively, this Ca - binding domain may only bind in the extracellular milieu (1-2 mM Ca2+). The high affinity C-

2+ 2+ terminal EF hand, which binds lower levels of Ca , may function when [Ca ]i is altered.

2+ Human S100A9 is phosphorylated on Thr113 when [Ca ]i levels increase, indicating that it participates in some as yet undefined intra-molecular function (392).

Most transduction pathways mediating cell migration involve components that regulate

2+ 2+ [Ca ]i levels. For example, Ca acts on actin-associated proteins like MARCKS and to regulate actin polymerization (509). Interestingly, in S100A9-/- neutrophils, which lack intracellular S100A8 and S100A9, CD11b surface expression is reduced in calcium-free buffers, and extracellular Ca2+ restores normal CD11b surface expression (338), indicating that CD11b expression is calcium-dependent on S100A9-/- cells. Moreover, IL-8-mediated up-regulation of

CD11b is not observed in S100A9-/- neutrophils (338), and it was suggested that deletion of the

50 murine S100A9 gene primarily affects calcium homeostasis. Similar alterations in Ca2+ homeostasis in neural cells are reported in S100B-/- and S100G-/- mice (510, 511). Further investigations are required to define the roles of S100A8 and S100A9 in .

1.7.1.2. Arachidonic acid transport

The human S100A8/S100A9 complex, but not the individual components, specifically binds fatty acids in a Ca2+-dependent, saturable, and reversible manner in Ca2+-induced differentiating keratinocytes (501) and neutrophils (512); the Ca2+ concentration is within the physiological range (513). Binding and competition studies indicated that S100A8/S100A9 exclusively bind polyunsaturated fatty acids including oleic, -linolenic, -linolenic and arachidonic acids (AA) (513). S100A8/S100A9 had the highest affinity for AA, but did not bind

AA-derived eicosanoids (513). The specificity and reversibility of fatty acid binding to the complex excludes the possibility that a mere solvation/saponification of insoluble fatty acid- calcium salts occurs (reviewed in (1)). Binding of one Ca2+ to each of the four EF-hands present in the heterodimer is a prerequisite for the AA binding capacity (514) and binding is not induced by bivalent cations such as Zn2+, Cu2+, or Mg2+. However, binding of AA is prevented by Zn2+ or Cu2+ in the presence of Ca2+, which may induce conformational changes, thereby affecting the calcium-induced formation of the AA binding pocket within the complex (514). Zn2+ inhibition was seen at physiological serum concentrations, implying that S100A8/S100A9 may transport AA within inflammatory loci, but not within the blood compartment.

Murine S100A8/S100A9 also binds AA, but has little affinity towards oleic acid

(monounsaturated fatty acid) (512). The unique C-terminal extension of S100A9 containing three consecutive histidine residues (His103-His105) is responsible for binding the fatty acid carboxy-group. The complex formed by association of native human S100A8 and the S100A9* isoform has similar AA-binding capacity (515). S100A8 and S100A9 both may have post- translational modifications (Section 1.6.5) that may influence complex formation and fatty acid binding, but phosphorylation of S100A9, or harsh oxidation by hypochlorite does not affect AA binding capacity (513).

51 S100A8/S100A9 complexes may play an important role in the AA metabolism of neutrophils. Stimulation decreases levels of cytosolic S100A8/S100A9 bound to fatty acid, with parallel increases in membranes, suggesting that S100A8/S100A9 may facilitate fatty acid uptake and/or release (516), or membrane anchorage of S100A8/S100A9. Neutrophil-like HL-

60 cells secrete S100A8/S100A9 upon activation and this contains AA which is released from membrane phospholipids via cytosolic phospholipase A2 (PLA2) (513, 517). Thus, in human neutrophils, S100A8/S100A9 may function as an intermediate AA reservoir or transporter of

AA to other target cells.

Fatty acids are implicated in energy delivery, membrane synthesis, in the lipid barrier function of epidermis, in inflammation, and in gene regulation. Fatty acids need to be solubilized, stabilized and translocated by specific carrier proteins (518), although little is known about the membrane proteins involved in AA uptake. One of the five putative fatty acid transporters is the fatty acid translocase (FAT)/CD36 located in protein membrane (519, 520).

S100A8/S100A9 may aid uptake of AA by EC by binding CD36 in an energy-and Ca2+- dependent manner (505). AA is the precursor of eicosanoids, which can regulate inflammatory responses. At inflammatory sites, EC respond to potential harmful conditions with appropriate adaptive changes and EC-derived eicosanoids can regulate smooth muscle contractility, platelet aggregation, and modulate adhesion of monocytes and neutrophils to endothelium (521-524).

Thus S100A8/S100A9/AA may influence these processes. Formation of an intracellular pool of

S100A8/S100A9/AA may pass the ligand to AA-metabolizing enzymes and initiate delayed eicosanoid formation and to other enzyme systems such as NADPH oxidase in which AA is a cofactor (Section 1.7.1.5). This mechanism may point to a role for the complex in initiation and regulation of inflammatory responses (reviewed in (356)).

1.7.1.3. Differentiation and development

Differentiation

S100A8 and S100A9 are clustered on human chromosome 1q21 in a so-called differentiation complex (48). Expression during distinct stages of myeloid differentiation is

52 discussed in Section 1.6.6.

In vitro experiments, using the human promyelocytic leukemia cell line HL-60, which do not express these proteins, have been used to study differentiation-dependent expression

(504). Differentiation to the monocytic lineage with 1, 25-dihydroxy vitamin D3 (Vitamine D3) induces high levels of both mRNA transcripts which peak on day 2 post-treatment and then quickly declined (504). When terminally differentiated into non-proliferating monocytic lineage cells with PMA, mRNA levels essentially disappear (351, 525). In contrast, when differentiated along the granulocytic lineage with DMSO, expression levels correspond to the high levels observed in human neutrophils (525-527).

In murine macrophage cell lines at different stages of maturation, S100A8/S100A9 expression is associated with an intermediate stage, seen in the J774A, P388D cell lines, and in bone marrow mononuclear cells during early days of culture. Precursor stages, represented by myeloblasts (M1), myelocyte cell lines (RMB.TG), immature macrophages (WEHI.TG), and mature macrophages in culture and in tissues do not express S100A8/S100A9 at all (371).

The S100A8/S100A9 complex, but not its subunits, inhibits casein kinases I and II

(177), which are implicated in phosphorylation of substrates such as nuclear oncogenes, RNA polymerase II, and topoisomerase. These are necessary for normal gene transcription and translation. Inhibition of casein kinases would terminate metabolic events. This may be particularly relevant to neutrophils which are short-lived and terminally differentiated (367) or to activated macrophages which are functionally differentiated and in which casein kinase II is activated by LPS (528), implying that terminal cell differentiation may be brought about by the inhibitory effect of S100A8/S100A9 on casein kinases. Interestingly, small amounts of

S100A8/S100A9 are found in electron-dense parts of nuclei in myelomonocytes (347) and in differentiated THP-1 and HL-60 cells (529). Moreover, the S100A8/S100A9 complex was purified from human spleen cell nuclei, using mAbs that recognize human myeloid cell nuclear chromatin (177). Thus S100A8/S100A9 may play an intra-nuclear role in differentiation.

Some histo-pathological findings have associated intracellular S100A8/S100A9 with differentiation and/or apoptosis of macrophages. Cat scratch disease is an infection usually

53 caused by Bartonella henselae. Within 1-3 weeks after infection, patients typically develop regional self-limited lymphadenopathy. Lymph nodes contain granulomas consisting of central necrosis, an inner rim of palisading macrophages which are S100A8/S100A9-negative and undergo apoptosis, and an outer rim of lymphocytes and non-palisading macrophages which express S100A8/S100A9 (530). Similarly, at sites of gout tophi, characterized by foreign-body granulomas consisting of mono- and multinucleated macrophages surrounding deposits of monosodium urate microcrystals, newly-recruited monocytes/macrophages localize perivascularly and are S100A8/S100A9-positive, whereas mature macrophages within granulomas are negative and undergo apoptosis (419). Interestingly, murine S100A9-/- neutrophils express S100A8 mRNA but not protein, and unlike wild-type neutrophils, apoptotic responses of these cells to Ca2+ mobilizers are unaffected (337). These studies suggest a potential role for the proteins in differentiation and/or in apoptosis.

S100A8/S100A9 are highly upregulated in abnormally-differentiated keratinocytes in psoriasis (455), and in the hyper-thickened epidermis of acute murine and human wounds and human ulcers (456). Increased expression in wound keratinocytes may be related to their differentiation state rather than being secondary to the inflammatory process, since both proteins are also upregulated in the hyperproliferative epidermis of activin-overexpressing mice which develop hyperproliferative and abnormally differentiated epidermis in the absence of inflammation (456).

Taken together, the evidence, much of which is descriptive, suggests that

S100A8/S100A9 is involved in differentiation, maturation and/or apoptosis in some cell lineages. However, mechanisms whereby these proteins regulate those processes are largely undefined. In addition, mechanisms responsible for their down-regulation in this context are not understood. Further insights concerning roles of S100A8/S100A9 in modulating membrane and cytoskeletal interactions may provide some clues for understanding mechanisms underlying differentiation and activation of phagocytes. Identification of a role in signalling pathways would be an important breakthrough in understanding functions of S100A8/S100A9, and may shed more light on their roles in these processes.

54 S100A8 in development

Murine S100A8 is expressed exclusively in two sites during mouse embryo development (339, 351, 365, 531). The restricted expression in a subset of hematopoietic cells in the liver is an excellent marker for the onset of definitive hematopoiesis, because the

S100A8/S100A9 genes are not expressed at all in developing embryonic phagocytes produced in large numbers by the yolk sac (531). S100A8/S100A9 is expressed in liver cells with monocyte-like appearance at 11.5 days post coitum (dpc) (351, 365). S100A8 is seen in the ectoplacental cone (EPC) in the absence of S100A9 (339), in very small subsets of trophoblasts at the external perimeter at 6.5- 7.5 dpc; by 7.5 dpc expression is restricted to a halo of cells surrounding the EPC, and to a tight group of cells at the very tip of the EPC, which are most likely infiltrating maternal leukocytes. Although the transcript accumulated to high levels in trophoblasts, the protein product did not, suggesting active secretion of S100A8. By 8.5 dpc,

S100A8 mRNA expression in large trophoblast-like cells in the vicinity of the EPC is no longer detectable, and by 10.5-11.0 dpc, expression is only detected in cells associated with the vasculature at the maternal face of the placenta.

Targeted disruption of the murine S100A8 gene caused embryo resorption at day 9.5 dpc in 100% of homozygous null embryos, suggesting non-redundant functions for this protein.

In addition, homozygous null embryos contain cells of maternal genotype, implying that

S100A8 may have an immunoregulatory role in regulatory fetal-maternal interactions, because the decidual reaction to embryo implantation is essentially a form of acute inflammation (532-

534). Thus, the absence of S100A8 may allow infiltration of maternal cells, resulting in early embryonic loss in S100A8-/- mice (339).

Murine S100A9 is also expressed exclusively in fetal liver from around 10.5 dpc (365,

531), but is not detected in the vicinity of the EPC at any stage (339). Moreover, disruption of the S100A9-/- gene is not embryonic lethal (337, 338). These findings substantiate roles for each of these proteins independent of their heterodimerization.

55 1.7.1.4. Modulation of the cytoskeleton

The initial events of leukocyte adhesion to EC leading to leukocyte extravasation are well characterized (535), although detailed mechanisms of transmigration are still being elucidated. During transendothelial migration, leukocytes remodel their cytoskeletal structures which constitute three major components; actin filaments/microfilaments (MFs) which are responsible for resisting tension, maintaining cell shape and forming cytoplasmatic protuberances; intermediate filaments (IFs) which organize the internal tridimensional structure of the cell, anchor organelles and serve as structural components of the nuclear lamina and sarcomeres; and microtubules (MTs) which play key roles in intracellular transport of vesicles.

S100 proteins can regulate cell morphology/motility and the dynamics of certain cytoskeleton constituents (reviewed in (3, 65)).

The intracellular distribution of S100A8/S100A9 varies with the activation state of neutrophils and monocytes. Normally localized in the cytosol (not in cytosolic granules), upon

2+ elevation of [Ca ]i they translocate to the cytoskeleton, and interact with IFs, MTs or F-actin

(112, 340, 502, 536, 537) and with keratin filaments in human epithelial cells (207).

Translocation may be mediated through activation of PKC (112), but details are unclear. Similar

Ca2+-dependent translocation events are documented for other S100 proteins in different cell types including tumor cells and involve different types of cytoskeletal filament proteins (99)

(538-540). In a similar manner, S100A8/S100A9 may regulate cytoskeletal/membrane interactions by blocking phosphorylation (Section 1.3.1). The phosphorylated isoforms of

S100A9 following activation of neutrophils (392) are preferentially translocated to membranes and, to a lesser extent, to cytoskeletal structures. S100A9 phosphorylated by p38 mitogen- activated protein kinase (MAPK) activator inhibits S100A8/S100A9-induced tubulin polymerization (205) thereby possibly regulating neutrophil migration.

Interestingly, S100A8/S100A9 tetramers bind directly to MTs and disruption of the tetramer decreases the rate constant of tubulin polymerization (206), suggesting a role in bundling or bridging MTs, facilitating stabilization of tubulin filaments. The primary interaction of the tetramers with tubulin may be via S100A8 (205, 206).

56 Translocation of S100A8/S100A9 suggests functional roles mediated by the cytoskeleton, in migration, chemotaxis, degranulation and phagocytosis. However, the true relevance of these interactions is still unclear. Studies using S100A9-/- mice indicate a role for

S100A8/S100A9 in granulocyte migration. Upon activation of p38 MAPK, S100A9+/+ granulocytes exhibit increased transmigration rates. However, S100A9-/-cells, which also contain little S100A8 and less polymerized tubulin, migrate less well in chemotaxis in vitro.

S100A9-/- mice have reduced recruitment of granulocytes into granulation tissue during wound healing in vivo (205). Modulation of tubulin polymerization by S100A8/S100A9 may contribute to rapid re-arrangement of the phagocyte cytoskeleton during migration.

1.7.1.5. Regulation of NADPH oxidase

Activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase during

¯ phagocytosis is a major source of O2 generation in neutrophils and macrophages. NADPH oxidase catalyzes electron transfer from NADPH to molecular oxygen. This is an electron transfer chain assembly of cytosolic regulatory factors (p67phox, p47phox, p40phox, small G protein

Rac 1/2) on the phagocyte membrane; membrane-bound flavocytochrome b558 comprises two subunits: gp91phox and p22phox (541-544). The cytosolic phox proteins pre-associate as a complex, which also contains p40phox, a regulator of oxidase activation. Upon cell stimulation, the complex assembles through specific protein/protein interactions. p67phox mediates

phox cytochrome b558 activation via a specific interface with gp91 (545), leading to electron transfer from NADPH in the cytosol to heme via flavin adenine dinucleotide (FAD) (546-548).

AA plays an essential role in activation of NADPH oxidase (549, 550), and this selectively binds S100A8/S100A9 (Section 1.7.1.2).

Using a semi-recombinant cell-free assay it was shown that phenylarsine oxide, an

NADPH oxidase activator, selectively bound to the bovine S100A8/S100A9 complex (p7/p23,

- See Table 1-2), synergistically activating NADPH oxidase and generating superoxide anion O2

(551). The heterodimer, and particularly S100A8 binds p67phox and Rac2; S100A9 did not interact with p67phox or p47phox (503, 552, 553). These findings suggest that S100A8/S100A9

57 may act as a scaffold for cytosolic phox proteins, enabling their interaction with membrane- bound cytochrome b to provoke its dormant oxidase activity (553), possibly by promoting conformational changes in cytochrome b558 (554).

According to the model proposed, upon ligation of specific cell surface receptors,

S100A8/S100A9 enhances NADPH oxidase activation by transferring AA to gp91phox through phosphorylation of p47phox, translocation of p47phox/p67phox and through interactions with the cytosolic factors, p67phox and Rac-2. Binding of AA to gp91phox induces a structural change in cytochrome b558, which results to the final formation of the active complex (553). Neutrophils normally generate ROS after stimulation whereas generation is reduced in neutrophils from

S100A9-/- mice (555), supporting the proposal that S100A8 and S100A9 positively regulate neutrophilic NADPH oxidase.

Individuals deficient in ROS production due to a genetic alternation in any of the four components of NADPH oxidase complex (p22phox, gp91phox, p47phox, or p67phox) experience severe recurrent infections, often from catalase-positive microbes. This condition is known as chronic granulomatous disease (CGD) (542, 556). In view of the potential importance of S100 proteins, in this context, it would be worth examining S100A8/S100A9 expression in phagocytes from patients with CGD, although this is a rare genetic disorder.

1.7.2. Extracellular functions of S100A8 and S100A9

Precise functions of S100A8 and S100A9 in the extracellular milieu are reported, but there are some conflicting findings, probably due to the protein preparations and correct protein folding, post-translational modifications, complex formation, and/or species differences.

Contamination with endotoxins can be a problem, particularly if the recombinant proteins are expressed in E. coli. Differences between laboratories in methods to purify, store, and manipulate the proteins are obvious and may account for some of the differences in functions reported. Species differences, based on homologies between mouse and human, may also make functional analysis complicated. For example, human S100A8 does not share the monocyte chemotactic properties of the murine form, although S100A8 is associated with inflammation in

58 both species. Technically, it may be difficult to examine effects of exogenous S100A8/S100A9 on adherent cells such as EC (557), possibly because trypsin/ EDTA treatment necessary for seeding depletes the heparan sulfate-specific 10E4 epitope, a putative S100A8/S100A9 receptor

(85) and also other receptors.

1.7.2.1. S100A8/S100A9 receptors

S100A8/S100A9 may be chemotactic in the local inflammatory microenvironment (112,

558) and activate EC. These functions require surface receptors on target cells that trigger intracellular signalling cascades, or alternatively, a protein or alternative mechanisms that assist in passage through the cell membrane. AA (505) and 2-macroglobulin (557) are reported to bind S100A8/S100A9 in the extracellular milieu. One putative receptor reported to bind several S100 proteins is RAGE, signalling through which activates pathways involving p38 or p44/42 MAP kinases, Cdc42/Rac, and NF-B, components that can influence processes such as cell survival, motility and inflammatory responses (240, 559). Direct binding to RAGE has been demonstrated for S100A12, S100B, S100A1, and S100P (240, 241, 251, 559), but not for

S100A8/S100A9. Recently S100A8 and S100A9 were reported to mediate LPS-induced cardiomyocyte dysfunction via RAGE ligation in a murine cardiomyocyte cell line (HL-1) and in primary cells (560). However, HL-1 cells are grown in Claycomb media which contains insulin, norepinephrine, retinoic acid, hypothalamic protein extract and FBS. These hormones and growth factors may induce/enhance (Table 1-23) or suppress S100A8 gene expression

(Table 1-28). Moreover, in contrast to human myocytes which do not express the S100A8 gene, untreated HL-1 cells express S100A8 gene. Thus LPS may enhance expression of S100A8 in cardiomyocytes in cooperation with various hormones and growth factors. Furthermore, primary murine cardiomyocytes were isolated by homogenizing heart tissue, a process that may modify

S100A8 gene expression because its expression is stress-related. Therefore the effect of LPS on this RAGE-mediated response is still unclear.

Other potential receptors are CD36 which may mediate AA uptake by EC (Section

1.7.1.2), heparan sulfate proteoglycans or carboxylated N-glycans. S100A8/S100A9 binds the

59 latter on human endothelial cells (HMEC-1) via S100A9 in an interaction independent of CD36 and RAGE (85, 86). Microarray analysis showed that S100A8/S100A9 induces a rather weak, but distinct inflammatory, thrombogenic response in microvascular EC (507). Additional studies are required to confirm that these proposed receptors are functional following

S100A8/S100A9 ligation.

Recently, S100A8 was claimed to be a ligand of TLR4 and to induce TNF- in murine leukocytes. S100A9 inhibited binding and the complex was inactive (242). In that study, recombinant S100A8 was used to test the effects on unfractionated murine bone marrow cells

(BMCs). However BMC contains ~30% neutrophils which would die during the culture periods used. These would release S100A8 and S100A9 and it is difficult to understanding how binding would not be competed by the cell-derived S100A8. In addition, dead cells and/or distressed cells release ATP, which activate purinergic receptors on neutrophils, monocytes and macrophages (561), resulting in TNF- production (see Section 5.1.4). Thus, induction of TNF-

may merely have reflected cell viability and/or toxicity of recombinant protein. However this may not be the only cause because it would not explain inhibition of the S100A8 effect by

S100A9. Although endotoxin levels were tested, some recombinant proteins are also contaminated with other bacterial products (see Section 1.10.2.1) that could produce false- positive results. Additional studies are required to confirm TLR4 interactions using native

S100A8 and homogenous well-defined cells such as bone marrow-derived macrophages.

In our opinion, a TLR4-S100A8 interaction is controversial. Our laboratory showed that the mechanisms whereby the S100A8 gene is upregulated do not point to a pro-inflammatory role. Induction is dependent on IL-10 and COX-2/PGE2/cAMP (see Section 1.10.3), and in marked contrast to TNF-, the gene is upregulated by corticosteroids (407). Moreover, our laboratory has been unable to induce pro-inflammatory cytokines in human or murine monocytes or macrophages with the relevant S100A8 preparations (Hsu K and Geczy CL unpublished data).

Cell surface binding sites specific for the S100A8/S100A9 complex were reported on various human leukemia cells (529) and IL-l, IL-3, IL-6, IL-8, IFN, and agents that induce

60 differentiation of leukemia cell lines did not change the degree of binding (529, 562).

Interestingly, leukemic cell lines of lymphocyte origin (Raji and MOLT-4) have abundant binding sites (529) although they do not express the protein (343, 562), suggesting that

S100A8/S100A9 may alter lymphocyte functions.

S100A8/S100A9 is reported to translocate into lipid raft domains in the plasma membrane after neutrophil activation (563). Lipid rafts are rich in glycosphingolipids and cholesterol and exist in a liquid-ordered phase, different from the rest of the plasma membrane which mainly consists of phospholipids in a liquid-disordered phase. They are proposed as platforms for the controlled interaction of substrates and signalling enzymes which are organized in lipid rafts, and include heterotrimeric G-proteins and members of the Src family of protein tyrosine kinases (564). Therefore, lipid rafts are one alternative mechanism whereby

S100A8/S100A9 may associate with the plasma membrane. However, further studies are required to elucidate interactions of S100A8 within lipid rafts and define its functional relevance.

Identification and confirmation of receptors, cell types which express such receptors and downstream signal transduction mechanisms would help to elucidate functions, leading to a new insight into the molecular basis of how S100A8/S100A9 contribute to activation and recruitment of effector cells in inflammatory lesions.

1.7.2.2. Cytostatic and pro-apoptotic roles

Cytostatic activity towards microbes

The potent anti-microbial function of S100A8/S100A9, described as calprotectin, was reported in 1983 (92, 344, 565). Calprotectin inhibits growth of bacterium, yeast and fungi through competition for the essential nutrient zinc, mediated principally by the zinc-binding domain in S100A9 (385, 566). Inhibition of C. albicans growth by abscesses fluid is completely reversed by micromolar levels of zinc, suggesting S100A8/S100A9 released from dying neutrophils is functional (566).

Supernatants of exudates from abscesses markedly inhibit proliferation of Candida

61 albicans (566), with a minimum effective concentration of 10-20 g/ml. Effective doses against

E. coli, Staphylococcus aureus, Staphylococcus epidermidis and Borrelia burgdorferi are some

10-fold higher (344, 417). Moreover, cells expressing S100A8/S100A9 can resist invasion by

Listeria monocytogenes and Salmonella typhimurium (567). Thus, S100A8/S100A9 plays an important anti-microbial role in host defense to infection.

Cytostatic, cytotoxic and pro-apoptotic activities

S100A8/S100A9 has cytostatic activity. Growth of a wide array of targets, including human myeloid leukemic cells (HL-60, THP-1, and K562), T-lymphocytic leukemia (CEM), malignant melanoma (PN-3) and several others, is dose-dependently (5-15 nM) suppressed by the S100A8/S100A9 complex (359, 470). Secretion of the complex during terminal differentiation induced in HL-60 cells or in THP-1 cells (470) also inhibits growth of these cells, suggesting autocrine regulation of growth upon terminal differentiation. At present, no mechanistic details or likely clinical correlates are available, and most targets used to date are transformed cell lines.

The cytostatic effect of S100A8/S100A9 (100 g/ml) is reversed by 10 M Zn2+ (359).

Plasma Zn2+ levels in healthy human subjects are ~15 M, more than half of which binds albumin and amino acids (568). Serum levels of S100A8/S100A9 are generally <10 g/ml in many inflammatory disorders (Section 1.6.7). Thus in blood, S100A8/S100A9 may not be cytotoxic to normal cells because of the relatively high amount of Zn2+. However, when released at inflammatory sites, the protein may be cytostatic.

Changes in cytosolic calcium concentrations can provoke apoptosis and necrosis (499), and some S100 proteins such as S100B play a role in apoptosis (see Section 1.3.2), but involvement of S100A8/S100A9 is controversial. More than 1.4 M rat S100A8/S100A9 inhibited growth of various tumor cell lines, whereas >5.6 M caused apoptosis (569). The apoptosis-inducing activity was confirmed with embryonic and human dermal fibroblasts (570) and was reversed by Zn2+ (569, 570).

Human S100A8/S100A9 (>200 g/ml) also inhibited proliferation and differentiation of

62 murine myoblasts (C2C12) and induced apoptosis via activation of caspase-3 in a time- and dose-dependent manner. Activated macrophages in inflammatory myopathies such as dermatomyositis (DM), including childhood DM, polymyositis (PM) and inclusion body myositis (IBM), may promote destruction and impair regeneration of myocytes by secreting

S100A8/S100A9 (571).

Whether the anti-proliferative and apoptosis-inducing properties of S100A8/S100A9 are functionally relevant in vivo requires clarification. The use of high doses of rat or human proteins across species could affect results, particularly because of the relatively low sequence homologies of the human and rodent proteins. Moreover, the normal range of the

S100A8/S100A9 complex in serum from healthy subjects is 0.303-1.66 g/ml, and this increases by 2-4-fold in response to bacterial infections (477), indicating that the concentrations used in the reported studies were not physiological for circulating cells although levels in localised inflammatory lesions may be much greater, particularly where there are high numbers of necrotic neutrophils. Taken together, extracellular roles of S100A8/S100A9 in apoptosis are still unclear, and more characterization using primary cells and mechanistic approaches, are warranted.

S100A8/S100A9 is also proposed to have cytotoxic activity (572). Human recombinant

S100A9 is cytotoxic for murine thymoma cells (EL-4) from 10 M, whereas effects of S100A8 are marginal. On the other hand, the complex induced almost complete cell death at 5 M, suggesting that the heterodimer is more cytotoxic than either subunit individually. However, the biological relevance of this cytotoxicity remains to be clarified, particularly because high doses of proteins were used across species.

1.7.2.3. Effects of S100A8/S100A9 on leukocyte adhesion, chemotaxis and cell migration

Neutrophils rapidly migrate from the blood to inflammatory sites in a multistage fashion, in a well-characterized cascade of adhesion events mediated by the selectins on EC, and their related carbohydrate/glycoprotein ligands, the leukocyte 2 integrins (CD11/CD18) and their ligands and by chemoattractants and their receptors Interactions between leukocyte L- and

63 endothelial P- and E-selectins and glycans mediate neutrophil rolling along the endothelium, and the adhesive properties of neutrophils are activated through a change in 2 integrins to an active high-affinity conformation. This is induced by chemoattractants such as platelet- activating factor, C5a, bacterial N-formylated peptides (fMLP), or chemokines like IL-8 and causes neutrophils to adhere strongly and extravasate between ECs. In the extravasculature, neutrophils follow concentration gradients of chemoattractants. Interaction of chemoattractants with their heterotrimeric G-protein-linked receptors on neutrophil membranes is also able to stimulate adhesion in vitro (573).

S100 proteins and chemotactic activities

Murine S100A8 was the first S100 protein demonstrated to have chemotactic activity for neutrophils and monocytes (44, 574). Subsequently, activities of bovine S100A2, human

S100A7, human S100A12, and S100B were reported. S100s now comprise a new class of chemoattractants. These generally act in the pico-nanomolar range as shown in Table 1-19, and they have a variety of target cells. Murine S100A8 is a chemoattractant for neutrophils and monocytes/macrophages (236, 574-576) and human S100A8 is a chemoattractant for neutrophils (577). Chemotactic concentrations of human S100A8 are 100-10,000-fold lower than levels found in serum of healthy controls or of patients suffering from inflammatory diseases ((577, 578), Table 1-17, Table 1-19). Similar to IL-8 which is high in serum from

Table 1- 19: Chemotactic S100 proteins

Optimal S100 protein Responsive cells Concentration Reference Bovine S100A2 Guinea pig eosinophils 10-10 M (238) Human S100A7 Human CD4+ T lymphocytes and 10-11 M (263) neutrophils Murine S100A8 Murine neutrophils and 10-13- 10-11 M (574, 576, 580) monocytes -11 -10 mS100A842-55 Murine neutrophils and 10 - 10 M (44, 580) monocytes Human S100A8, S100A9 Neutrophils 10-12- 10-9 M (577) and S100A8/S100A9 -12 Human S100A821-45 Human periodontal ligament cells 10 M (581) Human A12 Human monocytes, neutrophils and 10-12- 10-8 M (110, 582) the myeloid cell line, THP-1 S100B Murine SMCs Not determined (583)

64 patients with inflammatory conditions, elevated serum levels may desensitize leukocytes to halt migration (579).

Chemotactic activities of murine S100A8

Chemotactic agents can be divided into "classical chemoattractants" such as fMLP, C5a, and IL-8, which stimulate directed migration and activation events, and "pure chemoattractants" such as TGF-1 which influence actin polymerization and movement but not activation. Table 1-

20 shows comparisons of functional responses of murine neutrophils to chemoattractants.

Murine S100A8 belongs to the "non-classical" group (580), and may act through Ca2+- independent G-protein-coupled pathway. Unlike classical chemoattractants, co-ordinated upregulation of 2 integrins and down-regulation of L-selectin is not observed with murine

S100A8. murine S100A8-treated monocytes exhibited marked alternation in shape, increased cell size and polymerized F-actin within pseudopodia. These changes facilitate leukocyte deformability and subsequent leukocyte retention within microcapillaries that can initiate inflammation in vascular beds (236, 580).

Table 1- 20: Comparisons of functional responses of murine neutrophils to chemoattractants

fMLP, IL8, C5a Murine S100A8 TGF- Chemotactic potency + + + Optimal concentration 10-9- 10-7 M 10-13- 10-11 M 10-14- 10-12 M Actin polymerisation + + + Pertussis toxin inhibition + + + Intracellular Ca2 + flux + - - Degranulation of neutrophils + - - Induction of Mac 1 (CD11b/CD18) + - - Shedding of L-selectin + - - Oxidative burst + - - (from (580))

Interestingly, rapid retention of leukocytes in pulmonary capillaries after administration of LPS is not dependent on integrin-mediated adhesion (584), and S100A8 may mediate the early vascular response. Expression of S100A8 in LPS-activated microvascular endothelial cells

(95), and its inability to initiate L-selectin shedding may contribute to initial binding of leukocytes to the endothelium. The enhanced affinity of integrin receptors on leukocytes

65 promoted by S100A9 (377) may also contribute to tight adhesion before transmigration. In acute inflammatory sites, large amounts of murine S100A8 would be released from dying or activated neutrophils, or produced by appropriately-activated macrophages in more chronic situations, and may facilitate chemotactic activity. Extracellular murine S100A8 is found in bacterial abscess fluid and is chemotactic, it associates with the microvessels after intradermal LPS injection (585), and is found in bronchiolar lavage fluid from lungs of mice given LPS (73) or bleomycin (586). These studies support a chemotactic role of extracellular murine S100A8 in inflammatory sites that may facilitate leukocyte-EC interactions and transmigration.

The chemotactic activity of murine S100A8 resides within the hinge domain (44) and this was the first study confirm the hypothesis suggesting that this domain may contribute to the functional specificity of individual S100 proteins ((42), Section 1.2.3). Intradermal injection with full-length protein (574) or hinge peptide (mA842–55) causes an intense leukocyte infiltration with kinetics of leukocyte recruitment closely resembling delayed-type hypersensitivity (DTH) responses. Neutrophil infiltration occurs from 3-8 hours when responses are maximal (585) and a mixed mononuclear infiltrate peaks at 16- 24 hours and is sustained over 48 hours (587). The strong chemotactic property of mA842-55 may be due to its ability to attain considerable secondary structural features (-helices and -sheets) in hydrophobic environments (588). Interestingly, mutation of the redox-reactive Cys41 in murine S100A8 does not affect its chemotactic activity (73).

These results seem to conflict with the finding that transgenic mice overexpressing the human TGF- superfamily member activin A also overexpress S100A8/S100A9 in skin epidermal cells without dermal leukocyte infiltration (456). However, post-transcriptional modification/dimerization of S100A8 (73), or the presence of S100A9 may moderate S100A8 activity.

At inflammatory sites, S100A8 is likely to be exposed to oxidants such as H2O2 and hypochlorous acid (see Section 1.6.5.1). Figure 1-9 summarizes chemotactic activity of oxidized murine S100A8 products. HOCl generates interchain Cys41-Lysx sulfinamide-bonds but murine

S100A8 with this modification retains chemotactic activity (389). In contrast, the covalent

66 disulfide-linked homodimer generated by H2O2 is not chemotactic (73). The relative amounts of sulfinamide-containing S100A8 monomers depend on HOCl concentrations and reaction time

(73, 368, 389), suggesting that at inflammatory sites, low levels of HOCl formed via myeloperoxidase from activated phagocytes may generate sulfinamide bonds that may stabilize the monomeric chemotactic form and favor continued leukocyte influx, whereas higher amounts could generate inter-chain cross-linked inactive products. Because the hinge mA842–55 is chemotactic, covalent dimerization of S100A8 may structurally modify accessibility of this domain to restrict cellular target recognition (73).

Monomer Disulfide-linked Inactive in 2+ (10,308) H2O2/ Cu covalent dimer (20,614) chemotaxis Chemotactic

Intramolecular cross- HOCl linking of monomer Chemotactic (OxA8, 10,354)

Non-covalent dimer Intra- / Inter- molecular Not determined cross-linking dimer chemotaxis (20,707)

Murine Sulfinamide Disulfide (Molecular mass) S100A8 bond bond

Figure 1- 9: Murine S100A8 oxidization and chemotactic activity

Role of murine S100A8/S100A9 in leukocyte migration

Murine S100A9-/- neutrophils express normal levels of S100A8 mRNA but negligible

-/- levels of both proteins (338). S100A9 neutrophils do not respond to IL-8 and LTB4 and these cells have a deranged actin filament system that correlates with diminished chemotactic and adhesion responses following IL-8 stimulation in vitro (338). However, migration of leukocytes into the peritoneum and skin in response to subcutaneously-injected IL-8 are normal (337, 338) and S100A9-/- mice show no difference from wild-type mice in induced peritonitis (337).

S100A9 may stabilize cytoskeletal changes in response to chemoattractants. Injection of

67 S100A8/S100A9, S100A8 or S100A9 into the murine air pouch causes neutrophil accumulation and anti-S100A8 and anti-S100A9 antisera inhibited neutrophil recruitment provoked by urate crystals and a chemotactic role in vivo was suggested (576, 577). Moreover, after release by activated phagocytes, S100A8 and S100A9 bind EC (85, 86) and blocking this interaction with carboxylated N-glycans inhibited leukocyte extravasation in a murine model (86), also supporting a role in vivo. However further studies are required to fully elucidate mechanisms.

The sequence of S100A9 from position 89-108 (C-terminal region) is completely identical to the N-terminal 20 amino-acid residue of two small neutrophil-immobilizing factor proteins, NIF-1and NIF-2 (589, 590), implying a role in immobilizing myeloid cells at the endothelial surface and facilitating their movement into tissues during inflammation. However, whether the penultimate amino acid of S100A9, Thr113, is involved in the proposed NIF activity remains unknown.

Effects of human S100A8 and S100A9 on leukocyte adhesion and chemotaxis

There are conflicting in vitro studies regarding how S100A8/S100A9 affects leukocyte adhesion. Human S100A9 was reported to stimulate neutrophil adhesion to fibrinogen and

S100A8 suppressed this (377). In contrast, another group showed that S100A9 and

S100A8/S100A9, but not S100A8, enhanced monocyte adhesion to ECs via Mac-1/ICAM-1 interactions (591). In these reports, human S100A8 had no activity on neutrophils or monocytes.

However, a third group reported that the proteins individually, and the heterocomplex all promoted neutrophil chemotaxis. The activity of S100A8, but not S100A9, was inactivated by oxidation with NaOCl (577). In contrast, human S100A8 is also reported to cause repulsion of peripheral neutrophils (fugetaxis) that is oxidation-sensitive (387). Human S100A8 is also chemotactic for periodontal ligament cells (581).

The authors argue that the lack of activity of human S100A8 in one study (377) may have been due to improper folding or oxidative inactivation (577, 591). However, the authors did not consider the possibility that use of His-tagged proteins with three additional N-terminal amino acids (Gly-Ser-His-Met-…) after the thrombin cleavage site of the polyhistidine tail may

68 lead to incomplete/improper folding of the recombinant proteins, resulting in discrepant activities.

In contrast to murine S100A8, the human S100A8 hinge-region peptide has variable but weak chemotactic activity for human neutrophils and monocytes/macrophages (44). One explanation may be the differences in secondary structure of the hinge regions as these have only low amino acid homology (21%) (44). There may be species differences in receptor structure on effector cells, and murine leukocytes may express higher densities of receptors than circulating human blood leukocytes. Alternatively, murine and human S100A8 may have evolved to have discrete functions. In support of this idea, human S100A12 is a potent chemoattractant and functional ortholog of murine S100A8 (110). Mice lack S100A12 in their genome and S100A12 may have arisen by duplication of either human S100A8 or human

S100A9, because it lies between these on the chromosome, as shown in Figure 1-1. The intron/exon structure of S100A12 more closely resembles that of S100A8. The hinge region of

S100A8 and S100A12 are structurally similar and have common amino acids in the hinge regions that are essential for hydrophobicity and chemotactic activity; these are not present in human S100A8 (237). These studies imply that S100A12 has evolved to share the chemotactic function of murine S100A8, whereas murine and human S100A8 share oxidant scavenging properties (2). In contrast, S100A12 contains no Cys or Met residues, and its chemotactic properties would be stable to oxidants.

Taken together, whether the reported chemotactic effects observed in vitro are biologically relevant in vivo, particularly for human S100A8, are still controversial. Further investigations are required to elucidate its involvement in leukocyte migration.

1.7.2.4. Oxidant-scavenging properties

S100A8 may be protective in inflammatory lesions. It is a potent scavenger of reactive

- oxygen intermediates (ROI), particularly HOCl/hypochlorite anions (OCl ) and H2O2 (73, 368).

This is discussed in Sction 1.6.5.1. In contrast to S100A8, OCl- failed to convert murine S100A9 to homodimers although it has a free Cys residue at position 110 (73). On the other hand, human

69 S100A9 forms multimeric complexes, although their generation requires higher molar ratios of

HOCl than S100A8 (368), suggesting that S100A9 is less sensitive. Moreover, S100A9* lacks

Cys residues (Section 1.6.2) and would not have thiol scavenging properties.

Sulfinamide-linked complexes are resistant to reduction by DTT. S100A8 homodimers were detected in fluid from lungs of LPS-treated mice at the beginning of the resolution phase of inflammation (73), possibly because S100A8 is preferentially oxidized. In human atherosclerotic plaque extracts, DTT-resistant S100A8/S100A9 complexes are observed, suggesting sulfinamide cross-linking (368), because in the human S100A8/S100A9 complex, the distance between Cys42 in S100A8 and Cys3 in S100A9 would make disulfide bond formation highly unlikely (53).

The high sensitivity of S100A8 to oxidation implies an oxidant scavenging role whereby S100A8 may protect host tissue from excessive oxidative damage when oxidants are generated at acute inflammatory sites where S100A8/S100A9 are released from accumulated or dying neutrophils.

1.7.2.5. Inhibition of immunoglobulin synthesis

High concentrations (>64 g /ml) of S100A8/S100A9 inhibited production of IgG, IgM and IgA by mitogen-stimulated and unstimulated B lymphocytes (592). However, the relevance of this finding is questionable, because serum levels of the complex in healthy subjects range from 0.303-1.660 g/ml, and increase to up to ~6.230 g/ml in response to bacterial infections

(477). More detailed studies are required to clarify the clinical relevance of this finding.

1.7.2.6. Interactions with matrix metalloproteinases (MMPs)

MMPs are Zn2+-dependent enzymes with important roles in many normal processes including wound healing, and in the pathogenesis of inflammation, cancer, embryonic development, angiogenesis, and tissue destruction (593). The MMPs consist of a family of structurally-related proteinases (23 in human, 24 in mice). Gene knockouts indicate critical roles for particular MMPs in inflammation. To date, at least 14 murine MMP mutants have been

70 generated (594). S100A8/S100A9 were identified as substrates of MMP-2 and MMP-9 and degradation of S100A8 may abrogate its chemotactic effects, contributing to resolution of inflammation in a murine model (357).

There is also evidence that human S100A8/S100A9 inhibits activity of MMPs (MMP-1,

MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, and MMP-13) by sequestration of Zn2+ (593),

Section 1.6.4). The possibility of a negative feedback loop between S100A8/S100A9 and

MMPs is worthy of investigation, particularly as some pro-MMPs are activated by oxidants

(595) and S100 proteins could potentially also regulate this process. Thus some of the pleiotropic functions of extracellular S100A8/S100A9 may be attributed to inhibition of the

MMPs. Because MMPs not only degrade extracellular matrix proteins to facilitate leukocyte migration, but also activate a broad range of cytokines, such as IL-1 (596, 597), TNF- (598), in the initiation phase of acute inflammation, S100A8/S100A9 may indirectly modulate these.

Interestingly, S100A8/S100A9 was recently implicated in the transcriptional regulation of MMP-2 in a human gastric cancer cell line (SNU484 cells) (599), although molecular mechanisms are undefined.

1.8. Diseases associated with elevated S100A8/S100A9 expression

S100A8/S100A9 exhibit characteristic expression patterns in normal cells (Section

1.6.6) but this is dysregulated in a wide range of human diseases. Table 1-21 summarizes the diseases where S100A8 and/or S100A9 have been found, either using immunohistochemistry, or measurement of the complex in body fluids. Most studies are descriptive but confirm associations of these proteins with diverse inflammatory conditions. S100A8/S100A9 may be a potential link between inflammation and cancer.

Clinically, S100A8/S100A9 is suggested to be a sensitive marker of inflammation under various conditions, rather than being diagnostic indicators of specific diseases. For example, in psoriatic arthritis, the kinetics of elevation of serum levels reflect acute exacerbation, and levels rapidly decline in response to successful treatment (600). After surgery, S100A8/S100A9 in serum rise earlier than C-reactive protein (CRP), an acute phase reactant used extensively as a

71 Table 1- 21: S100A8/S100A9 and human disease

Disease Cell/ Tissue/ body fluids Expression Reference Infectious diseases Periodontitis Macrophages, epidermal cells A8, A9 (403, 606, 607) Chronic bronchitis Macrophages A8, A9 (495) Onchocerca infection Macrophages A8, A9 (608, 609) Tuberculosis Serum A8, A9 (353, 610) Cat scratch disease Macrophages A8, A9 (530) HIV-1 Serum, microglia A8, A9 (478, 605, 611) Malaria Serum A8, A9 (612) Leishmaniasis Macrophages A9 (613) Schitoma mansoni Macrophages, epithelial cells A8, A9 (614)

Autoimmune diseases Rheumatoid arthritis Serum, macrophages, synovial A8, A9 (615) membrane, synovial fluid, Psoriatic arthritis Synovial membrane A8, A9 (600) Juvenile idiopathic arthritis Phagocytes A8, A9 (467, 604, 616) Systemic lupus erythematosus Serum A8, A9 (482) Progressive systemic sclerosis Serum A8, A9 (617) Sjøgren’s syndrome Serum, saliva A8, A9 (492, 617) Giant cell arteritis Serum, phagocytes within A8, A9 (618) the adventitia and media ANCA-positive renal vasculitis Glomerular macrophages A8, A9 (619)

Gastrointestinal diseases Crohn’s disease Inflamed colonic tissue A8, A9 (483, 620) Ulcerative colitis Serum, inflamed colonic tissue A8, A9 (484, 620)

Respiratory diseases Pneumonia Alveolar macrophages A8, A9 (621) Cystic fibrosis Tracheal gland cells A8, A9 (622) Protracted asphyxiation Lung specimen A8, A9 (623) Bronchial disease Sputum A8, A9 (624)

Brain and central nervous system diseases Cerebral infarction Microglia A8 (625, 626) Alzheimer’s disease Microglia A9 (410) Multiple sclerosis Serum, macrophages A8, A9 (627, 628) Autoimmune neuropathies Endoneurial cells A8, A9 (629) Cerebral malaria Microglia A8, A9 (630) Brain aging Corpora amylacea A8, A9 (298) Brain injury Microglia A8, A9 (409, 631, 632) Neoplastic diseases Thyroid carcinoma Adenocarcinoma A9 (633) Lung cancer Squamous carcinoma A8, A9 (346, 634) Adenocarcinoma A9 (635) Gastric cancer Adenocarcinoma A8, A9 (283) Colorectal carcinoma Adenocarcinoma A8, A9 (89, 636, 637) Hepatocellular carcinoma Cancer cells A9 (638) Pancreatic carcinoma Adenocarcinoma A8 (639) Renal cell carcinoma Macrophages A8, A9 (640) Bladder carcinoma Cancer cells A9 (89, 641) Prostatic cancer Adenocarcinoma A8, A9 (642) Breast cancer Cancer cells A8, A9 (89, 643) Ectocervical uterine cancer Adenocarcinoma A8, A9 (89) Ovarian carcinoma Cystic fluid, serum A8, A9 (644)

72 Table 1-21: S100A8/S100A9 and human disease (Continued)

Disease Cell/ Tissue/ body fluids Expression Reference Neoplastic diseases (continued) Skin cancer Squamous carcinoma A8, A9 (89, 346, 498) Melanoma Macrophages A8, A9 (645)

Skin diseases Psoriasis Keratinocytes A8, A9 (207, 403, 468) Wound healing Keratinocytes A8, A9 (456) Urticaria Macrophages A8, A9 (403, 646) Contact dermatitis Macrophages A8, A9 (468) Discoid lupus erythematosis Keratinocytes A8, A9 (647) Erythroderma Macrophages, epidermal cells A9 (403) Atopic dermatitis Macrophages, epidermal cells A8 (403) Sarcoidosis Macrophages A8, A9 (403) Leprosy Macrophages A8, A9 (648) Allergic contact eczemas Macrophages, epidermal cells A8, A9 (403)

Vascular diseases Atherosclerosis Foam cells, macrophages A8, A9 (368) Ischemic heart diseases Serum, platelets A8, A9 (411) Kawasaki disease Serum A8, A9 (649-651)

Others Epitheloid granuloma Phagocytes A9 (652) Foreign-body granuloma Epithelioid cell A9 (353, 653) Gout Monocytes/macrophages A8, A9 (419) Inflammatory muscle diseases Macrophages A8, A9 (571) Urinary stones Undetermined A8, A9 (654) Osteoarthritis Macrophages A8, A9 (655) Surgery Serum A8, A9 (602, 656) Renal allograft rejection Macrophages A8, A9 (340, 421, 657)

marker of inflammation (601); S100 levels remain elevated longer than those of IL-6 (602).

There are strong correlations between S100A8/S100A9 levels to clinical scores of disease activity in inflammatory bowel disease (603), Kawasaki disease (486), psoriatic arthritis (600), juvenile idiopathic arthritis (604) and HIV (605) and the complex is proposed as a suitable biomarker for monitoring disease activity in chronic inflammatory disorders. Some examples of

S100A8/S100A9 expression, and where known, their possible functional relevance, will be discussed.

Infectious diseases

In 1984 Sander et al. reported the S100A8/S100A9 complex (calprotectin) to be a marker of inflammation in febrile conditions (476). Since that time, high circulating levels have

73 been found in numerous bacterial infections listed in Table 1-21. Serum calprotectin levels have been suggested as a marker of HIV infection (605, 611, 658), oral candidiasis (659) and mycobacteriosis (610).

High levels of serum S100A8/S100A9 are found in HIV-1-seropositive patients with advanced immunodeficiency (478, 605, 611). Levels are inversely proportional to CD4+ T cell counts and correlate with viral load in patients with advanced HIV-1 (478, 605). Elevated

S100A8/S100A9 levels in AIDS patients correlate with onset and ongoing-opportunistic infections (490, 660, 661). S100A8/S100A9 caused 4- to 5-fold induction of HIV-1 viral replication in a latently-infected human T lymphoid cell line with HIV-1. Induction is mediated through NF-B activation. In addition, S100A8 derived from cervico-vaginal secretions induces virus production in a latently HIV-1-infected monocytoid cell line (662), suggesting a role of

S100A8 in viral replication. However, precise mechanisms remain to be elucidated.

Autoimmune diseases

Studies indicate a role of S100A8 in DTH responses in sensitized animals challenged intradermally with antigen. Expression in macrophages was obvious. The DTH reaction is a model of Th-1-dependent cell-mediated immunity and forms the basis of numerous immune responses in autoimmune diseases. It is characterized by the accumulation of leukocytes, at sites of intradermally-injected antigen into a sensitized subject. In 1987, a cytokine-like factor was isolated from activated murine spleen cells (663, 664). This induced skin responses with characteristics similar changes to DTH reactions when intradermally injected into non- sensitized rats. Initially, this factor was called CP-10, and following purification, was identified as murine S100A8 (44, 585, 587).

Early studies found S100A8/S100A9 expression in inflamed synovial tissue in rheumatoid arthritis (RA), namely in newly-recruited phagocytes in the sublining layer (345,

403, 615). S100A8/S100A9 in synovial fluid from inflamed joints is ~10-fold more than in serum from individual patients (467, 480). Subsequent studies described their expression in psoriatic arthritis (PsA) (600) and juvenile idiopathic arthritis (JIA) (467). In particular, children 74 with systemic onset of JIA (SOJIA), characterized by massive neutrophil activation, have serum

S100A8/S100A9 concentrations up to 20-fold higher than those found in sepsis or other inflammatory disorders (616, 665), and these correlate well with individual disease activity (467,

480, 616). Interestingly, patients with SOJIA also have extensive S100A8/S100A9 expression in their dermal epithelium, and it was suggested that this may actually initiate a systemic autoimmune disorder through recruitment of leukocytes to the dermis (665).

Elevated serum concentrations of S100A8/S100A9 were found in Sjøgren’s syndrome, systemic lupus erythematosis (SLE) and progressive systemic sclerosis (482, 617). In SLE, concentrations correlate with the disease activity index (482). Immunohistochemical analysis of renal biopsies demonstrated that S100A8/S100A9-positive infiltrating macrophages in the glomeruli of lupus nephritis correlated well with disease severity (666). There is also a clear association of S100A8 and S100A9 expression in infiltrating macrophages, with degeneration of myofibers in dermatomyositis, polymyositis, and inclusion-body myositis. In vitro data suggests that their release from activated macrophages inhibits myoblast proliferation/differentiation, and induces apoptosis through activation of caspase-3, resulting in destruction and impairment of myocyte regeneration in the course of inflammatory myopathies (571). High serum concentrations of S100A8/S100A9 are also reported to predict renal allograft rejection (657).

Inflammatory bowel disease

In 1992 Roseth et al developed a method for the determination of calprotectin in stools as an alternative to 1-antitrypsin for evaluation of disease activity in inflammatory bowel disease (495). However, it soon became apparent that increased faecal S100A8/S100A9 may represent a marker of diseases of the gastrointestinal tract, including gastric cancer, colorectal adenoma or cancer, Crohn's disease, and ulcerative colitis (654, 667). Measurement of

S100A8/S100A9 in faeces is reliable and highly sensitive, possibly because of its resistance to proteolysis (668). Together with serum levels, faecal levels are useful in discriminating between active and inactive Crohn’s disease (483, 603). S100A8/S100A9 in stools has an excellent diagnostic accuracy (669) and there is a close correlation between histological findings and

75 results of technetium-99 (99Tc) scans (670).

A proposal that correlations merely reflect numbers of dying neutrophils is not generally considered to be correct, because there is considerable evidence that the proteins can be also secreted under inflammatory conditions and appear to be up-regulated in macrophages and epithelial cells in ulcerative lesions in Crohn’s disease (671). In addition, faecal

S100A8/S100A9 could also indicate gastro-intestinal complications of treatment with non- steroidal anti-inflammatory drugs (672).

Skin diseases

In normal epidermis, S100A8/S100A9 are generally expressed at very low levels apart from in the pilosebaceous unit (457) and occasional expression in the granular layer (66). Both proteins are expressed in the skin of patients with diseases such as SLE, psoriasis and cutaneous malignancies (341, 457), as shown Table 1-21. For example, in psoriasis these are highly expressed in the basal, granular, and spinous layers (310). S100A8 and S100A9 levels increase in response to a variety of skin stressors, including tape stripping, exposure to detergent,

Vaseline application and UV exposure (446). They are found in most dermatoses associated with hyperproliferation of epithelial cells (352) and in wound healing-associated disorders, most likely through altered or abnormal pathways of epithelial cell differentiation rather than accompanying inflammation (66, 456). In a murine model, expression of S100A8/S100A9 is strongly induced within the first week after epidermal injury, and the levels are increased in the epidermis of activin-overexpressing mice that display epidermal hyperproliferation without inflammation (456), suggesting a role in promotion and/or response to the hyperproliferative state in the epidermis.

S100A8 and S100A9 are differentially up-regulated in advanced stages of skin cancer in mouse and human (342, 498, 673, 674). Significant alterations in expression of other S100 members, such as S100A3, S100A6, and S100A7, are also found in skin tumors, implying a functional role of S100 proteins during promotion and/or malignant progression of epidermal skin cancer (262, 673, 675).

76 Cystic fibrosis

Cystic fibrosis (CF) is an autosomal recessive disease prevalent among Caucasians

(676). In 1985, a serum protein abnormally elevated in CF patients was described, and was found in high concentrations in granulocytes from normal individuals, or those with cystic fibrosis (677, 678). Initially the protein was called “cystic fibrosis antigen” and a function in the pathogenesis of CF was proposed. However, this was shown to be the S100A8/S100A9 complex. Patients with CF are highly susceptible to chronic infections, particularly of

Pseudomonas aeruginosa, which usually leads to ongoing inflammation of the lung and subsequent tissue damage and death. A defect in the cystic fibrosis transmembrane conductance regulator (CFTR) results in defective Cl- transport across epithelial cells of exocrine glands

(679). This, together with associated abnormalities of fluid transport, accounts for a number of the pathological features of CF. Persistence of P. aeruginosa was attributed to trapping within the thick mucus in the airways due to abnormal hydration resulting from improper Cl- transport.

However, a growing body of evidence suggests that dysregulation of the inflammatory response due to persistent infection contributes to the cycle of infection and lung damage (680-683).

TNF- and IL-8 are elevated in CF airways (680, 681, 683) and inflammation in CF infant lung occurs before overt bacterial infection (682, 684). Down-regulation of the anti-inflammatory cytokine IL-10 has been described (683, 685). Thus dysregulation of inflammation may disrupt the balance between destruction of bacteria and of tissue, resulting in eventual lung failure in CF patients.

The S100A8/S100A9 complex is elevated in lungs and serum of CF patients (354).

Levels may reflect neutrophil accumulation as neutrophils appear to be a major source. G551D mice carry a G551D mutation in the CFTR, and are a murine model for CF. Contrary to human tracheal epithelial cells from patients with CF (677), no S100A8 expression was evident in lung epithelial cells (686). However, S100A8 mRNA levels are 3- 4 times higher in lungs of G551D mice compared with littermate controls. Moreover, intravenous injection of LPS induces more

S100A8 mRNA in lungs of G551D mice than in wild-type littermates. In situ hybridization indicates expression of S100A8 mRNA in neutrophils, with marginal expression in interstitial or

77 alveolar macrophages and infiltrating monocytes. Interestingly, bone marrow-derived macrophages from G551D mice constitutively express S100A8 and exhibit hypersensitivity to

LPS. These results suggest that the combination of overexpression of a potent neutrophil chemoattractant (S100A8) and potent pro-inflammatory agents (TNF- and its cascade of cytokines) may contribute to the pathological changes in the lung. However, mechanisms of upregulation of S100A8 in macrophages from G551D mice are unclear. Interestingly, the Cl- channel in human fibroblasts is, at least partially, activated by cAMP/cAMP-dependent protein kinase (687, 688), which contributes to S100A8 mRNA upregulation in murine macrophages

(94).

Neoplastic disorders

S100A8 and S100A9 expression is reported in neoplastic disorders, and is strongly expressed in breast, lung, gastric, colorectal, pancreatic, and prostate cancer (Table 1-21), and is elevated in cystic fluid and serum from patients with ovarian carcinoma (644). However these are down-regulated in squamous esophageal (689-691). Interestingly, some cell types express only S100A8, and some only S100A9. For example, 28% of invasive breast cancers were reported to express human S100A9 whereas only 14% expressed S100A8 (89).

S100A9 expression is related to poor tumor differentiation in carcinomas of glandular cell origin, such as breast, lung, and thyroid gland (633, 692). A possible role in inflammation- associated carcinogenesis is supported by the fact that S100A8/S100A9-positive myeloid cells are observed within the tumor stroma of epithelial malignancies, such as skin, colorectal and prostate cancer, although associations between this and cancer pathogenesis is unknown (637,

642). The chromosomal localization of S100A8/S100A9 genes is within a region that contains frequent re-arrangements in several common human skin tumors (26). Increased

S100A8/S100A9 levels in mouse skin treated with tumorigenic agents (342) also suggest a role in carcinogenesis.

Constitutive S100A8/S100A9 or S100A9 expression is found in several cancer cell lines (Table 1-22), indicating that their expression may be a consequence of transformation.

78 Table 1- 22: Human cancer cell lines and S100A8/S100A9 expression

Expression Treatment S100A8 S100A9 Reference Glioma cells Hs683 None + + (599) Hepatocarcinoma SK-Hep1 None - + (599) Breast cancer MCF7 None - + (599) T47D None + + (599) Buccal squamous cell carcinoma TR146 None + + (207) Gastric cancer SNU484 None + + (599) MKN74 None - + (2) Prostate cancer LNCaP None - - (599) TPA + + (178) Cervical cancer HeLa None + + (599)

However, S100A9 is induced in MCF-7 cells by oncostatin M (693). Further studies are required to elucidate the relationships between S100A8/S100A9 expression and tumorigenesis.

Vascular diseases

S100A8/S100A9 is found in macrophages, foam cells and neovessels in human atheroma (368). Normal artery contains negligible S100s whereas atherosclerotic plaque contains multiple S100 complexes, the majority of which are resistant to reduction, suggesting that they contain sulfinamide bonds as macrophage-derived myeloperoxidase is active in human atherosclerosis (73, 368, 389). The rapid oxidation of these proteins with equimolar levels of

HOCl contrasts markedly with amounts required to oxidize LDL or BSA (~1:800, or ~1:100 respectively) (368, 398), suggesting that S100A8/S100A9 protects host tissue from excessive oxidative damage.

High levels of serum of S100A8/S100A9 is found in Kawasaki disease, an acute multi- system vasculitis that occurs in children and that leads to coronary artery abnormalities, implying an involvement of S100A8/S100A9 in human vasculitis (486, 651). Expression of the

S100 genes in human atheroma S100A8 is associated with neovascularization (95, 368) (see

Section 1.6.6). The S100A8/S100A9 complex was reported to change the adhesive and pro- thrombotic properties of the endothelium by inducing inflammation-associated genes and secretion that enhance platelet activation (507) that may contribute to vascular changes.

79 1.9. Transcription of the S100A8 gene

Little is known concerning the mechanisms that regulate S100A8 gene transcription and regulatory elements have not been completely identified. Website programs indicate putative transcription factors binding sites based on homologies to consensus binding sequences.

Mutational analysis, electrophoretic mobility shift assays (EMSAs), chromatin immunoprecipitation (ChIP) assays, gene silencing by siRNA and particular knockout mice would be useful in substantiating the factors and binding sites involved. Given that deletion of the S100A8 gene in mice is embryonic lethal (339), this approach is unsuitable. However, examination of S100A8 expression in mice defective in particular repressors/activators of the

S100A8 gene, if these do indeed survive may be useful.

Clustering of S100 genes on human chromosome 1q21 suggest common regulatory mechanisms of regulation (4). Transcriptional activation of the S100A9 gene is regulated differently in monocytic and granulocytic cells (reviewed in (356)), in which EMSA revealed different patterns of nuclear protein binding and results suggested complicated regulation.

A cluster analysis of inflammation-associated S100 genes predicts consensus binding sites for transcription factors normally required for gene regulation in macrophages. These include Sp1, Pu.1, MZF-1, AP1, and HMG-I/Y (2, 694-697). Promoter analysis comparisons with other inflammation-associated S100 genes, such as human and murine S100A4, S100A8,

S100A9 and S100A12 (2), may be useful, particularly as S100A8 and S100A9 are often co- expressed. However, in contrast to murine macrophages, which do not express S100A9 in response to stimulation (93), S100A8 and S100A9 are co-induced in human macrophages ((407),

Section 1.6.6), suggesting subtle differences. Interestingly, according to our prediction based on functional comparisons (2) and consistent with expression profiles, the human S100A12 promoter is most similar to the murine S100A8 promoter, supporting the concept that S100A12 may have arisen from human S100A8 (2).

In the murine S100A8 promoter, NF-1, c-Ets, SPE, Myb (575), Gata-3, VDR, C/EBP,

CEBP, and ELF-1 are predicted (2). These factors are generally associated with basal, tissue- specific, developmental and inducible gene expression, and include factors associated with

80 myeloid and lymphoid-specific differentiation, activation and inflammation. There is no evidence of an NF-B binding site. A stretch in the S100A8 promoter 400 bp upstream of the

TATA box is highly conserved between murine and human, sharing 64% nucleotide sequence identity (698). This region in particular includes common regulatory motifs (TATA box, NF1,

C/EBP) and others that bind nuclear proteins in EMSA ((575), Figure 1-10).

-178 Human CCCCTACCTGCTTTTTCCTTCTGGGC ACTATTGCCCAGCAAATGCCTTCCTCTTTCCGC Murine CCCCATCCTGATTCTTCCTGCTGGGT ACTCCTGTCTGGTAAATGTTCCAACACTCCCAC **** **** ** ***** ***** *** ** * * ***** * ** * C/EBP C/EBP Human TTCTCCTACCTCCCCACCCAAAATTTTCATTCTGCACAGTGATTGCCACATTCACCTGGT Murine TTCCTCAGACTCA------GAAATGCTCACTGTACTCAGTGATTGCCACATGGACTTGGT *** * *** **** *** * * * *************** ** **** C/EBP -94 Human TGAGAAACCAGAGACTGTAGCAACTCTGGCAGGGAGAAGC--TGTCTCTGATGGCCTGAA Murine TAGGAAAC-AGAGGCTGTGGCAACTCTGGAAGGGAAGAGCGTTGTCTCC-ATAGCCCGAG * ****** **** **** ********** ***** *** ****** ** *** ** SPE NF1 / CTF -34TATA Box Human GCTGTGGGCAGCTGGCCAAGCCTAACCGCTATAAAAAGGAGCTGCCTCTCAGCCCTGCAT Murine GCTGTGGGCAGCTGGCCAAGCTTT-CCTCTATAAAA-GCAGCTGACACTTAGCCTCACAT ********************* * ** ******* ******* * ** **** *** +1 Human GTCTCTTGTCAGCTGTCT-TTCAGAAGACCTGGTAAGTGGGACTGTCTGGGTTGGCCCCG Murine ATCCTTTGTCAGCTCCGTCTTCAAGACATCGTGTAAGTAGGGCTATGTGACT--GTCTCA ** ********* * **** * * * ****** ** ** * ** * * * * Exon 1

Figure 1- 10: Comparison of promoter elements in the human and murine S100A8 genes

Homology between the murine and human S100 promoters is higher than corresponding regions of the human S100A8 and S100A9 genes (351), suggesting specific, and highly conserved transcriptional regulation of the S100A8 gene in human and mouse. On the other hand, homologies outside of this region, including introns and sequences downstream of the polyadenylation site, are below 54% (698). In this section, properties of the promoter region of the murine S100A8 gene will be reviewed.

81 1.9.1. Proximal promoter elements of S100 genes

Eukaryotic gene transcription is regulated by RNA polymerase II which functions as a form of holoenzyme consisting of RNA polymerase II, general transcription factors which bind proximal promoter elements and enhancers/suppressors which modify the proximal promoter elements by binding distal promoter elements (699). The proximal promoter region of S100A8 contains TATA, GC boxes and CCAAT boxes. The latter is one of the most typical elements for transcriptional activation, and several transcription factors, such as C/EBP family and NF-1 bind

CCAAT sequences. Analysis of the promoter region of S100A8 and putative transcription factor binding sites are shown in Figure 1-11.

In conjunction with the general transcription factors, RNA polymerase II forms an initial complex surrounding the startpoint, and the TATA box site binds TATA binding protein

(TBP) in TFIID, a subunit in RNA polymerase II (TFII). The transcription startpoint is identified by the TATA box and/or an initiator. Most promoters contain a TATA box sequence

(TATA A/T A A/T), usually located ~25 bp upstream of the transcription startpoint.

GTAGACTGGA CATGAAGGCA TTGGATCAGC AATGGATCCA ATTAGGAGAG GGTTAAGATT GAGAGTCTGT

GATA-1 TTAGATGCAG GGATGAGGTG CCAGGGGCCT AGACATGGAC TTATTGCCAT GCCCCATCCT GATTCTTCCT

C/EBP -178 GCTGGGTACT CCTGTCTGGT AAATGTTCCA ACACTCCCAC TTCCTCAGAC TCAGAAATGC TCACTGTACT

C/EBP C/EBP C/EBP -94 CAGTGATTGC CACATGGACT TGGTTAGGAA ACAGAGGCTG TGGCAACTCT GGAAGGGAAG AGCGTTGTCT

SPE NF1 / CTF -34TATA Box Inr-like CCATAGCCCG AGGCTGTGGG CAGCTGGCCA AGCTTTCCTC TATAAAAGCA GCTGACACTT AGCCTCACAT

+1 ATCCTTTGTC AGCTCCGTCT TCAAGACATC GTGTAAGTAG GGCTATGTGA CTGTCTCACA GTGTAGGCTC Exon 1 TCCTTAGCGA GGGTTGGGGG ATAGAGTAGC CTCCTCTGAG AGGGCGAGAA AGCGTGGGGA AGTCTCCAGC

ACCGATCAAA TGCTTGAGGA TAAAGGAAGT GGAATGGCGT

Figure 1- 11: Putative promoter elements identified in the murine S100A8 gene

Modified and adapted from analysis of transcription factor binding sites in the murine S100A8 promoter predicted by TFSEARCH Search (http://www.cbrc.jp/research/db/TFSEARCH.html).

82 The murine S100A8 gene has two such sequences; one is perfectly matched to the 8 bp consensus sequence located -32 upstream of the startpoint, and a TATA box-like sequence which matches a 8 bp consensus sequence, but with one difference, at -979. The former is appropriate for RNA polymerase II promoters (700) and consistent with the mRNA size detected in a variety of cell types (701). The latter is unlikely to be involved in expression because of its distance from exon I and the discrepancy in transcript size. Generally, more than

70% of putative TATA boxes are situated between 33 bp and 28 bp upstream of the putative transcriptional start site, with 31 bp and 30 bp as preferred sites (702). However, from homologies with the cDNA sequence the putative transcriptional start site on the murine

S100A8 promoter is 23 bp downstream of the TATA box (365). There is no extensive sequence homology with a consensus sequence for the startpoint, but there is a tendency for the first base of mRNA to be A, flanked by pyrimidines. This region is called the initiator (Inr), and the general sequence is C/T C/T AN T/A C/T C/T, located between positions -3 and +5, which

RNA polymerase II recognize. The S100A8 promoter has an Inr-like sequence between positions -3 and +4, with only one base pair different from the consensus Inr sequence.

A CCAAT box, named according to its consensus sequence, can function at distances that vary considerably from the startpoint and can determine the efficiency of the promoter. It does not play a direct role in promoter specificity, but increases promoter strength. In most cases CCAAT boxes are within 100 bp of transcription start sites (703). In S100A8, there is no exact CCAAT box consensus sequence, but at -54 bp a CTF/NF-I (CCAAT transcription factor/nuclear factor I) binding site is identified. CTF/NF-I binds the CCAAT box in viral and cellular promoters (704). Only the first base pair of the putative CTF/NF-I sequence in S100A8 is different from the consensus sequence. Generally, a T after CCAA is sometimes present in the CTF/NF-I binding site, but is not strictly necessary (705, 706). In S100A8 the T is absent. In

TATA-containing promoters the CCAAT box is preferentially located within the -80/-100 region (mean position, –89 bp) and not generally nearer to the start site than -50 bp (703). The localization of CCAAT box in murine S100A8 at -40 bp suggests that the promoter region of this gene might be unusual. Initially a CAAT box in human S100A8 was reported to be 5'-

83 CAACT -3' at position -92, corresponding to -96 bp in murine S100A8 (351). However, based on the CTF/NF-I sequence, the CCAAT box-like sequence at -40 bp seems more plausible.

A GC box is a relatively common promoter component containing the sequence

GGGCGG and multiple copies are often present. The closest GC box is usually located between

40 and 70 bp upstream of the startpoint, and is recognized by several factors, including SP1

(specificity protein 1) (707), No candidates for SP1 binding sites were identified between 0 and

500 bp upstream in the murine S100A8 promoter. However, the human S100A9 promoter contains a putative binding site (5'-CCGCCC-3') at position -130 (351). Murine S100A8 has a

GC box-like sequence between positions -48 and -53 (5’-GGGCAG-3’), only one base pair different from the consensus sequence. This GC box-like region is also part of the putative

CTF/NF-1 binding site.

The S100 protein element (SPE) is a well conserved 12-base-pair element

(ARRRGCTGCCTC, R = A or G), apparently unique to S100 genes (708), occurring in 18 of the 21 S100 genes from different species (709). It is located close, or adjacent to the TATA box.

This common element is suggested to regulate transcription (82, 708), but there is no real functional evidence. In murine S100A8, a similar sequence, AAAAGCAGCTGA, is present at position -27, which is close to the TATA box, suggesting its involvement in formation of the transcription initiation complex.

1.9.2. Distal enhancer/suppressor elements

The murine S100A8 5’-flanking region contains several functionally-important enhancer elements including C/EBP, and E26 transformation-specific (Ets) DNA binding domains.

1.9.2.1. Enhancer elements

In 1993 the first report of transcriptional regulation of human S100A8 and S100A9 was published using HL-60 cells and EMSA to study elements involved in differentiation-dependent

S100A8 expression (504). HL-60 cells express little or no S100A8 or S100A9 transcripts until

84 differentiated to granulocytes but not to macrophages (351). Nuclear extracts from granulocytes indicate two specific DNA-binding sites; one adjacent to the TATA box between -47 and +20 bp and another in the region between -426 and -48 bp upstream from the transcription initiation site (504). However, no functional correlations, or identification of the nuclear factors involved have been published. Human S100A9 contains a potent enhancer located within intron I and this sequence is highly conserved in the human and murine 100A8 and S100A9 genes at nearly identical positions (710). Affinity purification confirmed that four proteins (unidentified) bind this enhancer element, although biological relevance is unclear.

NF-1 binds as a dimer to the consensus TTGGC(N5)CCAA on duplex DNA. NF-1 proteins are derived from 4 genes and multiple copies are generated by alternative splicing, and are implicated in activation and repression of promoters (reviewed in (711)) and can act as

‘silencers’ in several promoters (712). The balance between activation and repression may be dependent on specific isoforms of NF-1, resulting in cell-type specific expression (711). NF-I proteins affect gene expression regulated by several signal transduction pathways, including those controlled by insulin, TGF-, cAMP, steroid hormones, vitamin D, and TNF- (reviewed in (711)).

Mutation of NF-1 abolished S100A8 gene expression in murine macrophages stimulated by LPS and/or IL10 ((407), unpublished data), suggesting that the putative NF-1 sequence, together with TATA box, is necessary for the initiation of polymerase II complex formation. Indeed, the human S100A8 gene binds to a basal transcription factor in the region from -47 to -29 (526), which includes half of the putative NF-1 motif. Although NF-1 generally binds as a dimer, monomers may also bind specifically to individual half sites (TTGGC or

GCCAA) (713).

C/EBPs are a family of 6 (C/EBP-) transcription factors. Except for C/EBP, which lacks a canonical basic region, each contains similar basic region and leucine zipper sequences at its C-terminus, which mediate DNA binding and dimerization, respectively. C/EBPs bind palindromic DNA sites (T T/G NNGNAA T/G) as homo- or heterodimers, and are important in controlling cell proliferation and differentiation (714-718).

85 Individual members can have specific roles. For example, C/EBP regulates the terminal differentiation of adipocytes (719) and hepatocytes (720) and is expressed predominantly in post-mitotic cells (reviewed in (721)). C/EBP, -, and - can regulate inflammatory genes. C/EBPs also form heterodimers with other transcription factors, such as fos, activating transcription factor/cAMP–response element binding protein (ATF/CRE), and NF-B

(716, 722-724). C/EBP may inactivate the myeloid master regulator PU.1 (725) and/or its co- activator c-Jun (726) through physical interactions. However, relatively little is known about how C/EBPs interact with other nuclear proteins to regulate myeloid-specific transcription.

Accumulating evidence indicates that C/EBP, also known as nuclear factor-IL-6 (NF-

IL6), is an important regulator of immune and inflammatory responses in macrophages. It regulates expression of genes including COX-2 (727, 728), iNOS (729), IL-1 (730, 731), IL-6 and IL-12 ((732). C/EBP is a transcriptional enhancer of the human S100A8 gene, the activity of which is antagonized by the retinoic acid receptor (RAR) in a ligand-dependent manner (526).

However, there is little information concerning pathways leading to C/EBP activation. In NIH

3T3 cells, C/EBP activity is regulated through phosphorylation at Thr235 by MAPK in response to activated Ras (733). In LPS-stimulated RAW cells, PKC may modulate phosphorylation of

C/EBP through activation of Raf-1 (734).

The murine S100A8 promoter sequence contains three tandem C/EBP motifs at -94, -

109, -114 bp upstream of the promoter region (see Figure 1-11). Point mutation of C/EBP at -

114 bp dramatically reduced expression in RAW cells activated with LPS (Hsu K, unpublished data), but additional studies are required to confirm this and assess involvement of the other

C/EBP motifs. Interestingly, CEBP, which is exclusively expressed in myeloid cells, was considered as having the potential to upregulate S100A9 in these cells. However, expression studies in CEBP-/- mice showed that CEBP is dispensable for S100A8 and S100A9 expression

(735). Transfection experiments demonstrated that C/EBP is sufficient to establish S100A9 gene expression in HL60 granulocytes and L132 fibroblasts, and upregulation was antagonized by myb (527). However the contribution of C/EBP alone in establishing S100A8 gene

86 expression is undetermined. Recent studies indicate that vitamin D3 which induces human

S100A8, also upregulates C/EBP (736) and - (737).

The E26 transformation-specific (Ets) DNA binding domain is a purine-rich GGAA/T core motifs and there are >30 members in mammals (738), suggesting diverse functions. Ets factors regulate many processes, including proliferation, differentiation, development, transformation and apoptosis (739). Several members are expressed predominantly in certain types of tissues and some ubiquitously (740) and many cell types simultaneously express several Ets factors which can bind similar DNA sequences, and it is unclear how individual proteins regulate specific functions. However, after binding to specific DNA sequences, they can interact with other transcription factors and/or transcriptional co-activators (740).

Involvement of Ets family proteins in S100A8 gene regulation is still unclear, although some computer searches predict their binding sites.

1.9.2.2. Repressor elements

The possible involvement of repressors of S100A8 gene regulation was first reported by

Roth and colleagues (741). Human blood monocytes express S100A8 and S100A9 during

2+ maturation; expression is suppressed by increases in [Ca ]i and calcium-induced de novo protein synthesis of a transcriptional repressor may be involved, because suppression is abrogated by cycloheximide or actinomycin D. However, neither a regulatory element within the S100A8 promoter, nor identification of the postulated suppressor protein is reported (741).

Recently, strong and early induction of S100A8 and S100A9 expression in epidermis was seen in mice with an inducible deletion of JunB/c-Jun (742), suggesting negative control by these, at least in keratinocytes. This is supported by the fact that basal, and TPA-induced

S100A8 and S100A9 mRNA levels are upregulated in the skin from c-fos-/- mice (342).

Interestingly, TPA-induced S100A8 and S100A9 were reduced by GCs in wild type, but enhanced in c-fos-/- mice. Given that GCs interfere with gene expression through negative cross- talk between the GC receptor and other transcription factors, such as AP-1 and NF-B (743,

744), S100A8 and S100A9 are the first examples of negatively-regulated c-fos target genes for

87 which repression by GCs depends on c-fos. Although mice deficient in ether subunit of AP-1 show enhanced expression of S100A8/S100A9 in epithelial cells (342, 742), surprisingly, human and murine S100A8 do not have perfect AP-1 consensus sites, but only a variant site (5’-

AGTGACTTAG-3’) located -658 bp upstream from the TATA box of the murine gene (526).

Of interest is the cell-type specificity of repression mediated by GCs; in LPS-activated macrophages, fibroblasts and microvascular EC, GCs enhance S100A8 induction and directly induce S100A8 and S100A9 in human monocytes (407), suggesting complicated transcriptional regulation.

More recently, a microarray-based expression profiling approach revealed that BRCA1, a potent tumor suppressor conferring genetic predisposition to breast and ovarian cancer, may be a potential repressor/co-repressor of S100A7, S100A8 and S100A9 transactivation in breast cancer cell lines (745). BRCA1 co-purifies with the RNA polymerase II holoenzyme complex through association with RNA helicase A (746), suggesting that it is a component of the core transcriptional machinery. BRCA1 also associates with a range of transcription factors, such as p53 (747), c-Myc (748), ATF1 (749), and STAT1 (750), to modify their activities. Among these, c-Myc forms a complex with BRCA1 on the S100A7 promoter and represses S100A7 in a c-

Myc-dependent manner (745). S100A8 is implicated in carcinogenesis and may be regulated in a similar fashion. However, apart from this report, there are no publications concerning co- activators/co-repressors of S100A8 gene regulation.

Taken together, identification of regulatory elements and the particular suppressor proteins involved in S100A8 gene regulation requires more extensive experimentation.

1.9.3. Deletion analysis of the murine S100A8 promoter region

Deletion analysis of the murine S100A8 promoter reveals a number of distinct regulatory regions up- and downstream of the transcription initiation site that activate or repress promoter activity. In murine macrophages, elements essential for LPS induction and for GC enhancement are located within the region -178 to -1 (575), and the minimal promoter required for LPS/IL-10-induced responses is restricted to the region from 94 to 465. Deletion of the

88 region from 178 to 94 bp, which may contain Ets and C/EBP motifs, partially negated activity induced by LPS/IL-10, suggesting this region contains important elements for full expression of S100A8. Further deletion from 94 to 34 bp totally abolished activity, indicating that this region contains distinct response elements essential for LPS/IL-10 activation in macrophages. Preliminary data obtained from co-transfection of transcription factor expression constructs identified a number of factors that either enhance or repress LPS-induced expression, including p65, p50, NF-IL6, Ets-2 and c-jun (575). These factors are variously reported to direct tissue-specific expression of genes pivotal to the pro-inflammatory functions of lymphocytes and activated macrophages, and are implicated in regulation of myeloid proliferation and differentiation. However, these co-transfection experiments may also affect S100A8 expression through modifying levels of other proteins, such as IL-10 (see Chapter 5). Therefore, mutations of the corresponding binding motifs within the promoter are required to positively identify essential elements for regulation of expression.

In murine fibroblasts activated with FGF-2/heparin, the region -94 to -34 bp was essential for transcription, whereas the region -178 to -94 bp contains enhancer elements (378).

These results suggest more complicated transcriptional regulation of the S100A8 gene that may depend on the type of cell, and/or particular stimulants.

1.10. Mechanisms regulating S100A8 gene expression

Regulation of S100A8 gene expression has been characterized using various approaches, including pharmacological intervention and gene modification. However, precise mechanisms are still being characterized. In this section, the unique aspects of S100A8 gene regulation will be introduced, followed by possible signal transduction pathways mediated by major induces/enhancers. The TLR pathway and the IL-10 signalling pathway are important. FGF-2- signalling will be briefly overviewed because this induces S100A8 in fibroblasts. The reagents that induce/enhance S100A8 gene expression are listed in Table 1-23. It should be noted that in the mouse, S100A9 expression has not been induced by any stimulant tested to date. Few studies have been performed concerning regulation of the human genes. With respect to their 89 Table 1- 23: Inducers and enhancers of S100A8 gene expression

Cell type Inducers Enhancers References Murine cell lines Fibroblasts (NIH/3T3 cells) LPS, IL-1 (378) FGF-2 Heparin, IL-1, cell (378) confluence, Serum starvation** DEX** Rahimi F** Macrophages/monocytes LPS IL-10, Glucocorticoids, (406) (94, 407) (RAW 264.7 cells) PGE2, cAMP, TGF- CpG** IL-10, PGE2 Hsu K** Macrophages/monocytes LPS (406) (WEHI 265 cells) Microvascular endothelial LPS Cell confluence (95) cells (bEND3 cells) IL-1 (95) Keratinocytes (412) (PAM212 cells) UVA, H2O2 LPS + IL-10 +TNF- (412) (PMK-R3 cells) PMA (342) Murine primary cells Elicited peritoneal LPS PMA, U73122 (PLC (93, 407) macrophages* inhibitor), DEX TNF-, IFN- (93) Keratinocytes PMA (342) Human cell lines Granulocytes DMSO (463) (differentiated HL-60) Monocytic cells (Monomac 6) LPS** IL10**, PGE2, ** cAMP** Vit D3** (U-937 cells) Vit D3, (751, 752) Norepinephrine Macrophages (differentiated HL-60) PMA, Vit D3 (463) (470) (THP-1) PMA (470) Keratinocytes (HaCat cells) IL-17, DEX (753) Activin A (456) Human primary cells Monocytes PMA (112, 340, 379) IL-1 (112, 754, 755) GM-CSF (112) TNF- (754, 755) IFN- (379) LPS (379, 407, 755) Calcium ionophore (347) A 23187 DEX (407) Dendritic cells IL-10 (408) Keratinocytes TNF-, IL-1, IFN- (756) * Murine primary macrophages are generated with thioglycolate. ** Unpublished data from our laboratory. Vit D3; 1,25-dihydroxyvitamin D3, DMSO; dimethylsulphoxide, DEX; dexamethasone, TGF- ; transforming growth factor-, PMA; phorbol 12-myristate 13-acetate

90 reported constitutive expression in primary human monocytes (Table 1-23), it is noteworthy that the isolation processes required to purify monocytes may modify S100A8 expression, because this gene is apparently upregulated by various cell stressors (see Chapter 4).

1.10.1. Different S100A8 inducers among cell types

At sites of inflammation, S100A8/S100A9 proteins are predominantly expressed by phagocytes and epithelial cells, with lower incidence of expression in microvascular endothelial cells (MEC) and fibroblasts in vivo. Murine S100A8 in elicited macrophages is moderately upregulated by pro-inflammatory mediators such as LPS, TNF-, and IFN in vitro (Table 1-

23), but not in MEC by TNF- or IFN (95). LPS and IL-1 are key regulators of the gene in

MEC and fibroblasts (95, 378), although levels induced are lower than those in neutrophils and stimulated monocytes/macrophages.

To date, mechanisms allowing constitutive S100A8 and S100A9 expression in neutrophils are unknown. Interestingly, S100A8 mRNA is expressed in bone marrow cells from S100A9-/- mice, but neutrophils lack the protein (337, 338). Moreover, the percentage of S100A8-positive cells in the bone marrow of S100A9-/- mice increases after inflammatory stimulation; the absence of

S100A8 was proposed to be due to inefficient translation, or to instability of S100A8 protein in the absence of S100A9 (337). However our studies (93, 94, 407) and those presented in this thesis, clearly show S100A8 expression in activated macrophages in the absence of S100A9, making the latter possibility unlikely. Mechanisms of S100A8 and S100A9 regulation in myeloid cell differentiation are not known. The endogenous stimulants that upregulate

S100A8/S100A9 may vary with cell type (Section 1.6.6), although they share a common promoter sequence.

1.10.2. Mechanisms mediating S100A8 induction

The earliest host-defense mechanism against invading microbes is recognition of an abnormal presence, and subsequent activation of an appropriate innate response through a series of stably-inherited molecules designated pattern recognition receptors (PRRs). Many PRRs 91 recognize structures unique to microbes. These structures are termed pathogen-associated molecular patterns (PAMPs), which constitute an efficient self/non-self discrimination system

(757).

To date, four major groups of PRRs are recognized; Toll-like receptors (TLRs), nucleotide-binding oligomerization domain (NOD) proteins, RNA helicases and dsRNA- activated protein kinase R (PKR). In human and/or murine macrophages, S100A8 is induced by activation of TLR4 (93, 94, 407) and TLR9 (Hsu K in preparation). Common pathways downstream of these PRRs may provide clues concerning S100A8 regulation. Therefore, in this section, firstly signal transduction originating from TLRs, and then likely involvement of these in S100A8 gene regulation will be overviewed.

1.10.2.1. Toll-like receptor signalling

TLRs consist of 13 well-characterized members (758, 759). They are expressed on sentinel cells of the immune system, including dendritic cells (DC) and macrophages, and regulate and link innate and adaptive immune responses. TLRs are members of the interleukin-1 receptor (IL-1R) superfamily, sharing significant homologies in the cytoplasmic regions, the

Toll/IL-1R (TIR) domain (758, 760). These receptors are defined by an extracellular or luminal ligand-binding leucine-rich region (LRR) and a cytoplasmic signalling TIR domain (761).

Based on their amino acid sequences and genomic structures, TLR1, 2, 6 and TLR10 are closely related and constitute the TLR2 subfamily. TLR1 and TLR6 form heterodimers with TLR2.

Likewise, TLR7, 8 and 9 constitute the TLR9 subfamily (758). TLRs 1, 2, 4, 5, 6, and 10 are expressed on the cell surface, whereas TLR7, 8, and 9 are localized intracellularly in endosomes

(762). The subcellular distribution of TLR3 is cell-type dependent; it is expressed on the surface of fibroblasts, but localizes to an intracellular vesicular compartment in monocyte-derived immature DCs (763).

A wide range of microbial components, shown in Table 1-24, signal via TLRs.

However the functions and ligands of TLR10, 12 and 13 are unknown. TLR11, 12 and 13 are expressed as functional genes in the mouse but are pseudogenes in human. TLR10 is expressed

92 in human but not in the mouse (764). TLRs recognize genetically-conserved molecular features of bacteria, fungi and viruses.

Table 1- 24: Exogenous ligands of TLRs

TLRs PAMPs Reference TLR1 /TLR2 Tri-acyl lipopeptides, soluble factors (765, 766) TLR2 Lipoproteins, peptidoglycans, lipoteichoic acid, (767-777) lipoarabinomannan, phenol-soluble modulin, glycolipids, glycoinositolphospholipids, porins, atypical lipopolysaccharide, zymosan TLR3 Double-stranded RNA (778) TLR4 Lipopolysaccharide (LPS), taxol, fusion protein, (779-782) envelope protein TLR5 Flagellin (783) TLR2/ TLR6 Di-acyl lipopeptides, lipoteichoic acid, zymosan (769, 784, 785) TLR7, TLR8 Single-stranded RNA (786-788) TLR9 Unmethylated CpG DNA, malaria pigment haemozoin (789) TLR 11 Toxoplasma gondi profilin-like protein (790) (Adapted and modified from (418, 759))

Host-derived ligands are listed in Table 1-25, and include extracellular matrix (ECM) breakdown products, pulmonary surfactant, and necrotic cells. To distinguish these from

PAMPs of microbial origin, the term, “endogenous ligands of TLRs”, is used (791) (792). A number of endogenous ligands generate pro-inflammatory cytokines from monocytes/macrophages or activate DC via TLR pathways. Historically, recombinant heat

Table 1- 25: Putative endogenous ligands of TLRs

Endogenous molecule TLRs involved Reference Fibrinogen TLR4 (795) Surfactant protein-A TLR4 (796) Fibronectin extra domain A TLR4 (797) Heat shock proteins (Hsp 60, Hsp 70, Gp96)* TLR2, TLR4 (791, 793, 794, 798- 800) Heparan sulfate TLR4 (801, 802) Soluble hyaluronan TLR4 (803) -Defensin 2 TLR4 (804) High mobility group box 1 (HMGB1) TLR2, TLR4, TLR9 (805) Messenger RNA (mRNA) TLR3 (806) Saturated fatty acid TLR4 (807) Minimally modified LDL (low density lipoprotein) TLR4 (808) Recombinant S100A8 TLR4 (242) *Concerns of possible pathogen-associated molecular patterns contamination remain for some of these ligands (Adapted and modified from (418, 809, 810))

93 shock proteins, such as Hsp60 (791), Hsp70 (793), Gp96 (794) and HMGB1 (amphoterin) were reported as putative endogenous ligands of TLR2 and TLR4. However, the possibility of contamination of recombinant proteins with bacterial products is an important consideration

(811-816).

Recombinant human S100A8 produced from E. coli was recently shown to be a putative endogenous ligand of TLR4 (242). Although the authors provided some evidence that this was free of LPS, additional contaminant(s) or trace contamination with PAMPs such as lipopeptides may generate misleading results. Furthermore, contaminant(s) which may synergise with a potential activator to enhance TLR4 signalling may also be misleading. It is essential to conclusively establish whether the reported induction of pro-inflammatory cytokines by recombinant S100A8 is due to the protein itself or due to contaminant(s), before exploring further implications, particularly as our laboratory cannot reproduce this finding (Hsu K and

Geczy CL unpublished).

TLR-mediated signalling

The early innate host response of macrophages to microbes is characterized by production of IFN-/ and pro-inflammatory chemokines/cytokines. These stimulate development of the subsequent adaptive immune response important for microbial elimination and development of protective immunity. Upon interaction of TLRs with PAMPs, a variety of signalling molecules, including phosphoinositide 3-kinase (PI3K), Jun N-terminal kinase, p38, extracellular signal related kinase (ERK), NF-B, and IFN regulatory factor-3 (IRF-3) are activated, each leading to induction of numerous target genes involved in inflammation, immune responses, and differentiation (758, 759, 817, 818). Broadly speaking, and despite the divergent structure of PAMP ligands, most TLRs share a common signalling pathway through different combinations of adaptor molecules, leading to activation of NF-B, mitogen-activated protein (MAP) kinases and IRF-3, and subsequent induction of cytokines and IFN-/. The proposed pathway is shown in Figure 1-12. Four TIR domain-containing adaptor proteins

94

Figure 1- 12: TLR3, TLR4, TLR7/8 and TLR9 signalling pathways

(P)=phosphorylation, (Ub)=ubiquitination (from (819))

95 mediate signal transduction: MyD88, Mal, TRIF and TRAM (761). Table 1-26 shows TIR- domain-containing adaptor proteins. Each adaptor is essential to one or more individual TLR signalling cascades and contributes to the specificity of TLR responses (759, 820).

Table 1- 26: TIR-domain-containing adaptor proteins

Abbreviation TIR-domain-containing adaptor proteins MyD 88 Myeloid differentiation primary response protein 88 Mal/TIRAP MyD88-adaptor-like/TIR-domain containing adaptor protein TRIF/TICAM-1 TIR domain-containing adaptor inducing IFN-/TIR domain-containing molecule 1 TRAM/TICAM-2 TRIF-related adaptor molecule/TIR domain containing molecule 2

MyD88 is the most widely-implicated adaptor protein and was first cloned as a myeloid differentiation primary response gene (821). MyD88 is used by all TLRs, with TLR3 as a possible exception, whereas the other adaptor proteins are much more restricted. TLR signalling is classified as MyD88-dependent or MyD88-independent (details summarized in Table 1-27).

Interestingly, TLR4 signalling uses both the MyD88-dependent (early response) and independent pathways (later response), leading to activation of NF-B, p38 and JNK (822)

(Figure 1-12).

Table 1- 27: MyD88-dependent and independent TLR signalling pathways

MyD88- MyD88- dependent independent TLRs signalling signalling Gene induction TLR1 /TLR2, TLR2, MyD 88, Mal - Pro-inflammatory cytokines TLR2/TLR6 TLR3 - TRIF IFN- TLR4 MyD 88, Mal TRIF, TRAM Pro-inflammatory cytokines, IFN- TLR5, TLR7, TLR9 MyD 88 - Pro-inflammatory cytokines (Adapted and modified from (809))

MyD88-dependent signalling pathways

MyD88 has a Toll/IL-1R (TIR) domain in its C-terminal region and a death domain

(DD) in its N-terminal region (758, 759, 818). Upon ligand recognition by TLRs, MyD88 is

96 recruited and associates with the cytoplasmic domain of TLRs through homophilic interaction between the TIR domains. The DD of MyD88 then recruits IL-1R-associated kinase 4 (IRAK-4) and binds the DD of IRAK-4, leading to activation of IRAK-4 by phosphorylation. Activated

IRAK-4 further recruits and phosphorylates IRAK-1, the signal from which is subsequently propagated via TNF-receptor-associated factor-6 (TRAF6) (823). TRAF6 activates transforming growth factor (TGF)--activating kinase 1 (TAK1).

TLR1/2, TLR2/6 and TLR4, but not TLR7 or TLR9, require a second adaptor molecule,

Mal/TIRAP, in addition to MyD88 (824, 825). This is recruited to the plasma membrane through its phosphatidylinositol 4,5-bisphosphate-binding domain, where it then can promote delivery of MyD88 to activated TLR4 (826).

The signalling pathway can bifurcate at TAK1. TAK1 phosphorylates IKK-, leading to ubiquitination and degradation of I-B and subsequent nuclear translocation of NF-B. TAK1 also activates components of the MAPK cascade, such as p38 and JNK, through phosphorylatation of MAPK kinase 6 (MKK 6), leading to activation of factors such as AP-1 and IRF-5 which bind IFN-stimulated response element (ISRE) motifs in the promoter regions of numerous cytokine genes. Activation of the transcription factors ultimately results to induction of genes relevant to inflammatory responses, including TNF-, IL-1, IL-6, IL-12, IL-

18 and COX-2 (758, 759, 818, 827).

In addition to p38 and JNK MAPK, ERK1 and ERK2 are also activated downstream of the MyD88-dependent pathway via activation of Cot/Tpl2, a member of the MAPKKK family which phosphorylates MEK1/2 (828, 829). Although activation via all TLRs activates NF-B and MAP kinases, there are differences in the ultimate gene expression profiles resulting from activation of individual TLRs. The divergence of adaptor proteins that are differentially recruited provides the first indication of the molecular basis of this specificity (761).

MyD88-independent signalling pathways

TLR3 and TLR4 signalling is mediated through two TIR-containing adaptor molecules:

TRIF and TRAM. TRIF is essential for MyD88-independent signalling leading to induction of

97 IRF-3, and subsequent production of IFN- (830). TRIF interacts with TRAF3 to activate the

TRAF-family-associated NF-kB activator (TANK)-binding kinase 1 (TBK1) and IKKi, a non- canonical inhibitor of NF-B (IB) kinase (831). In turn, these kinases directly phosphorylate

IRF-3 and IRF-7, allowing them to translocate into the nucleus where they induce type I IFNs and IFN-inducible genes (832).

The IRFs are a family of transcription factors involved in induction of type I IFNs and in responses to IFNs (833). IRF3, IRF5 and IRF7 are functional signalling transducers (834).

IRF3 is expressed constitutively in various cells, whereas, IRF7 is inducible in most cells in response to IFNs and viral infection (759). Since induction of IFN-/ requires IRF-3 and IRF-7

(835), TRIF appears to play a central role as the adaptor molecule that enables TLR3, and TLR4 to generate IFN-/. Secreted IFNs participate in an autocrine/paracrine loop leading to production of a secondary set of genes involved in antiviral and antimicrobial responses (836).

TRIF can also interact with receptor-interacting protein 1 (RIP1) and TRAF6, to co-operatively activate NF-B to induce a late phase cytokine response (837, 838). TLR3-signalling only requires TRIF. TLR4 also uses TRAM to recruit TRIF to induce a MyD88-independent type-1

IFN response (831). TRAM is specifically involved in TLR4-signalling and is considered as a bridging adaptor between TLR4 and TRIF.

1.10.2.2. Lipopolysaccharide-mediated activation

Gram-negative bacterial cell walls compose an inner membrane (cytoplasmic membrane) of a double layer of phospholipids and lipoproteins overlaid by a thin layer of peptidoglycan in the periplasmic space. The periplasmic space is covered by an outer membrane, composed mainly of lipopolysaccharide (LPS), phospholipids, porins and lipoproteins (827).

These structures protect bacteria from bile salts, hydrophobic antibiotics and complement activation, and are crucial for bacterial survival. LPS is the main component of the outer leaflet of the outer membrane. Its structure is often unique to specific bacterial strains (839-841).

98 LPS, also known as endotoxin, consists of three covalently-linked regions; lipid A, core oligosaccharide, and an O-linked side chain. Lipid A consists of six fatty acyl chains linked to two glucosamine residues. When released from Gram-negative bacteria, LPS tends to form aggregates that poorly activate the host immune system (842). For recognition of lipid A, LPS- binding protein (LBP), a serum glycoprotein (843), is required to convert oligomeric micelles to a monomer for delivery to CD14, another LPS binding protein (844). CD14 has two forms: membrane-bound (mCD14) and circulating (sCD14) (845). mCD14 is expressed on myelomonocytic cells, whereas sCD14 helps to convey LPS signalling to cells lacking membrane-bound CD14, such as EC and epithelial cells. CD14 was initially thought to be a receptor for LPS, but subsequent studies revealed that the actual signalling receptor is TLR4

(779). However, for effective LPS signalling, TLR4 requires another molecule, MD-2. This is a secreted glycoprotein which acts as an extracellular adaptor to bind LPS. MD-2 associates with the extracellular leucine-rich repeats (LRR) of TLR4. Thus, recognition of LPS occurs largely by the aggregation of the TLR4-MD2-CD14 complex (846).

LPS binding triggers transcriptional activation of LPS-responsive genes, such as cytokines (TNF-, IL-1, IL-6, IL-8, IL-12, etc), chemokines, other biological response mediators including IFN-, platelet-activating factor (PAF), COX-2, enzymes, and inducible nitric oxide synthase (iNOS), and other transcription factors (reviewed in (433, 847)).

LPS is a strong inducer of the S100A8 gene, and LPS-activated macrophages are the best-studied model of its regulation. However, precise mechanisms still require clarification because of the complexity of signal transduction and the numerous effects of LPS on macrophages. In cells where S100A8 mRNA is inducible, the time for maximal induction varies with the stimulant, probably depending on the early gene products induced and sometimes takes well over 8 hours for maximal expression. Murine fibroblasts (NIH3T3) activated with FGF-

2+heparin express S100A8 mRNA after 8 hours, is maximal at 20 hours, and then gradually declines (378). With IL-1 the increase is more gradual and maximal at 32 hours and declines over 48-52 hours (378). Similar kinetics are seen with the murine macrophage cell line (RAW

99 264.7) cells stimulated with LPS (94). The delayed response suggested a requirement for de novo protein synthesis. This is supported by the following facts: cycloheximide (CHX) completely abrogated responses (94, 378) and IL-10 markedly decreased the time required for maximal S100A8 mRNA induction by LPS in RAW cells. Inhibition of endogenous IL-10 by anti-IL-10 mAb strongly reduced S100A8 mRNA levels (94). Similarly, murine S100A8 is up- regulated by TNF- and oxidative stressors such as UVA and hydrogen peroxide in keratinocytes (412) (Table 1-23), and its expression is enhanced by IL-10. Thus IL-10 is one de novo protein enhancing S100A8 induction in macrophages and keratinocytes but not fibroblasts.

COX-2 and its downstream metabolites, PGE2 and cAMP are also candidates in macrophages because COX-2 inhibitors reduce S100A8 mRNA levels and the metabolites enhance (94).

These results suggest involvement of at least two major pathways contributing to optimal

S100A8 expression in macrophages and possibly other cell types.

It is important to note that some stimulants have synergistic effects, but do not directly induce S100A8. For example, IL-10 or PGE2/cAMP synergize with LPS to markedly enhance

S100A8 mRNA expression in murine macrophages, and IL-10 and PGE2 together do not induce

S100A8 (Hsu K, unpublished observation). Co-treatment with neutralizing anti-IL-10 antibody and COX-2 inhibitors inhibits LPS-induced S100A8 mRNA by ~91%, and inhibition is additive of the individual treatments (407). These results suggest that additional mediators may be involved in S100A8 gene regulation downstream of activation of TLR4 in macrophages.

Activation of macrophages by LPS activates the MAPK pathways. Selective inhibitors of ERK kinase (PD98059) and p38 MAP kinase (SB202190) reduce LPS-induced S100A8 mRNA in macrophages, suggesting their involvement (93). However, it is not clear if the

MAPK pathway is only required for de novo synthesis of IL-10, or induction of other genes.

Interestingly, p38-specific inhibitors suppressed LPS-induced IL-10 production, whereas a specific inhibitor of ERK did not (848), suggesting that the p38 pathway may be common to IL-

10 and S100A8 gene induction, whereas the ERK pathway may be specific and essential for

100 S100A8. Likewise, inhibitors of ERK and p38 MAPK suppress FGF-2+heparin induced

S100A8 mRNA in murine fibroblasts (378), suggesting common key pathways.

To date, involvement of the JNK pathway in S100A8 gene regulation is unclear.

Generally pro-inflammatory cytokines mostly mediate AP-1 induction through JNK and p38

MAPK cascades (849). Activated JNKs translocate to the nucleus (850), where they phosphorylate c-Jun and thereby enhance its transcriptional activity (851). The JNKs also phosphorylate and potentiate the activity of ATF2, which heterodimerizes with c-Jun to bind divergent AP-1 sites in the c-jun promoter (852). Interestingly, S100A8/S100A9 transcription may be negatively controlled by these subunits of AP-1 in keratinocytes (342, 742) (see Section

1.9.2.2). Promoter analysis suggests that AP-1 may not directly regulate S100A8 however it is possible that AP-1 may regulate expression. Detailed analysis of the mechanisms involving this pathway in LPS-induced responses is required.

The NF-B pathway is indirectly activated by TLR4 signalling. There are no reports concerning involvement of NF-B in S100A8 induction. The murine S100A8 gene has no consensus sequences for NF-B binding, and deletion analysis of the promoter region shows that an inhibitor of NF-B (Bay 11-7082) does not affect activity although this reagent inhibits

S100A8 mRNA induction (Hsu K unpublished results). Thus NF-B may be required to produce other mediators essential for optimal S100A8 expression. However, in LPS-activated macrophages, S100A8 induction is enhanced by IL-10 which suppresses NF-B signalling (see

Section 1.10.3.1).

Thus, the S100A8 gene could be regulated indirectly, as a consequence of TLR4 signalling. Additional support for this is that S100A8 mRNA induction by LPS is enhanced by

PMA, a general PKC activator, and reduced by PKC inhibitors and by inhibitors of PKA, suggesting involvement of PKC and PKA (93). Effects of type I IFNs on S100A8 gene regulation are not determined.

Exogenous cAMP also synergistically enhances S100A8 induction in LPS-stimulated macrophages, whereas cAMP alone only slightly induces S100A8 (93), suggesting involvement

101 of purinergic signalling. PGE2, also enhances S100A8 induction and is secreted from LPS- stimulated macrophages and can activate its own G-protein coupled receptor.

These are all potential mechanisms of enhancement that involve in de novo protein synthesis downstream of LPS stimulation and more precise characterization is required. The gene regulation and signal transduction pathways of these “enhancers” are presumably similar to those required for the induction pathway, both of which are essential for full S100A8 expression of S100A8, At least one “enhancer” must be expressed under the same conditions required for “induction”.

1.10.2.3. DNA and single-stranded RNA mediated macrophage activation

TLR9 was first recognized as the major receptor for bacterial DNA (853). The specific nucleic acid ligand, which is relatively infrequent in the vertebrate genome, is the unmethylated

CpG dinucleotide within a species-specific base context (commonly referred to as a CpG motif).

Stimulation with CpG-motif-containing DNA provokes host defenses against various bacteria

(854-856). Similarly, TLR7 and TLR8 are highly homologous and these recognize single- stranded RNA (ssRNA) (831). In humans, blood DCs contain two subsets, myeloid (mDC) and plasmacytoid dendritic cell (pDC) (857-859). mDCs express TLR1, 2, 3, 4, 5, and 8, whereas pDCs exclusively express high levels of TLR7 and TLR9 (860-864). The latter are located in the late endosome/lysosome, where CpG DNA is found following nonspecific uptake into cells (865, 866). This may explain why CpG DNA-induced activation of signalling cascades such as JNK and NF-B are delayed compared with LPS-induced activation of macrophages (789). Interestingly, activation of TLR7/8 and TLR9 induces pro-inflammatory cytokines and type-1 IFNs (831) even though signalling is MyD88-dependent and TRIF- independent. Upon nucleic acid recognition, MyD88, IRAK-1, IRAK-4, TRAF6, IKK1 and a precursor of (OPN) form a complex at the TIR domain of TLR7 and TLR9 (867-

872). This complex activates NF-B and AP-1 to induce pro-inflammatory cytokines, and

102 activate IRF-7 to induce type 1 IFNs, particularly IFN- (reviewed in (819)). Thus, MyD88,

IRAK-4 and TRAF6 complex is essential for both NF-B and IRF-7 activation (871, 873).

Treatment with unmethylated CpG-containing oligodeoxynucleotides (ODN) or bacterial DNA induces S100A8, but not S100A9 mRNA in murine macrophages (Hsu K in preparation). IL-10 and PGE2 are required for full induction, which peaks at 16 hours compared to the earlier expression of the IL-10 and COX-2 genes. Pharmacological manipulation indicates that p38 MAPK, JNK MAPK, PI3K and JAK pathways are essential for either IL-10 or COX-2/

PGE2 gene induction by CpG DNA, whereas only the ERK pathway was specific for S100A8 induction, because exogenous IL-10 and PGE2 failed to restore S100A8 expression suppressed by the ERK inhibitor (Hsu K in preparation). This also supports the notion that IL-10 and COX-

2 participate in an autocrine/paracrine loop contributing to S100A8 induction as a secondary gene.

1.10.2.4. Fibroblast growth factor-2 mediated activation

Fibroblast growth factors (FGFs) comprise a family of structurally-related heparin- binding proteins that exert pleiotropic effects on cells (874-877). FGFs are expressed by almost all tissues and play important roles in proliferation, mitogenesis, differentiation, angiogenesis, wound healing and embryo development (874, 878-882). FGFs bind membrane tyrosine kinase receptors, FGFR1-4, and their splice variants, with different affinities. FGFRs typically contain an extracellular ligand-binding domain and a highly-conserved intracellular signalling domain connected by a transmembrane region. Heparan sulphate proteoglycans (HSPGs) are present at the plasma membrane and act as low affinity ‘receptors’ to facilitate interaction of the ligand with FGFR (883, 884). Figure 1-13 shows the signalling pathways activated by FGF-2. Binding of FGF causes receptor dimerization and subsequent autophosphorylation of intrinsic tyrosine residues, leading to activation of specific signal transduction pathways including the three branches of the MAPK pathway, PI3K pathways the PKC- and Src associated pathways((883,

885) reviewed in (886)).

103

Figure 1- 13: Signalling pathways activated by FGF-2

(modified from (309))

In murine NIH3T3 fibroblasts, FGF-2 induces S100A8 mRNA maximally after 12 hours and this response is strongly enhanced and prolonged by heparin or IL-1. There is a requirement for de novo protein synthesis (378). The ERK and p38 MAPK pathways are apparently involved (378). Similar to the requirement for confluence in MEC for optimal gene induction (95), S100A8 induction by FGF-2 is maximal at confluence (378). This suggests involvement of mediators induced and/or enhanced in confluent cells, such as PKC (887) and/or PKR (888).

1.10.3. Enhancers of S100A8 gene induction

1.10.3.1. Interleukin-10

Interleukin-10 (IL-10) was originally called “cytokine synthesis inhibiting factor”, produced by murine CD4+ Th-2-type T cell clones that inhibited production of cytokines such as

IL-2 and IFN- by Th-1-cells (889). However, its expression profile and inhibitory effects have widened. It is expressed in various subsets of T cells, macrophages, monocytes, DCs, mast cells,

B cells, eosinophils, keratinocytes, epithelial cells and various tumor cell lines (890). 104 IL-10 belongs to the Class 2-helical cytokines, which consist of IL-10, IL-19, IL-20,

IL-22, IL-24 (Mda-7), and IL-26, type 1 IFNs and IFN-like molecules (limitin, IL-28A, IL-28B, and IL-29). These initiate a broad and varied array of signals that induce anti-viral states, modulate inflammatory responses, inhibit or stimulate cell growth, produce or inhibit apoptosis, and affect many immune mechanisms (891). Thus, IL-10 is a pleiotropic cytokine. Its main functions seem to be to limit and terminate inflammatory responses by virtue of blocking pro- inflammatory cytokine induction (eg reducing TNF-, IL-1, IL-12, IL-6 and GM-CSF)

(reviewed in (892)), inhibiting macrophage activation, and regulating differentiation and proliferation of T cells, B cells, natural killer cells and mast cells (893). IL-10 can decrease the severity of inflammatory processes in vivo. For example, it reduces disease activity in animal models of microbial sepsis (894, 895), and IL-10-/- mice acquire autoimmune manifestations of colitis due to an over-abundance of IL-12 and IFN- (896, 897), indicating the essential immunoregulatory role of IL-10. Lack of IL-10 is implicated in a number of inflammatory conditions such as sepsis, chronic arthritis, and inflammatory bowel disease.

IL-10 is a homodimer composed of two non-covalently associated 18 kDa subunits produced by a single gene. IL-10 gene homologues are found in numerous viral genomes and is highly homologous to an open reading frame in the Epstein-Barr virus genome, termed BCRF1

(898, 899). The viral IL-10 protein (BCFR1) shares many functional properties associated with cellular IL-10, suggesting that the virus may have acquired this gene as a means of suppressing host antiviral responses. Moreover, many tumors also acquire an IL-10-secreting phenotype that may allow malignant cells to evade cell-mediated immune defenses (900-902).

Induction of IL-10

IL-10 is induced in monocytes by a variety of stimuli, including Gram-positive and negative bacteria, bacterial exotoxins, LPS, TNF-, IFN- and certain viruses such as HIV-1

(903-907). In LPS-stimulated monocytes, induction of IL-10 is delayed relative to the pro- inflammatory genes such as TNF- and IL-1 (908). Expression in LPS-activated murine

105 macrophages may depend on the induced synthesis of at least one protein (909), or on a constitutively-expressed, labile protein that rapidly degrades following addition of CHX (909).

Activated macrophages release ATP that is promptly degraded to adenosine ((910), see

Section 5.1.4). Adenosine receptor activation can upregulate LPS-induced IL-10 (911-913), and adenosine enhanced IL-10 production by TNF--stimulated, or H2O2-stimulated human monocytes (914). Interestingly, factors that elevate cAMP may also upregulate IL-10 (915, 916) and may explain why catecholamines trigger human IL-10 production in monocytes via a cAMP-dependent pathway (917, 918).

p38 MAPK regulates IL-10 production (919) and although the ERK inhibitor had no effect (848), blocking ERK activation prevented histone phosphorylation and transcription factor binding to the IL-10 promoter (920). Additional studies are necessary to elucidate ERK involvement.

IL-10 production is also dependent on protein-tyrosine kinases and PKC activation in a murine cell line (921). Several transcription factors are implicated, including Sp1 (848, 909,

922), Sp3 (922), C/EBP and C/EBP (923), STAT3 (924), cAMP response elements (917,

918) and c-Maf (925). Induction is apparently independent of Rel proteins in macrophages (926,

927). Although, most promoters of pro-inflammatory cytokine genes contain functionally- important binding sites for Rel, C/EBP and AP-1 proteins (732, 928-932), these are not found in the IL-10 promoter. Rather, Sp1 may be a key regulator of IL-10 transcription (909).

IL-10 production is also regulated at the post-transcriptional level, including alterations in mRNA stability and translation efficiency (890, 933, 934). Potential mRNA-destabilizing sequences (AUUUA with A 1 U-rich sequences) are found in the 3’-untranslated regions of mouse and human IL-10 mRNA (898, 935, 936).

Interestingly, the promoter region of S100A8 shares similar transcription factor binding motifs with IL-10, such as C/EBP and SP1 (Section 1.9), suggesting that S100A8 could exploit a similar combination of transcription factors, resulting in simultaneous expression of these

106 proteins. In this line, the question of whether S100A8 can execute some of the anti- inflammatory properties attributed to IL-10 in LPS-activated macrophages is intriguing.

IL-10 induced signal transduction

The IL-10 receptor (IL-10R) heterotetramer complex is composed of four transmembrane polypeptides: two chains of IL-10R1 that bind ligand and two of IL-10R2 that initiate signal transduction, and is thought to be pre-assembled (891). Janus kinase-1 (Jak1) and

Tyk2 are constitutively bound to IL-10R1 and IL-10R2 chains, respectively (937-939).Upon binding by IL-10, Jak1 and Tyk2 are activated (940) by cross-phosphorylation of two tyrosine residues on the intracellular domain of IL-10R1 that mediate direct interaction of the transcription factor, signal transducer and activator of transcription (STAT), to the receptor complex (941). STATs exist as homodimers in the cytoplasm (942-946), and undergo conformational changes upon activation. (946). Among the genes activated by IL-10, there is no doubt that STAT3 is absolutely essential for its anti-inflammatory effects (947-949). Inhibition of LPS-induced gene expression requires JAK1 because IL-10 does not inhibit LPS-induced cytokine production in macrophages from JAK1-/- mice (950). Moreover, although IL-10 activates STAT1 in certain cell types, it is not required for inhibition of LPS-induced macrophage responses as STAT1-/- macrophages respond normally (951). The critical role for

STAT3 was confirmed by targeted deletion of the STAT3 gene in macrophages and neutrophils

(948).

Recently, several groups analyzed genes regulated by IL-10, by suppression subtractive hybridization (952), serial analysis of gene expression analysis (953) and cDNA- (408, 954) or oligo-based microarrays (955-959) in monocytes, macrophages or DCs of human or murine origin. Of 1600 genes that were upregulated by IL-10 in human monocytes using Hu95a

Affymetrix mRNA arrays (12,000 genes), S100A8 and S100A9 were highly upregulated; 1,300 genes were downregulated (958). It is difficult to make comparisons between studies because of differences in methods of detection, numbers of genes screened, and the threshold applied for

107 each study. However, some particular genes such as SOCS-3, protein tyrosine phosphatase nonreceptor type 1 (PTPN1) and versican were generally detected, and some sets of genes were shared between human monocytes and murine macrophages, whereas others were only detected in murine or human cells (reviewed in (960)). Thus the molecular mechanisms of IL-10 functions are still being revealed, but these studies give new insights into potential functions of

IL-10-regulated genes.

IL-10 and LPS-signalling

IL-10 inhibits a number of LPS-inducible genes in monocytes. IL-10 signalling does not directly interfere with LPS signalling but de novo protein synthesis is necessary to mount the anti-inflammatory response (961-963). Several transcription factors may be activated by IL-10, implicating multiple signalling pathways. Figure 1-14 shows the points in the pathway

Figure 1- 14: Interference of LPS-induced transcription of pro-inflammatory mediators by IL-10

IRAK1, 4, IL-1R-associated kinase types 1 and 4; AP-1, activated protein 1; IP-10, IFN-inducible protein 10 (adapted and modified from (960))

108 mediating LPS-induced transcription that may be affected by IL-10. IL-10 and LPS induce suppressor of cytokine signalling (SOCS)-1 and SOCS-3.

The SOCS family provides negative-feedback by interfering with the JAK-STAT signalling pathway (964). SOCS-1 is the major physiological inhibitor of IFN--, IL-10-, and

IL-4-induced signal transduction by binding to the activation loop of Jak kinases and physically preventing it from phosphorylating its substrates (965-968). SOCS-1 can interact directly with

IRAK1 in LPS-signalling (969), but it is unclear if these also mediate IL-10 effects. SOCS-3 does not block LPS-signalling but may inhibit IFN-mediated responses (960); forced expression of the SOCS-3 gene in myeloid cells markedly inhibits cytokine-induced activation of the

Jak/STAT pathway (964, 970, 971). SOCS induction and subsequent cytokine receptor inhibition may mediate many anti-inflammatory activities of IL-10.

Other anti-inflammatory activities of IL-10 may be explained by its ability to stabilize

IB (972) thereby preventing LPS-induced NF-B activation (973) by inhibiting IB kinase

(974), which, by phosphorylating the NF-B inhibitor IB, induces proteolysis of IB and release of NF-B. NF-B regulates expression of numerous pro-inflammatory cytokines suppressed by IL-10 (975). Suppression of NF-B activity is important as NF-B is activated by a diverse range of stimulants, including LPS, UV light, H2O2, IL-1 and TNF- (975, 976).

IL-10 may also cause transcriptional repression. Transcriptionally-active NF-B consists of p65/p50 heterodimers, but can be blocked by an excess of p50/p50 homodimers, which lack a transactivation domain, but bind the same recognition site (977). IL-10 can induce formation of p50/p50 homodimers (978) and upregulates a member of the IB family, bcl-3, which associates with nuclear p50 homodimers (955, 957). This association may recruit more transcriptionally-inactive p50/p50 homodimers to NF-B sites (reviewed in (979)).

Additional LPS-triggered pathways, such as those mediated by Bruton’s tyrosine kinase

(Btk) and phosphatidylinositol-3 kinase (PI3K)/Akt, may support NF-B activation. The effect of IL-10 on PI3K is controversial, but it may represses PI3K/Akt signalling thereby reducing

IKK and NF-B activation in some cell types (980). 109 Taken together, more characterization is required to pinpoint the IL-10-regulated genes that mediate the transcriptional repression described for IL-10.

1.10.3.2. Modulation of macrophage response by cAMP and PGE2

cAMP is a classic second messenger, and activates transcription via the cAMP-response element binding protein (CREB). The initial step is activation of adenylate cyclase at the cell membrane via activation of G-protein coupled receptors, including the PGE2 and purinergic receptors. Increased levels of cAMP bind the regulatory subunit of PKA, which is anchored in the perinuclear membrane. The PKA-cAMP complex releases the catalytic subunit of PKA which translocates to the nucleus, where it phosphorylates transcription factors, particularly

CREB. Phosphorylated CREB binds the response element (CRE), found in the promoter region of genes in which transcription is induced by cAMP.

COX-2 is a rate-limiting enzyme in prostaglandin (PG) biosynthesis, catalyzing conversion of AA to PGH2. There are two COX isoforms: COX-1 is constitutively expressed in most cells, whereas COX-2 is induced by stressors such as pro-inflammatory cytokines, ischemia, and mitogens (981, 982). Macrophages stimulated by LPS produce PGE2 (983), which upregulates cAMP and IL-10 generation (984-986). In murine macrophages, PGE2 does not, or very weakly initiates S100A8 gene expression. However, it synergizes with LPS or IFN- in a

COX-2-dependent manner (94). However, there is no obvious CRE binding region in the murine S100A8 promoter, although several copies of NF-1, Ets and C/EBP consensus sequences were located. C/EBP is also strongly associated with cAMP signalling, and its expression is intensified by cAMP (987-989). C/EBP-consensus binding sequences are conserved in the promoter regions of the murine and human S100A8 genes, suggesting its possible involvement. Alternatively, CREB may regulate S100A8 induction through other mediators/co-activators. For example, the promoter region of IL-10 has CRE where CREB binds (848), and factors that elevate cAMP may regulate monocytic IL-10 mRNA synthesis

(915, 916). Thus, elevation of cAMP may enhance S100A8 induction because of elevation of

110 IL-10.

1.10.3.3. Steroid hormones influence S100A8 gene expression

Steroid hormones, including glucocorticoid (GC), vitamin D, retinoic acid (vitamin A) and estrogen play crucial roles in growth, tissue development, and body homeostasis. Receptors for these comprise two categories: the GC receptor, a classic steroid receptor, and receptors for diverse hormones, such as thyroid hormone, vitamin D and retinoic acid. These represent the nuclear receptor (NR) transcription factors. GC binds the GC receptor in the nucleus and this binds a specific consensus sequence, the GC response element (GRE), typically located in enhancer regions of genes.

The synthetic GC analogue dexamethasone (DEX) induced S100A8 in a human macrophage cell lines (751) and directly induces S100A8 and S100A9 in human monocytes

(407). GCs are commonly used to treat allergic and autoimmune diseases by limiting expression of numerous inflammatory cytokines and other proteins associated with leukocyte migration and adhesion, primarily by suppressing gene transcription. GCs also enhance transcription of a limited number of genes, the products of which generally have anti-inflammatory effects (for review (990)). The effects of GC on murine S100A8 expression were established using DEX

(407), which did not directly induce S100A8 mRNA in macrophage but markedly enhanced levels stimulated by LPS. Synergy was counteracted by RU486, a synthetic anti-GC that competes for binding of DEX to GR. Similar results were obtained with the NIH3T3 fibroblasts and MEC.

In murine macrophages activated with LPS, S100A8 expression enhanced by DEX is suppressed by inhibitors of PKC, p38 and ERK1/2 (407), suggesting overlapping pathways in induction by LPS that are enhanced by DEX. Interestingly, effects of DEX are reliant on the IL-

10 and COX-2 pathways, possibly because of the requirement for IL-10. IL-10 promoter has putative binding sites for GRE and CRE (848); DEX may enhance IL-10 production, and elevated cAMP may also enhance S100A8 through PGE2. DEX did not alter the kinetics of the

111 LPS response; synergy was highest in macrophages pre-incubated with DEX for 21 hours and required new protein synthesis, including IL-10. Promoter analysis demonstrated that elements responsible for GC enhancement are located in the region from -173 to 0 bp upstream of the essential murine S100A8 promoter. This has no obvious GRE consensus sequences. It is possible that NF1 at position of -58 may be transactivated by the GC receptor in a manner similar to that described by Hebbar and Archer (991).

-estradiol and vitamin D3 did not influence S100A8 expression in LPS-activated macrophages (Hsu K, Geczy CL, unpublished results), but -estradiol induces S100A8 in MEC

(Geczy CL, unpublished observation). In addition, all-trans-retinoic acid inhibits pathologically-expressed S100A8 in human keratinocytes in vitro and in vivo (526, 992). NRs have a conserved modular domain structure and bind regulatory DNA elements in target genes as homodimers, heterodimers, or in some cases, as monomers; many NRs heterodimerize with the retinoid X receptor (RXR). Once bound to their specific response element, NRs recruit co- activator proteins, often coincident with displacement of co-repressor proteins; >100 co- activators of NRs have been identified (for review; (993)). Further studies are required to elucidate effects of these hormones on S100A8 gene induction.

1.10.4. Suppressors of S100A8 expression

Currently-known suppressors of S100A8 gene induction/expression are summarized in

Table 1-28.

Suppression is apparently dependent on the cell type and the stimulant. Calcium regulates transcription of a number of S100 genes (284, 994) and changes in Ca2+ mobilization via release from intracellular stores and/or the extracellular space may regulate S100A8 gene expression in macrophages. In LPS-activated murine macrophages, of extracellular

Ca2+, and inhibition of Ca2+ release from the endoplasmic reticulum (995) suppresses S100A8 induction (93). In human monocytes, constitutive expression of S100A8/S100A9 is

112 Table 1- 28: Suppressors of S100A8 gene induction/expression

Cell Type Induction Suppressors/ Inhibitors Reference Murine cell lines Fibroblast FGF-2+heparin, TGF-, cycloheximide, SB202190 (378) (NIH3T3 cells) IL-1 (p38 inhibitor) PD98059 (ERK inhibitor) Macrophages LPS IFN-** Hsu K** (RAW 264.7 cells) IL-4, IL-13 (94) Ly294002 (PI3K inhibitor)** (93) SB202190 (p38 inhibitor) PD98059 (ERK inhibitor) H89 (PKA inhibitor) Indomethacin (COX inhibitor) NS389 (COX-2 inhibitor) CHX LPS + DEX SB202190 (p38 inhibitor) (407) PD98059 (ERK inhibitor) H89 (PKA inhibitor) Indomethacin (COX inhibitor) NS389 (COX-2 inhibitor) RU486 (synthetic anti-GC) CpG** CHX, JNK inhibitor II, Hsu K** SB202190 (p38 inhibitor) U0126 (ERK inhibitor), LY294002 (PI3K inhibitor) AG490 (JAK-2 inhibitor), Indomethacin (Indo) NS398 (COX-2 inhibitor) Keratinocytes PMA Goedecke 6983 (PKC inhibitor), (342) (PMK-R3 cells) Goedecke 6976 (PKC inhibitor), DEX (PAM212 cells) UVA SOD+catalase (412) Murine primary cells Macrophages* TNF- or IFN- Actinomycin D (93) LPS, TNF-, Cycloheximide (93) IFN- LPS H-7 (PKC inhibitor), (93) Calphostin C (PKC inhibitor), Thapsigargin (ER Ca2+-ATPase inhibitor) LPS, IFN- PD98059 (ERK inhibitor) (93) SB202190 (p38 kinase inhibitor) EGTA, A23187, TMB-8 (Ca2+ influx blocker) IFN- U73122 (PLC inhibitor) (93) Keratinocytes UVA TEMPOL (412) Human cell lines Keratinocytes (HaCat IL-17 IL-4, IL-13 (753) cells) Human primary cells Monocytes TPA Ionomycin (calcium ionophore, (741) A23187), thapsigargin Keratinocytes IFN- retinoic acid (992) * Murine primary macrophages are elicited with thioglycolate. **Unpublished data from our laboratory. ER; endoplasmic reticulum, PLC; phospholipase C, TEMPOL; 4-hydroxy-tempo, SOD; superoxide dismutase

113 down- regulated by A23187 (741), which passively transfers extracellular calcium and triggers release from intracellular pools causing a calcium spike. It also inhibits the S100A8 gene induction in LPS-activated macrophages, whereas reduction of resting cytoplasmic Ca2+ levels with BAPTA-AM does not alter expression, suggesting that S100A8 gene induction in LPS-

2+ activated macrophages is modulated by mobilization of [Ca ]i from distinct intracellular stores

(93). Moreover, PKC may be involved (93) (see Section 1.10.2.2). These converging pathways could lead to phosphorylation of MAP kinases, an important event in stress-induced and inflammatory responses.

Interestingly, divergent pathways of S100A8 gene expression by LPS and IFN- are indicated from studies with thapsigargin, which causes influx of stored Ca2+ by inhibiting microsomal ATPases without producing inositol 1,4,5-trisphosphate (IP3). This only inhibited the LPS-induced response (93). In addition, S100A8 mRNA induced by IFN-, but not LPS, was suppressed by a PLC inhibitor and the resultant conversion of phosphatidylinositol-4.5-

2+ bisphospate to IP3 and mobilization of [Ca ]i (93). Therefore, the response induced by IFN- may be mediated by Ca2+-dependent PLC to generate PKC and activate MAPK, and may rely largely on constitutive factors, possibly via NF-kB or the Jak/STAT pathways. Taken together,

2+ S100A8 gene induction in activated macrophages is modulated by mobilization of [Ca ]i levels from distinct intracellular stores.

Expression of S100A8 is also suppressed by some growth factors, cytokines and ROS scavengers. For example, TGF- almost abolished S100A8 in murine fibroblast activated with

FGF-2, implying involvement of S100A8 in regulation of proliferation and differentiation (378)

(see Section 1.6.6). In murine keratinocytes, UVA-induced S100A8 is suppressed by anti- oxidants or a free radical scavenger (412). In LPS-activated murine macrophages, S100A8 induction is suppressed IL-4 and/or IL-13, particularly in combination. These induce

“alternative macrophage activation” (93) (see Section 1.6.6), implying restricted expression of

S100A8 in certain phenotype of macrophages. Interestingly, pre-incubation of IFN- abolishes

LPS-induced S100A8 in murine macrophages, despite IFN-’s ability to induce the gene (Hsu K

114 and Geczy CL unpublished data). Little is known concerning underlying mechanisms of suppression and these are currently under investigation in our laboratory. Identification of naturally-occurring inhibitors of S100A8, and studies of their interactions represent of another approach to clarify S100A8 function.

It is worthwhile emphasizing that, except for a few particular cases, results from pharmacological manipulation of gene induction using chemical inhibitors have been required to identify mechanisms to replace/complement approaches using siRNA or knockout/transgenic mice to manipulate gene expression, particularly because of the problems involved. These will be more fully explained in Chapter 5.

115 2 GENERAL METHODS

Suppliers of all reagents and equipments used in this project are listed in Appendix

(reagents and equipments).

2.1 General cell culture Cell culture medium

All cells were grown in appropriate culture medium (Table 2-1) containing 10% heat- treated bovine serum (56ºC, 30 minutes) filtered through 0.2-M Zetapore membranes, and maintained at 37ºC in 5% CO2 in air, and grown to confluence. Medium and mediators were only used if endotoxin levels were <20 pg/ml (chromogenic limulus amoebocyte assay;

Associates of Cape Cod) (378, 407). Specific details of each experimental condition are described in the corresponding sections.

General subculture for adherent cells

When adherent cells, such as NIH3T3, MCF-7 or 293FT cells were grown to confluence, cells were rinsed twice in Ca2+- and Mg2+-free Dulbecco’s phosphate- buffered saline (DPBS), and detached by incubating with 2 ml trypsin-ethylene-diamine-tetraacetate

(EDTA) solution (0.05% trypsin and 0.02% EDTA w/v in Ca2+-free DPBS) for 2 minutes in a

75 cm2 flask. Complete culture medium was added to arrest further tryptic digestion, cells centrifuged and seeded into a 75 cm2 flask for maintenance, or into wells of 24- or 48-well plates for stimulation. Table 2-1 describes the source of cells, details of medium/reagents used for culture, and the conditions for their subculture and stimulation. All cultures throughout the thesis were performed at 37ºC in 5% CO2 in air. Generally 24 hours after seeding, cells were activated with particular stimulants or transfected after replenishing with fresh culture medium.

For experiments using inhibitors, cells were generally pre-treated with inhibitors for 30 minutes, then untreated or stimulated for 24 hours, unless specifically detailed. Cell viability determined by Trypan blue exclusion was always >90-97%.

116 Table 2- 1: Culture conditions of cell lines

NIH3T3 cells RAW 264.7 cells THP-1 MCF-7 293FT Species Mouse Mouse Human Human Human Cell type Embryo fibroblasts Macrophage Acute monocytic Breast Emblionic kidney leukemia adenocarcinoma epithelial cell Origin ATCC CRL-1658 ATCC TIB-71 ATCC TIB-202 ATCC HTB-22 Invitrogen R700-07 Culture medium DMEM RPMI 1640 RPMI 1640 DMEM DMEM + 10% BCS + 10% BCS + 10% BCS + 10% FBS + 10% FBS + 2 mM L-glutamine + 2 mM L-glutamine + 2 mM L-glutamine + 2 mM L-glutamine + 2 mM L-glutamine + 3.7 g/L NaHCO3 + P/S + 1.5 g/L NaHCO3 + 1.5 g/L NaHCO3 + 1.5 g/L NaHCO3 + 1.0 mM Na pyruvate + 1.0 mM Na pyruvate + 1.0 mM Na pyruvate + 0.1 mM NEAA + 4.5g/L glucose + 0.05 mM -ME + 0.1 mM NEAA + 500 g/ml Geneticin + P/S + P/S + P/S + P/S Culture vessel 75 cm2 flask (Nunc) ø10 cm Petri dish 75 cm2 flask (Nunc) 75 cm2 flask (Nunc) 75 cm2 flask (Nunc) (Falcon) Culture volume 20 ml 20 ml 20 ml 20 ml 15 ml Inoculated cell numbers at subculture 1.5×106 / flask 1.5×106 / dish 0.7×106 / flask 1.5×106 / flask 1.0×106 / flask Subculture every 3-4 days every 3-4 days every 3-4 days every 3-4 days every 3-4 days interval Inoculated cell density on well of plate (cells/well) 24-well plate 0.8×105 / 500 l 1.5×105 / 500 l (Nunc) 3.0×105 / 500 l (Nunc) (Griner) 48-well plate 1.0×105 / 300 l (Nunc) 96-well plate 0.34×105 / 100 l (Nunc) ø10 cm TC dish 6.0×106 / 15 ml (Nunc) Cryopreservation Culture medium + 10% Culture medium + 10% Culture medium + 5% Culture medium + 5% Culture medium + 10% medium DMSO DMSO DMSO DMSO DMSO ATCC, American Type Culture Collection; P/S, 100 U/ml penicillin+ 100 g/ml streptomycin; BCS, heat-treated bovine calf serum; FBS, fetal bovine serum; NEAA, non-essential amino acids, Na pyruvate, sodium pyruvate; -ME, -mercaptoethanol; TC dish, tissue culture dish; (Supplier)

117 Cell cryopreservation and revival

For storage, all cell lines were suspended in 5 or 10% dimethylsulphoxide (DMSO) in the appropriate culture medium at ~2.0×106 cells/ml (Table 2-1). Aliquots of 1 ml were dispensed into 2 ml sterile Cryo tubes which were left to freeze at -80ºC overnight and then transferred to liquid nitrogen for long-term storage. Tubes containing frozen cells were taken from liquid nitrogen when required, rapidly thawed at 37ºC, transferred into a Falcon tube containing 10 ml appropriate culture medium at 37ºC and centrifuged (1200 rpm, 5 min) at room temperature to remove DMSO. Cells could be maintained for up to 5 to 15 passages without losing the ability to express S100A8 mRNA in response to the stimulants outlined. Cell viability determined by Trypan blue exclusion was generally >90-97%.

Specific conditions for cell lines

Induction of S100A8 by FGF-2 in NIH 3T3 cells varies among batches of bovine calf serum used (Rahimi F unpublished observation), presumably because a yet-unidentified mediator(s) contained in the serum is involved in S100A8 regulation. For the sake of simplicity, bovine calf serum (HyClone Laboratories, batch #8455) was used for NIH3T3 culture throughout the thesis.

RAW 264.7 macrophage-like cell line was a gift from Dr. D. Hume (University of

Queensland, Brisbane, Australia). Cells were grown to subconfluence in 10 cm Petri dishes

(Falcon), and then flushed with culture medium to lift the cells from the bottom of the dish, cells centrifuged and subcultured in 10 cm Petri dishes for maintenance, or seeded onto 24-well plates for stimulation. Unless otherwise stated, RAW cells were activated with stimulants for 24 hours. For neutralizing antibody experiments, 96-well plates were used. For protein analysis, cells in 48-well plates were stimulated with appropriate stimulants for 36 hours.

THP-1 monocytoid cells were grown to subconfluence; when numbers reached ~8×105

/ml, they were centrifuged and subcultured in 75 cm2 flasks for maintenance, or seeded into 24- well plates for stimulation.

When confluent, MCF-7 breast cancer cell line were subcultured in 75 cm2 flasks for

118 maintenance, or seeded into wells of 48-well plates for stimulation.

The 293 cell line is a permanent line established from primary embryonal human kidney transformed with sheared human adenovirus type 5 DNA (996, 997). The E1A adenoviral gene is expressed in these cells and participates in transactivation of some viral promoters, allowing these cells to produce very high levels of viral protein. The 293FT cell line is a fast growing variant of the 293 cell line, and stably expresses the SV40 large T antigen from the pCMVSPORT6TAg.neo plasmid. Expression of the SV40 large T antigen is controlled by the human cytomegalovirus (CMV) promoter at a high-level and is constitutive (998). 293-FT cells are suitable hosts for generating lentiviral constructs. When confluent, cells were subcultured into 75 cm2 flasks for maintenance, or seeded into 10 cm tissue culture dish (Nunc) for generation of lentivirus. For virus generation, 24 hours after seeding, cells were transformed with lentiviral constructs after replenishing with fresh culture medium.

Specific and non-specific inhibitors

Specific and non-specific inhibitors used in this project are summarized in Table 2-2.

Table 2-2: Specific and non-specific inhibitors unsed in this project

Pathway inhibitors Actions Reference SB 202190 A highly selective, potent and cell permeable inhibitor (999) (1000) of p38 MAP kinase. SB 202190 binds within the ATP pocket of the active kinase, and selectively inhibits the p38 and isoforms. PD 98059 Specific inhibitor of the activation of mitogen- (1001) (1002) (1003) activated protein kinase kinase (MAPKK). U0126 A potent and specific inhibitor of MEK1 and MEK2. (1004) (1005) (1006) The inhibition is noncompetitive with respect to both ATP and ERK. JNK inhibitor II A potent, cell-permeable, selective, and reversible (1006) (1007) (1008) (SP600125) inhibitor of JNK. The inhibition is competitive with respect to ATP. 2-Aminopurine A potent, cell-permeable inhibitor that competes for (1009) (2-AP) ATP at the ATP-binding site of PKR and thereby inhibits autophosphorylation Diphenyleiodonium A potent and reversible inhibitor of nitric oxide (1010) (1011) chroride (DPI) synthetase from macrophages and endothelial cells. Also inhibits other flavoenzymes such as neutrophil NADPH oxidase Apocynin A cell-permeable, anti-inflammatory phenolic (1012) (1013) compound that inhibits superoxide production by

119 NADPH oxidase, probably by inhibiting its assembly by blocking free sulfhydryl groups. TEMPOL A free radical scavenger and superoxide dismutase (1014) (1015) (1016) mimic (1017) Superoxide Catalyzes the dismutation of superoxide radicals to (1018) (1019) (1020) dismutase (SOD) hydrogen peroxide and molecular oxygen. Catalase Activates the decomposition of hydrogen peroxide, (1021) Natural antioxidant used to study roles of reactive oxygen species in gene expression. N-Acetyl-L-cysteine Antioxidant and mucolytic agent. Increases cellular (1022) (1023) (1024) pools of free radical scavengers. (1025) Carbonyl cyanide 3- Protonophore (H+ ionophore) and uncoupler of (1026) (1027 {Biswas, chlorophenylhydrazo oxidative phosphorylation in mitochondria. 1999 #2369) (1028) ne (CCCP) (1029) (1030) (1031) (1032) Antimycin A Inhibitor of electron transfer at complex III. (1033) (1034) (1035) CGP 37157 Selective antagonist of the mitochondrial Na+-Ca2+ (1036) (1037) (1038) exchanger (1039)

2.2 RNA purification

RNA extraction from cells cultured in 24-well plates

Adherent cells grown as monolayers were lysed directly in 24-well plates with 0.3 ml

Trizol reagent. When grown in suspension, cells were pelleted and lysed in 0.3 ml Trizol. After pipetting up and down, lysates were transferred to autoclaved Eppendorf tubes (1.7 ml), and 30

l 1-bromo-3-chloropropane added, tubes vigorously shaken for 15 seconds and left at room temperature for 3 minutes, then centrifuged at 12,000 g for 15 minutes at 4°C, for separation into a phenol-chloroform phase, an interphase, and upper aqueous phase containing RNA, which was transferred to a fresh tube. In the case of primary cells, 5 g glucogen was added to the aqueous phase. RNA was precipitated by mixing with an equal volume isopropyl alcohol, incubating at room temperature for 10 minutes, then centrifugation at 12,000 g for 15 minutes at

4°C. RNA pellets were rinsed once with 0.5 ml 75% ethanol, air-dried and dissolved in double- autoclaved distilled water (ddH2O) at 55 °C for 10 minutes, then stored at 20 °C or quantitated by spectrophotometry at A260 nm.

RNA extraction and cDNA synthesis from cells cultured in 96-well plates

For adherent cells grown in 96-well tissue-culture plates, RNA extraction and cDNA synthesis were performed using a modified protocol from SuperScript III Cells Direct cDNA

120 Synthesis System from Invitrogen. Briefly, at harvest, media was aspirated, cells washed with

100 l DPBS, and 18.2 l Resuspension Buffer and 1.8 l Lysis Enhancer solution added to each well. Plates were incubated on ice for 10 minutes, then cells detached by pipetting up and down, and then 5 l cell suspension was transferred to a 0.2 ml thin-walled PCR tube on ice.

Tubes were transferred to a thermal cycler preheated to 75°C for 10 minutes, and cell lysates treated with 1.3 l Turbo DNase and 0.7 l 10×Turbo DNase Buffer to degrade any contaminating DNA, and incubated for 8 minutes at 25°C. Subsequently, 0.8 l 25 mM EDTA was added to each tube on ice, and samples incubated at 70°C for 10 minutes to inactivate

Turbo DNase. Following DNA elimination, first-strand cDNA synthesis was carried out immediately by adding 10 l 2RT reaction and 1 l RT enzyme mix. The reaction mixture was transfered to a thermal cycler preheated to 25°C for 10 minutes, then incubated at 50°C for 20 minutes and the reaction was inactivated at 85°C for 5 minutes. To eliminate RNA templates,

0.5 l RNase H (2 U/l) was added to each tube and incubated at 37°C for 20 minutes. Single- stranded cDNA was stored at –20°C.

2.3 Real-time quantitative PCR

Total RNA (1 g) from cultured cells was treated with DNase 1 (Ambion, Austin TX) and reverse transcribed using random hexamers and the SuperscriptIII First-Strand Synthesis

System for RT-PCR (Invitrogen). Negative controls (no first strand synthesis) were prepared by performing reverse transcription reactions in the absence of reverse transcriptase. PCR amplification was performed with Platinum SYBR Green qPCR SuperMix UDG (Invitrogen).

Reactions were performed in duplicate, and contained 2SYBR Green qPCR SuperMix, 1 l template cDNA or control, 100 nM primers (Table 2-3) in a final volume of 25 l, and analyzed in 96-well optical reaction plates (Applied Biosystems, Foster City, CA). Reactions were amplified and quantified using an ABI 7700 sequence detector with standard cycle conditions and the Applied Biosystems software. Relative quantities of mRNA in duplicate samples were obtained using the comparative CT method and normalized against murine hypoxanthine- guanine phosphoribosyltransferase (HPRT) or human  actin as endogenous controls.

121 Table 2- 3: Primers and conditions used for Real-time RT-PCR amplification

Gene Forward primer sequences (5’ primer) Reverse primer sequences (3’ primer) Mouse COX2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC HPRT AACAAAGTCTGGCCTGTATCCAA GCAGTACAGCCCCAAAATGG IL-10 ACCTGCTCCACTGCCTTGCT GGTTGCCAAGCCTTATCGGA iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC S100A8 CCGTCTTCAAGACATCGTTTGA GTAGAGGGCATGGTGATTTCCT S100A9 ATACTCTAGGAAGGAAGGACACC TCCATGATGTCATTTATGAGGGC Human S100A8 GGGATGACCTGAAGAAATTGCTA TGTTGATATCCAACTCTTTGAACCA S100A9 GTGCGAAAAGATCTGCAAAATTT GGTCCTCCATGATGTGTTCTATGA S100A12 CTGCTTACAAAGGAGCTTGCAA GGCCTTGGAATATTTCATCAATG actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

2.4 Dual luciferase reporter assay

Construction of the murine S100A8 promoter-luciferase-fused reporter plasmids was described previously (94) and reagents were available. RAW cells were transiently transfected as described (93) using 3.0104 cells/500 l seeded into 24-well plates (Nunc) 72 hours before transfection, and then 0.5 g luciferase reporter plasmid or 0.05 g reference plasmid (pRL-TK) was transfected in the presence of DEAE-dextran (Sigma; 300 g/ml). After 24 hours, cells were stimulated for 20 hours with the reagents indicated, and firefly and Renilla luciferase activities assayed with 15 l extract using Promega reagents according to the manufacturer’s instructions (Luciferase Assay System, Promega) and measured using a TD-20/20 Luminometer.

Results are expressed as mean ± SD of luciferase activity from 3 separate experiments.

Database searching (TFSERCH; http://www.cbrc.jp/research /db/TFSEARCH.html) was used to search putative consensus binding sequences of transcription factors in murine S100A8 promoter region.

2.5 Preparation of polyclonal antibodies

Antibodies raised in rabbit by multiple intradermal dorsal injections with purified recombinant murine S100-GST fusion proteins bound to nitrocellulose particles were used as described (701), and were available in the laboratory. Immunoglobulin G (IgG) from normal

122 rabbit serum and from anti-S100 sera was purified by Protein A Sepharose affinity chromatography according to the manufacturer’s instructions. To remove antibodies that were reactive with GST, the IgG was passed through a GST-absorption column (Amersham

Pharmacia Biotech), and 300 g aliquots were biotinylated using the EZ-Link Sulfo-NHS-LC-

Biotin Reagent (1040).

2.6 Western blot analysis

The presence of S100A8 protein in cell lysates were detected by Western blotting as described (410). Briefly, cells were washed twice with DPBS, and DPBS containing 5% NP-40,

50 mM Tris-HCl, pH 8.5, 20 mM iodoacetamide, 1% SDS and Complete Protease Inhibitor

Cocktail added, then cells lysed by pipetting up and down. Cell debris was removed by centrifugation (14000 rpm, 4°C, 10 minites). To normalize protein loading for semi-quantitative analysis, total protein levels were quantitated using the BCA Protein Assay Kit and 25 g protein from each sample was reduced with 100 mM dithriothrietol (DTT). Samples were heated at 100°C for 3 minutes, subjected to 10% SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes then membranes incubated overnight at 4°C in Tris buffer containing nonfat dried milk powder (5%, w/v) and Tween 20 (0.01%, v/v) to block non- specific reactivity. The membranes were incubated with anti-human S100A8 (1 g/mL) for 2 hours at room temperature with light agitation and reactivity detected with goat anti-rabbit-HRP and ECL chemiluminescence from Amersham Biosciences according to manufacturer’s instructions. Western blots were imaged using a Fujifilm LAS-3000.

2.7 Enzyme-linked immunosorbent assay (ELISA)

A double-sandwich ELISA was used to detect S100 proteins. Flat-bottom 96-well microtiter plates (Maxisorp; Nunc) were coated with 50 l 5 g/ml anti-murine S100A8 (701) in 0.05 M sodium carbonate buffer, pH 9.6, overnight at room temperature, then washed 3 times with PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.3) containing 0.05% Tween 20, with a multichannel pipette. Then, 7% skim milk in PBS with

123 0.1% Tween 20 was added for 2 hours at room temperature to block non-specific reactivity, then wells washed three times. Samples (100 l/well) were incubated for 2 hours at room temperature. Recombinant murine S100A8 proteins (final concentration, 50-1.56 ng/ml) diluted in PBS with 0.05% Tween 20 were included as standards. Recombinant murine S100A8 was prepared using the pGEX expression system (701) and was available from other studies in the laboratory. After 3 washes, 100 l biotinylated anti-S100 IgG (4 g/ml) was added and plates incubated for 2 hours at 37ºC, washed 3 times, and then incubated with a streptavidin- horseradish peroxidase conjugate (1:2,000 v/v) for 1 hour at 37ºC. After washing 3 times, plates were incubated with substrate (TMB chromogen) for 10 min at room temperature, and the color reaction stopped with 2N H2SO4, and A450 nm measured.

2.8 Statistical analysis

Values in figures are expressed as means ± the SD of the indicated number of observations. Statistical analyses were performed using the Student t test.

124 3 KNOCKDOWN OF S100A8 WITH RNA INTERFERENCE

3.1 Introduction

Functions of S100A8 have been partially characterized using various approaches, including pharmacological intervention and gene deletion in murine models. However, its role is not fully understood clinically, particularly as targeted disruption of the S100A8 gene is embryonic lethal (339). Attempts to silence the S100A8 gene would help to understand its role and provide new insights into whether S100A8 would be a target for therapeutic intervention in patients with inflammatory diseases and cancer. At present, S100A9-/- mice represent the only genetically-modified model reported that do not express S100A8 in neutrophils (Section 1.6.1).

Based on studies with these, some functions of the S100A8/S100A9 complexes are being clarified (242, 337, 338, 555), but these mice are not appropriate for investigating functions of

S100A8 in other cell types. This chapter will address the possibility of suppressing S100A8 mRNA using small interfering RNA (siRNA) technology. The aim would be to understand

S100A8 functions at the cellular level, and ultimately, to investigate its functions in chronic inflammation. We considered that the most appropriate target cells are activated monocytes/macrophages, in which S100A8 is highly expressed in inflammatory lesions and upregulated by several inflammatory mediators.

While exploring the possibilities to suppress the S100A8 gene using siRNAs, two major questions concerning an RNAi pathway that partially overlapped with S100A8-inducing pathways had to be solved. Therefore, as part of this project, induction of S100A8 by dsRNA

(Chapter 4) and by cell stressors (Chapter 5) were also simultaneously examined. Based on these results, a tumor cell line stably silencing the S100A8 gene was established using a lentiviral siRNA delivery system based on microRNA technology. Because this system only became available in the last 6 months of this project, results that are presented are preliminary and require follow-up. However, this project opens the possibility to suppress S100A8 gene in activated cells and provides a new insight into its potential involvement in RNA viral infection.

125 3.1.1 Small interfering RNA (siRNA)

RNA interference (RNAi) describes the phenomenon whereby short, homologous double-stranded RNAs induce potent and target sequence-specific inhibition of eukaryotic gene expression via degradation of complementary messenger RNA (mRNA). RNAi function in a similar manner to the processes of post-transcriptional gene silencing and quelling, and is itself an ancient defense mechanism against foreign genetic material. RNAi occur in a wide variety of eukaryotes, including yeast, fungi, plants, and animals. In evolution, the ability to recognize and destroy potentially nonself organisms and material, including foreign genetic material such as

RNA virus, is key to self protection. In addition, mechanisms to protect genomic instability caused by mobile genetic elements such as transposons and repetitive elements which produce dsRNA intermediates inside the cell are important (1041-1043). Therefore, RNAi is considered an important defense mechanism protecting the host from aberrant gene expression.

3.1.2 History of siRNA and microRNA

In 1998, Craig Mello and Andrew Fire, were awarded the Nobel Prize for the discovery of RNAi (1044). They showed that dsRNAs caused more potent sequence-specific silencing than their single-stranded RNA counterparts in the nematode Caenorhabditis elegans.

In 2001, the breakthrough by Elbashir, et al demonstrated that synthetic double-stranded 21-bp siRNAs transfected into mammalian cell lines mimicked the effects of RNAi (1045, 1046).

Initially the important conceptual advance was thought to be that these 21-mer siRNA molecules were short enough to bypass mechanisms that triggered IFN responses leading to altered in cell metabolism (1047). Since that time, introduction of synthetic double-stranded 21- bp siRNAs has been a powerful tool to selectively manipulate gene expression in adult mammalian cells and nowadays is widespread. In 2004, FDA approved the first clinical trials using RNAi, at the time that this project, to suppress murine S100A8 mRNA using siRNA technology, began.

MicroRNA (miRNA) technology was developed as a tool for siRNA strategies, because engineered miRNAs cleave target mRNA in a manner similar to siRNA. miRNAs are

126 small non-coding RNAs (19–25 nt), that do not encode protein; naturally-occurring miRNAs regulate genes at the post-transcriptional level in many eukaryotic cells. These bind target mRNAs to suppress translation. Small RNAs which altered temporal development were first described in C. elegans (1048, 1049). In 1993 it was demonstrated that lin-4 in C. elegans, which regulates temporal development, is processed from a hairpin formed within its transcripts, causing repression of its target mRNA by binding to complementary sites within the 3’- untranslated region (UTR) via imperfect base pairing (1050, 1051). Although these publications were considered as elegant and interesting, they were regarded as a worm-specific oddity (1052).

In 2000, another regulator of developmental timing in C. elegans, let-7, was also found to be a small non-coding RNA (1053), and importantly, its sequence and expression pattern was conserved in mammals (1054). Since then, numerous small RNAs in this class have been identified by cloning and bioinformatics-prediction strategies (1055-1057), and are now termed miRNAs. In humans, 1000 or more are predicted to function, possibly regulating ~30% of genes

(1058-1060). To date, 450 human miRNAs have been identified, each one possibly regulating

100-200 target mRNAs (1061, 1062). miRNAs regulate crucial processes, such as cell proliferation (1063), apoptosis (1064), development (1065), differentiation (1066) and metabolism (1067). Expression of many miRNAs is specific to particular tissues or developmental stages, and miRNA profiles are altered in several human diseases (reviewed in

(1068)).

3.1.3 Mechanism of siRNA and miRNA function

RNA interference is initiated in cells by introduction of synthetic double-stranded siRNA. Figure 3-1 shows a model of siRNA function. In the cytoplasm, it associates with the multi-component RNA-induced silencing complex (RISC) consisting of several proteins, which in human cells, include Dicer, Argonaute protein 2 (Ago-2), HIV-1 transactivating response

RNA-binding protein (TRBP), protein activator of protein kinase R (PACT) and, possibly, others yet unidentified (1069). The sense (passenger) strand of the siRNA is then cleaved by

Ago-2 within the active RISC (1070), and is removed. The selection of the strand appears to be

127 determined by the relative thermodynamic stability of the 5’ or 3’ end of the RNA duplex (1071,

1072). Molecular mechanisms involved in RISC activation are unclear. The anti-sense (guide) strand associated with mature RISC guides the complex to the corresponding mRNA according to sequence homologies, and Ago-2 nuclease then cuts the target mRNA at a position corresponding to nt 10–11 from the 5’ end of the anti-sense guide strand. The cleaved mRNA is rapidly degraded, leading to gene silencing (reviewed in (1073)).

Anti-sense (guide) strand Sense (passenger) strand

Cleavage of sense strand

Cleavage of target mRNA

Figure 3- 1: RNA interference

(modified from (1073))

Although RNAi is a natural phenomenon, in mammalian cells long dsRNA (>30 bp) induces an IFN response which is rapid and near universal. This response represents the first line of host defense against lower organisms such as viruses and results in non-specific global cessation of protein synthesis, leading to cell death (1074). Type I IFNs comprise a family of cytokines of at least 12 IFN- isoforms and one IFN- in the mouse (1075, 1076). Most cells mount a modest response to initial viral infection by producing low quantities of IFN- and

IFN-4. This response uses pre-existing cell components, whereas augmented production of the

IFN- genes requires feedback-dependent induction by additional components, including IRF7

128 (1077). Fibroblasts produce IFN levels similar to other cell types and this is augmented by IRF7

(1078).

The failure to induce specific RNAi suppression in certain cells, with long dsRNA molecules, is attributed, at least in part, to activation of dsRNA-dependent protein kinase (PKR) with resultant IFN production (1079). siRNAs can activate PKR in vitro with corresponding stimulation of Jak-STAT signalling and changes in expression patterns of a number of IFN- regulated genes (1080, 1081). Activated PKR phosphorylates a subunit of eukaryotic initiation factor 2 (eIF2) (1082) and this mediates subsequent inhibition of protein synthesis. Thus, PKR activated by siRNA contributes to induction of the IFN response and inhibition of protein synthesis.

siRNA synthesized using the T7 bacteriophage RNA polymerase system triggers IFN-

/ induction in several cell lines. This is due to short single-stranded RNAs transcribed with T7 polymerases. Unlike capped mammalian mRNA, the 5’ ends of T7 transcripts have a triphosphate GTP nucleotide at their 5’ end. Treatment of T7 transcripts with RNase T1 and alkaline phosphatase to remove the 5’ end p-GGG was sufficient to abrogate IFN-inducing activity, suggesting a crucial role for a single-stranded T7 transcript in type I IFN induction

(1083). The IFN-inducing effect is also dependent on the sequence (1084-1086) and the dose of siRNA (reviewed in (1087)). An alternative to using siRNAs produced by this system is chemically-synthesized siRNA; optimal doses of exogenous 21-mer RNA duplexes can suppress gene expression in mammalian cells without triggering IFN responses (1046).

A great number of human miRNAs are present in introns of coding genes and introns and exons of non-coding transcripts (1088), and are transcribed by RNA polymerase II (pol II) as long precursor transcripts, known as primary miRNAs (pri-miRNAs) (Figure 3-2). Pri- miRNAs are capped and polyadenylated like other pol II transcripts, and can be up to several kilobases long (reviewed in (1089, 1090)). One third of all pri-miRNAs lack open reading frames, suggesting that their main function is production of miRNAs. However, these transcripts are often spliced and the miRNAs are frequently located within their intronic

129 segments (1088). One pri-miRNA can contain several miRNAs, and within the pri-miRNA, the miRNA itself is

Figure 3- 2: A model for miRNA biogenesis and function

Details of the proposed mechanisms are discussed in the text (from (1091)).

contained within an approximately 60-80 nucleotide sequence that can fold back on itself to form a stem-loop hairpin structure via imperfect base pairing. Pri-miRNA is cropped in the 130 nucleus into an ~70 nt stem-loop RNA intermediate (pre-miRNA) by the microprocessor complex, the core components of which are the RNase-III enzyme Drosha ribonuclease bound to an RNA binding protein, known as DGCR8 in humans (1092). The pre-miRNA is then ferried by the nuclear export factor exportin 5 into the cytoplasm (1093, 1094), and further cleaved by the cytoplasmic ribonuclease III enzyme, Dicer to generate imperfectly-matched double-stranded 18–24 nucleotide RNA molecules, miRNAs. One strand of this mature double- stranded miRNA becomes a guide strand and is incorporated into RISC for gene silencing, the other (passenger strand) is discarded. An miRNA-armed RISC (miRISC) represents an effector complex that mediates miRNA function(s).

miRNAs associate with their mRNA by imperfect base pairing. This may preclude endonucleolytic cleavage of mRNA by miRISC, similar to what is observed with siRNA- mediated RNA interference. It is still unclear how the miRISC-mRNA complex triggers silencing. Unlike siRNAs, several miRISC complexes bind imperfectly to target mRNAs by forming a bulge sequence in the middle that is not suitable for RNA cleavage and these accumulate in processing bodies (P-bodies) and repress translation of the target (1095). Target recognition is by pairing to a 7-8 nt miRNA, and mRNA complementarity is commonly composed of matched nucleotides at positions 2 to 7 in target mRNA (termed the seed sequence) (1061, 1096, 1097). Targets of miRNA are poorly defined, because of the small number of nucleotides required for complementarity. Effective translational repression usually requires multiple imperfect sites recognized by the same, or by several different miRNAs. The molecular basis of this process is unknown (1090, 1098-1100). Translationally-repressed mRNA is either stored in P-bodies within the cytoplasm or enters the mRNA-decay pathway for destruction. Depending on cellular conditions and stimuli, stored mRNA can re-enter either the translation pathway or the mRNA-decay pathway (reviewed in (1091)).

3.1.4 Application of siRNA for S100A8 silencing

Several issues needed to be considered concerning the use of siRNA to suppress the

131 S100A8 gene because RNAi technology was new and delivery systems, such as transfection reagents, not universally established. We considered it to be most meaningful to examine functional changes as a consequence of its suppression in neutrophils and/or activated monocytes/macrophages, but these myeloid cells are generally difficult to transfect/transform.

The second issue was that the siRNA must over-ride the induction levels of S100A8 mRNA.

Except for neutrophils and trophoblasts in vivo (339), at the time of this work, no other murine cells were known to constitutively express S100A8. To understand the role of S100A8 in inflammation, macrophage stimulation would be necessary to induce the gene before it could be suppressed by siRNA. Most initial reports using siRNA show suppression of constitutively- expressed genes. Hence, as S100A8 is often strongly induced in response to stimulation, the balance between levels of mRNA induction and post-transcriptional gene silencing needed to be considered. A third issue was that the transfection process itself could modify S100A8 expression because this gene appears to be induced in response to cell stress. Finally, because

S100A8 plays a role in development and S100A8-/- mice do not survive past day 9.5 dpc (339), transfected cells may not survive when S100A8 is successfully suppressed.

3.1.5 Hypothesis

RNAi technology can suppress murine S100A8

3.2 Material and methods

3.2.1 Design of siRNAs to reduce murine S100A8

To design effective siRNAs, careful consideration of the target sequences is required. siRNAs may be ineffective if the sense strand is preferentially used by RISC, over the intended guide (antisense) strand. To avoid this, siRNA duplexes are usually designed to have lower thermodynamic stability at the 5’ end of the antisense strand (1071, 1072). This also reduces the likelihood of off-targeting by the sense strand. Even if the appropriate strand can be loaded, an siRNA may still be non-functional if the sequence within the target mRNA is inaccessible due 132 to secondary and/or tertiary structures, or is associated proteins (1101, 1102). Thus, several candidate siRNAs must be screened to identify effective silencers. Various web-based programs assist in selecting these, by identifying target sites that satisfy strand-biasing guidelines, and additional criteria that promote effective silencing and reduce off-targeting. Three publications were available at the start of this project to assist in design of effective siRNAs (1045, 1087,

1103).

Elbashir’s criteria

Initial criteria for effective siRNA design is based on the observation that siRNA with 3’ overhanging UU dinucleotides are the most effective (1045); the initial version of the web- based program “The siRNA Target Finder and Design Tool

(www.ambion.com/techlib/misc/siRNA_finder.html.)” was based on this simple condition. This program provided all 21-nucleotide sequences starting with AA in mRNA, under the following conditions:

I siRNA ends with UU

II G/C content maximum is 50%

III Sequence construction to avoid 4 or more A’s or T’s in a row

IV Sequence construction to avoid 4 or more G’s or C’s in a row

According to the website, in an initial screen of 79 human genes, 94% of siRNAs designed using this program provided >70% reduction of target mRNA levels.

Ui-Tei’s criteria

In 2004 Ui-Tei et al reported that siRNAs which simultaneously satisfy all of the following sequence conditions are highly effective (1087):

I A/U at the 5’ end of the antisense strand

II G/C at the 5’ end of the sense strand

III At least five A/U residues in the 5’ terminal third of the antisense strand

IV Absence of any GC stretch of >9 nt in length

133 In contrast, siRNAs with features opposite to the first three conditions give rise to little or no gene silencing. siRNAs are grouped into three classes based on combinations of terminal base sequences. Class I siRNAs possess:

I A/U at the 5’ antisense strand end

II G/C at the 5’ sense strand end

III at least four A/U nucleotides in a 7 nt 5’-terminal end of the antisense strand

Class I siRNAs are further classified into two categories. Class Ia have 5-7 A/U residues in a 7 nt 5’-terminal end of the antisense strand; Class Ib is the remainder. Class III siRNAs are those with opposite features. All other siRNAs are classified as Class II siRNA.

Reynold’s criteria

Reynolds et al reported that siRNAs which simultaneously satisfy all the following sequence conditions are highly effective in gene silencing in mammalian cells (1103):

I 30%-52% G/C content

II At least 3 ‘A/U’ basis at positions 15-19 (sense strand)

III Absence of internal repeats (Temperature of potential internal hairpin is <20°C)

IV An ‘A’ base at position 19 (sense strand)

V An ‘A’ base at position 3 (sense strand)

VI A ‘U’ base at position 10 (sense strand)

VII A base other than ‘G’ or ‘C’ at 19 (sense strand)

VIII A base other than ‘G’ at position 13 (sense strand)

siRNA target sites in murine S100A8 mRNA (Genebank Access number: NM_013650;

402 bp) were designed using the web-based program “The siRNA Target Finder and Design

Tool (www.ambion.com/techlib/misc/siRNA_finder.html.)”. According to this, 27 candidates were provided. These were named based on the nucleotide positions within the coding region of the target mRNA, corresponding to the 3’ siRNA antisense end (Table 3-1A). Then, searches of the genome database (BLAST: www.ncbi.nlm.nih.gov/BLAST) were carried out to ensure that

134 the sequences would not target other gene transcripts. Among these, four targets sequences which highly matched Ui-Tei’s and Reynold’s criteria; siRNAmA8_10, 61, 94 and 270 were selected. Table 3-1B shows the satisfaction of each candidate of murine S100A8 siRNA according to Ui-Tei’s criteria to Reynold’s criteria. Figure 3-3 shows the target region (shown in red) of these siRNA sequences in murine S100A8 cDNA.

Table 3- 1: (A) Candidates of siRNA for murine S100A8 based on siRNA Target Finder and Design Tool

siRNA Target sequence GC content (%) Tm (ºC)* mA8_10 AAGACAUCGUUUGAAAGGAAA 33.30 53 mA8_23 AAAGGAAAUCUUUCGUGACAA 33.30 55 mA8_28 AAAUCUUUCGUGACAAUGCCG 42.90 60 mA8_42 AAUGCCGUCUGAACUGGAGAA 47.60 64 mA8_61 AAGGCCUUGAGCAACCUCAUU 47.60 64 mA8_73 AACCUCAUUGAUGUCUACCAC 42.90 61 mA8_94 AAUUAUUCCAAUAUACAAGGA 23.80 51 mA8_103 AAUAUACAAGGAAAUCACCAU 28.60 54 mA8_110 AAGGAAAUCACCAUGCCCUCU 47.60 63 mA8_114 AAAUCACCAUGCCCUCUACAA 42.90 62 mA8_133 AAGAAUGACUUCAAGAAAAUG 28.60 51 mA8_136 AAUGACUUCAAGAAAAUGGUC 33.30 56 mA8_145 AAGAAAAUGGUCACUACUGAG 38.10 58 mA8_148 AAAAUGGUCACUACUGAGUGU 38.10 60 mA8_150 AAUGGUCACUACUGAGUGUCC 47.60 66 mA8_184 AAUAUAAAUAUCGAAAACUUG 19.00 46 mA8_189 AAAUAUCGAAAACUUGUUCAG 28.60 52 mA8_197 AAAACUUGUUCAGAGAAUUGG 33.30 56 mA8_199 AACUUGUUCAGAGAAUUGGAC 38.10 57 mA8_212 AAUUGGACAUCAAUAGUGACA 33.30 56 mA8_223 AAUAGUGACAAUGCAAUUAAC 28.60 54 mA8_232 AAUGCAAUUAACUUCGAGGAG 38.10 59 mA8_237 AAUUAACUUCGAGGAGUUCCU 38.10 59 mA8_270 AAAAGUGGGUGUGGCAUCUCA 47.60 65 mA8_292 AAAGACAGCCACAAGGAGUAG 47.60 66 mA8_356 AAUAAAGUCAUCAUAUCUCAG 28.60 44 mA8_359 AAAGUCAUCAUAUCUCAGGUC 38.10 59 *Tm, the predicted melting temperature (Tm) of the RNA hairpin loop, was calculated by the nearest neighbor method using the site (http://www.basic.nwu.edu/biotools/oligocalc.html).

135 Table 3-1: (B) Compatibility of mouse S100A8 siRNAs with Ui-Tei’s and Reynolds’ criteria

Ui-Tei's criteria Reynolds’ criteria siRNA (I) (II) (III) (IV) Class (I) (II) (III) (IV) (V) (VI) (VII) (VIII) mA8_10 1 1 1 1 Ia 1 1 1 1 0 1 1 1 mA8_23 1 0 1 1 II 1 1 1 1 0 1 1 0 mA8_28 0 0 0 1 III 1 0 1 0 0 0 0 1 mA8_42 1 0 1 1 II 1 1 1 1 0 0 1 1 mA8_61 1 1 1 1 Ib 1 1 1 0 0 0 1 1 mA8_73 0 1 0 1 II 1 0 1 0 0 1 0 1 mA8_94 1 0 1 1 II 0 1 1 1 1 1 1 1 mA8_103 1 0 1 1 II 0 1 1 0 0 0 1 1 mA8_110 1 1 0 1 II 1 0 1 0 1 0 1 0 mA8_114 1 0 1 1 II 1 1 1 1 0 0 1 1 mA8_133 0 1 1 1 II 0 1 1 0 1 0 0 0 mA8_136 0 0 1 1 II 1 0 1 0 1 0 0 1 mA8_145 0 1 1 1 II 1 0 1 0 1 0 0 1 mA8_148 1 0 1 1 II 1 1 1 0 0 1 1 1 mA8_150 0 0 0 1 III 1 0 1 0 0 0 0 1 mA8_184 0 0 1 1 II 0 1 1 0 0 0 0 1 mA8_189 0 0 1 1 II 0 1 1 0 1 0 0 1 mA8_197 0 0 1 1 II 1 1 1 0 0 0 0 0 mA8_199 0 1 1 1 II 1 0 1 0 0 0 0 1 mA8_212 1 0 1 1 II 1 1 1 1 0 0 1 1 mA8_223 0 0 1 1 II 0 1 1 0 0 1 0 1 mA8_232 0 0 0 1 III 1 0 1 0 0 0 0 1 mA8_237 1 0 1 1 II 1 1 1 0 1 0 1 1 mA8_270 1 0 1 1 II 1 1 1 1 0 1 1 1 mA8_292 0 0 0 1 III 1 1 1 0 1 0 0 0 mA8_356 0 0 1 1 II 0 0 1 0 1 0 0 1 mA8_359 0 0 0 1 III 1 0 1 0 0 0 0 1 1: satisfied criteria are listed in Section 3.2.1, 0: criterion not satisfied

136 CCCGTCTTCA AGACATCGTT TGAAAGGAAA TCTTTCGTGA CAATGCCGTC TGAACTGGAG mA8_10 mA8_24 mA8_94 AAGGCCTTGA GCAACCTCAT TGATGTCTAC CACAATTATT CCAATATACA AGGAAATCAC mA8_61 mA8_83 mA8_110 CATGCCCTCT ACAAGAATGA CTTCAAGAAA ATGGTCACTA CTGAGTGTCC TCAGTTTGTG mA8_145 CAGAATATAA ATATCGAAAA CTTGTTCAGA GAATTGGACA TCAATAGTGA CAATGCAATT

AACTTCGAGG AGTTCCTTGC GATGGTGATA AAAGTGGGTG TGGCATCTCA CAAAGACAGC mA8_270 mA8_274 CACAAGGAGT AGCAGAGCTT CTGGCCTAGG GCTGGGTCCC TGGATATGTC TACAGAATAA mA8_306 mA8_346 AGTCATCATA TCTCAGGTCA AAAAAAAAAA AAAAAAAAAA AA

Figure 3- 3: The target regions of siRNAs for murine S100A8

Red underlines indicate target regions of the first series, blue, the second series of enzymatically- synthesized siRNAs, and green, chemically-synthesized siRNAs.

For firefly luciferase siRNA, the published sequence of the effective siRNA was used

(1087). This had no significant homology to the murine gene. Figure 3-4A shows antisense and sense strand sequences of firefly luciferase siRNA, and Figure 3-4B shows its target region.

A Sense strand 5’-ACGCCAAAAACAUAAAGAAAG -3’ Antisense strand 3’-UCUGCGGUUUUUGUAUUUCUU -5’

B 8 26

ATGGAAGACG CCAAAAACAT AAAGAAAGGC CCGGCGCCAT TCTATCCGCT 50

GGAAGATGGA ACCGCTGGAG AGCAACTGCA TAAGGCTATG AAGAGATACG 100

CCCTGGTTCC TGGAACAATT GCTTTTACAG ATGCACATAT CGAGGTGGAC 150

Figure 3- 4: Relationship between luciferase siRNA sequence and luciferase genes

(A) Antisense and sense strand sequences for firefly luciferase siRNA (B) Target region of the firefly luciferase gene

While testing these siRNAs, Amarzguioui et al reported another guideline for effective siRNA design (1104). This suggested that functionally-correlated features included an asymmetry in siRNA duplex end stability (the A/U content differential for the three terminal 137 nucleotides at both ends of the duplex). Furthermore, the initial guidelines for design emphasized the AA overhangs (1045), however subsequently it appeared that these had little or no effect on activity (1095, 1105-1108). Based on these observations, various web-based programs to select candidates for effective siRNA were upgraded. Another four siRNAs for murine S100A8 were re-designed using the web-based program, siRNA Target Finder and

Design Tool. siRNAmA8_24, 83, 274 and 346 were selected; target regions for those are shown in blue in Figure 3-3.

3.2.2 Production of siRNA

Chemically-synthesized siRNAs (mA8_110, mA8_145, mA8_306) were purchased from Ambion. These were pre-designed but their suppressive activity was not pre-validated.

Locations of their target regions are shown in green in Figure 3-3. Chemically-synthesized siRNA for GAPDH (Ambion) was purchased: its suppressive capacity had been validated.

Fluorescent-labeled chemically-synthesized scrambled siRNA control was supplied with the

RNAi starter (Qiagen).

Enzymatically synthesized siRNAs (GAPDH siRNA, firefly luciferase siRNA, and murine S100A8 siRNAs, mA8_10, 24, 61, 83, 94, 274 and 346) were synthesized using the

Silencer siRNA Construction Kit (Ambion Cat# 1620) according to the manufacturer’s protocol.

The sequence of siRNA for enzymatically synthesized GAPDH was supplied with the kit as a positive control for an effective siRNA.

Based on gene target sequences, sequences of sense and antisense siRNA oligonucleotide (oligo) templates were determined and "CCTGTCTC", which is complementary to the T7 promoter primer added to the 3' end of each oligo. The sense and anti-sense siRNA oligo templates were chemically synthesized, purified by desalting (Invitrogen) and siRNAs enzymatically synthesized using the Silencer siRNA Construction Kit (Ambion) according to the manufacturer’s protocol. Figure 3-5 illustrates the siRNA construction procedure. Briefly, two 29-mer DNA oligos (template oligos for sense and antisense siRNA) with 21 nt encoding

138 the siRNA, and 8 nt complementary to the T7 promoter primer were synthesized. In separate reactions, the 2 template oligos were hybridized to a T7 promoter primer which contains a T7 promoter sequence and 8 nt complementary to the template oligos. The 3' ends of the hybridized

DNA oligos are extended by the Klenow fragment of DNA polymerase to create double- stranded siRNA transcription templates. Then the sense and antisense siRNA templates were transcribed using T7 RNA polymerase and the resulting RNA transcripts hybridized to create dsRNA, which consists of 5' terminal single-stranded leader sequences, a 19 nt target-specific dsRNA, and 3' terminal UUs. The siRNA was purified by glass fiber filter binding and elution to remove excess nucleotides, short oligomers, proteins and salts. Note that siRNAs synthesized using this protocol have a triphosphate GTP nucleotide at their 5’ end.

Figure 3- 5: siRNA construction procedure

(from Ambion’s instructions)

139 3.2.3 Construction of pcDNA 6.2/ EmGFP-mA8 expression vector

To evaluate suppressive effects of chemically-synthesized siRNA for murine S100A8, a murine S100A8 expression vector fused with an emerald green fluorescent protein (EmGFP) was generated. A cDNA fragment encoding the 89 amino acids of murine S100A8 was amplified by AmpliTaq Gold using the forward primer

ACCATGGATGCCGTCTGAACTGGAG, and reverse primer CTACTCCTTGTGGCTGTC.

The PCR product was cloned into the pENTR/D-TOPO vector using pENTR Directional TOPO cloning kit (Invitrogen) and subcloned into the pcDNA6.2/N-EmGFP-DEST vector (Invitrogen) using the Gateway System (Invitrogen) to obtain pcDNA 6.2/N-EmGFP-MuS100A8. S100A8 was expressed as EmGFP fusion protein. The recombinant plasmid was transformed in competent E. coli (One Shot TOP10, Invitrogen), and grown at 37°C in Luria Bertani medium containing 100 μg/ml ampicillin.

3.2.4 Transfection of siRNAs and plasmids

One day before transfection, appropriate numbers of cells were plated in 500 μl culture medium without antibiotics into 24-well plates. Table 3-2 shows the conditions used for transfecting NIH3T3 fibroblasts and RAW 264.7 macrophages. Cells were 70-80% confluent at the time of transfection. For each sample, 60 pmol siRNA (final concentration 100 nM siRNA) with or without 0.8 g plasmid, and the appropriate dose of transfection reagent (Table 3-2) were diluted separately in 50 μl Opti-MEM I reduced-serum medium, and after 15 minutes at

Table 3- 2: Conditions of siRNA/plasmid transfection

NIH3T3 cells NIH3T3 cells RAW cells RAW cells siRNA/ 60 pmol siRNA 0.8 g plasmid 60 pmol siRNA 60 pmol siRNA plasmid ± 60 pmol siRNA Culture plates 24-well plate 24-well plate 24-well plate 24-well plate (Griner) (Griner) (Nunc) (Nunc) Inoculated cell 0.8×105 /500 l 0.8×105 /500 l 0.4×105 /500 l 0.4×105 /500 l density ( /well) Reduced serum 50l Opti-MEM 50l Opti-MEM 50l Opti-MEM medium Transfection Lipofectamine Lipofectamine Lipofectamine Ribojuce 2 l reagent 2000 2 l 2000 2 l 2000 1 or 3 l Incubation 20 minutes 20 minutes 20 minutes 10 minutes

140 room temperature, combined and incubated for 20 minutes to form complexes, the mixture (100

μl) was added to each well, and plates incubated for 24 hours at 37°C. Cells were then stimulated as indicated for another 24 hours. Levels of targeted mRNA were evaluated by real- time RT-PCR. Specific detail of each experimental condition is described in the relevant sections. For co-transfected siRNA for firefly luciferase with luciferase expression plasmids, luciferase activity was normalized using protein concentrations of cell lysates.

3.2.5 Design and production of miRNA lentiviral expression vectors

Based on the manufacturer’s instructions, miRNA expression vectors designed to target human S100A8 mRNA were generated. Briefly, RNAi Designer (Invitrogen, www.invitrogen.com/rnai) was used to select target sequences and to design pre-miRNA sequences. Three were selected on the basis of the highest predicted efficiency. Searches of the database (BLAST: www.ncbi.nlm.nih.gov/BLAST) were carried out to ensure that the sequences would not target other transcripts, particularly S100A9 and S100A12, that have high sequence similarities (2). Based on the nucleotide position within the coding region of the target mRNA, and corresponding to the 3’ siRNA antisense end, these were named miRNA_HuA8_82, miRNA_HuA8_103, and miRNA_HuA8_170. Figure 3-6 shows the miRNA target regions.

miRNA_HuA8_82 miRNA_HuA8_103 82 103102 ATGTCTCTTG TCAGCTGTCT TTCAGAAGAC CTGGTGGGGC AAGTCCGTGG GCATCATGTT

miRNA_HuA8_170 GACCGAGCTG123 GAGAAAGCCT TGAACTCTAT CATCGACGTC TACCACAAGT170 ACTCCCTGAT

190 AAAGGGGAAT TTCCATGCCG TCTACAGGGA TGACCTGAAG AAATTGCTAG AGACCGAGTG

TCCTCAGTAT ATCAGGAAAA AGGGTGCAGA CGTCTGGTTC AAAGAGTTGG ATATCAACAC

TGATGGTGCA GTTAACTTCC AGGAGTTCCT CATTCTGGTG ATAAAGATGG GCGTGGCAGC

CCACAAAAAA AGCCATGAAG AAAGCCACAA AGAGTAGCTG AGTTACTGGG CCCAGAGGCT

GGGCCCCTGG ACATGTACCT GCAGAATAAT AAAGTCATCA ATACCTCAAA AAAAAAAAAA

AAAAAAAA

Figure 3- 6: Target regions of miRNA for human S100A8.

141 Sequences of the top and bottom strand-engineered pre-miRNA oligo templates were subsequently determined by the RNAi Designer to form pre-miRNA structural features as detailed in Figure 3-7A and Table 3-3. Pre-miRNA began with 4 nucleotides, with a 5’ overhang (TGCT) complementary to the pcDNA6.2/EmGFP expression vector (Invitrogen) required for directional cloning. These were followed by a 5’G plus the 21 nucleotide antisense sequence (mature miRNA) derived from exon 2 of the S100A8 gene, followed by a short spacer of 19 nucleotides, to form the terminal loop, and a short sense target sequence with 2 nucleotides removed to create an internal loop. After the sense target sequence, 4 nucleotides,

CAGG were added, to form a 5’ overhang complementary to the vector (required for directional cloning).

A

5’- TGCT Antisense target Loop Sense target CAGG overhang sequence sequence sequence overhang -3’

B 5’-UG UGUGA UUGGCC CUGUUAAUGCUAAU UAGGGGUU U Native murine miR 155 GACAAUUACGAUUG AUCCUCAG 3’-G^ UCC-- UCAGUC

5’-UG CG UUUGGCC AAAUGUACUGCG UGGAGACGU A miRNA_Scr UUUACAUGACGC ACCUCUGCA 3’-AG^ -- GUCAGUC

5’-UG GA UUUGGCC UAGACGUCGAU UAGAGUUCGU miRNA_HuA8_82 A AUCUGCAGCUA AUCUCAAGCA 3’-AG^ -- GUCAGUC

5’-UG GT UUUGGCC UUUAUCAGGGA ACUUGUGGGU miRNA_HuA8_103 A AAAUAGUCCCU UGAACACCCA 3’-AG^ -- GUCAGUC

5’-UG AC UUUGGCC AUACUGAGGAC UCGGUCUCGU miRNA_HuA8_170 A UAUGACUCCUG AGCCAGAGCA 3’-AG^ -- GUCAGUC

Figure 3- 7: Structural features of pre-miRNAs and miRNAs

(A) Structural features of pre-miRNAs designed for human S100A8 mRNA. (B) Structural features of the miRNAs generated. 142 Table 3- 3: Oligonucleotide templates of miRNA to target the human S100A8 gene miRNA_HuA8_82 Top strand oligo: TGCTGTAGACGTCGATGATAGAGTTCGTTTTGGCCACTGACTGACGAACTCTAATCGACGTCTA Bottom strand oligo: CCTGTAGACGTCGATTAGAGTTCGTCAGTCAGTGGCCAAAACGAACTCTATCATCGACGTCTAC miRNA_HuA8_103 Top strand oligo: TGCTGTTTATCAGGGAGTACTTGTGGGTTTTGGCCACTGACTGACCCACAAGTTCCCTGATAAA Bottom strand oligo CCTGTTTATCAGGGAACTTGTGGGTCAGTCAGTGGCCAAAACCCACAAGTACTCCCTGATAAAC miRNA_HuA8_170 Top strand oligo: TGCTGATACTGAGGACACTCGGTCTCGTTTTGGCCACTGACTGACGAGACCGAGTCCTCAGTAT Bottom strand oligo CCTGATACTGAGGACTCGGTCTCGTCAGTCAGTGGCCAAAACGAGACCGAGTGTCCTCAGTATC

The engineered pre-miRNA sequence structure was based on the murine miR-155 sequence (1109). The 5’ and 3’ flanking regions derived from the miR-155 transcript were inserted into the vector to preserve, as far as possible, the miR-155 structure (Figure 3-7B).

Single-stranded antisense pre-miRNAs and sense pre-siRNAs were chemically synthesized and desalted. miRNA lentiviral expression vectors were synthesized using these oligo according to

Lentiviral Pol II miR RNAi Expression System with EmGFP (Invitrogen) as illustrated in

Figure 3-8. Briefly, the complimentary oligo (as indicated in Table 3-3) was annealed to generate a double stranded oligo, and then cloned into a pcDNA6.2-GW/EmGFP-miR expression vector using T4 DNA ligase. These expression cassettes were then transferred to a donor vector (pDONR221, Invitrogen) and finally to the pLenti6/V5-DEST vector to generate

Lenti6/EmGFP-miRNA_HuA8 expression constructs. Simultaneously, scrambled miRNA, with no significant homologies to mouse or human gene sequences, was also synthesized as a positive control for the synthesis procedure of pre-miRNA, and as a negative control in functional assays. All viral vectors generated in this project co-expressed miRNA and EmGFP, and contained the blasticidin resistance gene.

143 Virus

293FT cells

pcDNA 6.2 Lentiviral -GW/EmGFP expression pLP2 -miR clone

pLP1 pLP VSVG

Packing Mix

pLenti6/ pDONR 221 V5-DEST Vector + Vector

Figure 3- 8: Generation of lentivirus

(modified from manufacturer’s instructions)

For lentivirus generation, 293T cells were grown to 90% confluence (see Table 2-1 for culture conditions). Cells (6.0×106) in 10 cm tissue culture plate (Nunc) containing 13 ml growth medium were transfected with the lentviral vectors and Packing Mix (Invitrogen), which facilitates expression vectors to produce self-inactive virus, using Lipofectamine 2000

(Invitrogen). The medium was replaced 24 hours post-transfection. Viral supernatants were collected 60 hours after transfection, centrifuged at 2000 rpm for 5 minutes to pellet cell debris, and stored at -80°C.

For lentiviral infection, THP-1 cells (4.0×105/well) or MCF-7 cells (4.0×105/well) were seeded in 12-well plates (Nunc) containing 1 ml virus supernatant supplemented with 4 l

2 M HEPES (pH 7.5) and polybrene (final concentration: 20 g/ml). Spin infection of cells was

144 performed by centrifugation at 2500 rpm for 1.5 hours at 30°C; this was repeated once the following day. The next day blasticidin (2 g/ml) selection was started and EmGFP expression monitored by fluorescence microscopy.

3.2.6 Proliferation assay

Proliferation was evaluated using CellTiter-Blue Reagent (Promega), providing a homogeneous, fluorometric method for estimating numbers of viable cells present in multiwell plates. It uses resazurin to measure the metabolic capacity of cells, and corresponds to cell viability. Viable cells retain the ability to reduce resazurin into resorufin, which is highly fluorescent whereas non-viable cells rapidly lose this capacity. Resazurin has little intrinsic fluorescence until it is reduced to resorufin which is highly fluorescent (579Ex/584Em). Under the experimental conditions used, the fluorescent signal from this reagent was proportional to numbers of viable cells assessed manually by Trypan blue exclusion. For the assay, MCF-7 cells

(5×103/100l) were plated into 96-well white plates (Nunc) 24 hours before stimulation. The assay was done at the times indicated, by adding 20 l CellTiter-Blue Reagent directly into the wells and after 1 hour, 560Ex/590Em measured using a Spectra Max M2 fluorescence spectrophotometer (Molecular Devices).

3.3 Results

3.3.1 Delivery of siRNAs to NIH3T3 cells

To establish a method for transfection, 100 nM fluorescent-labeled scrambled-siRNA control was transfected with Lipofectamine 2000 into NIH3T3 fibroblasts as described in

Section 3.2.4. Immunofluorescence microscopy confirmed delivery because untransfected cells were not fluorescent (Figure 3-9A) compared to transfected cells (Figure 3-9B).

145 AB

Figure 3- 9: Delivery of siRNA to NIH3T3 fibroblasts

NIH3T3 cells (0.8×105) were seeded and transfected with 2 l Lipofectamine 2000 in the presence (A) or absence (B) of 60 pmol of scrambled fluorescence-labeled siRNA (final concentration, 100 nM). Transfection efficiency was evaluated by fluorescence microscopy after 6 hours. Magnification: ×400

Next, to confirm that the procedure used for siRNA synthesis was valid, enzymatically-synthesized firefly luciferase siRNA was co-transfected with the S100A8 promoter-luciferase-fused reporter plasmid. Figure 3-10 shows that siRNA dose-dependently suppressed firefly luciferase activity. Inhibition was ~90% with 10 nM siRNA. Surprisingly, renilla luciferase activity was also suppressed, but this was not obvious at low doses of siRNA

(1, 3.3 nM). Based on a computer search using ClustalW (http://www.ebi.ac.uk/Tools/clustalw

/index.html ), the sense strand of firefly luciferase siRNA has high homology to a region within the renilla luciferase gene, and this may function as an siRNA for renilla luciferase. These

Figure 3- 10: Enzymatically-synthesized 7000 luciferase siRNA suppressed luciferase genes 6000 g Protein ᕈ 5000 NIH3T3 cells were co-transfected with 0.5 g S100A8 promoter-luciferase-fused reporter 4000 vector (open bars), 0.05 g pRL-TK vector 3000 (solid bars), and siRNA for firefly luciferase 2000 at the indicated concentrations for 24 hours, then the cells stimulated with FGF-2 (25 1000 ng/ml) and heparin (1 IU/ml) for another 24

Relative Luciferase Intensity / Intensity Luciferase Relative 0 hours to induce firefly luciferase. Luciferase 0 1 3.33 10 33.3 100 activities in cell lysates were analyzed as Concentration of siRNA (nM) described in Section 3.2.4, and normalized by protein concentration (Section 2.6). (n=1).

146 results confirmed that enzymatically-synthesized siRNA was successfully delivered into

NIH3T3 cells and the same conditions used to test siRNAs designed to suppress S100A8.

3.3.2 Transfection of murine S100A8 siRNA into NIH3T3 cells

To determine the efficacy of enzymatically-synthesized siRNAs, NIH3T3 cells were transfected with 100 nM siRNA_mA8_10, 61, 94 and 270 for 24 hours, then activated by FGF-

2 and heparin for 24 hours. Figure 3-11A confirmed that FGF2+heparin increased S100A8 mRNA. This was ~70-fold above base levels, and the scrambled siRNA control had no effect

1.2 A 0.20 B

0.15 0.8

0.10

0.4 0.05 Relative S100A8mRNA/ HPRT Ratio HPRT S100A8mRNA/ Relative Ralative Ratio mRNA HPRT / S100A8 0 0 FGF2 + heparin - + + + + + + FGF2 + heparin - + + + + + + siRNA (100nM) - - Scr mA8 mA8 mA8 mA8 siRNA_mA8_61 - - 100 150 200 - 100 _10 _61 _94 _270 siRNA_mA8_270 - - - - - 100 100

6 C

4

2

Relative S100A8 / HPRT mRNA ratio mRNA / HPRT S100A8 Relative 0 FGF2 + heparin - + + + + + + siRNA (100nM) - - Scr mA8 mA8 mA8 mA8 _24 _83 _274 _346

Figure 3- 11: Effects of siRNA on S100A8 mRNA expression in NIH 3T3 cells

(A, B, C) Twenty-four hours before stimulation with FGF-2 and heparin, confluent NIH3T3 cells were transfected with the indicated concentrations (nM) of scrambled siRNA (Scr) or murine S100A8 siRNAs as given. Cells harvested 24 hours post-stimulation and mRNA quantitated by real-time RT-PCR. Data represent means relative to HPRT mRNA levels ± SD. Results are representative of 3 separate experiments. (C) Open and solid bars represent two series of separate experiments.

147 on S100A8 induction. Maximal suppression of S100A8 mRNA was 37.4% with siRNA mA8_61, whereas mA8_10 and mA8_270 had little effect. Interestingly, mA8_94 enhanced

S100A8 mRNA induction by FGF-2+heparin to 223-fold above baseline. Figure 3-11B shows that the maximal suppression of S100A8 mRNA was 40.0% with 100 nM siRNA_mA8_61;

33.3 nM did not suppress S100A8 mRNA (not shown) and amounts above 100 nM were ineffective. In an attempt to enhance suppression, combinations of siRNAs targeting different regions, were examined. Figure 3-11B shows only the most effective combination which was of mA8_61 and mA8_270, but suppression was not more than that with mA8_61 alone. Increased incubation to 72 hours post-transfection did not alter the degree of suppression by mA8_61.

(data not shown).

In mammalian cells, RNAi activity varies depending on the siRNA used, but effective siRNAs can reduce target gene expression by 70- 95% (1087). The results reported here for murine S100A8 indicate that none of the synthesized siRNAs were effective. One reason may have been inadequate siRNA design, and so another four siRNAs (siRNAmA8_24, 83, 274 and

346) were used. Figure 3-11C shows results from two typical independent experiments using these. S100A8 mRNA levels induced by FGF-2+heparin and transfected with scrambled siRNA were similar to these induced by FGF-2+heparin. Suppression of S100A8 mRNA by siRNA was variable; some enhanced S100A8 mRNA levels in some experiments, but suppressed induction in others. The reason for this variability is unclear as induction levels of the gene in the absence of siRNA were similar in both experiments, but could represent differences in transfection efficiencies. Alternatively, the level of cell confluence at the time stimulation may have influenced results. Figure 3-12 shows that when induction intensity of S100A8 mRNA was defined as a ratio of S100A8 mRNA levels in stimulated cells over unstimulated cells, there are reverse correlation (R=0.857) between confluence at harvest and intensity of induction by FGF-

2+heparin. This confirmed earlier data (378) that the degree of confluence affected induction intensity of S100A8 mRNA in NIH3T3 cells. However, overall, there was a similar trend to the first set of siRNAs, with generally low suppression and sometimes activation.

148 80

60

40 Figure 3- 12: Confluence-dependent induction of S100A8 mRNA in NIH3T3 fibroblasts. y=-1.6397x + 169.32 20 R=0.857 NIH3T3 cells (0.8105/well) seeded into 24-well plates were cultured cells for 48 hours, then cultured ± Intensity of S100A8 induction S100A8 of Intensity 0 FGF2+heparin for another 24 hours. At harvest, 50 60 70 80 90 100 confluence was estimated microscopically and S100A8 Confluence of cells mRNA levels quantified by real-time RT-PCR.

To ensure that the system was functional, the effect of GAPDH siRNA was tested.

Figure 3-13 shows that FGF-2+heparin reduced GAPDH mRNA levels by 32%, and GAPDH siRNA further suppressed this to 91%; mA8_61 had little effect on GAPDH mRNA levels.

Surprisingly, GAPDH siRNA markedly enhanced S100A8 mRNA induction, in contrast to the

50% suppression seen with mA8_61. Thus result implied that enhancement of S100A8 mRNA induction by siRNA was not specific to particular S100A8 siRNA constructs.

Figure 3- 13: Effects of enzymatically- 2.0 6 synthesized GAPDH and mA8_61 siRNA in NIH 3T3 cells

1.5 4 Twenty-four hours before stimulation with FGF- 2+heparin, confluent NIH3T3 cells were transfected 1.0 with the indicated concentrations (nM) of GAPDH siRNA or mA8_61 siRNAs as given. Cells 2 0.5 harvested 24 hours post-stimulation and S100A8 or GAPDH mRNA quantitated by real-time RT-PCR.

Relative S100A8 / HPRT mRNA ratio mRNA HPRT / S100A8 Relative HPRT was used as endogenous control. Open Relative GAPDH / HPRT mRNA ratio mRNA HPRT / GAPDH Relative 0 0 (GAPDH) and solid (S100A8) bars indicate relative FGF2 + heparin - + + + siRNA (100nM) - - mA8_61 GAPDH mRNA levels. Means ± SD of 3 separate experiments given.

3.3.3 Delivery of siRNAs to RAW cells

To test whether the ineffectiveness of siRNA was specific to fibroblasts activated with

FGF-2+heparin, RAW cells were chosen, principally because the final aim of this project was to determine how S100A8 may regulate macrophage function, and because these have been extensively used to investigate S100A8 gene regulation. Importantly, S100A8 is induced in the

149 absence of S100A9 (93, 94, 407) and this system would allow the possibilities of better assessing S100A8’s role. To select an efficient delivery method, fluorescent-labeled scrambled siRNA was transfected into RAW cells using the manufacturer’s protocol for each transfection reagent. Diethylaminoethyl-dextran (DEAE) and cationic lipids (Lipofectamine 2000 or

RiboJuce, Novagen) were used (see Table 3-2). Figure 3-14 shows delivery of siRNA into

RAW cells using these. Lipofectamine 2000 is reported to have a high efficiency for siRNA delivery (1110) and DNA transfection (1111) in RAW cells. RiboJuce was newly-developed as a specific transfection reagent for siRNA, and DEAE is used for DNA transfection as described in Section 2.4; this was unsuccessful in delivering siRNA to RAW cells (data not shown).

RiboJuce was also unsuccessful and was toxic to RAW cells, as assessed by Typan blue exclusion. Lipofectamine 2000 was much less toxic even at the higher dose (3 l, viability

>90% by Typan blue exclusion) and appeared to be the most efficient delivery system.

A B

C D

Figure 3- 14: Transfection methods to deliver siRNA to RAW cells

RAW cells were seeded as described in Section 3.2.4, and transfected with fluorescent-labeled scrambled siRNA (100 nM) in absence (A) or presence of 1 l Lipofectamine 2000 (B), 3 l Lipofectamine 2000 (C) or 2 l RiboJuce (D) in a total volume of 600l. Six hours after transfection, efficiency was evaluated by fluorescence microscopy. Magnification: ×100

150 Lipofectmaine 2000 (3 l in a total volume of 600l) was chosen, and transfection efficiency was estimated as >80%.

3.3.4 Enzymatically-synthesized siRNA transfection induces S100A8

To test enzymatically-synthesized S100A8 siRNAs, these were transfected into RAW cells, then cells activated with LPS. Fluorescent-labeled chemically-synthesized scrambled siRNA was used for comparison. Figure 3-15A is a typical result representative of 3 separate experiments. Surprisingly, transfection of siRNAs increased S100A8 mRNA levels induced by

LPS 21- to 180-fold, although they did not directly induce S100A8 mRNA (data not shown).

These results confirmed that transfection of enzymatically-synthesized siRNA enhanced

S100A8 induction.

80 0.3 A B 60 0.2

40

0.1 20 Relative S100A8mRNA/ H PRT Ratio

Relative S100A8/HPRT mRN Ratio A 0 0 LPS - + + + + + + + + + Lipofectamine -1.53.0 siRNA (100nM) - Scr mA8 mA8 mA8 mA8 mA8 mA8 mA8 mA8 2000 (l / 0. 5ml ) _10 _61 _94 _270 _24 _83 _274 _364

Figure 3- 15: Transfection of enzymatically-synthesized siRNA enhanced S100A8 induction

(A) Twenty-four hours before stimulation with LPS (20 ng/ml), RAW cells were transfected with the 100 nM fluorescent-labeled chemically-synthesized scrambled siRNA (Scr), or enzymatically-synthesized murine S100A8 siRNAs. Cells harvested 24 hours post-stimulation and S100A8 mRNA quantitated. Result shown is representative of 3 separate experiments. (B) 24 hours before stimulation, RAW cells were seeded then were treated with indicated dose of Lipofectamine 2000 for 24 hours, then untreated or stimulated with LPS (20 ng/ml). Open bars (unstimulated), solid bars (stimulated with LPS). After 24- hour incubation S100A8 mRNA levels relative to HPRT were quantitated. Data represent S100A8 relative to HPRT mRNA levels ± SD from duplicated wells. Results are representative of two separate experiments.

To test whether Lipofectamine 2000 may contribute to gene induction seen with enzymatically-synthesized siRNA, we tested its effect. Lipofectamine 2000 did not induce

S100A8 and in contrast to the effect seen with the siRNAs, it suppressed S100A8 induction in dose-dependent manner (Figure 3-15B), suggesting that cationic lipids may reduce S100A8

151 gene induction and that it was unlikely to cause the increases seen with the siRNAs.

Type 1 IFN responses can be induced by siRNA transfection (1080, 1084-1086), particularly by enzymatically-synthesized siRNA (1083). To examine if effects were restricted to one siRNA type, enzymatically- or chemically-synthesized siRNA for GAPDH transfected into RAW cells were compared. In the absence of stimulation, transfection of enzymatically- and chemically-synthesized GAPDH siRNA suppressed GAPDH mRNA by 62% and 43%, respectively, compared with untransfected control (Figure 3-16A), indicating a relatively low efficiency in RAW cells. Although chemically-synthesized GAPDH siRNA transfection weakly induced S100A8 mRNA (1.5-fold), enzymatically-synthesized siRNA caused 28-fold induction

(Figure 3-16B). This confirmed that in the absence of LPS stimulation, an enzymatically- synthesized (GAPDH) siRNA can induce S100A8 in RAW cells.

3 50 A B 40 2 30

20 1 A 10 Relative GAPDH/ HPRT mRNA Ratio HPRT mRNA GAPDH/ Relative Ratio HPRT mRNA S100A8/ Relative 0 0 y y A ll ll A lly ly N a a N a l R c c R c a i ti i i ti ic s a m s a m e e No ym h No m h z C zy n n C E E

Figure 3- 16: Effects of chemically and enzymatically-synthesized GAPDH siRNA on S100A8 mRNA expression

RAW cells seeded as described were transfected with 50 nM chemically- or enzymatically-synthesized GAPDH siRNA in absence (open bar) or presence (solid bar) of Lipofectamine 2000 (3 l). After 24 hours, GAPDH (A) or S100A8 (B) mRNA levels relative to HPRT were quantitated. Data represent the fold increases in mRNA levels relative to unstimulated samples without siRNA transfection; means ± SD of 3 separate experiments given.

IFN- was used to examine its effects on LPS- stimulated RAW cells, because most cells initially produce IFN- and IFN-4 in response to viral infection (1077). IFN- (100 U/ml) did not induce S100A8 mRNA, whereas this amount is sufficient to induce IFN-stimulated genes such as inducible nitric oxide synthase (iNOS) in RAW cells (1112). However, IFN- synergized with LPS. Figure 3-17 shows that as little as 20 U/ml IFN- increased mRNA levels

152 induced by LPS ~3-fold, and 100 U/ml, by ~9-fold.

15

10 Figure 3- 17: Effects of IFN- on S100A8 mRNA induction by LPS 5 RAW cells seeded as described then were untreated or

Relative S100A8 /HPRT mRNA Ratio /HPRT mRNA S100A8 Relative stimulated with LPS (20 ng/ml) ± the indicated dose of IFN-. 0 Data represent fold of mRNA levels relative to samples LPS (ng/ml) - 20 - 20 20 IFN-ᔾ (U/ml) - - 100 20 100 stimulated with LPS; means ± SD of 3 separate experiments given.

3.3.5 Suppression of S100A8 induction by chemically-synthesized siRNA

Because the chemically-synthesized GAPDH siRNA did not influence S100A8 gene induction, chemically-synthesized siRNAs for murine S100A8 (mA8_110, mA8_145, mA8_306) were tested using a pcDNA6.2/EmGFP-mA8 vector, which expresses a fusion of emerald green fluorescent protein (EmGFP) with S100A8 (Section 3.2.3). This approach was designed to avoid having to upregulate the S100A8 gene, because simultaneous stimulation (for induction) and siRNA (for suppression) may lead to insufficiencies of siRNA effectiveness or to a co-activation response. Figure 3-18A shows expression of the fusion protein in NIH3T3 cells;

3 A B

2

1

Relative S100A8 /HPRT mRNA Ratio /HPRT mRNA S100A8 Relative 0 pcDNA6.2/EmGFP-mA8 + + + + + + siRNA - Scr GAPDH mA8 mA8 mA8 _110 _145 _306

Figure 3- 18: Effects of chemically-synthesized siRNA on S100A8 mRNA expression driven by a murine S100A8-GFP expression vector in NIH3T3 cells

(A) The pcDNA6.2/EmGFP-mA8 vector was transfected to NIH3T3 cells as described in Section 3.2.4. Expression was evaluated by fluorescence microscopy 48 hours post-transfection. Magnification: 400× (B) The pcDNA6.2/EmGFP-mA8 vector was co-transfected with scrambled (Scr), GAPDH, mA8_110, mA8_145 or mA8_306 siRNAs into NIH3T3 cells. After 48 hours, S100A8 mRNA was quantitated. Data represent means (relative to HPRT mRNA levels) ± SD of from 3 separate experiments.

153 transfection efficiency was estimated to be ~60%.

The chemically-synthesized siRNAs were co-transfected into NIH3T3 cells together with this construct. Figure 3-18B showed that co-transfection of the pcDNA6.2/EmGFP-mA8 vector with the scrambled, or GAPDH siRNA increased S100A8 mRNA levels compared to those produced with the vector alone, suggesting that internalization of siRNA also may contribute to enhancement of S100A8 induction. In contrast, co-transfection with siRNAs for murine S100A8 caused effective suppression; mA8_ 110, mA8_145 and mA8_306 inhibited

S100A8 mRNA by 76.1%, 86.3% and 74.4%, respectively compared to the scrambled siRNA, confirming that chemically-synthesized siRNAs could effectively reduce S100A8 mRNA levels in unstimulated S100A8-expressing NIH3T3 cells.

Next, to test the effects of stimulation, these siRNAs were transfected into NIH3T3 cells then the cells activated with FGF-2+heparin (Figure 3-19A) or into RAW cells that were then activated with LPS (Figure 3-19B). Maximal suppression of the response of cells containing the scrambled siRNA was 60.8% in NIH3T3 cells with mA8_306 and 29.7% with mA8_110 siRNA in RAW cells. These results indicate that the siRNAs did not efficiently suppress S100A8 mRNA in activated cells, particularly RAW cells, although further studies, such as titration of siRNA, are required to confirm optimal conditions.

1 1 AB 0.8 0.8

0.6 0.6

0.4 0.4

0.2 0.2 Relative S100A8 /HPRT mRNA Ratio mRNA /HPRT S100A8 Relative Relative S100A8 /HPRT mRNA Ratio mRNA /HPRT S100A8 Relative 0 0 FGF2 + heparin - - + + + + + LPS - - + + + + + Lipofectsmine 2000 - + - + + + + Lipofectsmine 2000 - + - + + + + - Scr - Scr mA8 mA8 mA8 - Scr - Scr mA8 mA8 mA8 siRNA siRNA _110 _145 _306 _110 _145 _306

Figure 3- 19: Effects of chemically-synthesized siRNA on S100A8 mRNA in activated cells

Scrambled (Scr), mA8_110, mA8_145 or mA8_306 siRNA were transfected into NIH3T3 cells (A) or RAW cells (B). After 24 hours post-transfection, cells were stimulated with FGF-2 (25 ng/ml)+ heparin (1 IU/ml) (A) or LPS (20 ng/ml) (B) for another 24 hours, then S100A8 mRNA levels were evaluated. Data represent means (relative to HPRT mRNA levels) ± SD of 3 separate experiments. 154 3.3.6 Establishment of cell lines stably silencing the S100A8 gene

While exploring the possibilities to suppress to murine S100A8 gene, parallel projects revealed that murine S100A8 was induced by dsRNA in macrophages (Chapter 4) and cell stressors possibly lead to ATP release from distressed macrophages, that may enhance S100A8 induction (Chapter 5). Results found with dsRNA may provide an explanation for why S100A8 induction in activated fibroblasts and macrophages was not suppressed by siRNA. Thus the inherent difficulties in internalization of siRNA into macrophages may cause stress, particularly in macrophages. PKR is activated by internalized siRNAs in microglial cells and glioblastoma cells (1080, 1081, 1113), and leads to induction of IL-10 and other essential mediators that are also critical regulators of the S100A8 gene (Section 1.10.3.1). Together, these considerations suggested that cell lines stably-silencing the S100A8 gene by miRNA may be more preferable because this system does not require transfection and the engineered pri-miRNA is designed to function as an imperfect base pairing dsRNA.

The human promyelomonocytic cell line (THP-1) and a breast cancer cell line (MCF7) were selected, because S100 levels gradually increase in response to LPS (Hsu K unpublished observation) or oncostatin M (Figure 3-23), respectively. To establish the cell lines, the lentiviral siRNA delivery system based on microRNA technology was chosen. This creates a replication-incompetent lentivirus that delivers an miRNA sequence of interest. The engineered miRNAs produced by this system are perfectly complementary to their target site and cleave target mRNA in a manner similar to siRNA. This system provides stable, long-term expression of the miRNA of interest (reviewed in (1114)). Four lentivirus vectors expressing miRNA_Scr, miRNA_HuA8_82, miRNA_HuA8_103, and miRNA_HuA8_170 were generated as described in Section 3.2.5.

3.3.7 THP-1 and MCF-7 cell lines expressing miRNAs for human S100A8

Lentiviral vectors were infected into THP-1 and MCF-7 cells, and cells maintained in culture medium (see Table 2-1) supplemented with 2 g/ml blasticidin, a selection antibiotic.

155 Transfection efficiencies of both cell lines were >90%, as indicated by fluorescence microscopy

7 days post-infection. Figure 3-20A and Figure 3-21A show that neither untransformed cell line was auto-fluorescent, whereas EmGFP was detected in the cytoplasm of cells transfected with the scrambled control vector (Figure 3-20B, Figure 3-21B) and in cells transformed with the lentiviral silencing vectors (Figure 3-20C-E, Figure 3-21C-E). No differences in morphology were obvious in MCF-7 cells and visual observation of fluorescence intensities of infected cells in both cell lines, suggested that infection efficiencies of the various constructs were similar.

However, the fluorescence intensity in individual cells varied: some exhibited intense fluorescence in the cytoplasm whereas some were weak (see Figure 3-20D, Figure 3-21C), possibly suggesting differences in numbers of viral copies that had been

A B

C D

E

Figure 3- 20: Expression of EmGFP in THP-1 cells

THP-1 cells (4.0×105) were untransfected (A), or transfected with Lenti6/EmGFP-miRNA_Scr (B), Lenti6/EmGFP- miRNA_HuA8_82 (C), Lenti6/EmGFP-miRNA_HuA8 _103 (D), Lenti6/EmGFP-miRNA_HuA8_170 (E) as described in Section 3.2.5. Expression was evaluated by fluorescence microscopy 7 days post-transfection. (Magnification: ×400)

156 integrated and/or the frequency of gene transcription, which may vary depending on the region of genome where the constructs had integrated. THP-1 cells in particular were heterogeneous in size and some contained more cytoplasm with higher fluorescence intensity than others in the same fields of view (see Figure 3-20D). Some cells may have fused as a result of viral infection.

To allow the cells to recover from damage that may occur as a consequence of the transfection procedure, and that could influence S100A8 induction (Chapter 4, and Chapter5), they were subcultured every 5 days for at least 5 weeks before testing. At the time, except for some cells containing more cytoplasm, transformed cells showed no significant morphological differences compared to untransformed cells, or cells transformed with the scrambled miRNA construct.

A B

C D

E

Figure 3- 21: Expression of EmGFP in MCF-7 cells

MCF-7 cells (4.0×105) were untransfected (A), or transfected with Lenti6/EmGFP-miRNA_Scr (B), Lenti6/EmGFP- miRNA_HuA8_82 (C), Lenti6/EmGFP-miRNA_HuA8 _103 (D), Lenti6/EmGFP-miRNA_HuA8_170 (E) as described in Section 3.2.5. Expression was evaluated by fluorescence microscopy 7 days post-transfection. (Magnification: ×400)

157 3.3.8 Expression of S100A8 in transfected cells

All THP-1 cells contained low levels of S100A8 mRNA with no differences between the vectors used (Figure 3-22A). However compared with cells containing scrambled miRNA,

S100A8 mRNA induction by LPS in THP-1 cells expressing miRNA_HuA8_82 and miRNA_HuA8_103 increased, particularly with _103, which was enhanced ~5- fold (Figure 3-

22A). THP-1 cells infected with miRNA_HuA8_170 contained mRNA levels similar to the scrambled control. None of the vectors suppressed LPS-induced S100A8 mRNA. This reflected the results found in murine RAW cells (Figure 3-19B). S100A8 mRNA protein from the various stably-transfected THP-1 cells were confirmed by Western blot. Figure 3-22B shows no

S100A8 separated at 10 kDa in the scrambled-vector expression cells, or in _82; very weak reactivity was seen in _103 and _170. When cells were activated with LPS, lysates all contained about equivalent amounts of S100A8. As activated macrophages secrete S100A8 (94), assessment of S100A8 levels in supernatants of activated cells and in cell lysates, by ELISA, would be worthy of investigation.

12 A B 10 + LPS 100 ng/ml Scr 82 103 170 Scr 82 103 170 8

Actin mRNAratio 10 KDa

ᔾ 6

4

2 Relative S100A8/ S100A8/ Relative 0 miRNA- Scr HuA8 HuA8 HuA8 _82 _103 _170

Figure 3- 22: Expression of S100A8 in miRNA-transfected THP-1 cells

Transfected THP-1 cells were untreated (open bars) or stimulated (solid bars) with 100 ng/ml LPS for 24 hours. (A) mRNA levels relative to -actin were quantitated. Data represent ratios of S100A8 mRNA relative to S100A8/ actin mRNA ratio from stimulated cells containing the scrambled miRNA- transfected (Scr); means ± SD of 3 separate experiments given. (B) Western blotting of cell lysates (40 g) from transfected THP-1 cells showing anti-S100A8 immunoreactivity at 10 KDa. SDS-PAGE was performed under reducing conditions with 50 mM DTT. Membrane was blotted with anti-S100A8 (n=2). (Arrow indicates S100A8 which separated at 10kDa)

Although MCF-7 cells did not express S100A8, its expression gradually increased and peaked 72 hours post-stimulation with oncostatin M (Figure 3-23). All transformed MCF-7 cells

158 expressed negligible levels of S100A8 mRNA. Figure 3-24A shows that in marked contrast to

MCF-7 cells transfected with scrambled miRNA, S100A8 mRNA expression in OSM- stimulated cells was suppressed by 90-95% in miRNA_HuA8_82, miRNA_HuA8_103 and miRNA_HuA8_170-expressing cells, showing efficient gene silencing. These results indicate that suppression may be dependent on the cell type and/or the inducing agent. There were no apparent morphological differences in the transformed cell lines before and after stimulation.

Interestingly, in OSM-stimulated MCF-7 cells that stably expressed miRNAs compared with the scrambled control, S100A9 was suppressed by ~75% with miRNA_HuA8_82 and miRNA_HuA8_103 whereas miRNA_HuA8_170 was much less effective. Induced

S100A12mRNA levels were lower than those of S100A8 or 100A9 and miRNA_HuA8_82 and

0.8

0.6

Actin mRNA ratio Figure 3- 23: S100A8 mRNA is induced by OSM in ᔾ 0.4 MCF-7 cells

0.2 MCF-7 cells were untreated (dashed line) or treated with 50 g/ml OSM (solid line) for indicated times. mRNA levels

Relative S100A8/ S100A8/ Relative relative to -actin were quantitated. Data represent means ± 0 SD of duplicated samples. (n=1) 020406080 Hours

1.0 A 0.05 B 0.8 0.04

0.6 0.03 Actin mRNA ratio mRNA Actin ᔾ Actin mRNA ratio mRNA Actin 0.4 ᔾ 0.02 * 0.2 * 0.01 * Relative S100/ Relative Relative S100A8/ S100A8/ Relative 0 0 miRNA Scr HuA8 HuA8 HuA8 Scr HuA8 HuA8 HuA8 _82 _103 _170 _82 _103 _170 Figure 3- 24: Expression of S100A8 in miRNA-transfected MCF-7 cells

(A) MCF-7 cells transfected with the vectors indicated were untreated (open bars) or stimulated (solid bars) with 50 ng/ml OSM, for 48 hours. mRNA levels relative to -actin were quantitated. Data represent ratios of S100A8 mRNA relative to S100A8/ actin mRNA ratio from stimulated cells containing the scrambled miRNA-transfected (Scr); means ± SD of 3 separate experiments given. * P < 0.01 compared to stimulated and scrambled miRNA- transfected samples. (B) mRNA levels of S100A9 (open bars) and S100A12 (solid bars) in a series of samples from (A) were quantitated (n=1).

159 miRNA_HuA8_103 inhibited expression by ~60% whereas miRNA_HuA8_170 had no effect

(Figure 3-24B, n=1).

3.3.9 Silencing the S100A8 gene did not affect MCF-7 growth

OSM (50 ng/ml) strongly inhibits growth of MCF-7 cells through the STAT3 signalling pathway, and inhibition of S100A9 expression with siRNA decreases OSM-induced growth repression (693, 1115). Therefore, growth of MCF-7 cells transfected with miRNA expression vectors was examined. Figure 3-25 shows that no differences in cell numbers were seen between untransfected cells and miRNA expressing MCF-7 cell lines stimulated with OSM, suggesting that S100A8 did not counteract OSM-induced growth repression.

Untransfected 2.0 miRNA_Scr miRNA_HuA8_82 1.5 miRNA_HuA8_103 Figure 3- 25: S100A8 miRNA did not miRNA_HuA8_170 alter growth of MCF-7 cells 1.0 Twenty-four hours before stimulation, 5×103 MCF-7 cells were plated into wells of 96- 0.5 well plates as described in Section 3.2.6, then stimulated with OSM (50 ng/ml).

Number of cells relative to untreated to relative of cells Number Assay was carried out on the day indicated 0 Day 1 Day 4 Day 7 by adding 20 l CellTiter-Blue Reagent into the wells.

3.3.10 S100A8 induction in MCF-7 cells is PKR-mediated

The high levels of S100A8 mRNA induced by OSM in MCF-7 cells were inhibited by the PKR inhibitor 2-aminopurine (2-AP), by 98.6% (Figure 3-26); 2-AP alone had no effect.

S100A8 mRNA was not induced by 50 g/ml poly(I:C) in this system

1.0 (data not shown). A 0.8 Figure 3- 26: PKR is involved in S100A8 induction in MCF-7 cells

Actin mRNA ratio mRNA Actin 0.6 ᔾ

0.4 MCF-7 cells were stimulated with OSM (50 ng/ml) for 48 hours ± 2-AP (4 mM), then mRNA levels relative to actin quantitated. Data represent ratios 0.2 of S100A8 mRNA relative to stimulated samples; means ± SD of 3 separate experiments given. * P < 0.01 compared to OSM-stimulated samples. Relative S100A8/ S100A8/ Relative 0 * OSM - 50 - 50 2-AP - - 4 4 160 3.4 Discussion

Since synthetic double-stranded 21-bp siRNAs were first introduced into mammalian cells, RNAi technologies have developed quickly and are now widely used as a standard method for gene silencing. The progress made in the present study is partially reflected by the chronicle of RNAi development as a genetic tool in mammals. This preliminary study demonstrated the difficulty in suppressing the S100A8 gene in cells that required stimulation for its expression.

However, it did provide some clues concerning how the S100A8 gene is regulated. Cell lines stably silencing the S100A8 gene were established using miRNA technology. This confirmed the ability of miRNA to suppress S100A8 mRNA expression in a tumor cell line. This is the first report of suppression of the S100A8 gene that has been upregulated by stimulation.

Because this was achieved in the last few months of the project, functional studies need to be done. However, this work provides the bases for future research that may provide clues to

S100A8’s role in cancer pathogenesis.

3.4.1 siRNA system to suppress murine S100A8

Initially, NIH3T3 cells were chosen because siRNA transfection of these cells had been established using Lipofectamine 2000 (Invitrogen, personal communication) and because

S100A8 was induced with FGF-2+heparin (378). Lipofectamine 2000 is a proprietary cationic lipid formulation that offers high plasmid transfection efficiencies in a variety of cell lines but at the time the project began, siRNA transfection had not been validated. Later, numerous successful siRNA transfections using this were reported in cells including NIH3T3 cells (1116) and RAW cells (1110). In LPS-activated macrophages, Lipofectamine 2000 may suppress

S100A8 gene induction (Figure 3-15B).

Transfection of siRNA into cells only transiently knocks down the gene of interest, and the transient nature is determined by the rate of growth. In actively dividing cells, duration of silencing is directly related to numbers of cell doublings. For example, in HeLa cells, which double approximately every 24 hours, a rate similar to NIH3T3 cells, maximum silencing is usually seen 48-72 hours post-transfection, depending on the gene targeted (1117). S100A8

161 mRNA in NIH3T3 fibroblasts activated with FGF-2+heparin is maximal 18 hours post- stimulation, is maintained for up to 36 hours and declines over 48 hours (378). In this study, effects of siRNA were estimated 48 hours post-transfection and 24 hours post-stimulation, which was within the optimal period for induction of S100A8 mRNA and silencing by siRNA.

None of the synthesized siRNAs effectively suppressed S100A8 induced in activated fibroblasts or macrophages (Figure 3-11, 3-15A, 3-19). The siRNA concentrations (10 nM- 100 nM) used were sufficient to suppress firefly luciferase gene expression in unstimulated fibroblasts (Figure

3-10). This range of siRNA concentrations was similar to those required to suppress other target genes in human HeLa cells and NIH3T3 cells (1087, 1118). Several factors may have contributed to inefficiency, including the siRNA design, the delivery system, the requirement for S100A8 induction, and possibly the cell type, particularly macrophages (1119). In addition, there may have been a specific siRNA effect, rather than a more general effect, such as effect of siRNAs on transfection efficiency or protein translation. To explore this possibility experiments using an additional control siRNA that did not target luciferase would be required.

Generally, the simplest system to test siRNA efficiency is to measure constitutively- expressed genes following siRNA transfection. In fact, the targets of siRNA in most initial reports were constitutively-expressed genes in untreated cells. At the time of this study, we did not have access to cells other than neutrophils that constitutively expressed S100A8. We chose not to use these because of their extremely high endogenous S100A8 mRNA levels, and together with their short half life, and the access of S100A8-negative neutrophils to two other groups who produced S100A9-/- mice (337, 338), we sought alternatives. S100A8 expression was reported in a murine skin cancer cells (498). However, we found that a murine skin cancer cell line (T79) did not express constitutive S100A8 mRNA (data not shown). Another approach to studying S100A8 function is to overexpress the gene but to date, no genetically-modified cell lines overexpressing S100A8 are reported. This was attempted in this laboratory using several strategies, but was unsuccessful at the time this study was performed, possibly because of potential cytotoxicity of the overexpressed protein (Hsu K unpublished data). Therefore,

162 induction was necessary, so that effects of suppression of S100A8 on cell function could be studied.

Chemically-synthesized siRNAs suppressed S100A8 mRNA in murine fibroblasts co- transfected with the S100A8 expression vector, whereas these did not efficiently suppress the gene in NIH3T3 cells activated with FGF-2+heparin. Consistent with these results, constitutive human S100A8 expression in a gastric cancer cell line was recently inhibited by siRNAs (599).

Our study indicated that stimulation may interfere with gene silencing. One plausible explanation may be an imbalance between degradation by siRNA and mRNA induction by stimulants, because siRNA is a post-transcriptional modification.

To date, no publications concerning this issue are available, although a recent review proposed mRNA concentration as a factor that affects efficiency of siRNAs (1120). One possible mechanism is saturation of RISC. siRNA associates with the multi-component RISC to allow cleavage of target mRNA. Thus degradation of mRNA could be limited by available levels of mature RISC. When expression levels of the target gene are low, or the gene is gradually induced, RISC may process most of the mRNA, whereas robustly-induced mRNA may not be adequately processed, resulting in apparent insufficiency of the siRNA. This may account for the variability seen, particularly with RAW cells. Our studies indicate that macrophages are unsuitable for assessing functions of S100A8 using siRNA knockdown.

Another problem is the inherent difficulties that many groups encounter in transfecting macrophages (1121).

The degree of confluence may be important in induction of S100A8 (95, 378). In this study, and despite the similar low levels of S100A8 mRNA expression seen in untreated cells

(data not shown), levels of S100A8 mRNA induction in NIH3T3 cells activated with

FGF2+heparin varied, possibly because of different confluence at harvest, even though efforts were made to standardize this. NIH3T3 cells were inoculated into wells one day prior to transfection, when the cells had reached confluence as confirmed microscopically. Important anti-mitogenic signals in non-transformed cells are mediated by cell-cell contacts, described as contact-dependent inhibition of growth (1122) and NIH3T3 cells are used as a model of contact

163 inhibition (887). Figure 3-12 shows an inversion relationship (R=0.857) between confluence and S100A8 mRNA levels induced by FGF2+heparin. Interestingly in this preliminary study, there was a trend of less suppression of S100A8 by siRNA in activated NIH3T3 cells in which

S100A8 levels were highly induced (data not shown). Increased density of RAW cells enhances

LPS-activated IFN signalling pathways (1112). This could have contributed to induction of

S100A8 mRNA, because IFN- enhanced S100A8 gene induction in LPS-activated macrophages (Figure 3-17), although equal numbers of viable RAW cells were seeded.

However, small difference in confluence may have influenced levels of LPS-induced S100A8 mRNA.

3.4.2 Enzymatically-synthesized siRNAs

Transfection of enzymatically-synthesised GAPDH siRNA reduced GAPDH levels in

NIH3T3 (Figure 3-13) and in RAW cells (Figure 3-16A). This result validated the transfection and methods used. However, GAPDH siRNA induced S100A8 mRNA in RAW cells, whereas chemically-synthesized siRNA did not (Figure 3-16B). Interestingly, some enzymatically- synthesized siRNAs for S100A8 also enhanced S100A8 induction in fibroblasts (Figure 3-11A,

3-11C) and macrophages (Figure 3-15), possibly due to the GTP at their 5’ end that can promote

IFN induction (1083), although this was present on all constructs. The siRNAs used were enzymatically-synthesized using T7 polymerase but T7 transcripts were not treated with RNase

T1 and alkaline phosphatase that was later an added procedure to remove GTP (1083). This suggested to us, that enzymatically-synthesized siRNAs may have triggered an IFN production.

Our preliminary experiments indicate that IFN- is not inducer, but an enhancer of S100A8 gene induction (Figure 3-17) in a manner similar to IL-10, PGE2 and cAMP (Section 1.10.3).

Enhanced S100A8 mRNA induction in LPS-activated RAW cells by IFN- may result in insufficiency of siRNA. Interestingly, transfection of enzymatically-synthesised GAPDH siRNA induced S100A8 in RAW cells without stimulation (Figure 3-16B), suggesting additional mechanisms. Quantitation of IFN levels in supernatants from macrophages transfected with siRNA and suppression with neutralizing antibodies would provide firmer

164 evidence. However as IFN- may only partially contribute, and there are numerous IFN- subtypes, we did not try this approach. Blocking of type 1 IFN receptors may be a better strategy. Confirmation of enhanced IFN- mRNA levels in response to GAPDH siRNA in the presence/absence of LPS stimulation, concomitant with increases in S100A8 mRNA levels over a time-course would also be informative. Also, gene chip analysis may identify signalling pathways associated with these responses. Some of these pathways will be investigated in Chapter

4.

3.4.3 miRNA_HuA8 did not suppress LPS- induced S100A8 in THP-1 cells

Consistent with the attempt to suppress S100A8 with siRNA in activated murine macrophages, S100A8 induction was not suppressed in LPS-activated human THP-1 cells stably-transfected with miRNA (Figure 3-22A, B). In fact, gene induction was enhanced above levels induced by LPS, in cells containing miRNA_HuA8_82 and _103. In marked contrast, induction was effectively inhibited by S100A8 miRNAs, but not by scrambled miRNA, following activation of a breast tumor cell line with OSM (Figure 3-24A), confirming the importance of the target cell types, and/or type and effects of the stimuli. This result validated the method used for generation and infection by lentiviral vectors carrying miRNA for human

S100A8.

S100A8 levels are elevated in serum from patients with HIV infection, an RNA virus

(478, 605, 611), although the source of the protein has not been determined. We rationalized that the S100A8 gene may be upregulated by dsRNAs, such as siRNA or RNA virus.

Interestingly, early attempts to use dsRNA to trigger gene silencing in mammalian cells failed because IFN genes were induced through activation of PKR and 2’- 5’- oligoadenylate synthase

(OAS) (1123, 1124). Introduction of siRNA also activates the IFN-mediated Jak-STAT pathways and PKR (1080). Thus a dsRNA-activated pathway may also affect S100A8 induction.

These studies, although inconclusive, led to the work presented in chapter 4 where we define the pathway of S100A8 gene induction by poly(I:C) in RAW cells.

165 Endogenous miRNA may be directly involved in TLR signalling because in human monocytic cells, LPS sharply upregulates three miRNAs: miR-146, miR-132 and miR-155. In primary murine macrophages, miR-155 is also induced by poly(I:C) and CpG via the MyD88- or TRIF-dependent pathways. In the present study, the transfected THP-1 cells would have overexpressed pre-miRNAs/miRNAs in addition to the endogenous pre-miRNAs/miRNA induced in response to LPS. Different levels of excess pre-miRNAs/miRNAs might have altered

S100A8 expression, possibly through altered levels of enhancers such as IL-10, COX-2 metabolites, and IFNs. Further studies are required to compare S100A8, IL-10 and IFNs expression in LPS-activated THP-1 cells expressing different levels of scrambled miRNA.

High levels of pre-miRNA expression may modify PKR activity and generate IFN in

THP-1 cells, even though these have imperfect complementarity in base pairing. To date, there are no publications showing activation of PKR by pre-miRNAs. However, given that 16 bp dsRNA is sufficient to bind PKR, and 21 bp dsRNA can activate the enzyme (1125, 1126), it is possible that overexpressed pri-miRNAs could activate PKR and generate a IFN response in

THP-1 cells. The IFN response was induced by shRNA constructs expressed from either plasmids or lentivial vectors (1127, 1128) and was independent of the target gene (1129). Single colonies selected by serial dilution of stably-transfected THP-1 cells would be required to generate homogenous cell lines and to compare levels of S100A8 and IFN- expression in response to LPS. Loss of miRNA expression without loss of blastidicine resistance gene may contribute to insufficient suppression and PCR should be performed to confirm miRNA sequences in these cells.

siRNA and miRNA may more efficiently suppress mRNA that is gradually induced.

The capacity of miRNA to degrade target mRNA may be limited by saturation of the nuclear export factor exportin 5, which transfers miRNA and/or short hairpin RNA (shRNA) from the nucleus to cytoplasm (1130). shRNA is an alternative RNA interference strategy triggered by small dsRNA consisting of two target-complementary 19- to 29-bp RNA sequences linked by a short loop of 4–10 nt, and this readily saturates exportin 5. Similar to shRNA and possibly siRNA, other factors such as components of miRISC may limit efficiency of RNAi. Thus, the

166 ability of miRNA to process target mRNA may depend on how robustly particular mRNAs are induced. Studies with OSM-activated MCF-7 cells may support this view.

3.4.4 Oncostatin M induces S100A8 in MCF-7 cells and is suppressed by miRNA

OSM is a member of the IL-6 cytokine family, and is produced mainly by activated macrophages, DC and T-lymphocytes. It is implicated in inflammation, remodeling of the ECM, hematopoiesis, organ development, and regeneration (1131-1133). OSM manifests its function through heteromeric receptor complexes with glycoprotein (gp) 130, the common receptor subunit for all IL-6 cytokines (1133, 1134). Binding of OSM to its cognate receptors activates receptor-bound Janus tyrosine kinases, leading to phosphorylation of the docking sites in SHP-2 and STAT. SHP-2 transmits the signal to the Ras/Raf/MEK/ERK cascade, and phosphorylated

STAT dimerizes and translocates to the nucleus, where it regulates gene expression by binding to its target sequences (1135). The Jak/STAT, ERK and PI3K pathways are also crucial for induction of S100A8 in macrophages activated by TLR ligands (Table 1-28, Chapter 4).

Although the pathways involved were not part of the current investigation, intriguingly, induction of S100A8 by OSM was inhibited by the PKR inhibitor, 2-aminopurine (2-AP)

(Figure 3-26). There are no reports demonstrating a role for PKR in OSM signalling but PKR may participate in the JAK/STAT and ERK pathways. PKR activated by PDGF in murine fibroblasts mediates phosphorylation of STAT3 by regulating ERK activation (1136, 1137) and a response in OSM-treated MCF-7 cells. In rodents, normal tissues do not express S100A8 despite their constitutive expression of OSM. S100A8 upregulation in MCF-7 cells in response to OSM may be relevant to its expression in human breast tumors (see Table 1-21).

In OSM-activated MCF-7 cells, S100A8 mRNA levels gradually increased over 72 hours (Figure 3-23), whereas gene levels in macrophages and fibroblasts activated with

LPS/FGF-2+heparin sharply peak at 12/24 hours (93, 378). In OSM-stimulated MCF-7 that stably expressed miRNAs the gene was effectively reduced by 90-95% (Figure 3-24A), compared with scrambled control. It is noteworthy that S100A9, and to some extent S100A12

167 mRNAs, were also suppressed. Although this might simply reflect off-target effects, this also suggests that human S100A8 may regulate their expression (Figure 3-24B). Intriguingly, in a human gastric cell line, siRNAs for S100A8 and S100A9 inhibited MMP-2 expression (599).

The S100A8/S100A9 complex was purified from nuclei of spleen cells (177), and is found in electron-dense parts of nuclei in myelomonocytes (347) and in THP-1 and HL-60 differentiated to neutrophils (529). Strong S100A8 nuclear staining is also seen in murine keratinocytes activated by UVA (412). Together, these observations suggest an intra-nuclear role for S100A8 in gene transcription. The potential suppression of the S100 proteins, relative to -actin expression requires confirmation at the protein level. It would be worthwhile examining other members of the S100 family, because these may be regulated by a common regulatory factor

(Section 1.9), and other genes associated with inflammation. Gene arrays in cells where S100A8 expression is silenced may provide more clues to a possible nuclear function.

3.4.5 Inhibition of S100A8 mRNA did not affect OSM-induced growth inhibition

The high-affinity receptor specific for OSM is expressed on normal and malignant mammary epithelial cells (1138). OSM arrests growth of some cell types such as normal and neoplastic human breast epithelial cells and meningioma, but enhances growth of others

(reviewed in (1139)). Moreover, the signalling pathway required for OSM-induced growth inhibition is different in cell lines. For example, OSM inhibits growth of MCF-7 and T47D mammary epithelial cell lines by activating STAT3 (1115, 1140), whereas the MEK/ERK pathway is critical for inhibition of MDA-MB231 cells (1141), suggesting different expression patterns of downstream effectors. Interestingly, S100A9 is also induced by OSM in MCF-7 cells and induction is markedly reduced in cells stably-expressing a dominant-negative mutant of

STAT3 (693). Inhibition of S100A9 with siRNA alleviated the growth repression induced by

OSM, suggesting involvement of the STAT3-signalling cascade (693). In contrast, suppression of S100A8 induction did not affect OSM-induced growth inhibition (Figure 3-25), suggesting that S100A8 may not be crucial in this process. Additional studies are required because cells stably-expressing miRNAs also had reduced levels of S100A9 although growth was normal.

168 Time-course studies to define mRNA and protein levels of S100A8 and S100A9, and viability/apoptosis particularly at late-time points, would be informative.

3.4.6 miRNA and tumor cell lines

Endogenous miRNAs may be associated with tumor differentiation. For example, 19 miRNAs in brain tissue are downregulated in human and mouse cells, whereas expression is upregulated during neuronal differentiation (1142). Similarly, treatment of the myeloid leukemia cell line HL-60 with retinoic acid for 5 days induces 59 miRNAs coincident with differentiation (1143). Therefore, a general down-regulation of miRNAs in tumors, and an upregulation of these same miRNAs during differentiation imply that their expression reflects the state of differentiation of cancer cells. S100A8/S100A9 also may involve in tumor differentiation (504). Potential competition with endogenous miRNAs and introduced miRNA may alter differentiation of tumor cells, leading to differences in S100A8 function. This could be misleading in interpretation of results from experiments using miRNAs. Potential relationships between miRNA and the S100A8 gene in tumor differentiation may be worth examining. More in-depth studies are required to elucidate the potential involvement of pre- miRNAs and/or endogenous dsRNAs which could activate PKR.

As the data with miRNA was generated at the end of the PhD period, additional studies were not possible. Several undetermined factors would essentially affect interpretation of results in this section, and some unresolved issues relative to S100A8 gene suppression still remained. However, we demonstrated the possibility of suppressing S100A8 in a stimulated cell line. This opens possibilities for new studies concerning the role of S100A8 in various cancers, such as prostatec cancer (642), breast cancer (89, 643) and lung cancer (634). Successful establishment of lentiviral technology in our laboratory will contribute to understanding gene regulation of this S100 protein.

169 4. GENE REGULATION OF S100A8 BY dsRNA

4.1. Introduction

Preliminary studies described in Chapter 3 suggested that S100A8 may be induced by dsRNAs in murine fibroblasts and macrophages. Most natural dsRNAs are synthesized in virus- infected cells as by-products of viral replication or transcription (1144). S100A8/S100A9 is associated with viral infections such as human papilloma viruses 18 (1145), and HIV-1. In particular, the elevated serum levels in HIV-1-seropositive patients with advanced immunodeficiency (478, 605, 611) and correlate with the onset of, and with ongoing, opportunistic infections (490, 660, 661), which frequently result in enhanced viral load

(reviewed in (1146)). However, mechanisms of elevation of S100A8, or cells involved are unknown.

The last decade has seen an explosion of knowledge regarding mechanisms of cellular recognition of microbial pathogens, and several families of pattern recognition receptors (PRRs) survey the cell micro-environment for viral infection (819). Based on the observations in

Chapter 3, and the likely clinical relevance, we felt it worthwhile to examine involvement of dsRNA signalling in S100A8 regulation, and the pathways involved.

Macrophages engulf and destroy viruses; the subsequent phagocytosis triggers production of pro-inflammatory cytokines and mediators and ROS generation (Section 5.1.2).

Among the anti-viral factors released, the type 1 IFNs play a crucial role and there are numerous pathways that elicit IFN-/ expression with several sensors of viral infection, either in infected cells and/or by cells exposed to viral products. Type 1 IFNs regulate a range of responses through activation of its receptors, leading to transcription of >100 IFN-stimulated genes (ISGs), that together lead to “antiviral state” (reviewed in (1147)).

Specific immunity involves production of antibody by B lymphocytes and the activities of cytotoxic T cells following processing and presentation of viral antigens.

Macrophages play a crucial role in antigen processing and presentation of degraded viral antigen peptides through MHC II receptors to CD4+ T-cells. IL-12 and IL-18 produced by activated macrophages are predominantly involved in this response (1148). Effective T-cell

170 responses are crucial for clearance of viral infection, because in cases when virus-specific CD4+ and CD8+ T cells are either physically deleted, or become functionally unresponsive, the ability to produce an antiviral response and immunostimulatory cytokines is lost (1149).

4.1.1. Double-stranded RNA and cell signalling

Many viruses produce dsRNA during their replication cycle. It is either genetic material for RNA viruses, an essential intermediate, or a byproduct of viral RNA synthesis. dsRNA is a potent and global modulator of mammalian gene induction. It activates transcription of ISG.

Several mechanisms initiate dsRNA-mediated signalling. In addition to TLR3, intracellular dsRNA-binding proteins are potential candidates, such as dsRNA-dependent protein kinase

(PKR), 2’- 5’ oligoadenylate synthetase (2’-5’ OAS) and the retinoic acid-inducible gene I

(RIG-I)-like RNA helicase receptor family (819, 1150). Why a cell needs different mechanisms to recognize dsRNA is unclear, because signals converge to activate MAP kinases, NF-B and

IRF-3, although the points of convergence, and overlaps of mediators essential for the individual pathways are still being elucidated. Interestingly, different gene profiles are induced by poly(I:C) (polyinosinic acid-polycytidylic acid), a synthetic dsRNA analog that generates similar effects to viral dsRNA in vitro through TLR3, or by Sendai virus infection through RIG-

I, with only a couple of similar genes induced by each pathway (1151). These indicate subtle differences following TLR3, PKR or RIG-I signalling. These receptors for dsRNA may co- operate because there are distinctions between them, particularly their different cellular expression patterns and subcellular localization. For example, dsRNA is typically a cytoplasmic intermediate and, therefore, might not be expected to be accessible to TLR3, which surveys the extracellular or endosomal compartments in macrophages and myeloid DCs. This compartmentalization of TLR3 may have evolved to limit access to host dsRNA (e.g. ribosomal

RNA, heterogeneous nuclear RNA, tRNA, siRNAs or microRNAs), because host RNA can also trigger immune responses if it is recognized by TLRs (819). On the other hand, PKR and RIG-I are constitutively expressed in the cytoplasm of many cell types and RIG-I is inducible by

171 viruses and cytokines. Further investigation is needed to provide more insights into the specific roles of these dsRNA receptors.

Toll-like receptor 3 (TLR3)

TLR3 recognizes dsRNA, but is not involved in antiviral responses to all RNA viruses, even though dsRNA is regarded as an almost universal RNA-viral PAMP (1152, 1153). DNA viruses can also trigger TLR3 signalling because of production of complementary mRNAs; these are encoded by partially-overlapping genes located on the opposite strands of the viral genome. Long viral polycistronic mRNAs often contain many stable double-stranded stems that may be sufficient to activate TLR3 (1154). TLR3 triggers MyD88-independent signalling, since activation of NF-B and subsequent production of inflammatory cytokines was demonstrated in

MyD88-/- mice (759, 778). IRF3 is also activated, leading to expression of IFN- and IFN- inducible gene products (Figure 4-1, Section 1.10.2.1).

Figure 4- 1: TLR3 Signalling

(adapted and modified from (1155))

172 dsRNA-dependent protein kinase (PKR)

PKR is a prototypic member of the dsRNA-binding protein family and mediates some of the immunostimulatory activities of dsRNA. Before discovery of TLR3, PKR was thought to mediate cell recognition and responses to dsRNA. However, PKR -/- mice have little impairment in responses to viral infection, or to synthetic dsRNAs, such as poly(I:C) (1156, 1157), and additional pathways were indicated. TLR3 -/- mice have partially impaired responses to dsRNA and poly(I:C), but still retain responsiveness to dsRNA (778), indicating TLR3-dependent and - independent mechanisms (778, 830, 1158). Moreover, non-plasmacytoid DC, in which TLR3 is not expressed, can respond to lymphocytic choriomeningitis virus (LCMV) infection or transfected dsRNA, and produce high levels of type I IFNs. This is partially dependent on PKR, but not TLR3 (1159). Therefore, it is still unclear whether PKR is involved in TLR3- independent responses to dsRNA, and other molecules, such as RIG-I, may mediate this.

Generation of mice lacking both TLR3 and PKR may help clarify additional links in dsRNA recognition.

PKR is a Ser/Thr protein kinase implicated in control of cell growth and proliferation, and has a tumor suppressor function (1160-1162). Its expression can vary in a time- and tissue- specific manner. Human PKR (62 kDa) consists of a 20 kDa N-terminal RNA-binding domain, comprising two dsRNA binding motifs (dsRBMs) linked by 20 amino acids (1162-1164)

(Figure 4-2). dsRBMs are commonly found in dsRNA-binding proteins that do not require specific dsRNA sequences for binding (1165-1168). These motifs require only 16 bp of dsRNA to bind, whereas activation of the enzyme requires a longer duplex region (1125, 1126).

Third basic eIF-2 kinase region insert region dsRBM1 dsRBM2

1 170 273 551 R egulatory dom ain Catalytic kinase domain (dsR B D )

Figure 4- 2: Domain map for the dsRNA-dependent protein kinase, PKR

(from (1163))

173 Recent studies indicate that siRNAs, which were 19 bp duplex RNAs with 2 nt 3’ overhangs, activated PKR in vitro (1080, 1081). The C-terminus contains the kinase domain.

PKR is induced by type I IFNs and is synthesized in a latent, inactive form that requires association with dsRNA or other activator molecules such as various growth factors (PDGF), cytokines (TNF-, and IL-1, IL-3)(1137, 1169), IFN- (1137, 1170, 1171) (Figure 4-3). PKR can also be activated by polyanions (heparin, dextran sulfate, chondroitin sulfate, and poly-L- glutamine) (1172), a range of stressors (arsenite, thapsigargin, and H2O2) and the second messenger ceramide (1173, 1174).

TLR Cytokines Growth receptors (dsRNA, LPS, CpG) (TNFᔽ, IL-1) (PDGF)

PKR IFN-ᔿ Virus Activation ( VV, adenovirus, HSV)

Cellular stressors Polyanions (arsenite, thapsigargin, (heparin, dextran sulfate, chondroitin sulfate, poly-L-glutamine) H2O2, ceramide )

Figure 4- 3: Activators of PKR

(Adapted and modified from (1175)). HSV, herpes simplex virus; PDGF, platelet-derived growth factor; VV, vaccinia virus

Binding of an activating ligand is thought to facilitate PKR self-association and autophosphorylation in an ATP-dependent manner, leading to phosphorylation of the -subunit of the eukaryotic translation initiation factor 2 (eIF2) (1082), and subsequent inhibition of protein synthesis. This suppresses viral replication and may ultimately lead to cell death by apoptosis (1176, 1177).

PKR can also regulate major signalling pathways. The MAPK activator MKK6 is specifically activated by PKR-mediated phosphorylation, to trigger the MAPK pathways (1178).

174 PKR has TRAF-interacting motifs through which several members of the TRAF family interact with dimerized, activated PKR (1154). Thus, dsRNA binding to PKR promotes dimerzation and recruitment of TRAFs, which can link both the IKK and MAPK activation pathways (1179).

PKR also participates in MyD88-independent signalling triggered by TLR3 (1180) and MyD88- dependent- and independent pathways by TLR4 (1181). Recently, TRAF3 was shown to be required for activation of NF-B, and to produce type I IFN downstream of TLR3, -4, -7, and -9 activation through association with PKR (867, 1182). PKR-/- mice/cells display severely defective activation of NF-B in response to LPS, indicating PKR as an intermediary in TLR4 signalling (846, 1169). PKR is recruited and phosphorylated in the TLR4 pathway by the adaptor protein Mal (1154, 1181). PKR is also phosphorylated and activated in response to CpG

(1181), suggesting involvement in TLR9 signalling. PKR activated by PDGF also plays a critical role in signalling by mediating phosphorylation of STAT3, and as proposed for STAT1,

PKR also regulates ERK activation, ultimately involved in STAT3 phosphorylation (1137).

Interestingly, many viruses have developed ways of counteracting the induction, or effects, of IFN, particularly to avoid the deleterious effects generated by PKR activation (1183).

Some viral proteins interact with the PKR pathway at different levels, such as by inhibiting

PKR activation, sequestering dsRNA, inhibiting PKR dimerization, synthesizing PKR pseudosubstrates, activating antagonist phosphatases, or degrading PKR.

To date, there are no reports connecting S100A8 regulation with PKR. However, this would be interesting to explore, because some PKR activators are inducers or enhancers of its expression in various cell types. For example, IFN-, IL-1 and TNF- induce S100A8 in murine macrophages (93); heparin enhances FGF-2-induced S100A8 in fibroblasts (378). Examining

PKR involvement may provide clues to mechanisms of the inefficiency of siRNA in attempts to silence S100A8 mRNA induction (Chapter 3).

2’-5’ oligoadenylate synthetase and retinoic acid-inducible gene I (RIG-I)

2’-5’OAS mediates activation of the latent endoribonuclease, RNAse L which cleaves cellular and viral RNAs, thereby inhibiting initiation of protein synthesis (1082, 1184-1187). 2’- 175 5’OAS is activated by genomic viral dsRNA molecules or viral dsRNA replicative intermediates formed during viral replication (1188, 1189). It is implicated in the antiviral action of IFN as RNase L-/- mice require this enzyme for IFN-dependent antiviral functions

(1190). Overexpression of 2’-5’OAS is sufficient to protect cells against infection with picornaviruses (1191, 1192) and HIV (1193). Interestingly, expressing short hairpin RNA

(shRNA) can induce 2’-5’OAS (1128), suggesting the potential capacity of the 2-5A system to be activated by siRNA.

The RIG-I-like RNA helicase receptor (RLH) family comprises RIG-I, melanoma differentiation-associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP-2)

(1194-1197). The mouse homolog of MDA5 is termed Helicard (1198). These belong to the

DExD/H box family of helicases that unwind dsRNA and are found ubiquitously in cytoplasm.

There seems to be specificity for viral RNA recognition because in most cell types, RIG-I is essential for recognition of poly(I:C) and 5’-triphosphate-containing viral RNAs, such as

Newcastle disease virus, vesicular stomatitis virus (VSV), Sendai virus and influenza virus;

MDA5 is a sensor for picornavirus and poly(I:C) (1199). RIG-I and MDA5 are positive regulators of dsRNA-signalling, whereas LGP-2, which lacks a downstream signalling domain, is a negative regulator of RIG-I (1200).

In the resting state, RIG-I is a monomer, silenced by intra-molecular interactions with its repressor domain. Upon ligand recognition, RIG-I undergoes a conformational change in an

ATP-dependent manner, allowing self-association and initiation of signalling leading to type-1

IFN and pro-inflammatory cytokine production (819).

4.1.2. Hypothesis

dsRNA induces S100A8 gene

4.2. Material and methods

All general methods are described in Chapter 2. Other materials relevant to this work presented in this Chapter are given here.

176 4.2.1. Monocyte isolation of from human peripheral blood

Human monocytes were isolated from peripheral blood of healthy subjects as described in detail (1201). Briefly, peripheral blood mononuclear cells (PBMC) were depleted of erythrocytes and neutrophils by sedimentation on 4.5% dextran solution for one hour, then centrifuged over Ficoll-Plague PLUS according to the modified method of Böyum (1202) and

Tedla (1203). Aliquots of PBMC were analyzed using a Beckman Coulter Counter and generally contained ~10% monocytes, ~90% lymphocytes and <1.5% granulocytes. PBMC

(0.25106/well) were dispensed into 24-well plates (Costar), then incubated in culture medium

(described in Table 4-1) at 37ºC for 4 hours. After rinsing to remove non-adherent lymphocytes, monocytes were cultured overnight in RPMI 1640 supplemented with 10% (v/v) heated (56°C,

30 min) autologous human serum (Table 4-1). Cells were generally activated with particular stimulants after replenishing with fresh culture medium 24 hours after seeding.

Table 4- 1: Culture conditions of primary cells

PBMC Peritoneal macrophages Species human mouse Culture medium RPMI 1640 RPMI 1640 + 10% autologous serum + 2% BCS + 2 mM L-glutamine + 2 mM L-glutamine + P/S + P/S Inoculated cell density on 24-well plate (cells/well) ~2.5106 PBMCs/500 l (Costar) 0.5106/500l (Nunc) P/S, 100 U/ml penicillin+ 100 g/ml streptomycin; BCS, heat-treated bovine calf serum

4.2.2. Murine peritoneal macrophages

All animal experiments were done with approval from the Animal Care and Ethics

Committees, University New South Wales. C57BL/6 mice or C57BL/6-IL-10-/- mice (6–8 weeks old) were maintained under specific-pathogen free (SPF) conditions in accordance with the recommendations of the Australian Code of Practice for Care and Use of Animals for

Scientific Purpose (1997), Animal Research Act (1985) and Regulations (1995). Resident peritoneal cells were lavaged with cold RPMI 1640. Washed cells in 24-well plates were

177 incubated for 2 hours, washed 3 times with warm PBS to remove non-adherent cells, and equilibrated in RPMI 1640 with 2% BCS overnight. Thioglycollate (TG)-elicited macrophages were obtained as described (93, 406). Briefly, C57BL6 mice or C57BL6-IL-10-/- mice were injected intra-peritoneally with 2 ml 10% TG broth and 4 days later peritoneal exudate cells

(PEC) lavaged with cold RPMI 1640 (15 ml) containing 3.8% sodium citrate. Cells were dispensed into wells of 24-well plates as described in Table 4-1, incubated in RPMI 1640 without serum for 2 hours, washed 3 times with warm PBS to remove non-adherent cells, and equilibrated in RPMI 1640 with 2% BCS overnight. Medium was replenished before activation.

Populations contained ~98% macrophages (~98% viable by Trypan blue exclusion), and ~0.3% neutrophils by differential staining.

4.2.3. Influenza virus infection to BALB/c mice

Viral stock and infection procedures were as described (1204). Briefly, stocks of influenza virus A/Japan/305/57 (A/Jap, H2N2) were grown in embryonated eggs. Virus-containing allantoic fluid was harvested and stored in aliquots at -70°C. Virus content was determined by hemagglutination assay using erythrocytes from Gallus domesticus. Influenza virus infection was established by inoculating 2,2,2-tribromoethanol (Avertin)- anesthetized BALB/c female mice, 6 to 8 weeks old, intranasally with 50 hemagglutination units of virus. Mice were weighed prior to infection and then daily. Survival was monitored for 30 days. These experiments were kindly performed by Alison Budd and Professor Ian Clark (Australian National University,

Canberra, Australia).

4.2.4. Immunohistochemistry

Procedures for immunohistochemistry were as described (1205). Briefly, formalin-fixed tissue samples from murine lung (influenza infected) or human lung (SARS infected) were embedded in paraffin, sectioned onto polylysine-coated slides, and stained with haematoxylin and eosin (H&E) for routine morphology. Polyclonal anti-murine or anti-human S100 IgG and control IgG were used as appropriate, and in another control the primary antibody was omitted.

178 The antibodies to murine S100A8 do not cross-react with S100A9 or S100B are as described

(1206). Similarly anti-human S100A8 IgG does not cross-react with S100A9 or S100A12 and are described by McCormick et al (368). Antigen retrieval was performed by immersion in 0.01

M citrate buffer, pH 6.0, in a waterbath at 95°C for 20 minutes and cooled to room temperature while still immersed in buffer (1207). After quenching with 3% H2O2 and treating with primary antibody (dilution of stock solution, 1:500 to 1:4000) at room temperature for 1 hour, biotin- conjugated secondary antibody and streptavidin-conjugated horseradish peroxidase from an

LSAB+ kit (DAKO) were applied to sections for 20 minutes at room temperature to amplify the antigen signal for subsequent 3,3'-diaminobenzidine (DAB) staining. Known positive controls were stained in each run, and runs were often duplicated on different days to confirm repeatability. Sections were counterstained with haematoxylin. Cell-types were identified morphologically based on haematoxylin staining. These experiments were kindly performed by

Alison Budd and Professor Ian Clark (Australian National University, Canberra, Australia).

4.3. Results

4.3.1. Synthetic double stranded RNA induces S100A8, but not S100A9

Because results in Chapter 3, Section 3.4.2 (Figure 3-16B) suggested that siRNA may upregulate S100A8 in macrophages, we considered this aspect in more depth. We tested whether S100 proteins were upregulated by stimulation of macrophages using synthetic dsRNA.

Responses of murine RAW cells were compared to levels of activation by 20 ng/ml LPS.

Poly(I:C, 50 g/ml) directly induced S100A8 mRNA ~466 fold above control levels, compared to ~ 37-fold increase by LPS (Figure 4-4A). S100A8 in supernatants (0.48±0.68 g/106 cells with 10 g/ml poly(I:C) and 1.98±0.72 g with 50 g/ml) reflected this increase and the latter were 3-fold higher than protein in supernatants from cells stimulated by LPS (100 ng/ml)

(Figure 4-4B). Poly(I:C) markedly amplified S100A8 mRNA in the presence of LPS (Figure 4-

4C). S100A8 mRNA levels in RAW cells stimulated with 10 g/ml poly(I:C) alone, or 20 ng/ml

179 LPS alone, were 4- and 49-fold above control levels respectively. When combined, induction increased ~447-fold.

0.8 A 3 * B ** 0.6

cells) 2 6 0.4

1 0.2 S100A8 (µg/10 S100A8 Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 0 Ctr LPS 10 50 10 50 10 50 Ctr 20 100 10 50 10 50 10 50 Poly C Poly I Poly (I:C) LPS Poly C Poly I Poly (I:C)

250 C 200

150

100

50

Relative S100A8 / HPRT mRNA ratio HPRT mRNA / S100A8 Relative 0 Poly(I:C) - 10 - 10 LPS - - 20 20

Figure 4- 4: Induction of S100A8 mRNA by poly(I:C), poly C and poly I

(A) RAW 264.7 macrophages were incubated with 10 or 50 g/ml of poly(I:C), poly C or poly I. Controls include untreated, or 20 ng/ml LPS. Cells were harvested 24 hours post-stimulation and S100A8 mRNA quantitated by real-time RT-PCR; HPRT was endogenous control. Data represent means (relative to HPRT mRNA levels) ± SD of duplicate measurements from at least 3 independent experiments. * P < 0.05 compared to relative S100A8/HPRT mRNA ratio of untreated cells. (B) S100A8 in RAW cell supernatants quantitated by ELISA. RAW cells were stimulated with poly(I:C), poly C, poly I (10 or 50 g/ml) or LPS (20 or 100 ng/ml) for 36 hours. **P<0.01 compared to untreated cells. (C) RAW cells were stimulated with 10 g/ml poly(I:C) ± 20 ng/ml LPS for 24 hours. mRNA levels relative to HPRT were quantitated. Data represent S100A8 mRNA relative to poly(I:C)-stimulated samples, and means ± SD of duplicate measurements from at least 3 independent experiments.

A poly(I:C) at a dose of 50 g/ml was used for most subsequent experiments. Figure 4-

4A shows that synthetic single-stranded RNA at this dose caused weak responses; poly C and poly I increased S100A8 mRNA up to ~9-fold and ~29-fold above control levels, respectively, whereas poly(I:C) promoted a ~470-fold increase. S100A8 mRNA induction by poly(I:C) was evident after 8 hours and increased to 24 hours when the response was maximal and gradually declined over 48 hours (Figure 4-5A). In contrast, S100A9 mRNA was not induced by poly(I:C) at any time point, or in any experiment (not shown).

180 100 100 A B 80 80

60 60

40 40

20 20 % of % Maximal S100A8 Response mRNA 0 Response mRNA IL-10 Maximal of % 0 01224 36 48 04 8 12 16 hours hours

Figure 4- 5: Poly(I:C)-induced S100A8 mRNA is later than IL-10 mRNA induction

RAW cells were treated with 20 g/ml poly(I:C) for the indicated times. S100A8 (A), IL-10 (B) mRNAs were quantitated as given in Figure 4-4. Maximum mRNA induction by poly(I:C) was denoted as 100% maximal response. Data represent means ± SD of duplicates from 3 independent experiments.

4.3.2. Characterization of poly(I:C) – induced S100A8 expression

Given that the LPS induces S100A8 through IL-10 and PGE2/cAMP-dependent pathways (94), we tested whether the poly(I:C) response was dependent on these. Suppression of COX-2, the rate-limiting enzyme for prostanoid production, by the specific inhibitor (NS398), which reduces the LPS-stimulated response by 60% (94), was not significant, and reduced by only 10% (Figure 4-6A). Among the MAP kinase inhibitors, the JNK inhibitor (SP600125)

2.5 1.0 A B 2.0 0.8

1.5 0.6

1.0 0.4

0.5 0.2 Relative mRNA relative to HPRT ratio HPRT to relative mRNA Relative

ratio mRNA HPRT / S100A8 Relative 0 * * 0 Poly(I:C) -+-+-+-+-+-+ -+-+-+-+ Poly(I:C) - 50 - 50 SP600125 8 6 0 5 - - 10 10 9 2 9 2 3 1 1 1 S 0 2 0 N U 0 0 2 B P6 S S Figure 4- 6: Pathways involved in Poly(I:C)-activated S100A8 are different to that of LPS

(A) RAW cells were pretreated with DMSO (vehicle control), NS389 (10 M), U0126 (2.5 M), SB202190 (2.5 M), SP600125 (10 M); then untreated or stimulated with poly(I:C) (50 g/ml),mRNA levels relative to HPRT were quantitated. Data represent S100A8 mRNA relative to poly(I:C)-stimulated samples without inhibitors; means ± SD of 3 separate experiments given. * P < 0.05 compared to relative S100A8/HPRT mRNA ratios of poly(I:C) stimulation alone. (B) RAW cells were pretreated with SP600125 (10 M); then untreated or stimulated with poly(I:C) (50 g/ml) for 4 hours, mRNA levels relative to HPRT were quantitated. Data represent COX-2 (open bar) or IL-10 (solid bar) mRNA relative to poly(I:C)-stimulated samples without inhibitors; means ± SD of 3 separate experiments given.

181 partially blocked COX-2 and IL-10 expression (Figure 4-6B). However it did not suppress poly(I:C)-induced S100A8 mRNA and Figure 4-6A shows it caused some enhancement. Figure

4-6A shows that the p38 (SB202190) and ERK inhibitors (U0126) almost abolished S100A8 induction. These results indicate that S100A8 mRNA induction by poly(I:C) was likely to be

PGE2-independent and dependent on a p38 and ERK-mediated pathway and the JNK pathway was unlikely to be involved.

IL-10 does not directly induce S100A8 mRNA but is essential for, and increases the

LPS-activated response (94). IL-10 significantly enhanced the poly(I:C)-activated response 5- fold at the mRNA (Figure 4-7A), and 3-fold at the protein level (Figure 4-7B). IL-10 mRNA induction in RAW cells activated with poly(I:C) was evident after 2 hours and increased to

8hours when the response was maximal and ~30-fold above control levels, then gradually declined over 16 hours (Figure 4-5B). An optimized dose (94) of a neutralizing anti-IL-10 mAb suppressed relative IL-10 mRNA levels by 70% (Figure 4-7A), supporting IL-10 involvement in induction by poly(I:C). To confirm the role of IL-10, resident peritoneal macrophages from

IL-10 -/- mice were tested. Figure 4-7C shows significant S100A8 mRNA induction by LPS and

8 5 1 ** A B C 4 * 0.8 6 * 3 0.6 4 2 * 0.4 2 1 Relative secreted S100A8 Relative 0.2

Relative S100A8/ HPRT mRNA ratio mRNA HPRT S100A8/ Relative Relative S100A8 / HPRT mRNA ratio mRNA HPRT / S100A8 Relative * 0 0 0 Poly(I:C) -+-+ -+-+ Poly(I:C) -+-+ -+-+-+-+ Untreated LPS Poly(I:C) IL-10 IL-10 Anti-IL-10 Ab Figure 4- 7: S100A8 induction is IL-10-dependent

(A) RAW cells were untreated or stimulated with poly(I:C) (50 g/ml); cells were co-incubated with IL- 10 (10 ng/ml) or anti-IL-10 mAb (10 ng/ml) and mRNA levels relative to HPRT quantitated. Data represent S100A8 mRNA relative to poly(I:C)-stimulated samples without IL-10; means ± SD of 3 separate experiments (B) S100A8 in supernatants of RAW cells co-treated with IL-10 (10 ng/ml) ± poly(I:C) (50 g/ml) for 36 hours. Data represent S100A8 protein level relative to poly(I:C)-stimulated samples; means ± SD of duplicate measurements from at least 3 independent experiments. * P < 0.05 compared to poly(I:C) alone. (C) Peritoneal macrophages from wild-type C57/BL6 mice (open bars) or IL-10 -/- mice (solid bars) untreated or stimulated with LPS (20 ng/ml) or poly(I:C) (50 g/ml) for 24 hours and mRNA levels relative to HPRT quantitated. Data represent S100A8 mRNA relative to poly(I:C)-stimulated samples; means ± SD of 3 separate experiments given. * P < 0.05, ** P < 0.01 compared to wild-type mice

182 poly(I:C) in macrophages from wild type mice. In marked contrast, induction by poly(I:C) or

LPS in IL-10 -/- macrophages was 6.1- or 2.1-fold less than that in wild type mice, respectively

(p<0.01 compared to wild type macrophages). S100A8 mRNA levels induced by these agents in

IL-10-/- macrophages were ~2 fold more, but not significantly different to those in unstimulated samples. This experiment confirmed that S100A8 induction by poly(I:C) was IL-10-dependent, and that poly(I:C) also activates primary macrophages.

4.3.3. Protein kinase R mediates poly(I:C)-induced IL-10 and S100A8 mRNA

Poly(I:C) can also signal through a TLR3-independent pathway via PKR (Section 4.1.1)

To test its involvement, 2-aminopurine (2-AP) was used. This inhibitor competes for ATP at the

ATP-binding site of PKR and thereby inhibits autophosphorylation (1009). S100A8 mRNA levels induced by poly(I:C) in RAW cells were significantly inhibited by 2-AP by 90% (Figure

4-8A), and protein levels by 90% (Figure 4-8B). Interestingly, IL-10 mRNA was almost

1 1.0 A B 0.8 0.8

0.6 0.6

0.4 0.4

0.2 Relative secreted S100A8 0.2 * * 0 *

Relative S100A8 or IL-10/ HPRT mRNA ratio mRNA HPRT IL-10/ or S100A8 Relative 0 Poly(I:C) - 50 - 50 Poly(I:C) - 50 - 50 2-AP - - 4 4 2-AP - - 4 4

6 C Figure 4- 8: PKR is implicated in S100A8 mRNA upregulation.

4 (A) RAW cells were untreated or pretreated with 2- aminopurine (2-AP, 4 mM) and then untreated or stimulated with poly(I:C) (50 g/ml) for 8 hours (IL-10 mRNA, solid 2 bar) or 24 hours (S100A8 mRNA, open bars). (B) S100A8 in supernatants of RAW cell pretreated with 2-AP, then stimulated with poly(I:C) for 36 hours. Data represent Relative S100A8/ HPRT mRNA ratio HPRT mRNA S100A8/ Relative 0 Poly(I:C) - 50 - 50 S100A8 protein level relative to poly(I:C)-stimulated 2-AP - - 4 4 samples; means ± SD of duplicate measurements from at least 3 independent experiments. * P < 0.05 compared to poly(I:C) alone. (C) RAW cell pretreated with 2-AP were untreated or stimulated with poly(I:C) in presence (solid bars) or absence (open bars) of IL-10 (10 ng/ml) for 24 hours. mRNA levels relative to HPRT were quantitated. For A and B, data represent mRNA levels relative to poly(I:C)-stimulated samples without inhibitors. Means ± SD of 3 separate experiments are given. * P < 0.05 compared to poly(I:C) alone.

183 abolished by 2-AP by 8 hours post-stimulation (Figure 4-8A). Suppression of S100A8 mRNA by 2-AP was restored to levels induced by poly(I:C), and were 43% of the levels induced by poly(I:C) plus exogenous IL-10 (Figure 4-8C). Thus PKR may contribute to S100A8 gene upregulation via its effects on IL-10 but other downstream mediators may also be involved.

4.3.4. IFN- enhanced S100A8 induced by poly(I:C)

In LPS-activated RAW cells, IFN- synergized with LPS to enhance S100A8 mRNA induction (Figure 3-17). To confirm a potential effect of IFN- in the poly(I:C)-mediated response, RAW cells were incubated with anti-IFN- mAb or IFN-. The dose of anti-IFN- mAb was initially optimized by measuring effects of various doses on iNOS mRNA induction by IFN-. Figure 4-9A shows that the anti-IFN- mAb suppressed iNOS mRNA by 81.1%, whereas S100A8 mRNA was suppressed by only 36.6% but reduction was statistically significant (P<0.05 compared to poly(I:C) alone). S100A8 mRNA was potentiated by 20 U/ml or 100 U/ml IFN-, increasing 1.9-, or 2.6-fold (Figure 4-9B). The results indicate the IFN- may contribute to the poly(I:C)-mediated induction of S100A8 and that IFN- can synergize with dsRNA and with LPS.

1.0 3 A * B 0.8 2 0.6

40 * 1 0.2 Relative S100A8/ HPRT mRNA ratio mRNA HPRT S100A8/ Relative 0 0 Relative iNOS or S100A8/ HPRT mRNA ratio mRNA HPRT S100A8/ or iNOS Relative Poly(I:C) - 50 - 50 PIC - 50 - 50 50 Z IFN-ᔾ - - 100 20 100 Anti IFN Ab - - 4000 4000

Figure 4- 9: IFN- involved in S100A8 induction by poly(I:C)

RAW cells were untreated or stimulated with poly(I:C) (50 g/ml) in absence or presence of anti-IFN- mAb (4000 NU/ml) (A). One neutralization unit (NU) is the amount of antiserum required to neutralize one unit of mouse IFN-. Eight hours post-stimulation, iNOS mRNA (open bars) or S100A8 mRNA (solid bars) levels relative to HPRT were quantitated. To determine effects of IFN- (B), RAW cells were incubated with the indicated dose of IFN- (U/ml) ± poly(I:C). Data represent S100A8 mRNA relative to poly(I:C)-stimulated samples; means ± SD of 3 separate experiments given (A). *p<0.05 compared to poly(I:C) alone. (B) n=1.

184 4.3.5. Identification of poly(I:C)-responsive regions in the S100A8 promoter

To examine mechanisms of transcriptional regulation of the S100A8 gene by poly(I:C),

5’-flanking sequences upstream of the transcription initiation site, untranslated intron 1 and sequences upstream of exon 1, were used to evaluate activities of deletion constructs after transient transfection into RAW cells. These are shown in a Figure 4-10. Intensity of luciferase activity was not affected by poly(I:C) in a positive control with a constitutively expressed luciferase construct (data not shown). However, marked differences between untreated and poly(I:C)- induced responses were seen with all constructs. Levels of luciferase activity after poly(I:C) stimulation were similar for all positive constructs, with 5- to 11 fold increases compared to unactivated cells. The region -94 to -34 bp contained the essential promoter because its deletion completely abrogated luciferase activity. The region -178 to -94 bp was responsible for luciferase activity in poly(I:C)-enhancement because deletion strongly reduced activity and lost enhancement. Consensus motifs for a number of transcription factors, including

CCAATenhancer binding protein (CEBP), and Ets are located within this region (Figure 1-11).

Constructs not containing the 1st exon and intron (-178-0 bp) generated positive, although somewhat weak luciferase activities, and may contain elements essential for gene induction by poly(I:C).

Deletion constructs (bp) Relative luciferase activity -1000 -500 0 500 0 5 10 15

Promoterless

-917 +465

-665 +465

-317 +465

-229 +465

-178 +465

-94 +465

-34 +465

-178 0

Figure 4- 10: Identification of poly(I:C)-responsive regions in the murine S100A8 promoter

RAW cells were transiently co-transfected with pRT-TK-luciferase and full-length (-917/465) or a series of 5’-deletion S100A8 promoter-luciferase reporters. pGL-basic plasmids were transfected as controls. The medium from transfected cells was replaced and left untreated (open bars) or stimulated with poly(I:C) (25 g/ml, solid bars) for 16 hours. Luciferase activities in cell extracts were analyzed. Data represent means ± SD of duplicates and are representative of 3 experiments. 185 4.3.6. Influenza A virus induced S100A8 in epithelial cells in murine lung in vivo.

To confirm the induction of S100A8 by dsRNA in vivo, BALB/c mice were infected with influenza A virus, a negative single-stranded RNA virus belonging to the orthomyxoviridae family. As expected, neutrophils within blood vessels in the lung were strongly reactive with anti-murine S100A8 IgG as indicated in Figure 4-11C (arrow). Although controls stained with nomal rabbit IgG were negative, another control could have been the use of the second antibody alone. Anti-S100A8 did not react with normal lung epithelial cells or interstitial cells (Figure 4-

11A, B). At day 4 post-infection, mice lost around 15% of body weight, and at day 5, began to appear hunched, with ruffled fur. Increased numbers of neutrophils and mononuclear cells that are weakly positive for S100A8 were seen in interstitial tissue (Figure 4-11C), and in epithelial cells, in which the cytoplasm reacted positively (Figure 4-11D). This was independent of the localization of neutrophils. At day 8 post-infection, mice were thin and hunched with very ruffled fur, and more than half had died. Peri-bronchiolar lesions were strongly S100A8-positive, particularly around rims of the bronchioles (Figure 4-11G). This may have been due to secretion of S100A8 into the airways.

ABA B

CDC D

186

EFE F

GHG H

IJI J

Figure 4- 11: S100A8 immunostaining of lung tissues from BALB/c mice infected with influenza A virus

Tissues harvested at day of infection (A, B) or 5 days (C, D), 6 days (E), 7 days (F), 8 days (G, H) or 12 days (I, J) post-infection. Samples were stained with anti-murine S100A8 Ab as described in Section 2.5 and Section 4.2.4. Immunostaining in tissues treated with a negative control IgG were similar to samples shown in (A) (not shown) Magnification: ×1000

Destruction of the epithelial lining was obvious at this time (Figure 4-11H). At day 12 post- infection, mice had recovered and had regained body weight. Although there were very few neutrophils in interstitial lesions, the epithelial cells lining the airways had apparently recovered and no strongly S100A8-positive cells were seen (Figure 4-11I, J). No positive reactivity was

187 seen in any section stained with the second Ab above (not shown). This time-course suggests that S100A8 expression may reflect the severity of influenza infection. Intriguingly, during the acute phase (day 6 and day 7), patchy staining of S100A8-positive interstitial cells was seen, in particular within interstitial lesions (Figure 4-11E, F). This may reflect differences in infectivity of these cells by virus. These observations suggest that influenza virus induced S100A8 in epithelial lung cells and that expression was independent of neutrophils. Additional studies are required to substantiate this, and measurement of S100A8 in bronchiolar lavage fluid, and serum from mice over the time course of infection would be informative. However in another study in collaboration with Professor Ian A Clark, Professor Geczy found substantial amounts of S100A8 in sera from patients with influenza infection.

4.3.7. Poly(I:C)-induces S100A8/S100A9 and S100A12 in human monocytes

Because viral infections are often blood-borne, peripheral blood monocytes from normal donors were used to test effects of poly(I:C). S100A8 mRNA was induced in human monocytes activated with poly(I:C) or LPS (Figure 4-12A). S100A8 mRNA was induced 25.1- and 16.1-fold above control levels by 50 g/ml poly(I:C) or 500 ng/ml LPS, respectively.

Unlike RAW cells (Figure 4-4C), the combination of poly(I:C) and LPS had no synergistic effect. In addition, Figure 4-12B shows that human THP-1 monocytoid cells also expressed

10 A 1 0.3 S100A8 B 8 0.8 S100A9 S100A12 0.2 6 0.6 actin ratio mRNA actin ratio mRNA actin ratio mRNA   

4 0.4 0.1 2 0.2 Relative S100A8/ S100A8/ Relative Relative S100A12/ S100A12/ Relative

Relative S100A8, A9/ A9/ S100A8, Relative 0 0 0 Untreated LPS Poly(I:C) LPS - 500 - 500 Poly(I:C) - - 50 50

Figure 4- 12: Poly(I:C) induces S100 mRNA in human monocytes

Monocytes (A) or THP-1 cells (B) were untreated or stimulated with LPS (500 ng/ml) or poly(I:C) (50 g/ml). Data represent means ± SD of duplicate measurements and are representative of 3 independent experiments (A). Note that the left axis represents S100A8 and S100A9 mRNA ratios and the right axis, S100A12 mRNA levels, which were 10-fold less. (B) n=1

188 S100A8 mRNA in response to poly(I:C); again no synergy with LPS was observed. Poly(I:C) also increased S100A9 and S100A12 mRNA levels 11.4-, and 6.2-fold, respectively (Figure 4-

12A). It is noteworthy that poly(I:C)- or LPS-induced S100A12 mRNA levels were ~38-fold less than those of S100A8 and ~18-fold less than S100A9 mRNA. However, ratios of S100A9 mRNA levels relative to S1008 induction in monocytes stimulated with LPS or poly(I:C) varied among individuals (from 0.2 to 3). Nevertheless, S100A8 was more highly induced by poly(I:C) than S100A9 or S100A12, suggesting that it may have a function independent of these.

Confirmation of protein levels is required.

As found for induction of S100A8 in murine macrophages, poly(I:C)-induced S100A8 and S100A9 and S100A12 mRNA were suppressed by the PKR inhibitor 2-AP, by 82, 82 and

69%, respectively. 2-AP alone did not alter S100A8 and S100A9 mRNA levels. Figure 4-13A shows the significant inhibition of S100A8 and S100A9. However, interpretation of suppression of S100A12 mRNA was difficult because of its low basal expression levels.

Until now, mechanisms of gene induction of these S100s in human monocytes/macrophages have not been as carefully characterized as in murine macrophages.

Here we show that IL-10 enhanced poly(I:C)-activated S100A8 and S100A9 mRNA induction

1.0 15 A S100A8 B S100A8 0.8 S100A9 S100A9 10 0.6 actin ratio mRNA  actin ratio mRNA  * 0.4 * * 5 * * * 0.2 ** Relative S100/ Relative Relative S100/ Relative 0 0 2-AP - - 10 4 10 IL-10 - - 10 2 10 Poly(I:C) - 50 - 50 50 Poly(I:C) - 50 - 50 50

Figure 4- 13: PKR and IL-10 are involved indsRNA-induced S100 mRNA in human monocytes

(A) Monocytes were pretreated with 2-AP (4 or 10 mM), then untreated or stimulated with poly(I:C) (50 g/ml). Data represent S100 mRNA levels relative to poly(I:C)-stimulated samples without 2-AP; means ± SD of 3 separate experiments (B) Monocytes were untreated or stimulated with poly(I:C) (50 g/ml) ± IL-10 (2 or 10 ng/ml). Data represent S100 mRNA relative to poly(I:C)-stimulated samples without IL- 10; means ± SD of 3 separate experiments. * P<0.05, **P<0.01 compared to relative S100A8/ actin mRNA ratios of poly(I:C) alone.

189 2-3 fold (Figure 4-13B). These results confirm that poly(I:C) induced S100 mRNAs in human monocytes, and PKR may be involved. Furthermore, this pathway is also likely to be mediated by IL-10. In this system, IL-10 directly induced low levels of mRNA although these were not significantly more than levels in unstimulated monocytes.

4.3.8. S100A8/S100A9 and S100A12 expression in SARS

In collaboration with Professor IA Clark, we had access to post-mortem brain specimens from a patient who had died of severe acute respiratory syndrome (SARS) caused by another RNA virus. As a control, we used peripheral blood neutrophils from healthy subjects. As expected, immunohistochemistry confirmed strong positive cytoplasmic staining with anti-S100A8 Ab

(Figure 4-14A) and anti-S100A9 Ab (Figure 4-14B) within neutrophils; these Abs only reacted weakly with other mononuclear cells in peripheral smears. In brain tissue from the patient with

SARS, infiltration of strongly S100A8/S100A9-positive mononuclear cells was apparent

(Figure 4-14C, D). Furthermore, the majority of mononuclear cells within capillaries exhibited

ABA B

Mon

Neu

Neu

Mon

CDC D

190 EFE F

G Figure 4- 14: Brain sections from a patient with SARS infection express S100 proteins

Smears of peripheral blood from a healthy subject (A, B) and SARS brain tissues (C, D, E, F, and G). Samples were stained with anti-human S100A8 Ab (A, C, E), anti-human S100A9 Ab (B, D, F) or anti-S100A12 (G) as described in Section 2.5 and Section 4.2.4. No staining was observed in smears of peripheral blood from healthy subject treated with a negative control IgG (not shown). Magnification: ×1000. Neu, neutrophil; Mon, monocyte

positive cytoplasmic reactivity for S100A8 (Figure 4-14E), S100A9 (Figure 4-14F), or

S100A12 (Figure 4-14G). Reactivity of the secondary detection Ab was negative in all sections

(not shown).

4.4. Discussion

Mechanisms of induction of S100A8 through activation of TLR4 and TLR9 has been well studied in murine macrophages ((93, 94), Hsu K unpublished data). The present study provides the first evidence that S100 proteins can be induced by dsRNAs. Although there are reports that serum levels of S100A8/S100A9 are elevated in patients with viral infections (478, 605, 611,

1145), mechanisms whereby these become elevated are unknown. Here we found that S100A8 induction by dsRNA was dependent on IL-10 and, as reported for LPS (94), S100A8 induction by poly(I:C) in a murine macrophage cell line, and in primary peritoneal macrophages represents an autocrine pathway. Similarly, activation of the MAPK pathway through p38 and

ERK plays crucial roles in induction by both stimulants. Induction of IL-10 and S100A8 were 191 both dependent on activation of PKR. Importantly, the S100A8 gene was also induced in primary human monocytes, and THP-1 cells by poly(I:C). The potential clinical relevance of the in vitro findings were confirmed in mice infected with influenza virus and in brain tissue samples obtained from a patient with SARS. Given that monocytes/macrophages and neutrophils are vital components of the innate immune system, endowed with multiple responses against invasion by external micro-organisms and viruses, upregulation of S100 proteins in these systems implies a role in anti-viral defense.

4.4.1. S100A8 is induced by an IL-10-dependent pathway

RAW 264.7 cells (Figure 4-4A) and primary macrophages (Figure 4-7C) stimulated with dsRNA strongly expressed mRNA. This was reflected by elevated secreted levels of S100A8 from activated RAW cells (Figure 4-4B). S100A9 was not co-expressed. In contrast, the synthetic single-stranded RNA only weakly induced the gene (Figure 4-4A). This suggests a role for S100A8, but not the S100A8/S100A9 complex, in the murine innate response to RNA- viral infections. S100A8 and S100A9 were both induced in human monocytes, again confirming a divergence of S100A9 gene regulation between rodent macrophages and human monocytes

(406, 407). Similarly, glucocorticoids only amplify LPS-induced S100A8 in murine macrophages, whereas S100A8 and S100A9 are both directly upregulated in human monocytes and macrophages (407). S100A8 mRNA induced by dsRNA increased in synergy with LPS in murine macrophages, whereas no synergy was seen with human monocytes or THP-1 cells, possibly due to different expression levels of TLR3 and TLR4 (and/or CD14) between these cell types.

Kinetics studies showed that dsRNA-induced S100A8 mRNA was maximal 24 hours post-stimulation (Figure 4-5A), similar to the time of optimal expression following LPS stimulation (407), suggesting a secondary event. Induction of S100A8 by LPS is IL-10 and

COX-2 dependent (94). IL-10 mRNA was also induced by dsRNA, peaking at 8 hours post- stimulation (Figure 4- 5B). IL-10 alone only slightly induced S100A8 mRNA (2.5-fold), but synergistically enhanced dsRNA-induced S100A8 mRNA and protein (Figure 4-7A, B).

192 Moreover, inhibition of endogenous IL-10 by anti-IL-10 mAb reduced S100A8 mRNA levels by ~70% (Figure 4-7A). Importantly, S100A8 mRNA levels induced by dsRNA or by LPS were significantly less in macrophages from IL-10-/- mice than those wild type mice (Figure 4-7C).

Together, these results confirm that S100A8 is an IL-10-dependent secondary response gene product and indicate that IL-10 is a major enhancer, rather than an inducer of the gene.

This study indicated divergence of pathways used by dsRNA and LPS to express

S100A8. Unlike the LPS-provoked response, dsRNA-induced S100A8 was independent of

COX-2 metabolites because suppression of the COX-2 gene had no effect (Figure 4-6A). Thus, there appears to be at least two pathways that may independently contribute to induction and/or enhancement of S100A8 in macrophages, depending on the stimulant.

4.4.2. Pathways involved in signalling to induce IL-10 and S100A8

Although dsRNAs are recognized by different receptors, some downstream signalling is shared with LPS signalling (Section 1.10.2.1). For example, there is divergence and convergence in TLR4 and TLR3 signalling. TLR4 signalling can occur via MyD88-dependent and independent pathways, whereas TLR3 signalling is generally MyD88-independent (830,

1208), and the adaptor proteins are much more restricted in their TLR interactions (Section

4.1.1). PKR can participate in both MyD88-independent signalling triggered by TLR3 (1180) and in MyD88-dependent- and independent pathways by TLR4 (1181). Notably, PKR directly interacts with dsRNA and is activated by dsRNA. Thus, PKR activation could be common to dsRNA and LPS signalling. In fact, murine alveolar macrophages activated by LPS induces rapid phosphorylation of PKR (1209). The results found here indicate a crucial and convergent role for PKR in inducing S100A8 by LPS and by dsRNA.

2-AP almost totally abolished IL-10 mRNA induction (Figure 4-8A), consistent with the reported role for PKR in IL-10 induction in PBMC (1210). Consequently, S100A8 mRNA and protein levels were also reduced (Figure 4-8B), presumably because IL-10 production was suppressed. This indicates regulation of S100A8 by PKR- and IL10-dependent pathways. To confirm involvement of PKR, S100A8 induction by LPS and dsRNA in macrophages from

193 PKR-/- mice could be used. It is noteworthy that transient transfection of siRNA or dominant- negative PKR may be unsuitable because results in Chapter 3 suggest that siRNA (dsRNA) and cell stress induce S100A8.

Attempts to reconstitute the 2-AP-inhibited response with IL-10 were only partially successful. Although amounts of secreted IL-10 are dependent on cell number, stimulation, incubation period, etc, RAW cells and murine macrophages secrete 0.06- 0.2 ng/ml IL-10 post- stimulation with LPS or heat-killed E. coli (1211-1213). Thus the dose used (10 ng/ml) to restore IL-10 levels was some 10-fold higher than levels that may be secreted and should have been in excess. However, 2-AP-suppressed S100A8 induction was only restored to just above levels induced by poly(I:C) alone, and the potentiation seen when poly(I:C) and IL-10 were added together was no longer significant (Figure 4-8C). This suggests that additional mediators possibly IFN- may contribute to full gene expression.

Similar to LPS-activated RAW cells (Figure 3-17), IFN- synergized with dsRNA in

S100A8 mRNA induction (Figure 4-9B). S100A8 is induced at sites of inflammation where

IFNs are abundant, suggesting that they may represent a major enhancer within lesions.

Although PKR is an IFN-inducible gene, its expression is dependent on cell type (1155). RAW cells constitutively express PKR, whereas poly(I:C) or IFN- induces it in numerous other cells

(1155, 1214). However, in cells that constitutively express PKR, effects of IFN- may be particularly relevant to activation. It is worthy examining effects of IFN- on S100A8 expression in various cell types. In this context and relevant to results obtained with RNAi

(Chapter 3), internalization of dsRNA would likely enhance S100A8 induction, independently of stimulation and cell stress caused by transfection, because it may induce IFN-.

dsRNA can activate two opposing antiviral strategies (1215) and PKR plays a role in both.

It contributes to self-elimination of infected cells via apoptosis, by decreasing the rate of host cell protein synthesis to prevent viral replication (Section 4.1.1), and also regulates NF-B,

MAPK signalling leading to inflammatory gene expression to trigger responses of naive cells to combat viral invasion (1163, 1177). Simular to LPS (93), dsRNA-induced S100A8 was dependent on p38 and ERK MAPK (Figure 4-6A). The PKR inhibitor blocks induction of a

194 number of genes in response to virus, dsRNA, and IFNs (1216). It reduces MKK6 and p38

MAPK phosphorylation in RAW cells, since the p38 MAPK activator MKK6 has increased affinity for PKR, forming a catalytic complex following exposure of cells to dsRNA (1178).

Although there are other possible mechanisms, such as inhibition of other signalling molecules, this mechanism could be involved in induction of IL-10 and S100A8, because the p38 pathway was crucial for both ((1217) and Figure 4-6A).

Interestingly, inhibition of JNK by SP600125 increased TNF- following dsRNA treatment in epithelial cells and JNK inhibition enhances p38 MAPK phosphorylation, suggesting that activation of JNK by dsRNA negatively regulates TNF- induction (1218).

Pharmacological inhibition of JNK also enhanced dsRNA-induced S100A8 (Figure 4-6A), also suggesting a regulatory role for JNK. As discussed in Section 1.9.2.2, this may be indirectly supported by the strong induction of S100A8 and S100A9 seen in the epidermis of JunB/c-Jun double-knockout mice (742), because activated JNKs translocate to the nucleus (850) and phosphorylate c-Jun to enhance its transcriptional activity (851). However in contrast to its effects on S100A8, the JNK inhibitor suppressed IL-10 mRNA (Figure 4-6B), suggesting additional mechanisms. Poly(I:C) stimulates rapid activation of ERK, JNK, and p38, and inhibition of JNK attenuates dsRNA-stimulated COX-2 mRNA accumulation and PGE2 production by RAW cells (1219). However inhibition of JNK did not attenuate S100A8 induction by dsRNA, supporting our finding that the COX-2 pathway is unlikely to be involved.

4.4.3. Transcription factors involved in dsRNA signalling

Using a series of S100A8 luciferase reporter constructs, we identified at least two important elements in the promoter region required for full responses to dsRNA (Figure 4-10).

Among unstimulated samples, the promoterless construct, a negative control, had no luciferase activity, whereas the others, except for the -34/+465 construct, showed low but obvious levels of luciferase activity. There is normally negligible S100A8 mRNA and protein in unstimulated

RAW cells, suggesting that they may be activated by the transfection procedure required to deliver the luciferase constructs. In transfected but unstimulated cells, deletion of -94 to -34

195 abolished luciferase activity, indicating that this region contained the minimal essential promoter region. Basal levels may have not been obvious in earlier studies (94) because experiments with dsRNA employed a more sensitive detection system.

Following poly(I:C)-stimulation, the -178/465 construct fully responded to dsRNA, whereas the -34/465 construct totally lost luciferase activity, indicating elements responsible for dsRNA gene induction within the region -178 to -34 of the essential promoter necessary for full expression of S100A8. Interestingly the -94/465 reporter responded only weakly to LPS (94), but this generated a partial but obvious response to dsRNA, although activity was similar to levels in unstimulated counterparts. These results suggested that the region -178 to -94 includes elements required for enhancement by dsRNA and this is the reported LPS/IL-10 response region (94). The region -94 to -34 includes elements essential for induction of S100A8 in response to dsRNA. This region contains CTF/NF-I (Figure 1-11, Section 1.9.1) and c-ETS motifs. The CTF/NF-I motif located -54 bp from the transcription start site is essential for synergy of LPS with glucocorticoids, but not for induction by LPS (407). The contribution of

CTF/NF-I to the dsRNA-induced response requires further study. Induction/enhancement of the gene by dsRNA appears to be facilitated by multiple transcription factors located within a small region of the S100A8 promoter; the -178 to -94 bp region contains consensus sequences for c-

Ets and CEBP motifs. In the case of the unstimulated (but transfected) cells, deletion of the

“inducer region (-94 to -34)” had no obvious activity and deletion of the “enhancer region (-178 to -94)” had weak activity, similar to that in dsRNA activated cells. These observations suggest that the transfection process may activate an “inducer region” rather than an “enhancer region”, possibly because S100A8 is a stress response gene. Additional discussion concerning this, is provided in Section 5.4.8.

Promoter analysis of S100A8 in NIH3T3 fibroblasts stimulated by FGF-2+heparin also suggests that the region -94 to -34 bp contains the essential promoter and that the -178 to -94 bp region is involved in enhancement (378). Taken together, there may be a divergence in essential elements responsible for dsRNA and LPS induction of the S100A8 gene in macrophages and at least two important regions within the promoter are required for full induction by dsRNA.

196 4.4.4. Induction of S100 proteins by viral infection in vivo

Most natural dsRNA activators of PKR are synthesized in virus-infected cells as by- products of viral replication or transcription (1144). Particularly for RNA viruses, dsRNA replicative forms are obligatory intermediates for the synthesis of new genomic RNA copies.

S100A8 was expressed in lungs of mice infected with influenza virus (Figure 4-11C-J), although it was not present on the day of infection (Figure 4-11A, B). Our results strongly support induction of S100A8 in response to an RNA-viral infection in vivo. Expression was observed early in infection, and maximal at day 8 when strong immunoreactivity in epithelial cells lining the airways was obvious. Expression declined early in the recovery phase, implying that it may be regulated by mediator(s) upregulated in the resolution phase of inflammation.

This observation is consistent with the report that serum levels correlate with the clinical course in patients with HIV infection (490, 660, 661).

SARS first emerged in China’s Guangdong Province in November 2002, and was the first human pandemic of the 21st century. The etiological agent is SARS coronavirus (SARS-

CoV), which belongs to a family of large, positive, single-stranded RNA viruses (1220).

Patients with SARS present with flu-like symptoms including fever, chills, cough, and malaise

(1221). Approximately 70% subsequently suffer from shortness of breath, and 20 to 30% of patients require treatment including mechanical ventilation (1222) (reviewed in (1223)).

In brain samples from a patient with SARS, strong upregulation of S100 proteins was apparent in the majority of mononuclear cells within capillaries, although the mean SARS-CoV infection rate is reported to be 51.5% in lymphocytes and 29.7% in monocytes (1224), suggesting that in addition to viral dsRNA, other mediators released as a result of the infection may have contributed to the S100 expression. Severe SARS-related injury is attributed to an excessive reaction of the host’s immune system, particularly dysregulation of pro-inflammatory cytokines and chemokines (1225). Increased serum levels of several cytokines are found in the majority of the SARS patients (1226, 1227), although there seems to be no consistency in profiles. Interestingly, PGE2 and TGF- were detected in certain cases (1228). These might enhance S100 protein expression.

197 SARS-CoV replicates progressively in the upper respiratory tract during the first 10 days of the disease, suggesting that it may evade the innate immune response (1229, 1230). It does not induce IFN-/ gene expression in infected macrophages, PBMCs or dendritic cells (1229,

1230), suggesting that IFNs are unlikely to be major enhancers of S100 protein expression in this case.

Increased expression of S100A8 in HIV-1 infected patients could be induced by opportunistic pathogens or by direct HIV infection of monocytes. Alternatively, production could be subsequent to IL-10 secretion by HIV-infected cells. Among a number of essential structural proteins for which HIV-1 encodes, Tat acts as a potent transcriptional activator by binding to transactivation response (TAR) element of the HIV-1 long terminal repeat (LTR) to mediate viral gene expression (1231). Tat is secreted from infected cells for subsequent uptake by other cells to exert its biological effects including induction of cytokines (1232). HIV Tat induces IL-10 and NF-IL-6 in primary human blood monocytes (1210). Here our promoter analysis showed that activation of the regions -94 to -34 bp and -178 to -94 bp is necessary for full induction of S100A8 by dsRNA. The region -178 to -94 bp contains consensus sequences for CEBP motifs to which NF-IL-6 binds, and elements in this region may contribute to IL-10 enhancement (94). Thus dsRNA, which is an intermediate of HIV-1 replication, may activate the S100A8 promoter, and secreted HIV Tat could enhance activation through IL-10 and NF-IL-

6. Interestingly human S100A8 accentuates HIV-1 transcription and virus production (662,

1233) and these amplifications may reflect clinical manifestation in patients with HIV-1.

Viral infections can have one of two outcomes: control of viral replication and acute infection, or viral persistence and chronic infection. Effective T cell responses are crucial for control of many viral infections (1234), but the responses are often inadequate because of functional exhaustion of anti-viral CD8 and CD4 T cells. These gradually lose the ability to produce anti-viral cytokines, kill infected target cells and proliferate in response to antigen during chronic infection (reviewed in (1235)). Recently, two groups independently identified an important role for the IL-10 in viral persistence. Blockade of IL-10 signalling increased virus- specific CD8 and CD4 T cells and enhanced their function, resulting in resolution (1149, 1236).

198 Since S100A8 levels may be maintained in conditions where IL-10 is raised, it would be interesting to examine whether S100A8 plays any role in T cell priming, differentiation, or other effector functions in pathogen control.

4.4.5. Summary

This study has delineated mechanisms of dsRNA-induced PKR-mediated events in monocytes/macrophages. In response to RNA viral infection, monocytes and macrophages activate anti-viral pathways to induce PKR and IFNs that can lead to subsequent induction of

IL-10 that in turn induce S100A8. The reduced S100A8 expression seen early in the resolution phase of influenza infection may indicate a role for S100A8 in viral defense. Given that S100A8 is a potent oxidant sink, it may contribute to scavenging of ROS produced as a consequence of viral infection and monocyte/macrophage activation. However the real functions of S100 proteins under these circumstances are undefined. Overexpression studies using S100A8 targeted to Clara cells in the lung are currently being undertaken in our laboratory. The course of influenza in these mice may shed light on whether the protein is really pro- and/or anti- inflammatory.

Induction of S100A8 by dsRNA, enhancement by IL-10 and IFN-, and the synergistic induction seen with LPS and dsRNA would help explain the lack of siRNA efficiency observed in studies presented in Chapter 3.

199 5. GENE REGULATION OF S100A8 VIA MITOCHONDRIA

5.1. Introduction

The S100A8 gene appears to be generally induced in response to cell stressors, such as bacterial infection, viral infection, acute inflammation, and UVA exposure (Table 1-23, Chapter

4), all of which can lead to ROS production. Because of the growing body of evidence pointing to a role of ROS as intracellular signalling molecule (1237-1239), we considered that this may be involved in S100A8 gene induction.

Murine S100A8, but to a lesser extent S100A9, may function as an oxidant sink and can scavenge ROS, such as HOCl (368, 389) and H2O2 (73) (Section 1.7.2.4). Thus, one feasible hypothesis is that S100A8 is induced in response to ROS and then scavenges ROS generated at inflammatory sites, thereby protecting the host from undergoing undue oxidative stress. In keeping with this, UVA-activated keratinocytes express S100A8 and the gene is upregulated by exogenous H2O2 and suppressed by catalase and SOD (412). In addition, IL-10 and glucocorticoids, traditionally viewed as anti-inflammatory and immunosuppressive agents, amplify S100A8 promoter in macrophages (407) and fibroblasts (378), supporting a protective function for S100A8, or a role in resolution of inflammation.

Human S100A8/S100A9 associates with NADPH oxidase, and may promote its activity

(Section 1.7.1.5). Activated NADPH oxidase is a major source of O2 in activated neutrophils and macrophages, and in neutrophils S100A8/S100A9 is particularly abundant. These properties seem contradictory, but S100 functions may depend on whether they are complexes, or act independently. Stimulation of monocytes/macrophages with LPS activates NADPH oxidase, induces iNOS, and activates the mitochondrial electron transport system leading, to production of intracellular superoxide and other ROS.

Identifying the signalling pathways resulting in S100A8 expression is crucial to understanding how it functions in processes such as inflammation, tumor promotion and apoptosis. Clinically it is interesting, because this could lead to new insights into the pathogenesis of these conditions. The underlying evidence was sufficient to propose involvement of ROS in S100A8 gene regulation. In this chapter, we provide evidence for

200 involvement of the mitochondrial ATP synthesis pathway in S100A8 induction in activated murine macrophages. This section of the project uses LPS to induce S100A8 because we understood more about this pathway at the time the project began. This represented a side project while siRNA transfection experiments (Chapter 3) were being performed.

5.1.1. Reactive oxygen and nitrogen species

Reactive oxygen species (ROS) are metabolites of oxygen that are highly reactive and participate in reduction-oxidation (redox) reactions. Some have an unpaired electron in their outer orbital which allows extreme chemical reactivity, e.g. superoxide anion radical (O2), hydroxyl radical (OH), nitric oxide radical (NO), alkoxyl radical (RO), etc. Others do not contain an unpaired electron and therefore are not free radicals but exchange electrons with other molecules. These include hydrogen peroxide (H2O2), peroxynitrite (ONOO), singlet

1 oxygen ( O2), hypochlorous acid (HOCl) and lipid peroxides (LOOH). Generation of ROS such

- as superoxide anion (O2 ), and hydrogen peroxide (H2O2), or reactive nitrogen species (RNS) such as nitric oxide (NO) can occur in cells and may accompany diverse environmental stimuli.

Many stimuli, including growth factors, cytokines, and UV light, induce production of

ROS, which may be beneficial or deleterious. At low concentrations, ROS and RNS can act as intracellular signalling molecules (1238, 1239), and can affect expression of a number of genes in monocytes. H2O2 activates NF-B to upregulate pro-inflammatory cytokines and immune mediators (437). However, when produced in excess, ROS can cause oxidative damage to many vital components of the cell, including proteins, lipids, and DNA. Their prolonged generation promotes cell death and tissue damage by activation of stress-activated signalling pathways.

ROS-promoted cell death was originally thought to be due to non-specific, widespread oxidative damage. However it is now clear that ROS can induce necrosis and apoptosis through a carefully controlled, active process involving direct thiol modifications and regulation of crucial components of the cell signalling machinery.

Superoxide dismutases (SOD), a group of metal-containing enzymes, are widely distributed in prokaryotic and eukaryotic cells (1240), and are a first line of defense by 201 scavenging O2, catalyzing its conversion to H2O2. Three types of SODs occur in eukaryotes, the most abundant being cytosolic SOD (SOD1; Cu/ZnSOD), identified by its Cu and Zn- containing prosthetic group, SOD2 (MnSOD) containing Mn and exclusively located in the inner mitochondrial space and SOD3 that binds cell surfaces by interacting with polyanions such as heparan sulphate (reviewed in (721)). A small fraction of Cu/ZnSOD also resides in the mitochondrial inter-membrane space (1241). The two-step chemical reaction of superoxide anion with the prosthetic group of SOD begins with the oxidized form of the enzyme (Cu2+ and

3+ Mn respectively) binding O2, acquiring a proton and releasing molecular oxygen. The reduced form of the enzyme (Cu+ and Mn2+) then binds a second superoxide anion and proton, to liberate H2O2 and return it to its oxidized state (reviewed in (721)).

+ 2 O2 + 2H O2 + H2O2

The conversion of superoxide anion to H2O2 by SOD has a Janus effect, with anti-oxidant and pro-oxidant consequences. As an anti-oxidant, SOD converts membrane-impermeable O2 to a diffusible species, thereby attenuating cell damage by oxidative stress. Superoxide anion is impermeable to membranes because of its negative charge. However, H2O2 and oxygen are both diffusible and both can facilitate distribution of ROS. As a result, toxicity of ROS is diluted by diffusion among cellular compartments. H2O2 is removed by H2O2-consuming enzymes such as catalase, peroxiredoxins or glutathione peroxidase. If the actions of SOD and H2O2-consuming enzymes are not in concert, increases in H2O2 lead to activation of JNK, triggering intrinsic and extrinsic apoptotic pathways (1242). Taken together, for the maximum anti-oxidant effect, it is expected that O2 converted to H2O2 by SOD immediately becomes a substrate for the H2O2 - catalyzing enzymes such as a catalase.

NO is enzymatically converted from L-arginine to citrulline and NO by nitric oxide synthase (NOS) (1243, 1244); there are several isoenzymes of NOS, two of which are constitutively expressed. Neuronal NOS (nNOS, NOS-I) is present essentially in neurons, and endothelial NOS (eNOS, NOS-III), was originally located in the plasma membrane of vascular

ECs. These are regulated by cytosolic calcium, calmodulin and numerous post-transcriptional mechanisms. Inducible NOS (iNOS, NOS-II) is cytokine-inducible in many cell types and is 202 independent of calcium and calmodulin (1245). iNOS is strongly induced by bacterial endotoxin and IFN- in macrophages and is important for anti-microbial defense. A putative mitochondrial

NO synthase (mtNOS) is a highly localized source of NO within the mitochondrial inner membrane (1246). Reactive nitrogen species are generated in response to diverse environmental stimuli. Low concentrations of NO produced by mammalian cells is a key signalling molecule in neurotransmittion, host-defense and vasodilation, whereas excessive and unregulated concentrations can be toxic, and may cause, or contribute to pathophysiological conditions including vascular shock, stroke, diabetes, neurodegeneration, arthritis, immune system, and chronic inflammation (1247).

NO is a free-radical gas that readily diffuses into cells and membranes where it reacts with molecular targets including hemoproteins, thiols and O2, and manifests its biological actions via chemical reactions which are often attributed to “reactive nitrogen species (RNS)” rather than the NO radical itself. RNS refers to different redox states and derivatives, including

+ NO¯, NO , NO2, NO2¯, NO3¯, N2O3, N2O4, S-nitrosothiols, peroxynitrite and nitrosyl-metal complexes (1248-1250). RNS can chemically modify critical thiols on particular proteins, to form S-nitrosothiols that can modify the function of target proteins. S-nitrosylation is now considered analogous to phosphorylation in cell signalling events (1251, 1252). For example, activities of caspase, metalloproteinases, protein tyrosine phosphatase (PTPs), NF-B and thioredoxin (Trx) can be modified by S-nitorosylation (reviewed in (1251)). Importantly, we recently found that S100A8 can be S-nitrosylated and this suppresses mast cell activation and inflammation in vivo (Raftery MJ and Geczy CL et al, submitted).

The powerful oxidant, peroxynitrite (OONO), is highly reactive, with various harmful effects on cells (1253) but has important microbicidal effects. The radius of reaction for OONO is limited by its high reactivity and charge. Its conjugated acid form (OONOH) may cross membranes and enter various cellular compartments (1254-1256). Mitochondria have several hemoproteins (e.g. cytochrome c oxidase), thiols (e.g. glutathione) and cysteine-containing proteins, and represent a major source of superoxide anion. Consequently, mitochondria are a major target of NO and several functions of NO are manifested in this compartment (1257). For

203 example, NO inhibits mitochondrial respiration in a transient and reversible manner through competing with O2 at the level of cytochrome oxidase, or by S-nitrosylating complex I.

5.1.2. Regulation of cell signalling by ROS

Macrophages are a major source of ROS that are involved in numerous signalling pathways regulating diverse functions including cell growth and proliferation, cell survival and apoptosis (1258, 1259), and inflammation. ROS activate signalling by inhibiting phosphatases leading to activation of numerous serine/threonine and tyrosine protein kinases (1260-1262).

This can influence several signalling cascades including growth factor tyrosine kinase-, src kinase-, MAPK- and PI3-kinase-dependent pathways, resulting in activation of several redox- regulated transcription factors (AP-1, NF-B, p53, HIF-1, NFAT). ROS also regulate ion

2+ 2+ channels (eg increases [Ca ]i by promoting Ca release from intracellular stores, and subsequent activation of kinases, such as PKC) (1258). Figure 5-1 shows a putative model of

ROS-induced signalling pathways in macrophages.

Figure 5- 1: Putative model of ROS-induced signalling pathways

(from (1258))

Numerous diverse ligands induce ROS and/or RNS. For example, growth factor receptors such as those for epidermal growth factor (EGF) (1263), platelet-derived growth 204 factor (PDGF) (1264) and vascular endothelial growth factor (VEGF) (1265) are receptor tyrosine kinases (RTKs) (1265), and activation following ligand binding generates ROS.

Cytokines such as TNF-, IL-1 and IFN- were among those first reported to generate ROS in non-phagocytic cells (1266).

ROS and RNS signal by mediating redox changes of certain moieties in proteins including heme, iron-sulfurs and cysteine thiols. Of note is the redox modification of cysteines of phophatases (protein tyrosine phosphatases), protein kinases (serine/threonine kinases of the

MAPK system) and transcription factors (AP-1, NF-B) (1267-1271). NF-B is an oxygen- sensitive transcription factor involved in upregulation of pro-inflammatory genes in macrophages (1272, 1273). However, precise mechanisms whereby transcription factors are activated by ROS are still being elucidated.

5.1.3. Mitochondrial electron transport chain and generation of ATP

The mitochondrial electron-transport chain participates in glucose energy metabolism.

Intracellular glucose oxidation begins with glycolysis in the cytoplasm, generating NADH and pyruvate (reviewed in (1274)), which are transported into the mitochondria, where pyruvate is oxidized by the tricarboxylic acid (TCA) cycle to produce CO2, H2O, four molecules of NADH and one of FADH2. Mitochondrial NADH and FADH2 participate in ATP production through oxidative phosphorylation by the electron-transport chain. Figure 5-2 shows electron flow that is mediated by four inner membrane-associated enzyme complexes, cytochrome c and the mobile electron carrier ubiquinone. NADH donates electrons to the electron transport chain, consisting of four complexes in the inner mitochondrial membrane-Complex I (NADH-coenzyme Q reductase, or NADH-dehydrogenase), Complex II (succinate-coenzyme Q reductase), Complex

III (Coenzyme Q-cytochrome c reductase), and Complex IV (cytochrome c oxidase). The electrons passing through I-III-IV or II-III-IV complexes ultimately reduce O2 to H2O in

Complex IV. Mitochondrial respiratory chain complexes I, III and IV are coupled with an active pumping mechanism that ejects protons across the inner membrane into the inter-membrane mitochondrial space, generating an electrochemical gradient (H+) and increased 205 mitochondrial membrane potential. The latter drives protons back into the mitochondrial matrix through ATP synthase (complex V), coupling oxidation to energy production.

Figure 5- 2: Production of superoxide by the mitochondrial electron-transport chain

(from (1274))

An uncoupling protein (UCP) is localized in the inner membrane of the organelle, and acts as a proton carrier activated by free fatty acids and creates a shunt between complexes of the respiratory chain and ATP synthase. Activation of UCP enhances mitochondrial respiration and the uncoupling process results in dissipation of oxidation energy by providing the protons with an alternative route back into the mitochondrial matrix in an ATP synthase-independent manner (reviewed in (1274-1277)).

5.1.4. Purinergic receptor signalling

ATP is normally present at ~5-10 mM in the cytosol of cells and plays numerous roles in signalling, as well as its established role in intracellular energy metabolism. For example, upon recognition of dsRNA, RIG-I undergoes a conformational change in an ATP-dependent manner to allow downstream signal transduction and binding of ATP to PKR is necessary for its autophosphorylation (see Section 4.1.1).

ATP and its metabolites play diverse roles in different phases of inflammation that can be divided into three stages which partly overlap (reviewed in (561, 1278-1280). The first is onset of acute inflammation and initiation of primary immune responses upon encounter with infectious or injurious agents. The second is modulation and fine-tuning of ongoing responses 206 by endogenous immunoregulatory substances. The third stage is down-regulation; induction of resolution and restoration of damaged tissues to preserve cellular homeostasis. In the first stage, millimolar amounts of cytoplasmic ATP released from damaged or necrotic cells can promote inflammation and initiate primary responses through P1 and P2 purinergic receptors.

The P2 receptor family is subdivided into two subfamilies; P2X and P2Y. P2X receptors are nucleotide-gated ion channels, whereas P2Y receptors are coupled to heterotrimeric G proteins (1281-1284). These comprise numerous receptors responsive to various forms of ATP and its metabolites, with different affinities. High levels of extracellular

ATP are mainly immuno-stimulatory in the microenvironment of damaged cells because it activates receptors such as the P2X7 (so-called P2Z) receptor on monocytes/macrophages, leading to induction of cytokines such as IL-1, IL-1, IL-6, IL-18 and TNF- (reviewed in

(561)). ATP and adenosine can also be released from monocytes/macrophages in response to

LPS (1285-1293).

In the second stage, the ecto-enzymes CD39/nucleoside triphosphate diphosphohydrolase (NTPDase; ENTPD I) (1294, 1295) and CD73/ecto-5-nucleotidase located on the surface of monocytes/macrophages progressively decrease extracellular ATP levels and increase adenosine concentrations (1296). This may contribute to the shift of the response to immuno-modulatory, thereby protecting the host. Low levels of ATP may attenuate pro- inflammatory cytokine production by monocyte/macrophages via P2Y receptor subtypes, by stimulating IL-10 release (1297, 1298). For example, in human monocytes activated with LPS,

ATP and ATPS, a P2Y11 receptor agonist, increase IL-10 production through the P2Y11 receptor, increasing cAMP levels (1299). ADP and adenosine, breakdown products of ATP, also regulate these cells through P1 and P2Y receptors. For example, in LPS-PHA-stimulated human whole blood, IL-10 production is mediated through the P2Y12 receptor, the ligand of which is

ADP (1298). Interestingly, macrophages from wild type mice produce low levels of IL-10 after exposure to LPS, but not to adenosine alone, and these agents synergise to dramatically increase

-/- IL-10 levels, whereas LPS-activated macrophages from A2A adenosine receptor mice fail to produce IL-10 in the presence/absence of adenosine. In contrast, macrophages from A2B

207 receptor-/- mice show only a minor effect (1212, 1300). Thus ATP and adenosine receptors are involved in IL-10 induction in human and murine monocytes/macrophages. Taken together, macrophage activation can be regulated by ATP and its metabolites through purinergic receptors.

Table 5- 1: Purinergic receptor subtypes and physiologic ligands/immune cell distribution

Immune cell distribution Monocytes/ Subtype Ligands Neutrophils macrophages Lymphocytes P1 receptors A1 Adenosine/ Inosine Y Y ND A2A Adenosine/ Inosine Y Y ND A2B Adenosine Y Y Y A3 Adenosine/ Inosine Y Y Y P2 receptors P2X1 ATP Y Y Y P2X2 ATP ND ND ND P2X3 ATP ND ND ND P2X4 ATP Y Y Y P2X5 ATP Y Y Y P2X6 ATP P2X7 ATP Y Y Y P2Y1 ADP Y Y Y P2Y2 UTP= ATP, UDP Y Y Y P2Y4 UTP> ATP, UDP Y Y Y P2Y6 UDP> UTP Y Y Y P2Y11 ATP Y Y Y P2Y12 ADP ND Y Y P2Y13 ADP ND Y Y P2Y14 UDP-glucose Y ND Y ND, Not determined (Adapted and modified from (561))

5.1.5. Hypothesis

Reactive oxygen spices are involved in S100A8 gene regulation

5.2. Material and methods

RAW 264.7 macrophages were used for all experiments. Cells were seeded into 24-well plates for mRNA analysis, and into 48-well plates for protein analysis (see Section 2.1 for condition of culture). At 24 hours post-seeding, cells were pre-treated with inhibitors for 30 minutes. For mRNA analysis, cells were untreated or stimulated with LPS (20 ng/ml) for 4 hours for analysis of COX-2, iNOS or IL-10 mRNA, or for 16-24 hours for analysis of S100A8 mRNA, unless otherwise stated. Cell viability determined by Trypan blue exclusion was always

>90-97%. mRNA levels relative to HPRT were quantitated using real-time RT-PCR as 208 described in Section 2.3. For protein analysis, cells were untreated or stimulated with LPS (20 ng/ml) for 36 hours, then S100A8 in supernatants quantitated by ELISA (Section 2.7). Unless otherwise stated, data presented represent the ratios of mRNA or protein relative to LPS- stimulated samples without inhibitors; means ± SD of 3 separate experiments are given.

Quantitation of nitrite

Quantitation of nitrite was performed using the Griess reaction as described (1301). Briefly,

RAW 264.7 cells were seeded into a 24-well plate (1.4×105/well) and allowed to attach for a minimum of 12 hours prior to use, then LPS (20 ng/ml) was added. When inhibitors were used, cells were pre-incubated with these for 30 minutes prior to LPS stimulation. Cells were incubated at 37 ºC for 24 hours, then supernatants (100 l/ well) mixed with an equal volume of

Griess reagent (Sigma); and A540 nm determined following incubation (15 minutes) at room temperature. Nitrite levels were determined by comparing them with a standard curve generated with sodium nitrite.

5.3. Results

5.3.1. H2O2 regulates S100A8 gene induction

To determine whether ROS could modulate S100A8 expression, RAW cells were first incubated with increasing concentrations of H2O2. At a physiologically high concentration of 1 mM, H2O2 increased S100A8 mRNA expression 5.0-fold above baseline levels (Figure 5-3A) compared to the 33-fold increase seen with LPS (20 ng/ml). These results suggested weak but direct upregulation of S100A8 in response to oxidant stimulation.

H2O2 is diffusible, and exogenous H2O2 can distribute within the cytoplasm, whereas the superoxide anion is membrane-impermeable. To investigate the source of H2O2 that may contribute to induction of S100A8 in response to LPS, LPS-treated RAW cells were firstly incubated with SOD and catalase. A combination of these enzymes did not alter S100A8 mRNA levels induced by LPS (Figure 5-3B), indicating that extracellular ROS did not make a major contribution. SOD or catalase is partially diffusible, and exogenous sources may distribute into 209 cytoplasm. To confirm whether endogeneous ROS was involved, TEMPOL (4-hydroxy-2,2,6,6- tetramethylpiperidine-N-oxyl), a free radical scavenger and superoxide dismutase mimic, was tested (1302-1304). Figure 5-3C shows that this agent did not alter S100A8 mRNA levels, suggesting that endgeneous O2and/or H2O2 were not involved.

1.0 1.2 A B 0.8 0.8 0.6

0.4 0.4 0.2 * Relative S100A8/ HPRT mRNA S100A8/ Relative ratio Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 0 LPS LPS - 20 - - - 20 - 20 SOD H O - - 0.5 1.0 + - - + + 2 2 Catalase

1.2 C 1.0 D 0.8 0.8 0.6

0.4 ** 0.4 0.2 ** Relative S100A8/ HPRT mRNA S100A8/ Relative ratio

Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 0 LPS - 20 - 20 20 LPS - 20 - 20 20 TEMPOL - - 1.0 0.5 1.0 NAC - - 10 5 10

Figure 5- 3: Hydrogen peroxide involvement in regulation of S100A8 induction

RAW cells pretreated with (A) 0.5 or 1.0 mM H2O2 (B), 30 g/ml SOD + 2 g/ml catalase (C), TEMPOL (mM), or (D) NAC (mM), then unstimulated or stimulated with LPS for 24 hours. * P < 0.05 compared to relative S100A8/HPRT mRNA ratios of unstimulated cells, ** P < 0.01 compared to relative S100A8/ HPRT mRNA ratios of LPS stimulation alone.

Interestingly, N-acetylcysteine (NAC) suppressed LPS-activated S100A8 mRNA production by 95% (Figure 5-3D). NAC is the N-acetyl derivative of the animo acid L-cysteine.

It has a free SH group which allows it to interact directly with oxidants, thereby acting as an oxidant scavenger.

210 5.3.2. NADPH oxidase does not regulate S100A8 induction by LPS

To further explore whether intracellular ROS was involved in S100A8 regulation, we next tested NADPH oxidase inhibitors. The NADPH oxidase inhibitor, DPI significantly reduced S100A8 mRNA (Figure 5-4A) and protein (Figure 5-4B) production by 99% and 87% respectively. Notably, a low dose of DPI (2.5 M) reduced S100A8 mRNA to almost baseline levels (p<0.01 compared to LPS-stimulated levels); no induction occurred with 5 M DPI.

However, DPI is not specific in its effects on NADPH oxidase, and also suppresses other flavin- containing enzymes such as iNOS and the respiratory chain complex I in mitochondria.

Apocynin, another NADPH oxidase inhibitor, also significantly suppressed S100A8 induction by 91% (Figure 5-4C). However apocynin is also not specific for NADPH oxidase, and interacts with flavoproteins (1305) and can scavenge ROS directly (1306).

1.0 A 1.0 B 0.8 0.8

0.6 0.6

0.4 0.4

0.2 0.2 * ** secreted S100A8 Relative ** Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 ** 0 LPS - 20 - 20 20 20 20 Untreated DPI DPI - - 10 1 2.5 5 10 5

1.6 C

1.2

0.8

0.4 ** ** Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 LPS - 20 - 20 20 20 20 Apocynin - - 300 20 67 200 300

Figure 5- 4: NADPH oxidase inhibitors suppressed S100A8 mRNA induction

RAW cells were pretreated with the indicated doses of (A, B) DPI (M), or (C) apocynin (M), then unstimulated or stimulated. (B) S100A8 levels in supernatants measured by ELISA. Open and solid bars indicate samples stimulated with or without LPS, respectively. * P < 0.05 and ** P < 0.01 compared to relative S100A8/ HPRT mRNA ratios of LPS stimulation alone.

211 To investigate the mechanisms further, cells were pretreated with an inhibitor of iNOS.

Figure 5-5A confirmed that L-NAME (4 mM) reduced nitrite production by 61%, whereas the control substrate D-NAME had no effect. In contrast, L-NAME did not reduce S100A8 mRNA levels (Figure 5-5B). These results suggested an involvement of mitochondria, but not NO or its metabolites, in S100A8 gene induction by LPS. They also suggest that the DPI-sensitive target may be at least in part, mitochondria complex I.

25 A 2.0 B

20 1.5

M) 15  1.0 10 Nitrite ( 0.5 5 Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 0 LPS - 20 - 20 LPS - 20 - 20 D-NAME 4 4 - - D-NAME 4 4 - - L-NAME - - 4 4 L-NAME - - 4 4

Figure 5- 5: NO is not involved in S100A8 induction

RAW cells were pretreated with the indicated doses of (A, B) D-NAME (mM) or L-NAME (mM), then unstimulated or stimulated. (A) Nitrite levels in supernatants 24 hours post-stimulation; duplicate determinations of one experiment. (B) S100A8 mRNA was quantitated.

5.3.3. Involvement of mitochondrial ROS and ATP in S100A8 induction

To confirm that disruption of the mitochondrial respiratory chain suppressed S100A8 mRNA induction by LPS, a mitochondrial complex III inhibitor (antimycin A), and a mitochondrial uncoupler (CCCP) were tested. Antimycin A (0.5 g/ml) and CCCP (5 M) significantly inhibited S100A8 mRNA induction by 75% and 94%, respectively (p<0.01 compared by LPS stimulated cells) (Figure 5-6A, B). CCCP inhibition was confirmed by the significantly reduced protein levels (Figure 5-6C). In contrast, and in keeping with the potential lack of NO involvement, CCCP only reduced iNOS mRNA by 13% (Figure 5-6D). An inhibitor of the mitochondrial respiratory chain complex I, 0.02 M rotenone, suppressed S100A8 mRNA induction by 84% (Figure 5-6E) and inhibition with 0.1 M was significant (p<0.01 compared to mRNA levels stimulated with LPS). 212 1.0 1.0 1.0 A B C 0.8 0.8 0.8

0.6 0.6 0.6 ** * 0.4 0.4 0.4 Relative secreted S100A8 Relative 0.2 0.2 0.2 ** ** Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 HPRT mRNA S100A8/ Relative ratio 0 - 20 - 20 20 0 LPS LPS - 20 - 20 20 20 Untreated CCCP - - 5 0.5 5 Antimycin A CCCP - - 10 1 5 10 5

1.0 1.0 D E 0.8 0.8

0.6 0.6

0.4 0.4 * ** 0.2 0.2 ** Relative iNOS/ HPRT Relative iNOS/ mRNA ratio

0 HPRT mRNA S100A8/ Relative ratio 0 LPS - 20 - 20 LPS - 20 - 20 20 20 20 CCCP - - 5 5 Rotenone - - 2.5 0.02 0.1 0.5 2.5

Figure 5- 6: Mitochondrial electron transport is required for S100A8 induction by LPS

RAW cells were pretreated with the indicated doses of (A) antimycin A (g/ml), (B, C, D) CCCP (M) or (E) rotenone (M), then treated or untreated with LPS for (A) 16, (B, E) 24, (C) 36 or (D) 4 hours. (A, B, D, E) mRNA levels determined or (C) S100A8 levels in supernatants measured by ELISA. Open and solid bars indicate samples stimulated with or without LPS. * P < 0.05 and ** P < 0.01 compared to LPS stimulation alone.

DPI and CCCP suppress ATP production because they suppress mitochondrial electron transport and downstream events in the respiratory chain. The mitochondrial ATP synthase inhibitor oligomycin was used to assess possible involvement of ATP. Surprisingly, this significantly suppressed S100A8 mRNA induction by 76% (p<0.05 compared to LPS-activated macrophages; Figure 5-7), suggesting an important role for ATP.

1.0

0.8 Figure 5- 7: ATP generated by the mitochondrial electron 0.6 transport is involved in S100A8 gene induction. 0.4 * RAW cells were pretreated with the indicated doses of oligomycin 0.2 (g/ml) then treated or untreated with LPS for 16 hours, and mRNA levels determined. * P < 0.05 and compared to relative

Relative S100A8/ HPRT mRNA HPRT S100A8/ Relative ratio 0 S100A8/HPRT mRNA ratios of LPS stimulation alone. LPS - 20 - 20 20 Oligomycin - - 10 1 10 213 Some inhibitors of the mitochondrial respiratory chain also modify mitochondrial calcium efflux. Figure 5-8 shows that S100A8 mRNA induction by LPS was only reduced by 22.2 % by the mitochondrial Ca2+ exchanger CGP37167; inhibition with the high concentration (10 M) was statistically significant (P=0.023 compared to LPS-stimulated cells), suggesting a minor contribution via changes in mitochondrial calcium efflux.

1.5

1.2

2+ 0.9 * Figure 5- 8: The mitochondrial Ca exchanger does not make a major contributor to S100A8 induction by LPS 0.6 RAW cells were pretreated with CGP37167 (1 or 10 M), then 0.3 untreated or stimulated with LPS, and mRNA levels determined.

Relative S100A8/ HPRT mRNA HPRT S100A8/ Relative ratio * P < 0.05 and compared to relative S100A8/ HPRT mRNA 0 ratios of LPS stimulation alone. LPS - 20 - 20 20 CGP37167 - - 10 1 10

5.3.4. The mitochondrial pathway is involved in IL-10 induction by LPS

Because IL-10 and COX-2-derived PGE2 enhance S100A8 induction in LPS-stimulated macrophages, involvement of the mitochondrial electron transport chain in induction of these genes was investigated next. Figure 5-9A shows that IL-10 mRNA suppression by DPI was evident after 4 hours (43%), and peaked at 8 hours when maximal inhibition was 46%, then gradually declined over 16 hours. In keeping with this, rotenone and antimycin A significantly reduced IL-10 mRNA induction by 59% and 61% (p=0.012, 0.042 compared to LPS stimulation alone), respectively (Figure 5-9B). CCCP and oligomycin also suppressed IL-10 mRNA induced by LPS by 75%, and 48%, respectively (Figure 5-9B), suggesting involvement of ATP synthesis. It is noteworthy that like its effects on S100A8 mRNA, NAC significantly suppressed

IL-10 mRNA induction by 92% (Figure 5-9B).

Because the mitochondrial pathway appeared to be involved in signal transduction leading to S100A8 production at multiple stages, particularly via IL-10 induction, exogenous

IL-10 was added to test cells pre-incubated with DPI. Figure 5-9C shows that S100A8 mRNA levels dramatically increased in cells treated with LPS+IL-10 and decreased with LPS+DPI.

214 120 1.0 A B 100 0.8 80 0.6 * 60 * * 0.4 40 0.2 20 ** Relative IL-10/HPRT mRNA ratio IL-10/HPRTRelative mRNA

% 0f Maximal IL-10 mRNA Response mRNA IL-10 Maximal 0f % 0 0 d e te AC n CP A in 061218 ea N no C cin yc tr ote C y om hours Un R tim lig An O 7 C 6 5 4 3 2 1

Relative S100A8/ HPRT mRNA HPRT S100A8/ Relative ratio 0 LPS - 20 - 20 DPI - - 5 5

Figure 5- 9: Mitochondrial transport chain is involved IL-10 induction by LPS

(A) RAW cells were pre-treated with (broken line) or without (solid line) 5 M DPI, and then stimulated with LPS for the indicated periods. IL-10 mRNAs were quantitated. Maximum mRNA induction by LPS was denoted as 100% maximal response. (B) RAW cells were pretreated with NAC (10 mM), rotenone (0.02 M), CCCP (5 M), antimycin A (0.5 g/ml) or oligomycin (10 g/ml); then unstimulated (open bars) or stimulated (solid bars) with LPS for 4 hours. mRNA levels of IL-10 were quantitated. (C) RAW cell pretreated with 5 M DPI were untreated or stimulated with LPS (20 ng/ml) in presence (solid bars) or absence (open bars) of IL-10 (10 ng/ml), then S100A8 mRNA levels were quantitated. * P < 0.05 and ** P < 0.01 compared to relative S100A8/HPRT mRNA ratios of LPS stimulation alone.

When IL-10 was added to cells pretreated with DPI and stimulated with LPS, S100A8 mRNA levels reached those seen with LPS alone, suggesting that IL-10 could compensate. However, mRNA levels did not reach those induced by LPS+IL-10, possibly because of excess DPI.

Titration with lower amounts of DPI would be necessary to verify this.

The effects of inhibitors on COX-2 mRNA expression were much less intense. DPI only weakly suppressed mRNA levels 4 hours after LPS stimulation, but in contrast to IL-10 and

S100A8, mRNA levels increased approximately 2-fold over 10-24 hours (Figure 5-10A),

Similar to DPI, NAC, CCCP and antimycin A only weakly reduced COX-2 mRNA induction by

215 LPS (Figure 5-10B). Thus the effects of DPI and CCCP on S100A8 induction may be principally through reduction of IL-10.

120 A 1.0 B 100 0.8 80 0.6 60 0.4 40

20 0.2 Relative COX2/HPRT mRNA ratio COX2/HPRTRelative mRNA

% 0f Maximal COX-2 mRNA Response mRNA COX-2 0f Maximal % 0 0 Untreated CCCP NAC Antimycin A 0 6 12 18 24 hours

Figure 5- 10: The mitochondrial transport chain is not involved in COX-2 induction by LPS

(A) RAW cells were pre-treated with (broken line) or without (solid line) 5 M DPI, and then stimulated with LPS for the indicated periods. COX-2 mRNAs were quantitated. Maximum mRNA induction by LPS was denoted as 100% maximal response. (B) Cells were pre-treated with CCCP (5 M), NAC (10 mM) or Antimycin A (0.5 g/ml); then unstimulated (open bars) or stimulated (solid bars) with LPS for 4 hours. COX-2mRNA levels were quantitated.

5.3.5. S100A8 is suppressed by a COX-2 metabolite produced in the resolution phase of

inflammation

12-14 To further examine a possible role for COX-2, the effect of 15deoxy PGJ2 (PGJ2), which is produced by COX-2 and regulates the resolution phase of inflammation (1279), on S100A8 mRNA induction was examined. Figure 5-11 shows that PGJ2 suppressed S100A8 mRNA induction by LPS by 82%.

1.0

0.8

0.6

0.4 Figure 5- 11: S100A8 is suppressed by the late phase COX-2 metabolite PGJ 0.2 2

Relative S100A8/ HPRT mRNA HPRT S100A8/ Relative ratio 0 RAW cells were pre-treated with or without PGJ2 (5 M) then LPS - 20 - 20 untreated or stimulated with LPS. S100A8 mRNA levels were PG J2 - - 5 5 quantitated.

216 5.3.6. Exogenous ATP enhances S100A8 mRNA induction by LPS

The mitochondrial electron transport pathway may bifurcate at ATP synthesis, because

ATP has intracellular and extracellular roles. One example is that intracellular ATP may be involved in S100A8 production as a result of its effect on PKR. Figure 5-12A shows that the 2-

AP suppressed S100A8 mRNA by 70.3% in LPS-activated RAW cells, indicating PKR involvement.

1.0 8 A B

0.8 6

0.6 4 0.4 2 0.2 Relative S100A8/ HPRT mRNA S100A8/ Relative ratio

Relative S100A8/ HPRT mRNA S100A8/ Relative ratio 0 0 LPS - 20 - 20 Untreated ATP ATP ATP ADP Adenosine 2-AP - - 1.6 1.6 3 30 300 300 100

Figure 5- 12: Exogenous ATP and its metabolites increase S100A8 induction

(A) RAW cells were pre-treated with or without 2-AP (1.6 M); then untreated, or stimulated with LPS. S100A8 mRNA levels were quantitated. (B) Cells were pretreated with the indicated doses of ATP or the metabolites (M), then untreated (open bars) or stimulated (solid bars) with LPS and relative mRNA levels quantitated.

To investigate a role for ATP, extracellular ATP and its metabolites were tested. Figure

5-12B shows that although low doses of ATP (3, 30 M) did not induce S100A8 mRNA, 300

M ATP directly caused a 6.5-fold increase. ADP and adenosine had little direct effect. When co-incubated with LPS, S100A8 mRNA levels were markedly enhanced above those induced by

LPS alone. In particular, ATP caused dose-dependent increases with up to 5.5-fold elevation of mRNA levels induced by LPS. These results confirm the potential involvement of ATP in

S100A8 gene induction by LPS.

5.3.7. Identification of the promoter region involved

To examine if DPI affected the S100A8 promoter at the transcriptional level in LPS- activated macrophages, 5’-flanking sequences upstream of the transcription initiation site,

217 untranslated intron 1 and sequences upstream of exon 1 were used to evaluate activities of deletion constructs after transient transfection into RAW cells. Assays using dual-luciferase reporters of the S100A8 promoter region (see Figure 1-11) were carried out using LPS- stimulated RAW cells pretreated with DPI. Results from three independent assays showed similar trends. Levels of luciferase activity generated by the -917/+465 construct were similar in cells treated with LPS and with LPS+DPI. Figure 5-13 shows that deletion of the region from

917 to -665 had little effect on activity in samples treated with LPS+DPI. However, further deletion of the region from 665 to 317 bp markedly reduced activity, whereas deletion of this region did not alter the activity of samples stimulated with LPS alone. Thus, the promoter region from 665 to 317 bp contains an important transcription factor binding site(s) for responses to LPS that was obvious only when RAW cells were pre-treated with DPI. The -178 to -94 bp region of the promoter is necessary and sufficient for gene induction by LPS, and for

IL-10 enhancement (94). In keeping with this, deletion of this region negated LPS-induced activity, and levels of luciferase activities of samples treated with LPS or LPS+DPI were similar, confirming that this region contains elements essential for gene induction by LPS, and implying that the essential elements were not affected by DPI. These results suggest that DPI may affect transcriptional regulation, possibly via enhancing element(s), rather than elements essential for gene induction by LPS.

Deletion constructs (bp) Relative luciferase activity Figure 5- 13: Identification of DPI- -1000 -500 0 500 0 0.1 0.2 0.40.3 0.5 responsive regions in the murine S100A8 Promoterless promoter

Promoter RAW cells were transiently co-transfected -917 +465 with pRT-TK-luciferase and full-length (- -665 +465 917/465) or a series of 5’-deletion S100A8

-317 +465 promoter-luciferase reporters. pGL-basic plasmids and pGL-promoter plasmids were -229 +465 transfected as controls. (See Section 2.4 for -178 +465 detail) Medium from transfected cells was replaced and cells were treated with or -94 +465 LPS without DPI (5 M), then stimulated with -34 +465 LPS+DPI LPS for 16 hours. Luciferase activities in -178 0 cell extracts were analyzed. Data representative of 3 experiments

218 5.4. Discussion

S100A8 is induced by bacterial and viral components, such as LPS, CpG (Hsu K unpublished data) and dsRNA (Chapter 4), and may have a protective role in host defense against micro-organisms. In human, this is the function of calprotectin, the S100A8/S100A9 complex released in large amount from activated neutrophils (92, 344, 565). However, activated murine macrophages only produce S100A8 and an alternative role has been proposed. S100A8 is a potent oxidant scavenger ((73, 368, 389), see Section 1.7.2.4), and is upregulated by UVA and H2O2 in keratinocytes, together implying a protective role against ROS. Furthermore, the requirement for IL-10 in S100A8 induction, and enhancement of its induction by glucocorticoids (407) supported an anti-inflammatory role. Initially, we proposed that S100A8 may be induced in macrophages in response to ROS. This investigation led to a new aspect of

S100A8 gene regulation that may be important in inflammation, namely the involvement of the mitochondrial ATP synthesis pathway, which we found to be critical in enhancing IL-10 and

S100A8 gene expression in macrophages activated with LPS. One caveat of this study is that the pathway was defined solely using the RAW cell line, although primary murine macrophages also require IL-10 for S100A8 gene induction by LPS (see (94) and Figure 4-7C).

5.4.1. Involvement of H2O2 in S100A8 regulation

Intracellular ROS can be generated by different systems, including NADPH oxidase, which is important in phagocytic defense, the mitochondrial electron transport chain, and via enzymes such as NOS, xanthine oxidase, cytochrome P450, lipoxygenases, and cyclooxygenases. As a starting point, H2O2 was added to macrophages to examine its extracelluar effect. Unlike S100A8 induction in keratinocytes (412), this induced only low

S100A8 mRNA levels, although these were significant, and 5.0-fold above baseline (Figure 5-

3A). Thus H2O2 may contribute to S100A8 upregulation in macrophages. To scavenge O2 and

H2O2, RAW cells were co-treated with SOD and catalase during LPS activation but these did not alter the response (Figure 5-3B), indicating that extracellular ROS are unlikely to be a major contributor. Exogenous sources of SOD/catalase only partially distribute into the cytoplasm. To

219 determine effects of catalase on cytoplasmic ROS, polyethylene glycol catalase, a membrane- permeable form, was tested. However, this and the vehicle control strongly induced S100A8 mRNA (data not shown) and results were not meaningful. TEMPOL had no effect on S100A8 mRNA levels induced by LPS (Figure 5-3C), indicating that cytoplasmic O2 was not involved.

NAC suppressed IL-10 mRNA by 92% (Figure 5-9B) in LPS-activated macrophages.

Because LPS-induction of S100A8 is IL-10 dependent (94), suppression of S100A8 mRNA

(Figure 5-3D) was presumably the consequence of reduced IL-10. NAC is a thiol oxidant scavenger, but can also directly inhibit human PKC (common PKC- and PKC-1) in vitro and this is independent of its anti-oxidant properties (1307). In murine macrophages, PKC inhibitors reduce mRNA levels induced by LPS (93), suggesting that PKC may mediate S100A8 gene induction, possibly via IL-10 signalling. It would be worth examining the role of PKC in IL-10 induction in more detail. In other studies, pre-treatment of LPS-stimulated RAW cells with

NAC reduced intracellular ROS levels, and the ensuing AP-1-mediated gene induction (1308).

Similarly, in cardiomyocytes under oxidative stress, NAC abolishes c-fos activation (1309).

Thus scavenging of intracellular ROS by NAC may alter AP-1 levels and this may reduce IL-10 mRNA. Recently, two functional AP-1 binding sites were identified in the IL-10 promoter

(1310). This would be another possible mechanism whereby NAC may have suppressed

S100A8 induction. It is noteworthy that S100A8 does not have perfect consensus sequences for

AP-1 binding sites (Section 1.9.2.2).

5.4.2. Mitochondrial flavin-containing enzymes are involved in S100A8 induction

DPI was initially regarded as a selective NADPH oxidase inhibitor that could counteract oxidative stress (1011, 1311) but DPI causes other effects mediated by other mechanisms (1010,

1312-1316). This agent suppressed S100A8 mRNA induction in a concentration-dependent manner (Figure 5-4A). The effective concentrations were quite low (2.5-5 M) whereas most studies to inhibit NADPH oxidase generally use concentrations >5 M for full inhibition (1011,

1317). ROS generated by NADPH oxidase are released into phagocytic vacuoles and into the extracellular milieu (1318, 1319). However the effects of DPI in this study are unlikely to be

220 attributed to suppression of NADPH oxidase, since extracellular/cytoplasmic ROS suppression by catalase + SOD or TEMPOL had little effect (Figure 5-3B, Figure 5-3C).

DPI also inhibits a wide range of other flavin-containing enzymes (1312) including xanthine oxidase (1314, 1320), NOS (1010), NADPH cytochrome P450 oxidoreductase (1314,

1321) and mitochondrial flavoenzymes (1317) such as NADH:ubiquinone oxidoreductase

(1322-1325).

Similar to DPI, apocynin is not a specific inhibitor of NADPH oxidase, but suppressed

S100A8 induction by 91% in LPS-activated macrophages (Figure 5-4C). Apocynin is a methoxy-substituted catechol (1012) that inhibits superoxide production by NADPH oxidase, probably by inhibiting its assembly by blocking free sulfhydryl groups (1013). Apocynin does not act directly as an inhibitor (1326) and must be pre-activated by H2O2 and a peroxidase

(1013) to be converted into a symmetrical dimer for function (1327). Therefore, for inhibition, apocynin requires pre-activation, suggesting that its activity may depend on the stimulants, and cell types. Apocynin may also interact with flavoproteins (1305), and its inhibition of S100A8 induction may be a result of this property. The most likely explanation is that DPI and apocynin disturbed efficient functioning of mitochondrial flavoenzymes to disrupt electron transport and

ATP generation, although this requires verification.

Because iNOS is induced by LPS in macrophages (1328-1330), and DPI may affect NOS, involvement of NO in S100A8 induction was investigated. In LPS-activated RAW cells, NO production is greatly increased (1331-1334), and the results of the present study confirmed this

(Figure 5-5A). It was feasible that peroxynitrite formation, or S-nitrosylation of particular proteins, could lead to expression of S100A8 in macrophages. However, the NOS inhibitor, L-

NAME, an L-arginine analogue that attenuates NO production by iNOS, did not reduce S100A8 mRNA levels (Figure 5-5B). Moreover, the mitochondrial uncoupler (CCCP) almost abolished

S100A8 induction by LPS (Figure 5-6B), whereas it only weakly reduced iNOS mRNA (Figure

5-6D), supporting the conclusion that NO did not make a major contribution.

221 5.4.3. Involvement of the mitochondrial electron transport chain in S100A8 induction

Because DPI and apocynin can suppress functions of flavoenzymes, involvement of the mitochondrial respiratory system was investigated. Rotenone suppressed S100A8 mRNA induction by LPS by 84% (Figure 5-6E), indicating mitochondrial involvement. Interestingly,

MMP-9 may be regulated through a mitochondrial ROS-p38 MAPK-AP-1 pathway, because

DPI, rotenone or rottlerin (a mitochondrial uncoupler) inhibit its induction in LPS-activated

RAW cells. However, unlike its effects on S100A8 induction (Figure 5-6A) antimycin A, a pharmacologic inhibitor of the mitochondrial electron transport chain complex III, had only a slight effect on MMP-9 (1335).

Rotenone and antimycin A block transfer of electrons to ubiquinone, between cytochrome b and the semiquinone intermediate, respectively. Figure 5-14 shows the points in the electron transport chain inhibited by these. Some studies report that complex I or complex III inhibition increases superoxide generation (1336) because upstream electron carriers become reduced and capable of reacting with O2 to generate superoxide. However, DPI and rotenone reduce mitochondrial superoxide production in macrophages, probably by inhibiting complex I (1317,

1337). These results indicate that S100A8 mRNA induction may depend on the mitochondrial electron transport chain rather than superoxide production.

I P D

Figure 5- 14: Antimycin A, rotenone and DPI inhibit the mitochondrial electron-transport chain

(modified from (1338))

222 DPI decreases cellular ATP levels as a result of inhibition of electron transfer (1322, 1339,

1340). To investigate the possibility that decreases in cellular ATP could reduce S100A8 mRNA, the specific F0F1ATP synthase inhibitor oligomycin, and the classic uncoupler of oxidative phosphorylation (CCCP), which also reduces intracellular ATP (1341, 1342) by dissipating H+, were used. Inhibition of the uncoupling protein (UCP) initially increases

ATP production and inner membrane potential (Figure 5-15). The latter subsequently slows electron transport, promoting higher levels of ROS, and ultimately inhibiting ATP synthesis

(1343). The ATP synthase inhibitors suppressed S100A8 mRNA induction in LPS-treated RAW cells (Figure 5-6B, 5-6C). Suppression by CCCP was almost total at the mRNA and protein levels. These results suggest that S100A8 may depend on de novo ATP synthesis in mitochondria.

External mitochondrial membrane

Intermembrane space

Inner mitochondrial membrane

UCP matrix

Figure 5- 15: Effects of inhibiting the uncoupling protein (UCP) on mitochondrial electron transport

(from (1343))

There is controversy concerning the effects of CCCP on mitochondria because it can also modify cytosolic Ca2+ mobilization and increases [Ca2+]i in various tissues (322, 1344-1347), presumably by increasing Ca2+ influx through nicotinic receptor-linked Ca2+ channels (1348). In keeping with this, low levels of DPI (3 M), similar to the dose that effectively suppressed LPS- induced S100A8 (Figure5-4A), reversibly inhibited currents in pulmonary smooth muscle cells (1316). Perhaps of more relevance to this study, calcium also regulates transcription of a number of S100 genes (284, 994). For example, S100A1 is down-regulated in 223 failing myocardium because of reduced Ca2+-induced Ca2+ release from sarcoplasmic reticulum, and conversely upregulated in hypertrophic heart as a possible compensatory response (120,

121). Expression of murine S100A8 in LPS-activated macrophages may be regulated by changes in Ca2+ mobilization via release from intracellular stores and/or the extracellular space

(Section 1.10.4). Thus, it was reasonable to propose that changes in Ca2+ release from mitochondria may affect S100A8 expression. However, an inhibitor of mitochondrial Na+/Ca2+ exchange (CGP37157) did not alter S100A8 mRNA levels in LPS-stimulated RAW cell (Figure

5-8), indicating that the suppression seen with CCCP and DPI was unlikely to be due to Ca2+ mobilization.

Given the involvement of IL-10 in LPS activated S100A8 induction, it was possible that its suppression by inhibiting mitochondrial electron transport may responsible for the reduced

S100A8 expression. DPI and rotenone reduced IL-10 mRNA levels by 46% and 59% (Figure 5-

9A, 5-9B), respectively, making this likely. Similar results were reported for human THP-1 cells in which DPI and rotenone inhibited IL-10 production by LPS by 68% and 87%, respectively

(1349). Here we showed that CCCP, antimycin A and oligomycin all reduced IL-10 mRNA levels by ~60%, suggesting that its expression may be dependent on mitochondrial ATP synthesis. Confirmation of reduced IL-10 levels in supernatants of cells treated with these inhibitors would be worthwhile. Taken together, it appears that S100A8 is enhanced by a mitochondrial ATP synthesis- IL-10-dependent pathway.

In RAW cells, a neutralizing anti-IL-10 mAb reduced S100A8 mRNA levels induced by

LPS by ~50% (94), and levels induced in primary peritoneal macrophages from IL-10-/- mice were approximately half of those from wild type mice (Figure 4-7C), suggesting involvement of another pathway. Because inhibition by DPI, rotenone and CCCP was almost total, additional mediators may contribute. Moreover, DPI-suppressed S100A8 induction was only restored by

IL-10, to levels induced by LPS alone, and the potentiation seen when LPS and IL-10 were added together was not obvious, suggests involvement of other mediators such as ATP (Figure

5-9C). It would be worthwhile examining the effects of ATP on S100A8 expression in LPS- activated macrophages in presence or absence of CCCP treatment, and in IL10-/- macrophages.

224 This would provide more insights, particularly to distinguish whether ATP acts in an autocrine or paracrine manner.

5.4.4. Extracellular ATP enhances IL-10 and S100A8 production

ATP and its metabolites can be released from monocytes/macrophages in response to

LPS stimulation and act through purinergic signalling in an autocrine/paracrine manner (see

Section 5.1.4). IL-10 production by macrophages is induced via TLR-mediated MyD88- dependent or TRIF-dependent pathways, as well as via non-TLR signals (1350). Intriguingly, extracellular ATP and its metabolites also enhance IL-10 expression in LPS-stimulated murine macrophages and human monocytes (1212, 1298, 1299), although precise mechanisms are unknown. Because there are many different purinergic receptors with different affinities, it may be difficult to exactly identify the pathway that enhances IL-10, but one common feature of these receptors is that cAMP increases upon activation, leading to activation of CREB (Section

1.10.3.2). The importance of a CREB-C/EBP pathway was suggested from promoter analysis of activated murine macrophages which identified C/EBP binding elements responsible for stimulation of IL-10 promoter activity by adenosine (1212). In support of this, C/EBP-/- macrophages fail to produce IL-10 in response to adenosine or E coli. (1212). Binding of CREB to C/EBP promoter elements is critical for activation of C/EBP transcription (1351) and adenosine enhances CREB transcriptional activity in macrophages (1352). Taken together, a purinergic receptor-cAMP-CREB-C/EBP axis may be critical for IL-10 production in LPS- activated macrophages, and this pathway could contribute to enhancement of S100A8 induction by LPS. Activation of other G-protein-coupled receptors may also promote IL-10 production such as those for PGE2 or cAMP (93, 94).

Low levels of exogenous ATP, ADP or adenosine did not directly induce S100A8 mRNA.

However, a high dose of ATP increased S100A8 mRNA expression 6.5-fold (Figure 5-12B). It is possible that S100A8 was induced as a consequence of mediators such as TNF-, induced by high doses of ATP via activation of the P2X7 receptor (1331, 1353-1355), and IL-10 by ATP

(1331, 1353), ADP (1298) and adenosine (1212, 1300). At inflammatory sits, necrotic cells

225 releasing ATP may enhance S100A8 expression, and in vitro, damaged cells, such as post- transfected cells, or cells exposed to toxic reagents, may also enhance S100A8 expression.

Elucidation of the potential involvement of the pathways regulated by extracellular ATP is worthwhile. Experiments with neutralising anti-IL-10 mAb may clarify this mechanism.

5.4.5. Mitochondrial electron transport chain regulates S100A8 promoter activity

The murine S100A8 promoter, region -178 to -0 bp contains consensus sequences for c-

Ets and CEBP motifs, and is involved in induction by LPS and IL-10 enhancement (94). Using the same series of S100A8 luciferase reporter constructs, this study revealed another important region from -665 to -317 bp that was required for LPS responses (Figure 5-13). This region contains variant consensus motifs for Ikaros-1, -2, -3 which have a critical role in development of the lymphocyte lineage(s) (1356, 1357), and EF1, a zinc finger homeodomain protein multi- functional factor capable of activating or repressing transcription (1358, 1359). Deletion of this region of the S100A8 promoter tended to increase luciferase activity in RAW cells transfected with -317/+465 construct, consistent with a previous report (94), suggesting that EF1 may function as a repressor, as shown for chondrocyte-specific genes (1360). Mechanisms of transcriptional repression by EF1 include recruitment of co-repressors (1361) (1362, 1363) and competition with activators of E-box binding sites (1364-1366). Our study, suggests that EF1 may act as a repressor, as activity was abolished only when the EF1 binding site was deleted/inhibited in the presence of DPI. One plausible model is that some key element for

S100A8 gene transcription required either EF1 or an unknown mediator to associate with the promoter.

Interestingly, EF-/- mice have multiple skeletal defects, defects in T-cell development

(1358), impaired thymic development, and respiratory failure. EF1 is also a key player in estrogen-mediated signalling cascades in vertebrates (1367), and its human homolog, ZEB-1 synergizes with Smad-mediated transcriptional activation in TGF-/BMP signalling (1368,

1369), implying that EF1 can function as an enhancer or repressor, depending on the co-factor.

Estrogen and TGF- can influence S100A8 gene regulation (Section 1.10.3.3, Table 1-28) and

226 EMSAs or chromatin immunoprecipitation (ChIP) assays could be performed to determine

EF1’s involvement.

Although it was difficult to compare samples with low levels of luciferase activity, the promoter activity of the -178/-0 construct appeared not to be altered by DPI, suggesting that the mitochondrial pathway may principally contribute to the enhancement pathway of S100A8 gene induction. However, the involvement of ATP from mitochondria is still unclear. It would be worthwhile comparing the luciferase activity profiles of RAW cells treated with LPS and ATP, and ATP+CCCP, because mitochondrial and extracellular ATPs are both potential candidates as enhancers of S100A8 induction. Alteration of luciferase activity of the essential promoter (-

178/-0 construct) in the presence or absence of various pathway inhibitors of MAPK, PKC and

PI3K may provide additional insights.

5.4.6. Potential involvement of intracellular ATP in S100A8 induction

Intracellular ATP plays numerous roles in signal transduction. For example, upon recognition of dsRNA, PKR binds ATP for autophosphorylation that enables signal transduction downstream. We found that PKR may play critical roles in S100A8 induction by poly(I:C)

(Figure 4-8A, 4-8B), and in LPS-activated macrophages (Figure 5-12A); this could occur via the intracellular ATP pathway. However unlike mitochondrial ATP generation, studies with other cell types indicate that intracellular ATP levels are not affected by 24-hour treatment with

CCCP (1370), or only weakly reduced by high doses of rotenone (0.2 M) or antimycin A (125

M) (1341). Together with the fact that CCCP is a mitochondrial uncoupler, we propose that

IL-10 reduction by these inhibitors may be due to depletion of ATP in mitochondria rather than to changes in intracellular ATP levels. Moreover, reduction of IL-10 mRNA by DPI was rapid and obvious 4 hours post-LPS-stimulation (Figure 5-9A). Thus, in LPS-activated macrophages, induction of IL-10 may be regulated by intra-mitochondrial ATP as well as by extracellular

ATP. However, more studies are required to determine changes in ATP levels in intracellular compartments.

227 Signal transduction downstream of mitochondrial electron transport is still obscure. One candidate is the apoptotic pathway, by virtue of its requirement for ATP. Cytochrome c released from mitochondria forms a so-called apoptosome complex with apoptosis-protease-activating factor-1 (APAF-1), procaspase 9 and ATP (1371), and pro-caspase 9 activator is ATP- dependent. Consistent with this, apoptosis in many cells requires ATP (1372-1374). However, any relationship with S100A8 is unknown.

5.4.7. Anti-inflammatory pathways in macrophages

Functions of monocytes/macrophages in inflammation are tightly regulated by extracellular nucleotides and nucleosides, and ATP can modulate activation or repression via

IL-10 (see Section 5.1.4). The model shown in Figure 5-16 proposes that when the

Figure 5- 16: Proposed model for interaction of ATP in LPS-signalling

ATP acts via P2Y11 receptors and increased cAMP to inhibit the pro-inflammatory immune response evoked by TLR activation, thereby preventing excessive host tissue damage (from (1299)).

pro-inflammatory response to LPS is excessive, such that it damages host tissues, ATP is released extracellularly and negatively regulates the response via P2Y11 receptors and increases cytosolic cAMP. Either directly, or indirectly via cAMP-dependent PKA, or possibly Epac

(exchange protein directly activated by cAMP) (1375), cAMP inhibits production of inflammatory cytokines, with concomitant increased expression of IL-10. Adenosine also has anti-inflammatory effects through activation of P1 receptors (1376, 1377).

In monocytes/macrophages LPS, IL-1 and TNF- up-regulate A2 receptors. Activation

228 of A2 receptors by adenosine indirectly affects P2X7 receptor function through cAMP-mediated inhibition of P2X7 receptors via upregulation induced by IFN- and TNF-, or by augmenting

IL-10-mediated down-regulation of P2X7 receptors (1378). Thus adenosine may switch the activated monocyte/macrophage phenotype, to one required for resolution of inflammation and tissue healing. Taken together, various purinergic receptors regulate inflammation positively or negatively, depending on levels of ATP and its metabolites. Importantly, in LPS-activated macrophages, S100A8 mRNA was enhanced by ATP and its breakdown products (Figure 5-

12B), and by cAMP (93) and IL-10 (94) all components of the anti-inflammatory pathway, further supporting an anti-inflammatory role for this protein.

Interestingly, the pyrimidinergic P2Y receptor subtypes (Table 5-1) P2Y4 and P2Y6, modulate eicosanoid synthesis generated via the COX system (1379, 1380). PGE2 also enhances

S100A8 induction (94). Activation of P2Y6 receptors by UTP markedly potentiates PGE2 production by LPS-primed murine macrophages via up-regulation of COX-2 and release of arachidonic acid (1379-1381). In this study, COX-2 mRNA induction by LPS was biphasic. mRNA levels peaked 4 hours post-stimulation, but then increased ~2-fold over 10-24 hours

(Figure 5-10A), suggesting that COX-2 metabolites also have a role in the later inflammatory phase.

There is an increasing notion of inflammation as a series of checkpoints controlling the influx, persistence, and clearance of inflammatory cells leading to resolution that are managed by endogenous mediators (1382). One example is the eicosanoids, in particular PGE2 and PGJ2.

The onset phase of carrageenin-induced pleurisy is characterized by rapid neutrophil influx mediated in part by PGE2 (1383, 1384). As inflammation progresses to resolution, PGE2 levels decline, giving way to a predominance of COX-2-derived PGD2 and its cyclopentenone breakdown product, PGJ2, both of which mediate resolution (1384). Interestingly, in LPS- activated macrophages, PGJ2 suppressed S100A8 by 82.3% (Figure 5-11) whereas PGE2 enhances the LPS-induced gene (94). Enhancement by PGE2 and suppression by PGJ2 implicate

S100A8 in the immuno-modulatory phase of inflammation rather than the resolution phase.

Contrary to this argument, recombinant S100A8 was recently shown to bind TLR4,

229 leading to induction of TNF- via activation of NFB in bone marrow cells (242), suggesting a pro-inflammatory role. Considering the requirement for S100A8 induction, and because ATP breakdown products and IL-10 suppress TNF- production (but enhance S100A8), it is highly questionable whether the reported pro-inflammatory role of S100A8 observed in vitro has functional relevance. From the point of view of purinergic regulation, the result described by

Vogl et al could arise if high levels of ATP were released from damaged cells and/ or dead cells in the whole bone marrow population used, following addition of recombinant S100A8.

5.4.8. Summary

This chapter provides a better understanding of pathways mediating induction of the

S100A8 gene by LPS. The mitochondrial electron transport pathway was involved, possibly via

ROS-mediated production of ATP. Thus mitochondrial stress, such as the transient transfection procedures used in Chapter 3 may have caused mitochondrial stress and subsequent S100A8 induction or enhancement, possibly via ATP. These factors may contribute to the ineffectiveness of siRNAs described in Chapter 3. The signal transduction pathway triggered by

LPS, summarized in Figure 5-17 implies an anti-inflammatory role for S100A8 in the immuno- modulatory phase of inflammation.

LPS ATP LPS

MT MT

? ATP ?

IL-10 S100A8

IL-10 S100A8

Figure 5- 17: Proposed model of S100A8 gene regulation

MT, mitochondria. 230 6. GENERAL DISCUSSION

Twenty-eight years has passed since S100A8/S100A9 was first isolated from granulocytes

(17). However, the functions of the proteins are not fully understood, partly due to difficulties in protein purification and isolation, and to oligomerization and other post-translational modifications that could influence functions, and incomplete knowledge of intra- and extracellular target proteins. Deletion of the S100A8 gene in mice is embryonic lethal (339). To gain more information of its function, the aim of this project was to establish gene-knockdown models using RNAi technology. Studies presented in this thesis demonstrated difficulties in suppressing the gene in activated cells, and only under limited conditions using breast tumor cell line could the S100A8 gene be efficiently suppressed. This was achieved during the last months of experimental work and although studies are incomplete, will contribute to functional assays in the future. However, we show that modulating expression of S100A8 by RNAi systems is probably not possible in monocytes/macrophages because S100A8 appears to be a stress response gene in these cells that may be upregulated as a secondary response gene product. Other strategies such as targeted gene deletion or overexpression in specific tissues/cells may provide new insights into function. Importantly, understanding how the

S100A8 gene is regulated has provided new insights that support the proposal that S100A8 has properties that may protect the host in anti-microbial defense. Work presented in this thesis has uncovered some of these, particularly S100 gene induction in macrophages by dsRNA, indicating potential involvement in anti-viral defence.

This thesis also describes a new mechanism involved in S100A8 gene induction by LPS, mediated by generation of mitochondrial ROS leading to ATP production. ATP and its metabolites acted as enhancers of S100A8 gene expression. An important new aspect of upregulation was the potential involvement of PKR in three different systems, possibly via regulation of IL-10.

S100A8 is expressed by numerous human tumors but its functions relating to tumor growth/metastasis are unknown. The ability to silence the S100A8 gene in a breast cancer cell line activated with OSM may help to uncover how it relates to the ability of OSM to regulate

231 tumor cell growth. Although preliminary, the successful establishment of stably-transfected miRNA that suppressed S100A8 gene induction in MCF-7 cells provides the basis for further studies in vitro, and injection of these cells into appropriate murine models may help to uncover its role in vivo.

6.1. “Two pathways” model for LPS- induced S100A8 expression

Enhancement of IL-10 in LPS-activated macrophages indicates that at least two pathways are involved in full induction of S100A8 (94, 407) (Figure 4-7C). One is a regulatory pathway which determines whether S100A8 is expressed or not; others are enhancer pathways which determine expression intensity that may be modulated by IL-10 and may differ, depending on the stimulus. The simplest model for LPS-induced gene expression is shown in Figure 6-1A.

Protein A is constitutively expressed in unstimulated macrophages. LPS causes a modification, such as phosphorylation and/or dissociation, of protein A. Modified protein A (A’) is a key regulator initiating mRNA transcription following binding. However S100A8 regulation in this simplest model is not sufficient to explain induction, because this requires de novo protein synthesis. Figure 6-1B shows the next simplest model, that satisfies this requirement. LPS induces protein B mRNA and subsequently synthesizes the protein, and then this de novo protein induces the enhancer, protein A. In this case, protein A could be secreted.

Among the enhancers, the role of IL-10 is well documented (94), and is a de novo synthesized product of LPS (94) or poly(I:C) (Section 4.4.1). Secreted IL-10 is not protein A in

Figure 6-1C, because exogenous IL-10 alone only weakly/does not induce S100A8 in murine macrophages. If IL-10 were protein A, exogenous IL-10 would be expected to strongly induce

S100A8. We propose that IL-10 contributes to an enhancement pathway. Protein C in Figure 6-

1D, a simplified version of Figure 6-1C, is downstream of the IL-10/Jak-STAT pathway, and protein C enhances expression of S100A8. Therefore, Protein C could be a transcription factor that binds the enhancer region of the S100A8 promoter, such as C/EBP that enhances expression of the human S100A8 gene (526). Notably, the role of protein A (or A’) is to activate a transcriptional regulator element, or alternatively to inhibit transcriptional repressor elements.

232 This model would also fit with results from deletion analysis of the S100A8 promoter using murine macrophages activated by poly(I:C) (Figure 4-10) and in fibroblasts activated by FGF-2

(378).

AB A ECM LPS ECM LPS A’

Cytoplasm Cytoplasm

A A B A’ B’ A’

Nucleus Nucleus

A’ B’ A’ S100A8 mRNA A mRNA S100A8 mRNA

CD A ECM LPS A’ IL-10 ECM LPS IL-10

Cytoplasm Cytoplasm

A A B B B’ A’ C B’ A’ C

Nucleus Nucleus

B’ C A’ B’ C A’ A mRNA S100A8 mRNA A mRNA S100A8 mRNA

Figure 6- 1: Two pathways model for LPS-induced S100A8 expression

Solid and open box in mRNA promoter region indicate regulatory and enhancer region, respectively. ECM, extracellular compartment; A’ and B’ are products of A or B.

Signal transduction to induce S100A8 can be divided into three parts: One that is initiated by the TLR ligand. This is IL-10-independent and ERK dependent (845). The second is induction of IL-10, and the third, downstream signalling initiated by IL-10 possibly in concert with transcription factors expressed/activated in response to LPS ligand. The IL-10 signalling is well documented and there is no doubt that the Jak/STAT3 pathway is essential for its anti- inflammatory effects ((947-949). STAT 3 could be “enhancer factor” C in Figure 6-1D.

Interestingly, PGJ2, which abolished S100A8 induction in LPS-activated macrophages (Figure

5-11), also suppresses STAT3 in IL-10-activated human monocytes (1385), implying involvement of the Jak/STAT pathway in S100A8 regulation. This may be supported by

S100A8 induction via activation of this pathway by OSM in MCF-7 cells (693, 1115), (Section

233 3.4.4). Other studies in our laboratory using ChIP analysis of nuclear extracts of macrophages activated by LPS or CpG indicate a clear involvement of STAT3 in regulation of S100A8 expression (Hsu K in preparation). Intriguingly, PKR activated by PDGF also plays a critical role in mediating phosphorylation of STAT3 in murine fibroblasts, and as proposed for STAT1,

PKR also regulates ERK activation, ultimately involved in STAT3 phosphorylation (1137).

Further studies are required to elucidate involvement of the in Jak/ STAT pathway, particularly in interactions with PKR.

Because IL-10 is induced as a secondary gene in response to LPS and other TLR ligands, and because S100A8 gene induction is dependent on TLR activation, it may be difficult to distinguish from common pathways, those that are either IL-10- or S100A8-specific. For example, PKR is involved in IL-10 induction (1210) and IL-10 subsequently enhances S100A8 production. But PKR may also directly regulate S100A8 induction through pathways other than those dependent on IL-10 (Figure 4-8C), as shown in Figure 6-1C, where PKR would be A or B and PKR-derived signals A’ or B’. Multiple and complicated pathway interactions may be involved, and thus the S100A8 gene appears to be tightly regulated.

This study revealed additional enhancer pathways, including ATP and IFN- co- activation in LPS- or dsRNA-activated macrophages. Similar to IL-10, IFN- enhanced S100A8 induction, possibly via as yet undetermined IFN-stimulated genes, because IFN- alone did not induce S100A8. This also implies a role of S100A8 in the innate immune system, particularly in anti-viral defense. This was supported by the strong expression of S100A8 in murine lung infected with influenza virus and in tissue from a patient with SARS. In the influenza model, S100A8 expression and was not apparent in the initial phase, and declined early in the recovery phase in agreement with in vitro observations that it is likely to be a secondary response gene.

This study also revealed differences in “enhancers” of the LPS- and dsRNA-induced responses. The LPS response is reduced by depletion of COX-2 and PGE2, PGE2amplifies

S100A8 induction by LPS (94). In contrast, COX-2 was apparently not involved in upregulation by dsRNA, indicating divergence in response to different stimulants (Section 4.4.2).

234 A requirement for de novo synthesised ATP for induction of IL-10 and for S100A8 mRNA was proposed. It is possible that ATP participates in the regulatory pathway. However, the results in Chapter 5 also suggested a potential involvement of mitochondrial ROS in IL-10 and S100A8 induction. This study has not distinguished whether the requirement for ROS was because an intact electron transport chain was required to generate mitochondrial-derived ATP.

To address this, measurement of electrochemical gradients (H+) in the inner membrane of mitochondria, and protein thiol redox changes in the organelle are required, because the studies presented use inhibitors to suppress the mitochondrial respiratory chain. NAC, a thiol scavenger, could interact with products of mitochondrial redox or free sulfhydryl groups on some proteins resulting in altered function. It is also necessary to examine changes of mitochondrial respiratory chain activities and/or in ATP levels in mitochondria and the cytosol following cell stress, including LPS or poly(I:C) activation. These studies would provide further insights into how IL-10 and S100A8 are regulated in various cellular responses.

In terms of S100A8 gene induction by dsRNA, and the importance of mitochondria/ATP in LPS-activated macrophages, another potential candidate for “protein A or B” shown in Figure

6-1C is a RIG-I-like RNA helicase, signalling for which is described in Section 4.1.1. This mediates dsRNA-signalling in an ATP-dependent association with mitochondria (1386-1389), leading to activation of NF-B and IRF-3 and -7. These could be A’, B’ in Figure 6.1C.

Interestingly, RNA helicase A (Dhx9) unwinds dsRNA and also acts as a bridging factor between the CREB-binding protein (CBP) and RNA polymerase II (Pol II) to activate transcription (1390, 1391). It has a similar bridging role between the breast cancer-specific tumor suppressor BRCA1 and Pol II (746, 1392) (1393). Interestingly, CREB (94) and BRCA1

(745) are suggested to have an involvement in S100A8 and/or IL-10 gene regulation. It would be worthwhile examining whether RNA helicases are involved in signalling in S100A8 regulation.

A PKR inhibitor suppressed S100A8 induction in LPS/dsRNA-activated murine macrophages (Figure 4-8A, Figure 5-12A) and in dsRNA-activated human monocytes (Figure

4-13A). It also suppressed OSM-induced S100A8 in breast cancer cells (Figure 3-26). These 235 studies suggest a common crucial role for PKR in S100A8 regulation. Features of PKR may explain, in a part, the unusual gene regulation of S100A8.

In murine microvascular ECs and fibroblasts, S100A8 induction is dependent on cell confluence (95, 378). Although PKR expression is dependent on cell type, increases could occur in confluent cells in a manner similar to that found for pre- fibroblasts (3T3-F442A cells) (888). This may explain the enhanced expression of S100A8 that correlated with confluence of NIH3T3 fibroblasts (Section 3.4.1). It is important to note that PKR is synthesized in a latent, inactive form that requires activation by stimulants such as dsRNA,

TNF-, IL-1, IFN- or heparin. These are also inducers and/or enhancers of S100A8 expression

(Section 1.10). Moreover, PKR is inactive until it binds ATP, which allows its autophosphorylation (1394). This could be another mechanism whereby ATP is necessary for

S100A8 gene induction. Additional studies to determine the levels of PKR/phophorylated PKR are necessary to confirm the relationship between PKR and S100A8 expression in confluent cells.

Interestingly, stimulation of RAW cells with poly(I:C) together with IFN- for 24 hours leads to degradation PKR (1395), and this coincides with the lack of expression of S100A8 seen in LPS-activated RAW cells pre-incubated with IFN- (Hsu K unpublished observation). PDGF also activates PKR autophosphorylation but this can be blocked by expression of activated p21ras which induces an endogenous inhibitor of PKR activation (1136). Such a mechanism may explain the reduction of S100A8 mRNA that was seen following co-treatment of FGF-2- activated NIH3T3 cells with PDGF (Rahimi F, unpublished observation). Identification of natural inhibitors of PKR may provide insights into how S100A8 may be regulated.

Taken together, more detailed characterization of the role of PKR may provide clues to explain some of the anomalies that this laboratory has found in regulation of the S100A8 gene.

To confirm its involvement, studies using different approaches are required, such as effects of other selective PKR inhibitors/activators and assessment of response of macrophages from

PKR-/- mice. It is worthwhile noting that transient transfection approaches such as siRNAs or dominant-negative PKR transfection would likely be unsuitable for evaluating effects on

236 S100A8 gene expression in macrophages for the reason discussed in Chapters 3 and 5, although this may be appropriate for MCF-7 cells. For gene modification, stable transfection procedures may be preferable, unless its modification results in cell damage.

6.2. The “Danger theory” and S100A8

The immune system is principally occupied with detecting “danger”, defined as anything causing tissue damage or cellular stress (1396-1400). In contrast to healthy cells, injured cells, namely those that are abnormally distressed, damaged, or destroyed necrotically, activate local antigen-presenting cells (APCs) (1401). In contrast, cells dying by normal physiological or programmed cell death should not induce co-stimulation. Exogenous danger signals, which are typically generated through binding of pathogen-associated molecular patterns (PAMPs) with pattern-recognition receptors (PRRs), trigger immune responses, and endogenous danger signals produced by stressed or damaged cells also trigger such responses.

The term “alarmin” is proposed to categorize these endogenous molecules whereas the term

“damage-associated molecular patterns (DAMPs)” is defined as any molecule that is not normally exposed if it is revealed during, after, or because of injury or damage(1402). Therefore, endogenous alarmins and exogenous PAMPs can be considered subgroups of DAMPs, because they convey similar messages and elicit similar responses.

DAMPs are generally: (1) constitutively present at high intracellular concentrations, (2), normally present at negligible extracellular concentrations, (3), are readily released in response to injury, infection or other inflammatory stimuli, (4), activate selective and specific receptors responsive over a wide range of concentrations, and (5) are quickly degraded following their release (1283, 1403). ATP and adenosine meet these prerequisites, and are considered as DAMP molecules (561).

237 (co-stimulation) Lymphocyte? ?

S100A8

Macrophage TLR9 ?

? TLR3

TLR4 ATP Antigen (alarm) LPS

Figure 6- 2: S100A8 in the danger model

Figure 6-2 shows how S100A8 may fit within the Danger model. The results found here indicate that S100A8 could be a DAMP, as proposed by Bianchi (1283, 1403, 1404). ATP may be a crucial in S100A8 gene induction, and S100A8 is induced by activation of TLR3 (Section

4.4.1), 4 (93, 94), and 9 (Hsu K 2008 in preparation). Hence S100A8 may be upregulated by alarmins and the PRR system, at sites of inflammation. S100A8 has so far not been detected in apoptotic cells.

However, S100A8 does not fully satisfy the proposed properties of ideal DAMPs (see

Table 6-1). Although neutrophils constitutively express very high amounts, circulating monocytes have little, and in macrophages its expression is delayed, suggesting a role in immune modulation rather than the activation phase of inflammation. However, the

S100A8/S100A9 heterodimer is apparently relatively protease-resistant (Section 1.6.1). S100A8

238 may activate lymphocytes, which do not express this protein; these cells may have surface binding sites specific for S100A8/ S100A9 (529), but this possibility has not been explored.

Table 6- 1: S100A8 in features of DAMPs

ATP IL-10 S100A8 Yes (Neutrophil) Constitutive presence at high intracellular concentrations Yes No No (Macrophages) Negligible extracellular concentrations in normal Yes Yes Yes conditions Easily release in response to injury, infection or other Yes Yes Yes inflammatory stimuli Ability to activate selective and specific cellular Not determined Yes Yes receptors responsive over a wide range of concentrations (TLR4?) Quick degradation following their release Yes No No (from (1283, 1403))

6.3. Functions that may be mediated by S100A8

In LPS- or dsRNA-activated macrophages, induction of S100A8 was dependent on PKR activity via IL-10 production, implying roles of S100A8 commonly shared with PKR and IL-10.

IL-10 plays immunosuppressive roles in the resolution phase of acute inflammation. In viral infection PKR suppress protein synthesis through phosphorylating eIF2. Moreover, IFN-, an important enhancer of S100A8 induction (Chapter 3), induces and/or activates PKR and 2’-5’- oligoadenylate synthetases (OAS) which also inhibits protein synthesis through cleavage of cellular and viral RNAs (see Section 4.1.2). Thus S100A8 is induced under influences that may repress cellular activities that are upregulated in response to stressors. Because S100A8 is found in both the intracellular and extracellular compartments, it could exhibit different functions, depending on the microenvironment, and whether it is co-expressed with S100A9. The studies presented here suggest an intracellular role of S100A8 possibly by regulating repression of cellular activities.

S100A8 expressed in the cytoplasm may scavenge ROS, as excess production of ROS leads to over-activation of stress-activated protein kinases (eg. JNK) that mediate cell apoptosis/death (see Section 1.7.2.4, Section 5.1.1). New studies from our laboratory indicate that S100A8 is readily S-nitrosylated and acts as a NO transporter (Raftery MJ et al, submitted).

239 In this fashion, it could S-nitrosylate important transcription factors such as NF-B (Section

5.1.1) to down-regulate activation. It could also participate in other thiol exchange reactions that could scavenge essential mediators such as glutathione.

S100A8 inhibits casein kinases that are implicated in phosphorylation of substrates such as nuclear oncogenes, RNA polymerase II, and topoisomerase, all necessary for normal cellular transcription and translation (177). Blocking this function may terminate metabolic events and would be keeping with S100A8’s regulation by PKR. Our laboratory demonstrated that histone

2B phosphorylation by guanosine-3',5'-cyclic- monophosphate (cGMP)-dependent protein kinase is specifically inhibited by S100A8 and S100A9, and most efficiently by the complex

(Harrison CA and Geczy CL, unpublished data). Interestingly, S100A8/S100A9 is also induced within 48 hours during differentiation of HL-60 cells (463) at the time when phosphorylation of

H2B decreases (1405). Inhibition of phosphorylation of core histones may regulate growth and division (1405). Together with the intra-nuclear localization of S100A8 (discussed in Chapter 3), the S100 proteins may contribute to repression of gene induction by inhibiting phosphorylation reactions in a manner similar to some other S100 proteins such as S100B (134, 135). In this context, it would be worth examining effects of S100A8 on phosphorylation of cytoplasmic enzymes such as PKR, to inhibit eIF2. Inhibition of this particular factor may contribute to restoration of cellular function following damage by cell stress. This may be supported by the rapid clearance of S100A8 seen in mice infected with influenza virus (Section 4.3.6)

We propose that S100A8 may play a role in modulation of inflammation rather than in leading to cell death and/or apoptosis. Its delayed expression may regulate PKR function in negative feedback manner. Taken together, intracellular S100A8 may participate in homeostasis to protect cells from over-reaction caused by stressors.

Similar to some DAMPs that exhibit a “double life” intracellularly and extracellularly at sites of inflammation, S100A8 also has extracellular functions. Earlier studies by this laboratory showed it to be a potent and efficient scavenger of ROS and hypochlorite and this could protect the host from undue tissue damage at inflammatory sites (73, 368, 389). Moreover, late expression of S100A8 downstream of IL-10 (Figure 4-5) supports a role during the resolution 240 phase of inflammation, when IL-10 expression peaks. The properties of activated macrophages that produce S100A8 are more typical of those that are involved in immunosuppression (Section

1.6.6, Figure 1-8), particularly as corticosteroids can markedly upregulate the gene (406).

Enhancement of S100A8 induction by PGE2 (94), and reduction by PGJ2 (Figure 5-11) in LPS- activated macrophages also supports a role in resolution. Failure to resolve inflammation potentially results in irreversible tissue remodeling that is a prominent feature of chronic inflammation (1406, 1407). Importantly, along with the genes activated to promote inflammatory responses, programs of genes that suppress or limit inflammation are also activated (1279, 1408)). S100A8/S100A9 may be suppressive genes in acute inflammation.

Because IL-10 has important regulatory functions on T-lymphocytes, particularly in suppressing proliferation of CD4 and CD8 cells, it would be interesting to test whether S100A8 alters T cell responses. Because serum S100A8 levels are elevated in patients with HIV (478,

605, 611), its role in viral persistence, such as recently attributed to IL-10 (Section 4.4.4), is worthy of investigation.

The mounting evidence from our laboratory, both functional and from gene regulation, including the results reported here, do not support a role for macrophage-derived S100A8 in acute inflammation. Studies to resolve the nature of an S100A8 receptor, and the proposed activation via TLR4 (242) are required before true mechanisms are fully understood.

6.4. Concluding remarks

The studies presented here showed the potential for selectively using RNAi technology in to assess S100A8 function in a tumor cell line. However its application to macrophages and fibroblasts is unlikely. More generally, this study also indicates potential pitfalls in using this approach, because of the genes that may be up/down-regulated by the transfected RNAis. These could alter a cell’s response, independently of the down-regulated gene of interest, giving misleading results.

241 The importance of dsRNA, PKR, ATP, IFN- and mitochondrial ROS/electron transport in S100A8 gene regulation were revealed. Figure 6-3 shows a putative model of S100A8 gene regulation based on the results in this thesis.

Distressed cells / necrotic cells

ATP LPS LPS

MT MT ATP PKR dsRNA ? dsRNA ERK? PKR p38 ?

IL-10

Enhancer Regulator S100A8 IFN-ᔾ

IL-10

IFN-ᔾ Undetermined factor induced S100A8 by type-1 IFN IFN inducible gene

ROS

LPS

Figure 6- 3: Putative model for S100A8 induction in LPS-activated macrophages

MT, mitochondria

These results provide new insights into a role in viral defence and neoplastic disorders.

More precise analysis of gene regulation of S100A8, including involvement of PKR and RIG-I- like RNA helicase signalling, and functional assays using the S100A8-stably knocked-down breast tumor cell lines generated in this study are likely to provide information concerning functions of S100A8, particularly in cancer.

242

7. REFERENCES

1. Kerkhoff, C., M. Klempt, and C. Sorg. 1998. Novel insights into structure and function of MRP8 (S100A8) and MRP14 (S100A9). Biochim Biophys Acta 1448:200. 2. Ravasi, T., K. Hsu, J. Goyette, K. Schroder, Z. Yang, F. Rahimi, L. P. Miranda, P. F. Alewood, D. A. Hume, and C. Geczy. 2004. Probing the S100 protein family through genomic and functional analysis. Genomics 84:10. 3. Donato, R. 2001. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. Int J Biochem Cell Biol 33:637. 4. Heizmann, C. W., G. Fritz, and B. W. Schafer. 2002. S100 proteins: structure, functions and pathology. Front Biosci 7:d1356. 5. Volz, A., B. P. Korge, J. G. Compton, A. Ziegler, P. M. Steinert, and D. Mischke. 1993. Physical mapping of a functional cluster of epidermal differentiation genes on chromosome 1q21. Genomics 18:92. 6. Krieg, P., M. Schuppler, R. Koesters, A. Mincheva, P. Lichter, and F. Marks. 1997. Repetin (Rptn), a new member of the "fused gene" subgroup within the S100 gene family encoding a murine epidermal differentiation protein. Genomics 43:339. 7. Heizmann, C. W. 1992. Calcium-binding proteins: basic concepts and clinical implications. Gen Physiol Biophys 11:411. 8. Moore, B. W. 1965. A soluble protein characteristic of the nervous system. Biochem Biophys Res Commun 19:739. 9. Isobe, T., and T. Okuyama. 1978. The amino-acid sequence of S-100 protein (PAP I-b protein) and its relation to the calcium-binding proteins. Eur J Biochem 89:379. 10. Isobe, T., and T. Okuyama. 1981. The amino-acid sequence of the alpha subunit in bovine brain S-100a protein. Eur J Biochem 116:79. 11. Glenney, J. R., Jr., M. S. Kindy, and L. Zokas. 1989. Isolation of a new member of the S100 protein family: amino acid sequence, tissue, and subcellular distribution. J Cell Biol 108:569. 12. Engelkamp, D., B. W. Schafer, M. G. Mattei, P. Erne, and C. W. Heizmann. 1993. Six S100 genes are clustered on human chromosome 1q21: identification of two genes coding for the two previously unreported calcium-binding proteins S100D and S100E. Proc Natl Acad Sci U S A 90:6547. 13. Barraclough, R., J. Savin, S. K. Dube, and P. S. Rudland. 1987. Molecular cloning and sequence of the gene for p9Ka. A cultured myoepithelial cell protein with strong homology to S-100, a calcium-binding protein. J Mol Biol 198:13. 14. Jackson-Grusby, L. L., J. Swiergiel, and D. I. Linzer. 1987. A growth-related mRNA in cultured mouse cells encodes a placental calcium binding protein. Nucleic Acids Res 15:6677. 15. Calabretta, B., R. Battini, L. Kaczmarek, J. K. de Riel, and R. Baserga. 1986. Molecular cloning of the cDNA for a growth factor-inducible gene with strong homology to S-100, a calcium- binding protein. J Biol Chem 261:12628. 16. Madsen, P., H. H. Rasmussen, H. Leffers, B. Honore, K. Dejgaard, E. Olsen, J. Kiil, E. Walbum, A. H. Andersen, B. Basse, and et al. 1991. Molecular cloning, occurrence, and expression of a novel partially secreted protein "psoriasin" that is highly up-regulated in psoriatic skin. J Invest Dermatol 97:701. 17. Fagerhol, M., I. Dale, and I. Anderson. 1980. Release and quantitation of a leucocyte derived protein (L1). Scand J Haematol 24:393. 18. Glenney, J. R., Jr., and B. F. Tack. 1985. Amino-terminal sequence of p36 and associated p10: identification of the site of tyrosine phosphorylation and homology with S-100. Proc Natl Acad Sci U S A 82:7884. 19. Todoroki, H., R. Kobayashi, M. Watanabe, H. Minami, and H. Hidaka. 1991. Purification, characterization, and partial sequence analysis of a newly identified EF-hand type 13-kDa Ca(2+)-binding protein from smooth muscle and non-muscle tissues. J Biol Chem 266:18668. 20. Dell'Angelica, E. C., C. H. Schleicher, and J. A. Santome. 1994. Primary structure and binding properties of calgranulin C, a novel S100-like calcium-binding protein from pig granulocytes. J Biol Chem 269:28929. 21. Wicki, R., B. W. Schafer, P. Erne, and C. W. Heizmann. 1996. Characterization of the human and mouse cDNAs coding for S100A13, a new member of the S100 protein family. Biochem Biophys Res Commun 227:594.

243 22. Pietas, A., K. Schluns, I. Marenholz, B. W. Schafer, C. W. Heizmann, and I. Petersen. 2002. Molecular cloning and characterization of the human S100A14 gene encoding a novel member of the S100 family. Genomics 79:513. 23. Kallfelz, F. A., A. N. Taylor, and R. H. Wasserman. 1967. Vitamin D-induced calcium binding factor in rat intestinal mucosa. Proc Soc Exp Biol Med 125:54. 24. Becker, T., V. Gerke, E. Kube, and K. Weber. 1992. S100P, a novel Ca(2+)-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. Eur J Biochem 207:541. 25. Gribenko, A. V., J. E. Hopper, and G. I. Makhatadze. 2001. Molecular characterization and tissue distribution of a novel member of the S100 family of EF-hand proteins. Biochemistry 40:15538. 26. Schafer, B. W., R. Wicki, D. Engelkamp, M. G. Mattei, and C. W. Heizmann. 1995. Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 25:638. 27. Kulski, J. K., C. P. Lim, D. S. Dunn, and M. Bellgard. 2003. Genomic and phylogenetic analysis of the S100A7 (Psoriasin) gene duplications within the region of the S100 gene cluster on human chromosome 1q21. J Mol Evol 56:397. 28. Marenholz, I., C. W. Heizmann, and G. Fritz. 2004. S100 proteins in mouse and man: from evolution to function and pathology (including an update of the nomenclature). Biochem Biophys Res Commun 322:1111. 29. Kawasaki, H., S. Nakayama, and R. H. Kretsinger. 1998. Classification and evolution of EF- hand proteins. Biometals 11:277. 30. Ridinger, K., E. C. Ilg, F. K. Niggli, C. W. Heizmann, and B. W. Schafer. 1998. Clustered organization of S100 genes in human and mouse. Biochim Biophys Acta 1448:254. 31. Marenholz, I., R. C. Lovering, and C. W. Heizmann. 2006. An update of the S100 nomenclature. Biochim Biophys Acta 1763:1282. 32. Kretsinger, R. H., S. E. Rudnick, D. A. Sneden, and V. B. Schatz. 1980. Calmodulin, S-100, and crayfish sarcoplasmic calcium-binding protein crystals suitable for X-ray diffraction studies. J Biol Chem 255:8154. 33. Hakansson, M., and S. Linse. 2002. Protein reconstitution and 3D domain swapping. Curr Protein Pept Sci 3:629. 34. Ostermeier, M., and S. J. Benkovic. 2000. Evolution of protein function by domain swapping. Adv Protein Chem 55:29. 35. Fuellen, G., D. Foell, W. Nacken, C. Sorg, and C. Kerkhoff. 2003. Absence of S100A12 in mouse: implications for RAGE-S100A12 interaction. Trends Immunol 24:622. 36. Fuellen, G., W. Nacken, C. Sorg, and C. Kerkhoff. 2004. Computational searches for missing orthologs: the case of S100A12 in mice. Omics 8:334. 37. Morgenstern, B., and W. R. Atchley. 1999. Evolution of bHLH transcription factors: modular evolution by domain shuffling? Mol Biol Evol 16:1654. 38. Ravasi, T., T. Huber, M. Zavolan, A. Forrest, T. Gaasterland, S. Grimmond, and D. A. Hume. 2003. Systematic characterization of the zinc-finger-containing proteins in the mouse transcriptome. Genome Res 13:1430. 39. Gribenko, A. V., and G. I. Makhatadze. 1998. Oligomerization and divalent ion binding properties of the S100P protein: a Ca2+/Mg2+-switch model. J Mol Biol 283:679. 40. Heizmann, C. W., and J. A. Cox. 1998. New perspectives on S100 proteins: a multi-functional Ca(2+)-, Zn(2+)- and Cu(2+)-binding protein family. Biometals 11:383. 41. Zimmer, D. B., P. Wright Sadosky, and D. J. Weber. 2003. Molecular mechanisms of S100- target protein interactions. Microsc Res Tech 60:552. 42. Kligman, D., and D. C. Hilt. 1988. The S100 protein family. Trends Biochem Sci 13:437. 43. Kretsinger, R. H. 1987. Calcium coordination and the calmodulin fold: divergent versus convergent evolution. Cold Spring Harb Symp Quant Biol 52:499. 44. Lackmann, M., P. Rajasekariah, S. E. Iismaa, G. Jones, C. J. Cornish, S. Hu, R. J. Simpson, R. L. Moritz, and C. L. Geczy. 1993. Identification of a chemotactic domain of the pro-inflammatory S100 protein CP-10. J Immunol 150:2981. 45. Kube, E., T. Becker, K. Weber, and V. Gerke. 1992. Protein-protein interaction studied by site- directed mutagenesis. Characterization of the annexin II-binding site on p11, a member of the S100 protein family. J Biol Chem 267:14175. 46. Seemann, J., K. Weber, and V. Gerke. 1996. Structural requirements for annexin I-S100C complex-formation. Biochem J 319 ( Pt 1):123. 47. Schaffer, C. J., and L. B. Nanney. 1996. Cell biology of wound healing. Int Rev Cytol 169:151.

244 48. Heizmann, C. W. 2002. The multifunctional S100 protein family. Methods Mol Biol 172:69. 49. Brodersen, D. E., M. Etzerodt, P. Madsen, J. E. Celis, H. C. Thogersen, J. Nyborg, and M. Kjeldgaard. 1998. EF-hands at atomic resolution: the structure of human psoriasin (S100A7) solved by MAD phasing. Structure 6:477. 50. Sastry, M., R. R. Ketchem, O. Crescenzi, C. Weber, M. J. Lubienski, H. Hidaka, and W. J. Chazin. 1998. The three-dimensional structure of Ca(2+)-bound calcyclin: implications for Ca(2+)-signal transduction by S100 proteins. Structure 6:223. 51. Ishikawa, K., A. Nakagawa, I. Tanaka, M. Suzuki, and J. Nishihira. 2000. The structure of human MRP8, a member of the S100 calcium-binding protein family, by MAD phasing at 1.9 A resolution. Acta Crystallogr D Biol Crystallogr 56:559. 52. Moroz, O. V., A. A. Antson, G. G. Dodson, K. S. Wilson, I. Skibshoj, E. M. Lukanidin, and I. B. Bronstein. 2000. Crystallization and preliminary X-ray diffraction analysis of human calcium- binding protein S100A12. Acta Crystallogr D Biol Crystallogr 56:189. 53. Hunter, M. J., and W. J. Chazin. 1998. High level expression and dimer characterization of the S100 EF-hand proteins, migration inhibitory factor-related proteins 8 and 14. J Biol Chem 273:12427. 54. Propper, C., X. Huang, J. Roth, C. Sorg, and W. Nacken. 1999. Analysis of the MRP8-MRP14 protein-protein interaction by the two-hybrid system suggests a prominent role of the C-terminal domain of S100 proteins in dimer formation. J Biol Chem 274:183. 55. Yang, Q., D. O'Hanlon, C. W. Heizmann, and A. Marks. 1999. Demonstration of heterodimer formation between S100B and S100A6 in the yeast two-hybrid system and human melanoma. Exp Cell Res 246:501. 56. Deloulme, J. C., N. Assard, G. O. Mbele, C. Mangin, R. Kuwano, and J. Baudier. 2000. S100A6 and S100A11 are specific targets of the calcium- and zinc-binding S100B protein in vivo. J Biol Chem 275:35302. 57. Wang, G., P. S. Rudland, M. R. White, and R. Barraclough. 2000. Interaction in vivo and in vitro of the metastasis-inducing S100 protein, S100A4 (p9Ka) with S100A1. J Biol Chem 275:11141. 58. Tarabykina, S., M. Kriajevska, D. J. Scott, T. J. Hill, D. Lafitte, P. J. Derrick, G. G. Dodson, E. Lukanidin, and I. Bronstein. 2000. Heterocomplex formation between metastasis-related protein S100A4 (Mts1) and S100A1 as revealed by the yeast two-hybrid system. FEBS Lett 475:187. 59. Berntzen, H. B., and M. K. Fagerhol. 1988. L1, a major granulocyte protein: antigenic properties of its subunits. Scand J Clin Lab Invest 48:647. 60. Teigelkamp, S., R. S. Bhardwaj, J. Roth, G. Meinardus-Hager, M. Karas, and C. Sorg. 1991. Calcium-dependent complex assembly of the myeloic differentiation proteins MRP-8 and MRP- 14. J Biol Chem 266:13462. 61. Strupat, K., H. Rogniaux, A. Van Dorsselaer, J. Roth, and T. Vogl. 2000. Calcium-induced noncovalently linked tetramers of MRP8 and MRP14 are confirmed by electrospray ionization- mass analysis. J Am Soc Mass Spectrom 11:780. 62. Moroz, O. V., A. A. Antson, S. J. Grist, N. J. Maitland, G. G. Dodson, K. S. Wilson, E. Lukanidin, and I. B. Bronstein. 2003. Structure of the human S100A12-copper complex: implications for host-parasite defence. Acta Crystallogr D Biol Crystallogr 59:859. 63. Drohat, A. C., E. Nenortas, D. Beckett, and D. J. Weber. 1997. Oligomerization state of S100B at nanomolar concentration determined by large-zone analytical gel filtration chromatography. Protein Sci 6:1577. 64. Drohat, A. C., D. M. Baldisseri, R. R. Rustandi, and D. J. Weber. 1998. Solution structure of calcium-bound rat S100B(betabeta) as determined by nuclear magnetic resonance spectroscopy. Biochemistry 37:2729. 65. Donato, R. 1999. Functional roles of S100 proteins, calcium-binding proteins of the EF-hand type. Biochim Biophys Acta 1450:191. 66. Eckert, R. L., A. M. Broome, M. Ruse, N. Robinson, D. Ryan, and K. Lee. 2004. S100 proteins in the epidermis. J Invest Dermatol 123:23. 67. Kligman, D., and D. R. Marshak. 1985. Purification and characterization of a neurite extension factor from bovine brain. Proc Natl Acad Sci U S A 82:7136. 68. Winningham-Major, F., J. L. Staecker, S. W. Barger, S. Coats, and L. J. Van Eldik. 1989. Neurite extension and neuronal survival activities of recombinant S100 beta proteins that differ in the content and position of cysteine residues. J Cell Biol 109:3063. 69. Barger, S. W., S. R. Wolchok, and L. J. Van Eldik. 1992. Disulfide-linked S100 beta dimers and signal transduction. Biochim Biophys Acta 1160:105.

245 70. Gerke, V., and K. Weber. 1985. Calcium-dependent conformational changes in the 36-kDa subunit of intestinal protein I related to the cellular 36-kDa target of Rous virus tyrosine kinase. J Biol Chem 260:1688. 71. Pedrocchi, M., B. W. Schafer, I. Durussel, J. A. Cox, and C. W. Heizmann. 1994. Purification and characterization of the recombinant human calcium-binding S100 proteins CAPL and CACY. Biochemistry 33:6732. 72. Golitsina, N. L., J. Kordowska, C. L. Wang, and S. S. Lehrer. 1996. Ca2+-dependent binding of calcyclin to muscle tropomyosin. Biochem Biophys Res Commun 220:360. 73. Harrison, C. A., M. J. Raftery, J. Walsh, P. Alewood, S. E. Iismaa, S. Thliveris, and C. L. Geczy. 1999. Oxidation regulates the inflammatory properties of the murine S100 protein S100A8. J Biol Chem 274:8561. 74. Moroz, O. V., G. G. Dodson, K. S. Wilson, E. Lukanidin, and I. B. Bronstein. 2003. Multiple structural states of S100A12: A key to its functional diversity. Microsc Res Tech 60:581. 75. Baudier, J., N. Glasser, and D. Gerard. 1986. Ions binding to S100 proteins. I. Calcium- and zinc-binding properties of bovine brain S100 alpha alpha, S100a (alpha beta), and S100b (beta beta) protein: Zn2+ regulates Ca2+ binding on S100b protein. J Biol Chem 261:8192. 76. Franz, C., I. Durussel, J. A. Cox, B. W. Schafer, and C. W. Heizmann. 1998. Binding of Ca2+ and Zn2+ to human nuclear S100A2 and mutant proteins. J Biol Chem 273:18826. 77. Gottsch, J. D., S. W. Eisinger, S. H. Liu, and A. L. Scott. 1999. Calgranulin C has filariacidal and filariastatic activity. Infect Immun 67:6631. 78. Gentil, B. J., C. Delphin, G. O. Mbele, J. C. Deloulme, M. Ferro, J. Garin, and J. Baudier. 2001. The giant protein AHNAK is a specific target for the calcium- and zinc-binding S100B protein: potential implications for Ca2+ homeostasis regulation by S100B. J Biol Chem 276:23253. 79. Fritz, G., P. R. Mittl, M. Vasak, M. G. Grutter, and C. W. Heizmann. 2002. The crystal structure of metal-free human EF-hand protein S100A3 at 1.7-A resolution. J Biol Chem 277:33092. 80. Nishikawa, T., I. S. Lee, N. Shiraishi, T. Ishikawa, Y. Ohta, and M. Nishikimi. 1997. Identification of S100b protein as copper-binding protein and its suppression of copper-induced cell damage. J Biol Chem 272:23037. 81. Schafer, B. W., J. M. Fritschy, P. Murmann, H. Troxler, I. Durussel, C. W. Heizmann, and J. A. Cox. 2000. Brain S100A5 is a novel calcium-, zinc-, and copper ion-binding protein of the EF- hand superfamily. J Biol Chem 275:30623. 82. Zimmer, D. B., E. H. Cornwall, A. Landar, and W. Song. 1995. The S100 protein family: history, function, and expression. Brain Res Bull 37:417. 83. Donato, R. 2003. Intracellular and extracellular roles of S100 proteins. Microsc Res Tech 60:540. 84. Kerkhoff, C., I. Eue, and C. Sorg. 1999. The regulatory role of MRP8 (S100A8) and MRP14 (S100A9) in the transendothelial migration of human leukocytes. Pathobiology 67:230. 85. Robinson, M. J., P. Tessier, R. Poulsom, and N. Hogg. 2002. The S100 family heterodimer, MRP-8/14, binds with high affinity to heparin and heparan sulfate glycosaminoglycans on endothelial cells. J Biol Chem 277:3658. 86. Srikrishna, G., K. Panneerselvam, V. Westphal, V. Abraham, A. Varki, and H. H. Freeze. 2001. Two proteins modulating transendothelial migration of leukocytes recognize novel carboxylated glycans on endothelial cells. J Immunol 166:4678. 87. Crivici, A., and M. Ikura. 1995. Molecular and structural basis of target recognition by calmodulin. Annu Rev Biophys Biomol Struct 24:85. 88. Schafer, B. W., and C. W. Heizmann. 1996. The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends Biochem Sci 21:134. 89. Cross, S. S., F. C. Hamdy, J. C. Deloulme, and I. Rehman. 2005. Expression of S100 proteins in normal human tissues and common cancers using tissue microarrays: S100A6, S100A8, S100A9 and S100A11 are all overexpressed in common cancers. Histopathology 46:256. 90. Kizawa, K., H. Uchiwa, and U. Murakami. 1996. Highly-expressed S100A3, a calcium-binding protein, in human hair cuticle. Biochim Biophys Acta 1312:94. 91. Boni, R., G. Burg, A. Doguoglu, E. C. Ilg, B. W. Schafer, B. Muller, and C. W. Heizmann. 1997. Immunohistochemical localization of the Ca2+ binding S100 proteins in normal human skin and melanocytic lesions. Br J Dermatol 137:39. 92. Dale, I., M. K. Fagerhol, and I. Naesgaard. 1983. Purification and partial characterization of a highly immunogenic human leukocyte protein, the L1 antigen. Eur J Biochem 134:1. 93. Xu, K., and C. L. Geczy. 2000. IFN-gamma and TNF regulate macrophage expression of the chemotactic S100 protein S100A8. J Immunol 164:4916. 94. Xu, K., T. Yen, and C. L. Geczy. 2001. Il-10 up-regulates macrophage expression of the S100 protein S100A8. J Immunol 166:6358.

246 95. Yen, T., C. A. Harrison, J. M. Devery, S. Leong, S. E. Iismaa, T. Yoshimura, and C. L. Geczy. 1997. Induction of the S100 chemotactic protein, CP-10, in murine microvascular endothelial cells by proinflammatory stimuli. Blood 90:4812. 96. Zreiqat, H., C. R. Howlett, S. Gronthos, D. Hume, and C. L. Geczy. 2007. S100A8/S100A9 and their association with cartilage and bone. J Mol Histol 38:381. 97. Tsoporis, J. N., A. Marks, H. J. Kahn, J. W. Butany, P. P. Liu, D. O'Hanlon, and T. G. Parker. 1997. S100beta inhibits alpha1-adrenergic induction of the hypertrophic phenotype in cardiac myocytes. J Biol Chem 272:31915. 98. Castets, F., W. S. Griffin, A. Marks, and L. J. Van Eldik. 1997. Transcriptional regulation of the human S100 beta gene. Brain Res Mol Brain Res 46:208. 99. Mandinova, A., D. Atar, B. W. Schafer, M. Spiess, U. Aebi, and C. W. Heizmann. 1998. Distinct subcellular localization of calcium binding S100 proteins in human smooth muscle cells and their relocation in response to rises in intracellular calcium. J Cell Sci 111 ( Pt 14):2043. 100. Labourdette, G., and P. Mandel. 1980. Effect of norepinephrine and dibutyryl cyclic AMP on S- 100 protein level in C6 glioma cells. Biochem Biophys Res Commun 96:1702. 101. Tabuchi, K., M. Imada, and A. Nishimoto. 1982. Effects of cyclic AMP on S-100 protein level in C-6 glioma cells. J Neurol Sci 56:57. 102. Higashida, H., M. Sano, and K. Kato. 1985. Forskolin induction of S-100 protein in glioma and hybrid cells. J Cell Physiol 122:39. 103. Freeman, M. R., S. L. Beckmann, and N. Sueoka. 1989. Regulation of the S100 protein and GFAP genes is mediated by two common mechanisms in RT4 neuro-glial cell lines. Exp Cell Res 182:370. 104. Niu, H., D. A. Hinkle, and P. M. Wise. 1997. Dexamethasone regulates basic fibroblast growth factor, and S100beta expression in cultured hippocampal astrocytes. Brain Res Mol Brain Res 51:97. 105. Hinkle, D. A., J. P. Harney, A. Cai, D. C. Hilt, P. J. Yarowsky, and P. M. Wise. 1998. Basic fibroblast growth factor-2 and interleukin-1 beta regulate S100 beta expression in cultured astrocytes. Neuroscience 82:33. 106. Pena, L. A., C. W. Brecher, and D. R. Marshak. 1995. beta-Amyloid regulates gene expression of glial trophic substance S100 beta in C6 glioma and primary astrocyte cultures. Brain Res Mol Brain Res 34:118. 107. Tsoporis, J. N., A. Marks, L. J. Van Eldik, D. O'Hanlon, and T. G. Parker. 2003. Regulation of the S100B gene by alpha 1-adrenergic stimulation in cardiac myocytes. Am J Physiol Heart Circ Physiol 284:H193. 108. Tonini, G. P., A. Casalaro, A. Cara, and D. Di Martino. 1991. Inducible expression of calcyclin, a gene with strong homology to S-100 protein, during neuroblastoma cell differentiation and its prevalent expression in Schwann-like cell lines. Cancer Res 51:1733. 109. Tsoporis, J. N., A. Marks, A. Haddad, D. O'Hanlon, S. Jolly, and T. G. Parker. 2005. S100A6 is a negative regulator of the induction of cardiac genes by trophic stimuli in cultured rat myocytes. Exp Cell Res 303:471. 110. Yang, Z., T. Tao, M. J. Raftery, P. Youssef, N. Di Girolamo, and C. L. Geczy. 2001. Proinflammatory properties of the human S100 protein S100A12. J Leukoc Biol 69:986. 111. Vimalachandran, D., W. Greenhalf, C. Thompson, J. Luttges, W. Prime, F. Campbell, A. Dodson, R. Watson, T. Crnogorac-Jurcevic, N. Lemoine, J. Neoptolemos, and E. Costello. 2005. High nuclear S100A6 (Calcyclin) is significantly associated with poor survival in pancreatic cancer patients. Cancer Res 65:3218. 112. Rammes, A., J. Roth, M. Goebeler, M. Klempt, M. Hartmann, and C. Sorg. 1997. Myeloid- related protein (MRP) 8 and MRP14, calcium-binding proteins of the S100 family, are secreted by activated monocytes via a novel, tubulin-dependent pathway. J Biol Chem 272:9496. 113. Meissner, G. 1986. Evidence of a Role for Calmodulin in the Regulation of Calcium Release from Skeletal Muscle Sarcoplasmic Reticulum. Biochemistry 25:244. 114. Christakos, S., C. Gabrielides, and W. B. Rhoten. 1989. Vitamin D-dependent calcium binding proteins: chemistry, distribution, functional considerations, and molecular biology. Endocr Rev 10:3. 115. Skelton, N. J., J. Kordel, M. Akke, S. Forsen, and W. J. Chazin. 1994. Signal transduction versus buffering activity in Ca(2+)-binding proteins. Nat Struct Biol 1:239. 116. Sorci, G., R. Bianchi, I. Giambanco, M. G. Rambotti, and R. Donato. 1999. Replicating myoblasts and fused myotubes express the calcium-regulated proteins S100A1 and S100B. Cell Calcium 25:93.

247 117. Donato, R., I. Giambanco, M. C. Aisa, G. di Geronimo, P. Ceccarelli, M. G. Rambotti, and A. Spreca. 1989. Cardiac S-100a0 protein: purification by a simple procedure and related immunocytochemical and immunochemical studies. Cell Calcium 10:81. 118. Fano, G., V. Marsili, P. Angelella, M. C. Aisa, I. Giambanco, and R. Donato. 1989. S-100a0 protein stimulates Ca2+-induced Ca2+ release from isolated sarcoplasmic reticulum vesicles. FEBS Lett 255:381. 119. Treves, S., E. Scutari, M. Robert, S. Groh, M. Ottolia, G. Prestipino, M. Ronjat, and F. Zorzato. 1997. Interaction of S100A1 with the Ca2+ release channel (ryanodine receptor) of skeletal muscle. Biochemistry 36:11496. 120. Remppis, A., T. Greten, B. W. Schafer, P. Hunziker, P. Erne, H. A. Katus, and C. W. Heizmann. 1996. Altered expression of the Ca(2+)-binding protein S100A1 in human cardiomyopathy. Biochim Biophys Acta 1313:253. 121. Ehlermann, P., A. Remppis, O. Guddat, J. Weimann, P. A. Schnabel, J. Motsch, C. W. Heizmann, and H. A. Katus. 2000. Right ventricular upregulation of the Ca(2+) binding protein S100A1 in chronic pulmonary hypertension. Biochim Biophys Acta 1500:249. 122. Most, P., A. Remppis, S. T. Pleger, E. Loffler, P. Ehlermann, J. Bernotat, C. Kleuss, J. Heierhorst, P. Ruiz, H. Witt, P. Karczewski, L. Mao, H. A. Rockman, S. J. Duncan, H. A. Katus, and W. J. Koch. 2003. Transgenic overexpression of the Ca2+-binding protein S100A1 in the heart leads to increased in vivo myocardial contractile performance. J Biol Chem 278:33809. 123. Most, P., A. Remppis, S. T. Pleger, H. A. Katus, and W. J. Koch. 2007. S100A1: a novel inotropic regulator of cardiac performance. Transition from molecular physiology to pathophysiological relevance. Am J Physiol Regul Integr Comp Physiol 293:R568. 124. Fano, G., S. Fulle, G. Della Torre, I. Giambanco, M. C. Aisa, R. Donato, and P. Calissano. 1988. S-100b protein regulates the activity of skeletal muscle adenylate cyclase in vitro. FEBS Lett 240:177. 125. Albert, K. A., W. C. Wu, A. C. Nairn, and P. Greengard. 1984. Inhibition by calmodulin of calcium/phospholipid-dependent protein phosphorylation. Proc Natl Acad Sci U S A 81:3622. 126. Sheu, F. S., F. L. Huang, and K. P. Huang. 1995. Differential responses of protein kinase C substrates (MARCKS, neuromodulin, and neurogranin) phosphorylation to calmodulin and S100. Arch Biochem Biophys 316:335. 127. Hagiwara, M., M. Ochiai, K. Owada, T. Tanaka, and H. Hidaka. 1988. Modulation of tyrosine phosphorylation of p36 and other substrates by the S-100 protein. J Biol Chem 263:6438. 128. Lin, L. H., L. J. Van Eldik, N. Osheroff, and J. J. Norden. 1994. Inhibition of protein kinase C- and casein kinase II-mediated phosphorylation of GAP-43 by S100 beta. Brain Res Mol Brain Res 25:297. 129. Sheu, F. S., E. C. Azmitia, D. R. Marshak, P. J. Parker, and A. Routtenberg. 1994. Glial-derived S100b protein selectively inhibits recombinant beta protein kinase C (PKC) phosphorylation of neuron-specific protein F1/GAP43. Brain Res Mol Brain Res 21:62. 130. Pozdnyakov, N., A. Margulis, and A. Sitaramayya. 1998. Identification of effector binding sites on S100 beta: studies with guanylate cyclase and p80, a retinal phosphoprotein. Biochemistry 37:10701. 131. Skripnikova, E. V., and N. B. Gusev. 1989. Interaction of smooth muscle caldesmon with S-100 protein. FEBS Lett 257:380. 132. Fujii, T., K. Machino, H. Andoh, T. Satoh, and Y. Kondo. 1990. Calcium-dependent control of caldesmon-actin interaction by S100 protein. J Biochem 107:133. 133. Pritchard, K., and S. B. Marston. 1991. Ca(2+)-dependent regulation of vascular smooth-muscle caldesmon by S.100 and related smooth-muscle proteins. Biochem J 277 ( Pt 3):819. 134. Baudier, J., and R. D. Cole. 1987. Phosphorylation of tau proteins to a state like that in Alzheimer's brain is catalyzed by a calcium/calmodulin-dependent kinase and modulated by phospholipids. J Biol Chem 262:17577. 135. Baudier, J., and R. D. Cole. 1988. Interactions between the microtubule-associated tau proteins and S100b regulate tau phosphorylation by the Ca2+/calmodulin-dependent protein kinase II. J Biol Chem 263:5876. 136. Ziegler, D. R., C. E. Innocente, R. B. Leal, R. Rodnight, and C. A. Goncalves. 1998. The S100B protein inhibits phosphorylation of GFAP and vimentin in a cytoskeletal fraction from immature rat hippocampus. Neurochem Res 23:1259. 137. Frizzo, J. K., F. Tramontina, E. Bortoli, C. Gottfried, R. B. Leal, I. Lengyel, R. Donato, P. R. Dunkley, and C. A. Goncalves. 2004. S100B-mediated inhibition of the phosphorylation of GFAP is prevented by TRTK-12. Neurochem Res 29:735.

248 138. Baudier, J., C. Delphin, D. Grunwald, S. Khochbin, and J. J. Lawrence. 1992. Characterization of the tumor suppressor protein p53 as a protein kinase C substrate and a S100b-binding protein. Proc Natl Acad Sci U S A 89:11627. 139. Rustandi, R. R., A. C. Drohat, D. M. Baldisseri, P. T. Wilder, and D. J. Weber. 1998. The Ca(2+)-dependent interaction of S100B(beta beta) with a peptide derived from p53. Biochemistry 37:1951. 140. Wilder, P. T., R. R. Rustandi, A. C. Drohat, and D. J. Weber. 1998. S100B(betabeta) inhibits the protein kinase C-dependent phosphorylation of a peptide derived from p53 in a Ca2+-dependent manner. Protein Sci 7:794. 141. Rustandi, R. R., D. M. Baldisseri, and D. J. Weber. 2000. Structure of the negative regulatory domain of p53 bound to S100B(betabeta). Nat Struct Biol 7:570. 142. Scotto, C., J. C. Deloulme, D. Rousseau, E. Chambaz, and J. Baudier. 1998. Calcium and S100B regulation of p53-dependent cell growth arrest and apoptosis. Mol Cell Biol 18:4272. 143. Wilder, P. T., J. Lin, C. L. Bair, T. H. Charpentier, D. Yang, M. Liriano, K. M. Varney, A. Lee, A. B. Oppenheim, S. Adhya, F. Carrier, and D. J. Weber. 2006. Recognition of the tumor suppressor protein p53 and other protein targets by the calcium-binding protein S100B. Biochim Biophys Acta 1763:1284. 144. Tsoporis, J. N., A. Marks, H. J. Kahn, J. W. Butany, P. P. Liu, D. O'Hanlon, and T. G. Parker. 1998. Inhibition of norepinephrine-induced cardiac hypertrophy in s100beta transgenic mice. J Clin Invest 102:1609. 145. Stegert, M. R., R. Tamaskovic, S. J. Bichsel, A. Hergovich, and B. A. Hemmings. 2004. Regulation of NDR2 protein kinase by multi-site phosphorylation and the S100B calcium- binding protein. J Biol Chem 279:23806. 146. Tamaskovic, R., S. J. Bichsel, H. Rogniaux, M. R. Stegert, and B. A. Hemmings. 2003. Mechanism of Ca2+-mediated regulation of NDR protein kinase through autophosphorylation and phosphorylation by an upstream kinase. J Biol Chem 278:6710. 147. Riuzzi, F., G. Sorci, and R. Donato. 2006. S100B stimulates myoblast proliferation and inhibits myoblast differentiation by independently stimulating ERK1/2 and inhibiting p38 MAPK. J Cell Physiol 207:461. 148. Sorci, G., F. Riuzzi, A. L. Agneletti, C. Marchetti, and R. Donato. 2003. S100B inhibits myogenic differentiation and myotube formation in a RAGE-independent manner. Mol Cell Biol 23:4870. 149. Reddy, M. A., S. L. Li, S. Sahar, Y. S. Kim, Z. G. Xu, L. Lanting, and R. Natarajan. 2006. Key role of Src kinase in S100B-induced activation of the receptor for advanced glycation end products in vascular smooth muscle cells. J Biol Chem 281:13685. 150. Baudier, J., D. Mochly-Rosen, A. Newton, S. H. Lee, D. E. Koshland, Jr., and R. D. Cole. 1987. Comparison of S100b protein with calmodulin: interactions with melittin and microtubule- associated tau proteins and inhibition of phosphorylation of tau proteins by protein kinase C. Biochemistry 26:2886. 151. Baudier, J., E. Bergeret, N. Bertacchi, H. Weintraub, J. Gagnon, and J. Garin. 1995. Interactions of myogenic bHLH transcription factors with calcium-binding calmodulin and S100a (alpha alpha) proteins. Biochemistry 34:7834. 152. Davies, M. P., P. S. Rudland, L. Robertson, E. W. Parry, P. Jolicoeur, and R. Barraclough. 1996. Expression of the calcium-binding protein S100A4 (p9Ka) in MMTV-neu transgenic mice induces metastasis of mammary tumours. Oncogene 13:1631. 153. Kriajevska, M., S. Tarabykina, I. Bronstein, N. Maitland, M. Lomonosov, K. Hansen, G. Georgiev, and E. Lukanidin. 1998. Metastasis-associated Mts1 (S100A4) protein modulates protein kinase C phosphorylation of the heavy chain of nonmuscle myosin. J Biol Chem 273:9852. 154. Grigorian, M., S. Andresen, E. Tulchinsky, M. Kriajevska, C. Carlberg, C. Kruse, M. Cohn, N. Ambartsumian, A. Christensen, G. Selivanova, and E. Lukanidin. 2001. Tumor suppressor p53 protein is a new target for the metastasis-associated Mts1/S100A4 protein: functional consequences of their interaction. J Biol Chem 276:22699. 155. Tugizov, S., J. Berline, R. Herrera, M. E. Penaranda, M. Nakagawa, and J. Palefsky. 2005. Inhibition of human papillomavirus type 16 E7 phosphorylation by the S100 MRP-8/14 protein complex. J Virol 79:1099. 156. Johnsson, N., P. Nguyen Van, H. D. Soling, and K. Weber. 1986. Functionally distinct serine phosphorylation sites of p36, the cellular substrate of retroviral protein kinase; differential inhibition of reassociation with p11. Embo J 5:3455.

249 157. Mailliard, W. S., H. T. Haigler, and D. D. Schlaepfer. 1996. Calcium-dependent binding of S100C to the N-terminal domain of annexin I. J Biol Chem 271:719. 158. Inagaki, M., Y. Nakamura, M. Takeda, T. Nishimura, and N. Inagaki. 1994. Glial fibrillary acidic protein: dynamic property and regulation by phosphorylation. Brain Pathol 4:239. 159. Rodnight, R., C. A. Goncalves, S. T. Wofchuk, and R. Leal. 1997. Control of the phosphorylation of the astrocyte marker glial fibrillary acidic protein (GFAP) in the immature rat hippocampus by glutamate and calcium ions: possible key factor in astrocytic plasticity. Braz J Med Biol Res 30:325. 160. Inada, H., H. Togashi, Y. Nakamura, K. Kaibuchi, K. Nagata, and M. Inagaki. 1999. Balance between activities of Rho kinase and type 1 protein phosphatase modulates turnover of phosphorylation and dynamics of desmin/vimentin filaments. J Biol Chem 274:34932. 161. Blackwood, R. A., and J. D. Ernst. 1990. Characterization of Ca2(+)-dependent phospholipid binding, vesicle aggregation and membrane fusion by . Biochem J 266:195. 162. Sarafian, T., L. A. Pradel, J. P. Henry, D. Aunis, and M. F. Bader. 1991. The participation of annexin II (calpactin I) in calcium-evoked exocytosis requires protein kinase C. J Cell Biol 114:1135. 163. Zimmer, D. B., and L. J. Van Eldik. 1986. Identification of a molecular target for the calcium- modulated protein S100. Fructose-1,6-bisphosphate aldolase. J Biol Chem 261:11424. 164. Zimmer, D. B., and J. G. Dubuisson. 1993. Identification of an S100 target protein: glycogen phosphorylase. Cell Calcium 14:323. 165. Landar, A., G. Caddell, J. Chessher, and D. B. Zimmer. 1996. Identification of an S100A1/S100B target protein: phosphoglucomutase. Cell Calcium 20:279. 166. Zimmer, D. B., and A. Landar. 1995. Analysis of S100A1 expression during skeletal muscle and neuronal cell differentiation. J Neurochem 64:2727. 167. Donato, R. 1991. Perspectives in S-100 protein biology. Review article. Cell Calcium 12:713. 168. Heierhorst, J., B. Kobe, S. C. Feil, M. W. Parker, G. M. Benian, K. R. Weiss, and B. E. Kemp. 1996. Ca2+/S100 regulation of giant protein kinases. Nature 380:636. 169. Millward, T. A., C. W. Heizmann, B. W. Schafer, and B. A. Hemmings. 1998. Calcium regulation of Ndr protein kinase mediated by S100 calcium-binding proteins. Embo J 17:5913. 170. Margulis, A., N. Pozdnyakov, and A. Sitaramayya. 1996. Activation of bovine photoreceptor guanylate cyclase by S100 proteins. Biochem Biophys Res Commun 218:243. 171. Duda, T., R. M. Goraczniak, and R. K. Sharma. 1996. Molecular characterization of S100A1- S100B protein in retina and its activation mechanism of bovine photoreceptor guanylate cyclase. Biochemistry 35:6263. 172. Pozdnyakov, N., R. Goraczniak, A. Margulis, T. Duda, R. K. Sharma, A. Yoshida, and A. Sitaramayya. 1997. Structural and functional characterization of retinal calcium-dependent guanylate cyclase activator protein (CD-GCAP): identity with S100beta protein. Biochemistry 36:14159. 173. Rambotti, M. G., I. Giambanco, A. Spreca, and R. Donato. 1999. S100B and S100A1 proteins in bovine retina:their calcium-dependent stimulation of a membrane-bound guanylate cyclase activity as investigated by ultracytochemistry. Neuroscience 92:1089. 174. Arcuri, C., R. Bianchi, F. Brozzi, and R. Donato. 2005. S100B increases proliferation in PC12 neuronal cells and reduces their responsiveness to nerve growth factor via Akt activation. J Biol Chem 280:4402. 175. Yamasaki, R., M. Berri, Y. Wu, K. Trombitas, M. McNabb, M. S. Kellermayer, C. Witt, D. Labeit, S. Labeit, M. Greaser, and H. Granzier. 2001. Titin-actin interaction in mouse myocardium: passive tension modulation and its regulation by calcium/S100A1. Biophys J 81:2297. 176. Boerries, M., P. Most, J. R. Gledhill, J. E. Walker, H. A. Katus, W. J. Koch, U. Aebi, and C. A. Schoenenberger. 2007. Ca2+ -dependent interaction of S100A1 with F1-ATPase leads to an increased ATP content in cardiomyocytes. Mol Cell Biol 27:4365. 177. Murao, S., F. R. Collart, and E. Huberman. 1989. A protein containing the cystic fibrosis antigen is an inhibitor of protein kinases. J Biol Chem 264:8356. 178. Hermani, A., B. De Servi, S. Medunjanin, P. A. Tessier, and D. Mayer. 2006. S100A8 and S100A9 activate MAP kinase and NF-kappaB signaling pathways and trigger translocation of RAGE in human prostate cancer cells. Exp Cell Res 312:184. 179. Kassam, G., B. H. Le, K. S. Choi, H. M. Kang, S. L. Fitzpatrick, P. Louie, and D. M. Waisman. 1998. The p11 subunit of the annexin II tetramer plays a key role in the stimulation of t-PA- dependent plasminogen activation. Biochemistry 37:16958.

250 180. Zhao, X. Q., M. Naka, M. Muneyuki, and T. Tanaka. 2000. Ca(2+)-dependent inhibition of actin-activated myosin ATPase activity by S100C (S100A11), a novel member of the S100 protein family. Biochem Biophys Res Commun 267:77. 181. Polans, A., W. Baehr, and K. Palczewski. 1996. Turned on by Ca2+! The physiology and pathology of Ca(2+)-binding proteins in the retina. Trends Neurosci 19:547. 182. Pugh, E. N., Jr., T. Duda, A. Sitaramayya, and R. K. Sharma. 1997. Photoreceptor guanylate cyclases: a review. Biosci Rep 17:429. 183. Asai, H., Y. Miyasaka, Y. Kondo, and T. Fujii. 1988. Inhibition of tubulin-dependent ATPase activity in microtubule protein from porcine brain by S100 protein. Neurochem Int 13:509. 184. Popova, J. S., J. C. Garrison, S. G. Rhee, and M. M. Rasenick. 1997. Tubulin, Gq, and phosphatidylinositol 4,5-bisphosphate interact to regulate phospholipase Cbeta1 signaling. J Biol Chem 272:6760. 185. Sorci, G., A. L. Agneletti, R. Bianchi, and R. Donato. 1998. Association of S100B with intermediate filaments and microtubules in glial cells. Biochim Biophys Acta 1448:277. 186. Donato, R. 1985. Calcium-sensitivity of brain microtubule proteins in the presence of S-100 proteins. Cell Calcium 6:343. 187. Donato, R. 1988. Calcium-independent, pH-regulated effects of S-100 proteins on assembly- disassembly of brain microtubule protein in vitro. J Biol Chem 263:106. 188. Garbuglia, M., M. Verzini, I. Giambanco, A. Spreca, and R. Donato. 1996. Effects of calcium- binding proteins (S-100a(o), S-100a, S-100b) on desmin assembly in vitro. Faseb J 10:317. 189. Bianchi, R., I. Giambanco, and R. Donato. 1993. S-100 protein, but not calmodulin, binds to the glial fibrillary acidic protein and inhibits its polymerization in a Ca(2+)-dependent manner. J Biol Chem 268:12669. 190. Bianchi, R., M. Verzini, M. Garbuglia, I. Giambanco, and R. Donato. 1994. Mechanism of S100 protein-dependent inhibition of glial fibrillary acidic protein (GFAP) polymerization. Biochim Biophys Acta 1223:354. 191. Wills, F. L., W. D. McCubbin, and C. M. Kay. 1993. Characterization of the smooth muscle calponin and calmodulin complex. Biochemistry 32:2321. 192. Ivanenkov, V. V., G. A. Jamieson, Jr., E. Gruenstein, and R. V. Dimlich. 1995. Characterization of S-100b binding epitopes. Identification of a novel target, the actin capping protein, CapZ. J Biol Chem 270:14651. 193. Ivanov, G. E., N. I. Misuno, and V. E. Ivanov. 1996. Enzyme-linked immunosorbent assay for human MRP-8/MRP-14 proteins and their quantitation in plasma of hematological patients. Immunol Lett 49:7. 194. Gimona, M., Z. Lando, Y. Dolginov, J. Vandekerckhove, R. Kobayashi, A. Sobieszek, and D. M. Helfman. 1997. Ca2+-dependent interaction of S100A2 with muscle and nonmuscle tropomyosins. J Cell Sci 110 ( Pt 5):611. 195. Kriajevska, M. V., M. N. Cardenas, M. S. Grigorian, N. S. Ambartsumian, G. P. Georgiev, and E. M. Lukanidin. 1994. Non-muscle myosin heavy chain as a possible target for protein encoded by metastasis-related mts-1 gene. J Biol Chem 269:19679. 196. Gibbs, F. E., M. C. Wilkinson, P. S. Rudland, and R. Barraclough. 1994. Interactions in vitro of p9Ka, the rat S-100-related, metastasis-inducing, calcium-binding protein. J Biol Chem 269:18992. 197. Ford, H. L., and S. B. Zain. 1995. Interaction of metastasis associated Mts1 protein with nonmuscle myosin. Oncogene 10:1597. 198. Li, Z. H., A. Spektor, O. Varlamova, and A. R. Bresnick. 2003. Mts1 regulates the assembly of nonmuscle myosin-IIA. Biochemistry 42:14258. 199. Li, Z. H., and A. R. Bresnick. 2006. The S100A4 metastasis factor regulates cellular motility via a direct interaction with myosin-IIA. Cancer Res 66:5173. 200. Dulyaninova, N. G., V. N. Malashkevich, S. C. Almo, and A. R. Bresnick. 2005. Regulation of myosin-IIA assembly and Mts1 binding by heavy chain phosphorylation. Biochemistry 44:6867. 201. Takenaga, K., Y. Nakamura, S. Sakiyama, Y. Hasegawa, K. Sato, and H. Endo. 1994. Binding of pEL98 protein, an S100-related calcium-binding protein, to nonmuscle tropomyosin. J Cell Biol 124:757. 202. Watanabe, Y., N. Usada, H. Minami, T. Morita, S. Tsugane, R. Ishikawa, K. Kohama, Y. Tomida, and H. Hidaka. 1993. Calvasculin, as a factor affecting the microfilament assemblies in rat fibroblasts transfected by src gene. FEBS Lett 324:51. 203. Mani, R. S., W. D. McCubbin, and C. M. Kay. 1992. Calcium-dependent regulation of caldesmon by an 11-kDa smooth muscle calcium-binding protein, caltropin. Biochemistry 31:11896.

251 204. Schneider, G., K. Nieznanski, E. Kilanczyk, P. Bieganowski, J. Kuznicki, and A. Filipek. 2007. CacyBP/SIP interacts with tubulin in neuroblastoma NB2a cells and induces formation of globular tubulin assemblies. Biochim Biophys Acta 1773:1628. 205. Vogl, T., S. Ludwig, M. Goebeler, A. Strey, I. S. Thorey, R. Reichelt, D. Foell, V. Gerke, M. P. Manitz, W. Nacken, S. Werner, C. Sorg, and J. Roth. 2004. MRP8 and MRP14 control microtubule reorganization during transendothelial migration of phagocytes. Blood 104:4260. 206. Leukert, N., T. Vogl, K. Strupat, R. Reichelt, C. Sorg, and J. Roth. 2006. Calcium-dependent tetramer formation of S100A8 and S100A9 is essential for biological activity. J Mol Biol 359:961. 207. Goebeler, M., J. Roth, C. van den Bos, G. Ader, and C. Sorg. 1995. Increase of calcium levels in epithelial cells induces translocation of calcium-binding proteins migration inhibitory factor- related protein 8 (MRP8) and MRP14 to keratin intermediate filaments. Biochem J 309 ( Pt 2):419. 208. Garbuglia, M., R. Bianchi, M. Verzini, I. Giambanco, and R. Donato. 1995. Annexin II2-p11(2) (calpactin I) stimulates the assembly of GFAP in a calcium- and pH-dependent manner. Biochem Biophys Res Commun 208:901. 209. De Seranno, S., C. Benaud, N. Assard, S. Khediri, V. Gerke, J. Baudier, and C. Delphin. 2006. Identification of an AHNAK binding motif specific for the Annexin2/S100A10 tetramer. J Biol Chem 281:35030. 210. Thiel, C., M. Osborn, and V. Gerke. 1992. The tight association of the tyrosine kinase substrate annexin II with the submembranous cytoskeleton depends on intact p11- and Ca(2+)-binding sites. J Cell Sci 103 ( Pt 3):733. 211. Zokas, L., and J. R. Glenney, Jr. 1987. The calpactin light chain is tightly linked to the cytoskeletal form of calpactin I: studies using monoclonal antibodies to calpactin subunits. J Cell Biol 105:2111. 212. Waisman, D. M. 1995. Annexin II tetramer: structure and function. Mol Cell Biochem 149- 150:301. 213. Drust, D. S., and C. E. Creutz. 1988. Aggregation of chromaffin granules by calpactin at micromolar levels of calcium. Nature 331:88. 214. Broome, A. M., and R. L. Eckert. 2004. Microtubule-dependent redistribution of a cytoplasmic cornified envelope precursor. J Invest Dermatol 122:29. 215. Vogl, T., C. Propper, M. Hartmann, A. Strey, K. Strupat, C. van den Bos, C. Sorg, and J. Roth. 1999. S100A12 is expressed exclusively by granulocytes and acts independently from MRP8 and MRP14. J Biol Chem 274:25291. 216. Whiteman, H. J., M. E. Weeks, S. E. Dowen, S. Barry, J. F. Timms, N. R. Lemoine, and T. Crnogorac-Jurcevic. 2007. The role of S100P in the invasion of pancreatic cancer cells is mediated through cytoskeletal changes and regulation of . Cancer Res 67:8633. 217. Clark, K., M. Langeslag, C. G. Figdor, and F. N. van Leeuwen. 2007. Myosin II and mechanotransduction: a balancing act. Trends Cell Biol 17:178. 218. Garrett, S. C., K. M. Varney, D. J. Weber, and A. R. Bresnick. 2006. S100A4, a mediator of metastasis. J Biol Chem 281:677. 219. Grum-Schwensen, B., J. Klingelhofer, C. H. Berg, C. El-Naaman, M. Grigorian, E. Lukanidin, and N. Ambartsumian. 2005. Suppression of tumor development and metastasis formation in mice lacking the S100A4(mts1) gene. Cancer Res 65:3772. 220. Fujii, T., A. Oomatsuzawa, N. Kuzumaki, and Y. Kondo. 1994. Calcium-dependent regulation of smooth muscle calponin by S100. J Biochem 116:121. 221. Umekawa, H., and H. Hidaka. 1985. Phosphorylation of caldesmon by protein kinase C. Biochem Biophys Res Commun 132:56. 222. Vorotnikov, A. V., V. P. Shirinsky, and N. B. Gusev. 1988. Phosphorylation of smooth muscle caldesmon by three protein kinases: implication for domain mapping. FEBS Lett 236:321. 223. Vorotnikov, A. V., and N. B. Gusev. 1990. Interaction of smooth muscle caldesmon with phospholipids. FEBS Lett 277:134. 224. Heierhorst, J., X. Tang, J. Lei, W. C. Probst, K. R. Weiss, B. E. Kemp, and G. M. Benian. 1996. Substrate specificity and inhibitor sensitivity of Ca2+/S100-dependent twitchin kinases. Eur J Biochem 242:454. 225. Lin, J., M. Blake, C. Tang, D. Zimmer, R. R. Rustandi, D. J. Weber, and F. Carrier. 2001. Inhibition of p53 transcriptional activity by the S100B calcium-binding protein. J Biol Chem 276:35037.

252 226. Selinfreund, R. H., S. W. Barger, M. J. Welsh, and L. J. Van Eldik. 1990. Antisense inhibition of glial S100 beta production results in alterations in cell morphology, cytoskeletal organization, and cell proliferation. J Cell Biol 111:2021. 227. Ebralidze, A., E. Tulchinsky, M. Grigorian, A. Afanasyeva, V. Senin, E. Revazova, and E. Lukanidin. 1989. Isolation and characterization of a gene specifically expressed in different metastatic cells and whose deduced gene product has a high degree of homology to a Ca2+- binding protein family. Genes Dev 3:1086. 228. Ambartsumian, N. S., M. S. Grigorian, I. F. Larsen, O. Karlstrom, N. Sidenius, J. Rygaard, G. Georgiev, and E. Lukanidin. 1996. Metastasis of mammary carcinomas in GRS/A hybrid mice transgenic for the mts1 gene. Oncogene 13:1621. 229. Mazzucchelli, L. 2002. Protein S100A4: too long overlooked by pathologists? Am J Pathol 160:7. 230. Senolt, L., M. Grigorian, E. Lukanidin, B. A. Michel, R. E. Gay, S. Gay, K. Pavelka, and M. Neidhart. 2006. S100A4 (Mts1): is there any relation to the pathogenesis of rheumatoid arthritis? Autoimmun Rev 5:129. 231. Breen, E. C., and K. Tang. 2003. Calcyclin (S100A6) regulates pulmonary fibroblast proliferation, morphology, and cytoskeletal organization in vitro. J Cell Biochem 88:848. 232. Sakaguchi, M., M. Miyazaki, Y. Inoue, T. Tsuji, H. Kouchi, T. Tanaka, H. Yamada, and M. Namba. 2000. Relationship between contact inhibition and intranuclear S100C of normal human fibroblasts. J Cell Biol 149:1193. 233. Davey, G. E., P. Murmann, and C. W. Heizmann. 2001. Intracellular Ca2+ and Zn2+ levels regulate the alternative cell density-dependent secretion of S100B in human glioblastoma cells. J Biol Chem 276:30819. 234. Mouta Carreira, C., T. M. LaVallee, F. Tarantini, A. Jackson, J. T. Lathrop, B. Hampton, W. H. Burgess, and T. Maciag. 1998. S100A13 is involved in the regulation of fibroblast growth factor-1 and p40 synaptotagmin-1 release in vitro. J Biol Chem 273:22224. 235. Prudovsky, I., C. Bagala, F. Tarantini, A. Mandinova, R. Soldi, S. Bellum, and T. Maciag. 2002. The intracellular translocation of the components of the fibroblast growth factor 1 release complex precedes their assembly prior to export. J Cell Biol 158:201. 236. Cornish, C. J., J. M. Devery, P. Poronnik, M. Lackmann, D. I. Cook, and C. L. Geczy. 1996. S100 protein CP-10 stimulates myeloid cell chemotaxis without activation. J Cell Physiol 166:427. 237. Yan, W. X., C. Armishaw, J. Goyette, Z. Yang, H. Cai, P. Alewood, and C. L. Geczy. 2008. Mast cell and monocyte recruitment by S100A12 and its hinge domain. J Biol Chem. 238. Komada, T., R. Araki, K. Nakatani, I. Yada, M. Naka, and T. Tanaka. 1996. Novel specific chemtactic receptor for S100L protein on guinea pig eosinophils. Biochem Biophys Res Commun 220:871. 239. Hsieh, H. L., B. W. Schafer, N. Sasaki, and C. W. Heizmann. 2003. Expression analysis of S100 proteins and RAGE in human tumors using tissue microarrays. Biochem Biophys Res Commun 307:375. 240. Hofmann, M. A., S. Drury, C. Fu, W. Qu, A. Taguchi, Y. Lu, C. Avila, N. Kambham, A. Bierhaus, P. Nawroth, M. F. Neurath, T. Slattery, D. Beach, J. McClary, M. Nagashima, J. Morser, D. Stern, and A. M. Schmidt. 1999. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell 97:889. 241. Arumugam, T., D. M. Simeone, A. M. Schmidt, and C. D. Logsdon. 2004. S100P stimulates cell proliferation and survival via receptor for activated glycation end products (RAGE). J Biol Chem 279:5059. 242. Vogl, T., K. Tenbrock, S. Ludwig, N. Leukert, C. Ehrhardt, M. A. van Zoelen, W. Nacken, D. Foell, T. van der Poll, C. Sorg, and J. Roth. 2007. Mrp8 and Mrp14 are endogenous activators of Toll-like receptor 4, promoting lethal, endotoxin-induced shock. Nat Med 13:1042. 243. Van Eldik, L. J., B. Christie-Pope, L. M. Bolin, E. M. Shooter, and W. O. Whetsell, Jr. 1991. Neurotrophic activity of S-100 beta in cultures of dorsal root ganglia from embryonic chick and fetal rat. Brain Res 542:280. 244. Ueda, S., E. T. Kokotos Leonardi, J. Bell, 3rd, and E. C. Azmitia. 1995. Serotonergic sprouting into transplanted C-6 gliomas is blocked by S-100 beta antisense gene. Brain Res Mol Brain Res 29:365. 245. Haglid, K. G., Q. Yang, A. Hamberger, S. Bergman, A. Widerberg, and N. Danielsen. 1997. S- 100beta stimulates neurite outgrowth in the rat sciatic nerve grafted with acellular muscle transplants. Brain Res 753:196.

253 246. Barger, S. W., L. J. Van Eldik, and M. P. Mattson. 1995. S100 beta protects hippocampal neurons from damage induced by glucose deprivation. Brain Res 677:167. 247. Iwasaki, Y., T. Shiojima, and M. Kinoshita. 1997. S100 beta prevents the death of motor neurons in newborn rats after sciatic nerve section. J Neurol Sci 151:7. 248. Ciccarelli, R., P. Di Iorio, V. Bruno, G. Battaglia, I. D'Alimonte, M. D'Onofrio, F. Nicoletti, and F. Caciagli. 1999. Activation of A(1) adenosine or mGlu3 metabotropic glutamate receptors enhances the release of nerve growth factor and S-100beta protein from cultured astrocytes. Glia 27:275. 249. Ahlemeyer, B., H. Beier, I. Semkova, C. Schaper, and J. Krieglstein. 2000. S-100beta protects cultured neurons against glutamate- and staurosporine-induced damage and is involved in the antiapoptotic action of the 5 HT(1A)-receptor agonist, Bay x 3702. Brain Res 858:121. 250. Alexanian, A. R., and J. R. Bamburg. 1999. Neuronal survival activity of s100betabeta is enhanced by calcineurin inhibitors and requires activation of NF-kappaB. Faseb J 13:1611. 251. Huttunen, H. J., J. Kuja-Panula, G. Sorci, A. L. Agneletti, R. Donato, and H. Rauvala. 2000. Coregulation of neurite outgrowth and cell survival by amphoterin and S100 proteins through receptor for advanced glycation end products (RAGE) activation. J Biol Chem 275:40096. 252. Li, Y., S. W. Barger, L. Liu, R. E. Mrak, and W. S. Griffin. 2000. S100beta induction of the proinflammatory cytokine interleukin-6 in neurons. J Neurochem 74:143. 253. Mariggio, M. A., S. Fulle, P. Calissano, I. Nicoletti, and G. Fano. 1994. The brain protein S- 100ab induces apoptosis in PC12 cells. Neuroscience 60:29. 254. Fulle, S., T. Pietrangelo, M. A. Mariggio, P. Lorenzon, L. Racanicchi, J. Mozrzymas, S. Guarnieri, G. Zucconi-Grassi, and G. Fano. 2000. Calcium and fos involvement in brain-derived Ca(2+)-binding protein (S100)-dependent apoptosis in rat phaeochromocytoma cells. Exp Physiol 85:243. 255. Hu, J., A. Ferreira, and L. J. Van Eldik. 1997. S100beta induces neuronal cell death through nitric oxide release from astrocytes. J Neurochem 69:2294. 256. Petrova, T. V., J. Hu, and L. J. Van Eldik. 2000. Modulation of glial activation by astrocyte- derived protein S100B: differential responses of astrocyte and microglial cultures. Brain Res 853:74. 257. Adami, C., G. Sorci, E. Blasi, A. L. Agneletti, F. Bistoni, and R. Donato. 2001. S100B expression in and effects on microglia. Glia 33:131. 258. Aberg, F., and E. N. Kozlova. 2000. Metastasis-associated mts1 (S100A4) protein in the developing and adult central nervous system. J Comp Neurol 424:269. 259. Sen, J., and A. Belli. 2007. S100B in neuropathologic states: the CRP of the brain? J Neurosci Res 85:1373. 260. Schneider, M., S. Kostin, C. C. Strom, M. Aplin, S. Lyngbaek, J. Theilade, M. Grigorian, C. B. Andersen, E. Lukanidin, J. Lerche Hansen, and S. P. Sheikh. 2007. S100A4 is upregulated in injured myocardium and promotes growth and survival of cardiac myocytes. Cardiovasc Res 75:40. 261. Novitskaya, V., M. Grigorian, M. Kriajevska, S. Tarabykina, I. Bronstein, V. Berezin, E. Bock, and E. Lukanidin. 2000. Oligomeric forms of the metastasis-related Mts1 (S100A4) protein stimulate neuronal differentiation in cultures of rat hippocampal neurons. J Biol Chem 275:41278. 262. Emberley, E. D., L. C. Murphy, and P. H. Watson. 2004. S100 proteins and their influence on pro-survival pathways in cancer. Biochem Cell Biol 82:508. 263. Jinquan, T., H. Vorum, C. G. Larsen, P. Madsen, H. H. Rasmussen, B. Gesser, M. Etzerodt, B. Honore, J. E. Celis, and K. Thestrup-Pedersen. 1996. Psoriasin: a novel chemotactic protein. J Invest Dermatol 107:5. 264. Yang, Z., W. X. Yan, H. Cai, N. Tedla, C. Armishaw, N. Di Girolamo, H. W. Wang, T. Hampartzoumian, J. L. Simpson, P. G. Gibson, J. Hunt, P. Hart, J. M. Hughes, M. A. Perry, P. F. Alewood, and C. L. Geczy. 2007. S100A12 provokes mast cell activation: a potential amplification pathway in asthma and innate immunity. J Allergy Clin Immunol 119:106. 265. Ellis, E. F., J. S. McKinney, K. A. Willoughby, S. Liang, and J. T. Povlishock. 1995. A new model for rapid stretch-induced injury of cells in culture: characterization of the model using astrocytes. J Neurotrauma 12:325. 266. Slemmer, J. E., E. J. Matser, C. I. De Zeeuw, and J. T. Weber. 2002. Repeated mild injury causes cumulative damage to hippocampal cells. Brain 125:2699. 267. Willoughby, K. A., A. Kleindienst, C. Muller, T. Chen, J. K. Muir, and E. F. Ellis. 2004. S100B protein is released by in vitro trauma and reduces delayed neuronal injury. J Neurochem 91:1284.

254 268. Sajithlal, G., H. Huttunen, H. Rauvala, and G. Munch. 2002. Receptor for advanced glycation end products plays a more important role in cellular survival than in neurite outgrowth during retinoic acid-induced differentiation of neuroblastoma cells. J Biol Chem 277:6888. 269. Bhattacharyya, A., R. W. Oppenheim, D. Prevette, B. W. Moore, R. Brackenbury, and N. Ratner. 1992. S100 is present in developing chicken neurons and Schwann cells and promotes motor neuron survival in vivo. J Neurobiol 23:451. 270. Liu, J. P., and J. M. Lauder. 1992. S-100 beta and insulin-like growth factor-II differentially regulate growth of developing serotonin and dopamine neurons in vitro. J Neurosci Res 33:248. 271. Hessian, P. A., L. Wilkinson, and N. Hogg. 1995. The S100 family protein MRP-14 (S100A9) has homology with the contact domain of high molecular weight kininogen. FEBS Lett 371:271. 272. Heizmann, C. W. 1996. Multistep calcium signalling in health and disease. Mol Cells 6:629. 273. Sheng, J. G., R. E. Mrak, and W. S. Griffin. 1994. S100 beta protein expression in Alzheimer disease: potential role in the pathogenesis of neuritic plaques. J Neurosci Res 39:398. 274. Van Eldik, L. J., and W. S. Griffin. 1994. S100 beta expression in Alzheimer's disease: relation to neuropathology in brain regions. Biochim Biophys Acta 1223:398. 275. Sussmuth, S. D., H. Tumani, D. Ecker, and A. C. Ludolph. 2003. Amyotrophic lateral sclerosis: disease stage related changes of tau protein and S100 beta in cerebrospinal fluid and creatine kinase in serum. Neurosci Lett 353:57. 276. Griffin, W. S., O. Yeralan, J. G. Sheng, F. A. Boop, R. E. Mrak, C. R. Rovnaghi, B. A. Burnett, A. Feoktistova, and L. J. Van Eldik. 1995. Overexpression of the neurotrophic cytokine S100 beta in human temporal lobe epilepsy. J Neurochem 65:228. 277. Rothermundt, M., M. Peters, J. H. Prehn, and V. Arolt. 2003. S100B in brain damage and neurodegeneration. Microsc Res Tech 60:614. 278. Kiewitz, R., C. Acklin, E. Minder, P. R. Huber, B. W. Schafer, and C. W. Heizmann. 2000. S100A1, a new marker for acute myocardial ischemia. Biochem Biophys Res Commun 274:865. 279. Bartling, B., G. Rehbein, W. D. Schmitt, H. S. Hofmann, R. E. Silber, and A. Simm. 2007. S100A2-S100P expression profile and diagnosis of non-small cell lung carcinoma: impairment by advanced tumour stages and neoadjuvant chemotherapy. Eur J Cancer 43:1935. 280. Wicki, R., C. Franz, F. A. Scholl, C. W. Heizmann, and B. W. Schafer. 1997. Repression of the candidate tumor suppressor gene S100A2 in breast cancer is mediated by site-specific hypermethylation. Cell Calcium 22:243. 281. Nagy, N., D. Hoyaux, I. Gielen, B. W. Schafer, R. Pochet, C. W. Heizmann, R. Kiss, I. Salmon, and C. Decaestecker. 2002. The Ca2+-binding S100A2 protein is differentially expressed in epithelial tissue of glandular or squamous origin. Histol Histopathol 17:123. 282. Heighway, J., T. Knapp, L. Boyce, S. Brennand, J. K. Field, D. C. Betticher, D. Ratschiller, M. Gugger, M. Donovan, A. Lasek, and P. Rickert. 2002. Expression profiling of primary non-small cell lung cancer for target identification. Oncogene 21:7749. 283. El-Rifai, W., C. A. Moskaluk, M. K. Abdrabbo, J. Harper, C. Yoshida, G. J. Riggins, H. F. Frierson, Jr., and S. M. Powell. 2002. Gastric cancers overexpress S100A calcium-binding proteins. Cancer Res 62:6823. 284. Lee, S. W., C. Tomasetto, K. Swisshelm, K. Keyomarsi, and R. Sager. 1992. Down-regulation of a member of the S100 gene family in mammary carcinoma cells and reexpression by azadeoxycytidine treatment. Proc Natl Acad Sci U S A 89:2504. 285. Feng, G., X. Xu, E. M. Youssef, and R. Lotan. 2001. Diminished expression of S100A2, a putative tumor suppressor, at early stage of human lung carcinogenesis. Cancer Res 61:7999. 286. Shrestha, P., Y. Muramatsu, W. Kudeken, M. Mori, Y. Takai, E. C. Ilg, B. W. Schafer, and C. W. Heizmann. 1998. Localization of Ca(2+)-binding S100 proteins in epithelial tumours of the skin. Virchows Arch 432:53. 287. Hough, C. D., K. R. Cho, A. B. Zonderman, D. R. Schwartz, and P. J. Morin. 2001. Coordinately up-regulated genes in ovarian cancer. Cancer Res 61:3869. 288. Ohuchida, K., K. Mizumoto, Y. Miyasaka, J. Yu, L. Cui, H. Yamaguchi, H. Toma, S. Takahata, N. Sato, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka. 2007. Over-expression of S100A2 in pancreatic cancer correlates with progression and poor prognosis. J Pathol 213:275. 289. Kizawa, K., M. Toyoda, M. Ito, and M. Morohashi. 2005. Aberrantly differentiated cells in benign pilomatrixoma reflect the normal hair follicle: immunohistochemical analysis of Ca- binding S100A2, S100A3 and S100A6 proteins. Br J Dermatol 152:314. 290. Lee, O. J., S. M. Hong, M. H. Razvi, D. Peng, S. M. Powell, M. Smoklin, C. A. Moskaluk, and W. El-Rifai. 2006. Expression of calcium-binding proteins S100A2 and S100A4 in Barrett's adenocarcinomas. Neoplasia 8:843.

255 291. Pelc, P., N. Vanmuylder, F. Lefranc, C. W. Heizmann, S. Hassid, I. Salmon, R. Kiss, S. Louryan, and C. Decaestecker. 2003. Differential expression of S100 calcium-binding proteins in epidermoid cysts, branchial cysts, craniopharyngiomas and cholesteatomas. Histopathology 42:387. 292. Ambartsumian, N., J. Klingelhofer, M. Grigorian, C. Christensen, M. Kriajevska, E. Tulchinsky, G. Georgiev, V. Berezin, E. Bock, J. Rygaard, R. Cao, Y. Cao, and E. Lukanidin. 2001. The metastasis-associated Mts1(S100A4) protein could act as an angiogenic factor. Oncogene 20:4685. 293. Platt-Higgins, A. M., C. A. Renshaw, C. R. West, J. H. Winstanley, S. De Silva Rudland, R. Barraclough, and P. S. Rudland. 2000. Comparison of the metastasis-inducing protein S100A4 (p9ka) with other prognostic markers in human breast cancer. Int J Cancer 89:198. 294. Pedrocchi, M., B. W. Schafer, H. Mueller, U. Eppenberger, and C. W. Heizmann. 1994. Expression of Ca(2+)-binding proteins of the S100 family in malignant human breast-cancer cell lines and biopsy samples. Int J Cancer 57:684. 295. Tang, Y., E. Pacary, T. Freret, D. Divoux, E. Petit, P. Schumann-Bard, and M. Bernaudin. 2006. Effect of hypoxic preconditioning on brain genomic response before and following ischemia in the adult mouse: identification of potential neuroprotective candidates for stroke. Neurobiol Dis 21:18. 296. Lusis, E., and D. H. Gutmann. 2004. Meningioma: an update. Curr Opin Neurol 17:687. 297. Hancq, S., I. Salmon, J. Brotchi, O. De Witte, H. J. Gabius, C. W. Heizmann, R. Kiss, and C. Decaestecker. 2004. S100A5: a marker of recurrence in WHO grade I meningiomas. Neuropathol Appl Neurobiol 30:178. 298. Hoyaux, D., C. Decaestecker, C. W. Heizmann, T. Vogl, B. W. Schafer, I. Salmon, R. Kiss, and R. Pochet. 2000. S100 proteins in Corpora amylacea from normal human brain. Brain Res 867:280. 299. Guo, X. J., A. F. Chambers, C. L. Parfett, P. Waterhouse, L. C. Murphy, R. E. Reid, A. M. Craig, D. R. Edwards, and D. T. Denhardt. 1990. Identification of a serum-inducible messenger RNA (5B10) as the mouse homologue of calcyclin: tissue distribution and expression in metastatic, ras-transformed NIH 3T3 cells. Cell Growth Differ 1:333. 300. Weterman, M. A., G. M. Stoopen, G. N. van Muijen, J. Kuznicki, D. J. Ruiter, and H. P. Bloemers. 1992. Expression of calcyclin in human melanoma cell lines correlates with metastatic behavior in nude mice. Cancer Res 52:1291. 301. Hoyaux, D., A. Boom, L. Van den Bosch, N. Belot, J. J. Martin, C. W. Heizmann, R. Kiss, and R. Pochet. 2002. S100A6 overexpression within astrocytes associated with impaired axons from both ALS mouse model and human patients. J Neuropathol Exp Neurol 61:736. 302. Cheng, C. W., A. Rifai, S. M. Ka, H. A. Shui, Y. F. Lin, W. H. Lee, and A. Chen. 2005. Calcium-binding proteins and S100A6 are sensors of tubular injury and recovery in acute renal failure. Kidney Int 68:2694. 303. Luu, H. H., L. Zhou, R. C. Haydon, A. T. Deyrup, A. G. Montag, D. Huo, R. Heck, C. W. Heizmann, T. D. Peabody, M. A. Simon, and T. C. He. 2005. Increased expression of S100A6 is associated with decreased metastasis and inhibition of cell migration and anchorage independent growth in human osteosarcoma. Cancer Lett 229:135. 304. Shekouh, A. R., C. C. Thompson, W. Prime, F. Campbell, J. Hamlett, C. S. Herrington, N. R. Lemoine, T. Crnogorac-Jurcevic, M. W. Buechler, H. Friess, J. P. Neoptolemos, S. R. Pennington, and E. Costello. 2003. Application of laser capture microdissection combined with two-dimensional electrophoresis for the discovery of differentially regulated proteins in pancreatic ductal adenocarcinoma. Proteomics 3:1988. 305. Maelandsmo, G. M., V. A. Florenes, T. Mellingsaeter, E. Hovig, R. S. Kerbel, and O. Fodstad. 1997. Differential expression patterns of S100A2, S100A4 and S100A6 during progression of human malignant melanoma. Int J Cancer 74:464. 306. Kim, J., S. Yoon, J. Joo, Y. Lee, K. Lee, J. Chung, and I. Choe. 2002. S100A6 protein as a marker for differential diagnosis of cholangiocarcinoma from hepatocellular carcinoma. Hepatol Res 23:274. 307. Yang, Y. Q., L. J. Zhang, H. Dong, C. L. Jiang, Z. G. Zhu, J. X. Wu, Y. L. Wu, J. S. Han, H. S. Xiao, H. J. Gao, and Q. H. Zhang. 2007. Upregulated expression of S100A6 in human gastric cancer. J Dig Dis 8:186. 308. Ohuchida, K., K. Mizumoto, N. Ishikawa, K. Fujii, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka. 2005. The role of S100A6 in pancreatic cancer development and its clinical implication as a diagnostic marker and therapeutic target. Clin Cancer Res 11:7785.

256 309. Lee, J. G., and E. P. Kay. 2006. FGF-2-mediated signal transduction during endothelial mesenchymal transformation in corneal endothelial cells. Exp Eye Res 83:1309. 310. Broome, A. M., D. Ryan, and R. L. Eckert. 2003. S100 protein subcellular localization during epidermal differentiation and psoriasis. J Histochem Cytochem 51:675. 311. Al-Haddad, S., Z. Zhang, E. Leygue, L. Snell, A. Huang, Y. Niu, T. Hiller-Hitchcock, K. Hole, L. C. Murphy, and P. H. Watson. 1999. Psoriasin (S100A7) expression and invasive breast cancer. Am J Pathol 155:2057. 312. Karvonen, S. L., T. Korkiamaki, H. Yla-Outinen, M. Nissinen, H. Teerikangas, K. Pummi, J. Karvonen, and J. Peltonen. 2000. Psoriasis and altered calcium metabolism: downregulated capacitative calcium influx and defective calcium-mediated in cultured psoriatic keratinocytes. J Invest Dermatol 114:693. 313. Buchau, A. S., M. Hassan, G. Kukova, V. Lewerenz, S. Kellermann, J. U. Wurthner, R. Wolf, M. Walz, R. L. Gallo, and T. Ruzicka. 2007. S100A15, an antimicrobial protein of the skin: regulation by E. coli through Toll-like receptor 4. J Invest Dermatol 127:2596. 314. Zhou, G., T. X. Xie, M. Zhao, S. A. Jasser, M. N. Younes, D. Sano, J. Lin, M. E. Kupferman, A. A. Santillan, V. Patel, J. S. Gutkind, A. K. Ei-Naggar, E. D. Emberley, P. H. Watson, S. I. Matsuzawa, J. C. Reed, and J. N. Myers. 2008. Reciprocal negative regulation between S100A7/psoriasin and beta-catenin signaling plays an important role in tumor progression of squamous cell carcinoma of oral cavity. Oncogene. 315. Svenningsson, P., K. Chergui, I. Rachleff, M. Flajolet, X. Zhang, M. El Yacoubi, J. M. Vaugeois, G. G. Nomikos, and P. Greengard. 2006. Alterations in 5-HT1B receptor function by p11 in depression-like states. Science 311:77. 316. Svenningsson, P., and P. Greengard. 2007. p11 (S100A10)--an inducible adaptor protein that modulates neuronal functions. Curr Opin Pharmacol 7:27. 317. Polans, A. S., R. L. Gee, T. M. Walker, and P. R. van Ginkel. 2000. Calcium-binding proteins and their assessment in ocular diseases. Methods Enzymol 316:103. 318. Tanaka, M., K. Adzuma, M. Iwami, K. Yoshimoto, Y. Monden, and M. Itakura. 1995. Human calgizzarin; one colorectal cancer-related gene selected by a large scale random cDNA sequencing and northern blot analysis. Cancer Lett 89:195. 319. Ohuchida, K., K. Mizumoto, S. Ohhashi, H. Yamaguchi, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka. 2006. S100A11, a putative tumor suppressor gene, is overexpressed in pancreatic carcinogenesis. Clin Cancer Res 12:5417. 320. Rehman, I., A. R. Azzouzi, S. S. Cross, J. C. Deloulme, J. W. Catto, N. Wylde, S. Larre, J. Champigneuille, and F. C. Hamdy. 2004. Dysregulated expression of S100A11 (calgizzarin) in prostate cancer and precursor lesions. Hum Pathol 35:1385. 321. Salama, I., P. S. Malone, F. Mihaimeed, and J. L. Jones. 2008. A review of the S100 proteins in cancer. Eur J Surg Oncol 34:357. 322. Yang, D. M., and L. S. Kao. 2001. Relative contribution of the Na(+)/Ca(2+) exchanger, mitochondria and endoplasmic reticulum in the regulation of cytosolic Ca(2+) and catecholamine secretion of bovine adrenal chromaffin cells. J Neurochem 76:210. 323. Gottsch, J. D., S. H. Liu, J. B. Minkovitz, D. F. Goodman, M. Srinivasan, and W. J. Stark. 1995. Autoimmunity to a cornea-associated stromal antigen in patients with Mooren's ulcer. Invest Ophthalmol Vis Sci 36:1541. 324. Wittkowski, H., K. Hirono, F. Ichida, T. Vogl, F. Ye, X. Yanlin, K. Saito, K. Uese, T. Miyawaki, D. Viemann, J. Roth, and D. Foell. 2007. Acute Kawasaki disease is associated with reverse regulation of soluble receptor for advance glycation end products and its proinflammatory ligand S100A12. Arthritis Rheum 56:4174. 325. Wittkowski, H., A. Sturrock, M. A. van Zoelen, D. Viemann, T. van der Poll, J. R. Hoidal, J. Roth, and D. Foell. 2007. Neutrophil-derived S100A12 in acute lung injury and respiratory distress syndrome. Crit Care Med 35:1369. 326. Frosch, M., and J. Roth. 2008. New insights in systemic juvenile idiopathic arthritis--from pathophysiology to treatment. Rheumatology (Oxford) 47:121. 327. Lorenz, E., M. S. Muhlebach, P. A. Tessier, N. E. Alexis, R. Duncan Hite, M. C. Seeds, D. B. Peden, and W. Meredith. 2008. Different expression ratio of S100A8/A9 and S100A12 in acute and chronic lung diseases. Respir Med 102:567. 328. Landriscina, M., R. Soldi, C. Bagala, I. Micucci, S. Bellum, F. Tarantini, I. Prudovsky, and T. Maciag. 2001. S100A13 participates in the release of fibroblast growth factor 1 in response to heat shock in vitro. J Biol Chem 276:22544. 329. Hayrabedyan, S., S. Kyurkchiev, and I. Kehayov. 2005. FGF-1 and S100A13 possibly contribute to angiogenesis in endometriosis. J Reprod Immunol 67:87.

257 330. Guerreiro Da Silva, I. D., Y. F. Hu, I. H. Russo, X. Ao, A. M. Salicioni, X. Yang, and J. Russo. 2000. S100P calcium-binding protein overexpression is associated with immortalization of human breast epithelial cells in vitro and early stages of breast cancer development in vivo. Int J Oncol 16:231. 331. Reeves, R. H., J. Yao, M. R. Crowley, S. Buck, X. Zhang, P. Yarowsky, J. D. Gearhart, and D. C. Hilt. 1994. Astrocytosis and axonal proliferation in the hippocampus of S100b transgenic mice. Proc Natl Acad Sci U S A 91:5359. 332. Gerlai, R., J. M. Wojtowicz, A. Marks, and J. Roder. 1995. Overexpression of a calcium-binding protein, S100 beta, in astrocytes alters synaptic plasticity and impairs spatial learning in transgenic mice. Learn Mem 2:26. 333. Winocur, G., J. Roder, and N. Lobaugh. 2001. Learning and memory in S100-beta transgenic mice: an analysis of impaired and preserved function. Neurobiol Learn Mem 75:230. 334. Bell, K., D. Shokrian, C. Potenzieri, and P. M. Whitaker-Azmitia. 2003. Harm avoidance, anxiety, and response to novelty in the adolescent S-100beta transgenic mouse: role of serotonin and relevance to Down syndrome. Neuropsychopharmacology 28:1810. 335. Du, X. J., T. J. Cole, N. Tenis, X. M. Gao, F. Kontgen, B. E. Kemp, and J. Heierhorst. 2002. Impaired cardiac contractility response to hemodynamic stress in S100A1-deficient mice. Mol Cell Biol 22:2821. 336. C, E. L. N., B. Grum-Schwensen, A. Mansouri, M. Grigorian, E. Santoni-Rugiu, T. Hansen, M. Kriajevska, B. W. Schafer, C. W. Heizmann, E. Lukanidin, and N. Ambartsumian. 2004. Cancer predisposition in mice deficient for the metastasis-associated Mts1(S100A4) gene. Oncogene 23:3670. 337. Hobbs, J. A., R. May, K. Tanousis, E. McNeill, M. Mathies, C. Gebhardt, R. Henderson, M. J. Robinson, and N. Hogg. 2003. Myeloid cell function in MRP-14 (S100A9) null mice. Mol Cell Biol 23:2564. 338. Manitz, M. P., B. Horst, S. Seeliger, A. Strey, B. V. Skryabin, M. Gunzer, W. Frings, F. Schonlau, J. Roth, C. Sorg, and W. Nacken. 2003. Loss of S100A9 (MRP14) results in reduced interleukin-8-induced CD11b surface expression, a polarized microfilament system, and diminished responsiveness to chemoattractants in vitro. Mol Cell Biol 23:1034. 339. Passey, R. J., E. Williams, A. M. Lichanska, C. Wells, S. Hu, C. L. Geczy, M. H. Little, and D. A. Hume. 1999. A null mutation in the inflammation-associated S100 protein S100A8 causes early resorption of the mouse embryo. J Immunol 163:2209. 340. Bhardwaj, R. S., C. Zotz, G. Zwadlo-Klarwasser, J. Roth, M. Goebeler, K. Mahnke, M. Falk, G. Meinardus-Hager, and C. Sorg. 1992. The calcium-binding proteins MRP8 and MRP14 form a membrane-associated heterodimer in a subset of monocytes/macrophages present in acute but absent in chronic inflammatory lesions. Eur J Immunol 22:1891. 341. Brandtzaeg, P., I. Dale, and M. K. Fagerhol. 1987. Distribution of a formalin-resistant myelomonocytic antigen (L1) in human tissues. II. Normal and aberrant occurrence in various epithelia. Am J Clin Pathol 87:700. 342. Gebhardt, C., U. Breitenbach, J. P. Tuckermann, B. T. Dittrich, K. H. Richter, and P. Angel. 2002. Calgranulins S100A8 and S100A9 are negatively regulated by glucocorticoids in a c-Fos- dependent manner and overexpressed throughout skin carcinogenesis. Oncogene 21:4266. 343. Hogg, N., C. Allen, and J. Edgeworth. 1989. Monoclonal antibody 5.5 reacts with p8,14, a myeloid molecule associated with some vascular endothelium. Eur J Immunol 19:1053. 344. Steinbakk, M., C. F. Naess-Andresen, E. Lingaas, I. Dale, P. Brandtzaeg, and M. K. Fagerhol. 1990. Antimicrobial actions of calcium binding leucocyte L1 protein, calprotectin. Lancet 336:763. 345. Odink, K., N. Cerletti, J. Bruggen, R. G. Clerc, L. Tarcsay, G. Zwadlo, G. Gerhards, R. Schlegel, and C. Sorg. 1987. Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis. Nature 330:80. 346. Wilkinson, M. M., A. Busuttil, C. Hayward, D. J. Brock, J. R. Dorin, and V. Van Heyningen. 1988. Expression pattern of two related cystic fibrosis-associated calcium-binding proteins in normal and abnormal tissues. J Cell Sci 91 ( Pt 2):221. 347. Johne, B., M. K. Fagerhol, T. Lyberg, H. Prydz, P. Brandtzaeg, C. F. Naess-Andresen, and I. Dale. 1997. Functional and clinical aspects of the myelomonocyte protein calprotectin. Mol Pathol 50:113. 348. Longbottom, D., J. M. Sallenave, and V. van Heyningen. 1992. Subunit structure of calgranulins A and B obtained from sputum, plasma, granulocytes and cultured epithelial cells. Biochim Biophys Acta 1120:215.

258 349. Brandtzaeg, P., D. B. Jones, D. J. Flavell, and M. K. Fagerhol. 1988. Mac 387 antibody and detection of formalin resistant myelomonocytic L1 antigen. J Clin Pathol 41:963. 350. Guignard, F., J. Mauel, and M. Markert. 1996. The monoclonal antibody Mac 387 recognizes three S100 proteins in human neutrophils. Immunol Cell Biol 74:105. 351. Lagasse, E., and R. G. Clerc. 1988. Cloning and expression of two human genes encoding calcium-binding proteins that are regulated during myeloid differentiation. Mol Cell Biol 8:2402. 352. Kelly, S. E., D. B. Jones, and S. Fleming. 1989. Calgranulin expression in inflammatory dermatoses. J Pathol 159:17. 353. Delabie, J., C. de Wolf-Peeters, J. J. van den Oord, and V. J. Desmet. 1990. Differential expression of the calcium-binding proteins MRP8 and MRP14 in granulomatous conditions: an immunohistochemical study. Clin Exp Immunol 81:123. 354. Sorg, C. 1992. The calcium binding proteins MRP8 and MRP14 in acute and chronic inflammation. Behring Inst Mitt:126. 355. Nacken, W., and C. Kerkhoff. 2007. The hetero-oligomeric complex of the S100A8/S100A9 protein is extremely protease resistant. FEBS Lett 581:5127. 356. Nacken, W., J. Roth, C. Sorg, and C. Kerkhoff. 2003. S100A9/S100A8: Myeloid representatives of the S100 protein family as prominent players in innate immunity. Microsc Res Tech 60:569. 357. Greenlee, K. J., D. B. Corry, D. A. Engler, R. K. Matsunami, P. Tessier, R. G. Cook, Z. Werb, and F. Kheradmand. 2006. Proteomic identification of in vivo substrates for matrix metalloproteinases 2 and 9 reveals a mechanism for resolution of inflammation. J Immunol 177:7312. 358. Naess-Andresen, C. F., B. Egelandsdal, and M. K. Fagerhol. 1995. Calcium binding and concomitant changes in the structure and heat stability of calprotectin (L1 protein). Clin Mol Pathol 48:M278. 359. Yousefi, R., M. Imani, S. K. Ardestani, A. A. Saboury, N. Gheibi, and B. Ranjbar. 2007. Human calprotectin: effect of calcium and zinc on its secondary and tertiary structures, and role of pH in its thermal stability. Acta Biochim Biophys Sin (Shanghai) 39:795. 360. Kerkhoff, C., K. Habben, L. Gehring, K. Resch, and V. Kaever. 1998. Substrate specificity of acyl-CoA:Lysophospholipid acyltransferase (LAT) from pig spleen. Arch Biochem Biophys 351:220. 361. Perret, C., N. Lomri, and M. Thomasset. 1988. Evolution of the EF-hand calcium-binding protein family: evidence for exon shuffling and intron insertion. J Mol Evol 27:351. 362. Edgeworth, J., M. Gorman, R. Bennett, P. Freemont, and N. Hogg. 1991. Identification of p8,14 as a highly abundant heterodimeric calcium binding protein complex of myeloid cells. J Biol Chem 266:7706. 363. van den Bos, C., J. Roth, H. G. Koch, M. Hartmann, and C. Sorg. 1996. Phosphorylation of MRP14, an S100 protein expressed during monocytic differentiation, modulates Ca(2+)- dependent translocation from cytoplasm to membranes and cytoskeleton. J Immunol 156:1247. 364. Foell, D., H. Wittkowski, T. Vogl, and J. Roth. 2007. S100 proteins expressed in phagocytes: a novel group of damage-associated molecular pattern molecules. J Leukoc Biol 81:28. 365. Lagasse, E., and I. L. Weissman. 1992. Mouse MRP8 and MRP14, two intracellular calcium- binding proteins associated with the development of the myeloid lineage. Blood 79:1907. 366. Raftery, M. J., C. A. Harrison, P. Alewood, A. Jones, and C. L. Geczy. 1996. Isolation of the murine S100 protein MRP14 (14 kDa migration-inhibitory-factor-related protein) from activated spleen cells: characterization of post-translational modifications and zinc binding. Biochem J 316 ( Pt 1):285. 367. Hessian, P. A., J. Edgeworth, and N. Hogg. 1993. MRP-8 and MRP-14, two abundant Ca(2+)- binding proteins of neutrophils and monocytes. J Leukoc Biol 53:197. 368. McCormick, M. M., F. Rahimi, Y. V. Bobryshev, K. Gaus, H. Zreiqat, H. Cai, R. S. Lord, and C. L. Geczy. 2005. S100A8 and S100A9 in human arterial wall. Implications for atherogenesis. J Biol Chem 280:41521. 369. Raftery, M. J., and C. L. Geczy. 1998. Identification of noncovalent dimeric complexes of the recombinant murine S100 protein CP10 by electrospray ionization mass spectrometry and chemical cross-linking. J Am Soc Mass Spectrom 9:533. 370. Nacken, W., C. Sopalla, C. Propper, C. Sorg, and C. Kerkhoff. 2000. Biochemical characterization of the murine S100A9 (MRP14) protein suggests that it is functionally equivalent to its human counterpart despite its low degree of sequence homology. Eur J Biochem 267:560.

259 371. Goebeler, M., J. Roth, U. Henseleit, C. Sunderkotter, and C. Sorg. 1993. Expression and complex assembly of calcium-binding proteins MRP8 and MRP14 during differentiation of murine myelomonocytic cells. J Leukoc Biol 53:11. 372. Saris, C. J., T. Kristensen, P. D'Eustachio, L. J. Hicks, D. J. Noonan, T. Hunter, and B. F. Tack. 1987. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I). J Biol Chem 262:10663. 373. Murphy, L. C., L. J. Murphy, D. Tsuyuki, M. L. Duckworth, and R. P. Shiu. 1988. Cloning and characterization of a cDNA encoding a highly conserved, putative calcium binding protein, identified by an anti-prolactin receptor antiserum. J Biol Chem 263:2397. 374. Jensen, R., D. R. Marshak, C. Anderson, T. J. Lukas, and D. M. Watterson. 1985. Characterization of human brain S100 protein fraction: amino acid sequence of S100 beta. J Neurochem 45:700. 375. Miranda, L. P., T. Tao, A. Jones, I. Chernushevich, K. G. Standing, C. L. Geczy, and P. F. Alewood. 2001. Total chemical synthesis and chemotactic activity of human S100A12 (EN- RAGE). FEBS Lett 488:85. 376. Vogl, T., J. Roth, C. Sorg, F. Hillenkamp, and K. Strupat. 1999. Calcium-induced noncovalently linked tetramers of MRP8 and MRP14 detected by ultraviolet matrix-assisted laser desorption/ionization mass spectrometry. J Am Soc Mass Spectrom 10:1124. 377. Newton, R. A., and N. Hogg. 1998. The human S100 protein MRP-14 is a novel activator of the beta 2 integrin Mac-1 on neutrophils. J Immunol 160:1427. 378. Rahimi, F., K. Hsu, Y. Endoh, and C. L. Geczy. 2005. FGF-2, IL-1beta and TGF-beta regulate fibroblast expression of S100A8. Febs J 272:2811. 379. Zwadlo, G., R. Schlegel, and C. Sorg. 1986. A monoclonal antibody to a subset of human monocytes found only in the peripheral blood and inflammatory tissues. J Immunol 137:512. 380. Kumar, R. K., Z. Yang, S. Bilson, S. Thliveris, B. E. Cooke, and C. L. Geczy. 2001. Dimeric S100A8 in human neutrophils is diminished after phagocytosis. J Leukoc Biol 70:59. 381. Roth, J., T. Vogl, C. Sorg, and C. Sunderkotter. 2003. Phagocyte-specific S100 proteins: a novel group of proinflammatory molecules. Trends Immunol 24:155. 382. Berntzen, H. B., and M. K. Fagerhol. 1990. L1, a major granulocyte protein; isolation of high quantities of its subunits. Scand J Clin Lab Invest 50:769. 383. Korndorfer, I. P., F. Brueckner, and A. Skerra. 2007. The crystal structure of the human (S100A8/S100A9)2 heterotetramer, calprotectin, illustrates how conformational changes of interacting alpha-helices can determine specific association of two EF-hand proteins. J Mol Biol 370:887. 384. Brodersen, D. E., J. Nyborg, and M. Kjeldgaard. 1999. Zinc-binding site of an S100 protein revealed. Two crystal structures of Ca2+-bound human psoriasin (S100A7) in the Zn2+-loaded and Zn2+-free states. Biochemistry 38:1695. 385. Loomans, H. J., B. L. Hahn, Q. Q. Li, S. H. Phadnis, and P. G. Sohnle. 1998. Histidine-based zinc-binding sequences and the antimicrobial activity of calprotectin. J Infect Dis 177:812. 386. Jongeneel, C. V., J. Bouvier, and A. Bairoch. 1989. A unique signature identifies a family of zinc-dependent metallopeptidases. FEBS Lett 242:211. 387. Sroussi, H. Y., J. Berline, P. Dazin, P. Green, and J. M. Palefsky. 2006. S100A8 triggers oxidation-sensitive repulsion of neutrophils. J Dent Res 85:829. 388. Guignard, F., J. Mauel, and M. Markert. 1996. Phosphorylation of myeloid-related proteins MRP-14 and MRP-8 during human neutrophil activation. Eur J Biochem 241:265. 389. Raftery, M. J., Z. Yang, S. M. Valenzuela, and C. L. Geczy. 2001. Novel intra- and inter- molecular sulfinamide bonds in S100A8 produced by hypochlorite oxidation. J Biol Chem 276:33393. 390. Raftery, M. J., and C. L. Geczy. 2002. Electrospray low energy CID and MALDI PSD fragmentations of protonated sulfinamide cross-linked peptides. J Am Soc Mass Spectrom 13:709. 391. Sroussi, H. Y., J. Berline, and J. M. Palefsky. 2007. Oxidation of methionine 63 and 83 regulates the effect of S100A9 on the migration of neutrophils in vitro. J Leukoc Biol 81:818. 392. Edgeworth, J., P. Freemont, and N. Hogg. 1989. Ionomycin-regulated phosphorylation of the myeloid calcium-binding protein p14. Nature 342:189. 393. Bengis-Garber, C., and N. Gruener. 1993. Calcium-binding myeloid protein (P8,14) is phosphorylated in fMet-Leu-Phe-stimulated neutrophils. J Leukoc Biol 54:114. 394. Weiss, S. J. 1989. Tissue destruction by neutrophils. N Engl J Med 320:365.

260 395. Dean, R. T., S. Fu, R. Stocker, and M. J. Davies. 1997. Biochemistry and pathology of radical- mediated protein oxidation. Biochem J 324 ( Pt 1):1. 396. Winterbourn, C. C., and A. J. Kettle. 2000. Biomarkers of myeloperoxidase-derived hypochlorous acid. Free Radic Biol Med 29:403. 397. Segal, B. H., T. L. Leto, J. I. Gallin, H. L. Malech, and S. M. Holland. 2000. Genetic, biochemical, and clinical features of chronic granulomatous disease. Medicine (Baltimore) 79:170. 398. Hazell, L. J., L. Arnold, D. Flowers, G. Waeg, E. Malle, and R. Stocker. 1996. Presence of hypochlorite-modified proteins in human atherosclerotic lesions. J Clin Invest 97:1535. 399. Fu, X., D. M. Mueller, and J. W. Heinecke. 2002. Generation of intramolecular and intermolecular sulfenamides, sulfinamides, and sulfonamides by hypochlorous acid: a potential pathway for oxidative cross-linking of low-density lipoprotein by myeloperoxidase. Biochemistry 41:1293. 400. Clark, R. A. 1993. Regulation of fibroplasia in cutaneous wound repair. Am J Med Sci 306:42. 401. Clarke, S. 1993. Protein methylation. Curr Opin Cell Biol 5:977. 402. Paik, W. K., and S. Kim. 1971. Protein methylation. Science 174:114. 403. Zwadlo, G., J. Bruggen, G. Gerhards, R. Schlegel, and C. Sorg. 1988. Two calcium-binding proteins associated with specific stages of myeloid cell differentiation are expressed by subsets of macrophages in inflammatory tissues. Clin Exp Immunol 72:510. 404. Merten, M. D., and C. Figarella. 1993. Constitutive hypersecretion and insensitivity to neurotransmitters by cystic fibrosis tracheal gland cells. Am J Physiol 264:L93. 405. Santhanagopalan, V., B. L. Hahn, and P. G. Sohnle. 1995. Resistance of zinc-supplemented Candida albicans cells to the growth inhibitory effect of calprotectin. J Infect Dis 171:1289. 406. Hu, S. P., C. Harrison, K. Xu, C. J. Cornish, and C. L. Geczy. 1996. Induction of the chemotactic S100 protein, CP-10, in monocyte/macrophages by lipopolysaccharide. Blood 87:3919. 407. Hsu, K., R. J. Passey, Y. Endoh, F. Rahimi, P. Youssef, T. Yen, and C. L. Geczy. 2005. Regulation of S100A8 by glucocorticoids. J Immunol 174:2318. 408. Kumar, A., A. Steinkasserer, and S. Berchtold. 2003. Interleukin-10 influences the expression of MRP8 and MRP14 in human dendritic cells. Int Arch Allergy Immunol 132:40. 409. Akiyama, H., K. Ikeda, M. Katoh, E. G. McGeer, and P. L. McGeer. 1994. Expression of MRP14, 27E10, interferon-alpha and leukocyte common antigen by reactive microglia in postmortem human brain tissue. J Neuroimmunol 50:195. 410. Shepherd, C. E., J. Goyette, V. Utter, F. Rahimi, Z. Yang, C. L. Geczy, and G. M. Halliday. 2006. Inflammatory S100A9 and S100A12 proteins in Alzheimer's disease. Neurobiol Aging 27:1554. 411. Healy, A. M., M. D. Pickard, A. D. Pradhan, Y. Wang, Z. Chen, K. Croce, M. Sakuma, C. Shi, A. C. Zago, J. Garasic, A. I. Damokosh, T. L. Dowie, L. Poisson, J. Lillie, P. Libby, P. M. Ridker, and D. I. Simon. 2006. Platelet expression profiling and clinical validation of myeloid-related protein-14 as a novel determinant of cardiovascular events. Circulation 113:2278. 412. Grimbaldeston, M. A., C. L. Geczy, N. Tedla, J. J. Finlay-Jones, and P. H. Hart. 2003. S100A8 induction in keratinocytes by ultraviolet A irradiation is dependent on reactive oxygen intermediates. J Invest Dermatol 121:1168. 413. Eversole, L. R., K. T. Miyasaki, and R. E. Christensen. 1992. The distribution of the antimicrobial protein, calprotectin, in normal oral keratinocytes. Arch Oral Biol 37:963. 414. Eversole, L. R., K. T. Miyasaki, and R. E. Christensen. 1993. Keratinocyte expression of calprotectin in oral inflammatory mucosal diseases. J Oral Pathol Med 22:303. 415. Coleman, N., and M. A. Stanley. 1994. Expression of the myelomonocytic antigens CD36 and L1 by keratinocytes in squamous intraepithelial lesions of the cervix. Hum Pathol 25:73. 416. Voganatsi, A., A. Panyutich, K. T. Miyasaki, and R. K. Murthy. 2001. Mechanism of extracellular release of human neutrophil calprotectin complex. J Leukoc Biol 70:130. 417. Lusitani, D., S. E. Malawista, and R. R. Montgomery. 2003. Calprotectin, an abundant cytosolic protein from human polymorphonuclear leukocytes, inhibits the growth of Borrelia burgdorferi. Infect Immun 71:4711. 418. Zhang, X., and D. M. Mosser. 2008. Macrophage activation by endogenous danger signals. J Pathol 214:161. 419. Schweyer, S., B. Hemmerlein, H. J. Radzun, and A. Fayyazi. 2000. Continuous recruitment, co- expression of tumour necrosis factor-alpha and matrix metalloproteinases, and apoptosis of macrophages in gout tophi. Virchows Arch 437:534. 420. Gordon, S. 2007. The macrophage: past, present and future. Eur J Immunol 37 Suppl 1:S9.

261 421. Goebeler, M., J. Roth, F. Burwinkel, E. Vollmer, W. Bocker, and C. Sorg. 1994. Expression and complex formation of S100-like proteins MRP8 and MRP14 by macrophages during renal allograft rejection. Transplantation 58:355. 422. Postler, E., A. Lehr, H. Schluesener, and R. Meyermann. 1997. Expression of the S-100 proteins MRP-8 and -14 in ischemic brain lesions. Glia 19:27. 423. Hoyal, C. R., J. Giron-Calle, and H. J. Forman. 1998. The alveolar macrophage as a model of in oxidative stress. J Toxicol Environ Health B Crit Rev 1:117. 424. Mosmann, T. R., and R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol 7:145. 425. Mosmann, T. R., and R. L. Coffman. 1989. Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adv Immunol 46:111. 426. Gordon, S. 2003. Alternative activation of macrophages. Nat Rev Immunol 3:23. 427. Lucey, D. R., M. Clerici, and G. M. Shearer. 1996. Type 1 and type 2 cytokine dysregulation in human infectious, neoplastic, and inflammatory diseases. Clin Microbiol Rev 9:532. 428. Goerdt, S., and C. E. Orfanos. 1999. Other functions, other genes: alternative activation of antigen-presenting cells. Immunity 10:137. 429. Duffield, J. S. 2003. The inflammatory macrophage: a story of Jekyll and Hyde. Clin Sci (Lond) 104:27. 430. Mantovani, A., A. Sica, and M. Locati. 2005. Macrophage polarization comes of age. Immunity 23:344. 431. Mills, C. D., K. Kincaid, J. M. Alt, M. J. Heilman, and A. M. Hill. 2000. M-1/M-2 macrophages and the Th1/Th2 paradigm. J Immunol 164:6166. 432. Mantovani, A., S. Sozzani, M. Locati, P. Allavena, and A. Sica. 2002. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 23:549. 433. Martinez, F. O., A. Sica, A. Mantovani, and M. Locati. 2008. Macrophage activation and polarization. Front Biosci 13:453. 434. Adams, D. O. 1989. Molecular interactions in macrophage activation. Immunol Today 10:33. 435. Stein, M., S. Keshav, N. Harris, and S. Gordon. 1992. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med 176:287. 436. Sutterwala, F. S., G. J. Noel, P. Salgame, and D. M. Mosser. 1998. Reversal of proinflammatory responses by ligating the macrophage Fcgamma receptor type I. J Exp Med 188:217. 437. Bowie, A., and L. A. O'Neill. 2000. Oxidative stress and nuclear factor-kappaB activation: a reassessment of the evidence in the light of recent discoveries. Biochem Pharmacol 59:13. 438. Anderson, C. F., and D. M. Mosser. 2002. A novel phenotype for an activated macrophage: the type 2 activated macrophage. J Leukoc Biol 72:101. 439. Mosser, D. M. 2003. The many faces of macrophage activation. J Leukoc Biol 73:209. 440. Stadelmann, W. K., A. G. Digenis, and G. R. Tobin. 1998. Physiology and healing dynamics of chronic cutaneous wounds. Am J Surg 176:26S. 441. Zeisberg, M., F. Strutz, and G. A. Muller. 2000. Role of fibroblast activation in inducing interstitial fibrosis. J Nephrol 13 Suppl 3:S111. 442. Ritchlin, C. 2000. Fibroblast biology. Effector signals released by the synovial fibroblast in arthritis. Arthritis Res 2:356. 443. Jones, S. A., F. McArdle, C. I. Jack, and M. J. Jackson. 1999. Effect of antioxidant supplementation on the adaptive response of human skin fibroblasts to UV-induced oxidative stress. Redox Rep 4:291. 444. Hogaboam, C. M., M. L. Steinhauser, S. W. Chensue, and S. L. Kunkel. 1998. Novel roles for chemokines and fibroblasts in interstitial fibrosis. Kidney Int 54:2152. 445. Konttinen, Y. T., T. F. Li, M. Hukkanen, J. Ma, J. W. Xu, and I. Virtanen. 2000. Fibroblast biology. Signals targeting the synovial fibroblast in arthritis. Arthritis Res 2:348. 446. Marionnet, C., F. Bernerd, A. Dumas, F. Verrecchia, K. Mollier, D. Compan, B. Bernard, M. Lahfa, J. Leclaire, C. Medaisko, B. Mehul, S. Seite, A. Mauviel, and L. Dubertret. 2003. Modulation of gene expression induced in human epidermis by environmental stress in vivo. J Invest Dermatol 121:1447. 447. Zhang, H. Y., M. Gharaee-Kermani, and S. H. Phan. 1997. Regulation of lung fibroblast alpha- smooth muscle actin expression, contractile phenotype, and apoptosis by IL-1beta. J Immunol 158:1392. 448. Maltseva, O., P. Folger, D. Zekaria, S. Petridou, and S. K. Masur. 2001. Fibroblast growth factor reversal of the corneal myofibroblast phenotype. Invest Ophthalmol Vis Sci 42:2490.

262 449. Mattey, D. L., P. T. Dawes, N. B. Nixon, and H. Slater. 1997. Transforming growth factor beta 1 and interleukin 4 induced alpha smooth muscle actin expression and myofibroblast-like differentiation in human synovial fibroblasts in vitro: modulation by basic fibroblast growth factor. Ann Rheum Dis 56:426. 450. Bodo, M., P. Carinci, T. Baroni, C. Bellucci, M. Giammarioli, F. Pezzetti, and E. Becchetti. 1998. Role of growth factors on extracellular matrix production by chick embryo fibroblasts in vitro. Antagonist effect of TGF-beta through the control of IL-1 and IL-1Ra secretion. Cytokine 10:353. 451. Papetti, M., J. Shujath, K. N. Riley, and I. M. Herman. 2003. FGF-2 antagonizes the TGF-beta1- mediated induction of pericyte alpha-smooth muscle actin expression: a role for myf-5 and Smad-mediated signaling pathways. Invest Ophthalmol Vis Sci 44:4994. 452. Zhang, T., T. L. Woods, and J. T. Elder. 2002. Differential responses of S100A2 to oxidative stress and increased intracellular calcium in normal, immortalized, and malignant human keratinocytes. J Invest Dermatol 119:1196. 453. Deshpande, R., T. L. Woods, J. Fu, T. Zhang, S. W. Stoll, and J. T. Elder. 2000. Biochemical characterization of S100A2 in human keratinocytes: subcellular localization, dimerization, and oxidative cross-linking. J Invest Dermatol 115:477. 454. Nickoloff, B. J., and L. A. Turka. 1993. Keratinocytes: key immunocytes of the integument. Am J Pathol 143:325. 455. Madsen, P., H. H. Rasmussen, H. Leffers, B. Honore, and J. E. Celis. 1992. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid- binding proteins. J Invest Dermatol 99:299. 456. Thorey, I. S., J. Roth, J. Regenbogen, J. P. Halle, M. Bittner, T. Vogl, S. Kaesler, P. Bugnon, B. Reitmaier, S. Durka, A. Graf, M. Wockner, N. Rieger, A. Konstantinow, E. Wolf, A. Goppelt, and S. Werner. 2001. The Ca2+-binding proteins S100A8 and S100A9 are encoded by novel injury-regulated genes. J Biol Chem 276:35818. 457. Gabrielsen, T. O., I. Dale, P. Brandtzaeg, P. S. Hoel, M. K. Fagerhol, T. E. Larsen, and P. O. Thune. 1986. Epidermal and dermal distribution of a myelomonocytic antigen (L1) shared by epithelial cells in various inflammatory skin diseases. J Am Acad Dermatol 15:173. 458. Saintigny, G., R. Schmidt, B. Shroot, L. Juhlin, U. Reichert, and S. Michel. 1992. Differential expression of calgranulin A and B in various epithelial cell lines and reconstructed epidermis. J Invest Dermatol 99:639. 459. Mantovani, A., F. Bussolino, and E. Dejana. 1992. Cytokine regulation of endothelial cell function. Faseb J 6:2591. 460. Introna, M., F. Colotta, S. Sozzani, E. Dejana, and A. Mantovani. 1994. Pro- and anti- inflammatory cytokines: interactions with vascular endothelium. Clin Exp Rheumatol 12 Suppl 10:S19. 461. Diaz-Flores, L., R. Gutierrez, and H. Varela. 1994. Angiogenesis: an update. Histol Histopathol 9:807. 462. Mantovani, A., and E. Dejana. 1989. Cytokines as communication signals between leukocytes and endothelial cells. Immunol Today 10:370. 463. Roth, J., M. Goebeler, C. van den Bos, and C. Sorg. 1993. Expression of calcium-binding proteins MRP8 and MRP14 is associated with distinct monocytic differentiation pathways in HL-60 cells. Biochem Biophys Res Commun 191:565. 464. Bresnihan, B., G. Cunnane, P. Youssef, G. Yanni, O. Fitzgerald, and D. Mulherin. 1998. Microscopic measurement of synovial membrane inflammation in rheumatoid arthritis: proposals for the evaluation of tissue samples by quantitative analysis. Br J Rheumatol 37:636. 465. Bjerke, K., T. S. Halstensen, F. Jahnsen, K. Pulford, and P. Brandtzaeg. 1993. Distribution of macrophages and granulocytes expressing L1 protein (calprotectin) in human Peyer's patches compared with normal ileal lamina propria and mesenteric lymph nodes. Gut 34:1357. 466. Katz, A. B., and L. B. Taichman. 1999. A partial catalog of proteins secreted by epidermal keratinocytes in culture. J Invest Dermatol 112:818. 467. Frosch, M., A. Strey, T. Vogl, N. M. Wulffraat, W. Kuis, C. Sunderkotter, E. Harms, C. Sorg, and J. Roth. 2000. Myeloid-related proteins 8 and 14 are specifically secreted during interaction of phagocytes and activated endothelium and are useful markers for monitoring disease activity in pauciarticular-onset juvenile rheumatoid arthritis. Arthritis Rheum 43:628. 468. Roth, J., S. Teigelkamp, M. Wilke, L. Grun, B. Tummler, and C. Sorg. 1992. Complex pattern of the myelo-monocytic differentiation antigens MRP8 and MRP14 during chronic airway inflammation. Immunobiology 186:304.

263 469. Ryckman, C., C. Gilbert, R. de Medicis, A. Lussier, K. Vandal, and P. A. Tessier. 2004. Monosodium urate monohydrate crystals induce the release of the proinflammatory protein S100A8/A9 from neutrophils. J Leukoc Biol 76:433. 470. Murao, S., F. Collart, and E. Huberman. 1990. A protein complex expressed during terminal differentiation of monomyelocytic cells is an inhibitor of cell growth. Cell Growth Differ 1:447. 471. Rubartelli, A., F. Cozzolino, M. Talio, and R. Sitia. 1990. A novel secretory pathway for interleukin-1 beta, a protein lacking a signal sequence. Embo J 9:1503. 472. Myers, M. A., A. Fleck, B. Sampson, C. M. Colley, J. Bent, and G. Hall. 1984. Early plasma protein and mineral changes after surgery: a two stage process. J Clin Pathol 37:862. 473. Sampson, B., M. K. Fagerhol, C. Sunderkotter, B. E. Golden, P. Richmond, N. Klein, I. Z. Kovar, J. H. Beattie, B. Wolska-Kusnierz, Y. Saito, and J. Roth. 2002. Hyperzincaemia and hypercalprotectinaemia: a new disorder of zinc metabolism. Lancet 360:1742. 474. Pillay, S. N., J. R. Asplin, and F. L. Coe. 1998. Evidence that calgranulin is produced by kidney cells and is an inhibitor of calcium oxalate crystallization. Am J Physiol 275:F255. 475. Dale, I. 1990. Plasma levels of the calcium-binding L1 leukocyte protein: standardization of blood collection and evaluation of reference intervals in healthy controls. Scand J Clin Lab Invest 50:837. 476. Sander, J., M. K. Fagerhol, J. S. Bakken, and I. Dale. 1984. Plasma levels of the leucocyte L1 protein in febrile conditions: relation to aetiology, number of leucocytes in blood, blood sedimentation reaction and C-reactive protein. Scand J Clin Lab Invest 44:357. 477. Striz, I., M. Jaresova, J. Lacha, J. Sedlacek, and S. Vitko. 2001. MRP 8/14 and procalcitonin serum levels in organ transplantations. Ann Transplant 6:6. 478. Muller, F., S. S. Froland, P. Aukrust, and M. K. Fagerhol. 1994. Elevated serum calprotectin levels in HIV-infected patients: the calprotectin response during ZDV treatment is associated with clinical events. J Acquir Immune Defic Syndr 7:931. 479. Berner Berntzen, H., G. K. Endresen, M. K. Fagerhol, J. Spiechowicz, and P. Mowinckel. 1991. Calprotectin (the L1 protein) during surgery in patients with rheumatoid arthritis. Scand J Clin Lab Invest 51:643. 480. Berntzen, H. B., U. Olmez, M. K. Fagerhol, and E. Munthe. 1991. The leukocyte protein L1 in plasma and synovial fluid from patients with rheumatoid arthritis and osteoarthritis. Scand J Rheumatol 20:74. 481. Berntzen, H. B., M. K. Fagerhol, M. Ostensen, P. Mowinckel, and H. M. Hoyeraal. 1991. The L1 protein as a new indicator of inflammatory activity in patients with juvenile rheumatoid arthritis. J Rheumatol 18:133. 482. Haga, H. J., J. G. Brun, H. B. Berntzen, R. Cervera, M. Khamashta, and G. R. Hughes. 1993. Calprotectin in patients with systemic lupus erythematosus: relation to clinical and laboratory parameters of disease activity. Lupus 2:47. 483. Lugering, N., R. Stoll, T. Kucharzik, K. W. Schmid, G. Rohlmann, G. Burmeister, C. Sorg, and W. Domschke. 1995. Immunohistochemical distribution and serum levels of the Ca(2+)-binding proteins MRP8, MRP14 and their heterodimeric form MRP8/14 in Crohn's disease. Digestion 56:406. 484. Lugering, N., R. Stoll, K. W. Schmid, T. Kucharzik, H. Stein, G. Burmeister, C. Sorg, and W. Domschke. 1995. The myeloic related protein MRP8/14 (27E10 antigen)--usefulness as a potential marker for disease activity in ulcerative colitis and putative biological function. Eur J Clin Invest 25:659. 485. Golden, B. E., P. A. Clohessy, G. Russell, and M. K. Fagerhol. 1996. Calprotectin as a marker of inflammation in cystic fibrosis. Arch Dis Child 74:136. 486. Hirono, K., D. Foell, Y. Xing, S. Miyagawa-Tomita, F. Ye, M. Ahlmann, T. Vogl, T. Futatani, C. Rui, X. Yu, K. Watanabe, S. Wanatabe, S. Tsubata, K. Uese, I. Hashimoto, F. Ichida, M. Nakazawa, J. Roth, and T. Miyawaki. 2006. Expression of myeloid-related protein-8 and -14 in patients with acute Kawasaki disease. J Am Coll Cardiol 48:1257. 487. Garred, P., E. Fosse, M. K. Fagerhol, V. Videm, and T. E. Mollnes. 1993. Calprotectin and complement activation during major operations with or without cardiopulmonary bypass. Ann Thorac Surg 55:694. 488. Semb, A. G., T. O. Gabrielsen, T. S. Halstensen, M. K. Fagerhol, P. Brandtzaeg, and J. Vaage. 1991. Cardiac surgery and distribution of the leukocyte L1 protein-calprotectin. Eur J Cardiothorac Surg 5:363. 489. Ikemoto, M., T. Tanaka, Y. Takai, H. Murayama, K. Tanaka, and M. Fujita. 2003. New ELISA system for myeloid-related protein complex (MRP8/14) and its clinical significance as a

264 sensitive marker for inflammatory responses associated with transplant rejection. Clin Chem 49:594. 490. Dunlop, O., J. N. Bruun, B. Myrvang, and M. K. Fagerhol. 1991. Calprotectin in cerebrospinal fluid of the HIV infected: a diagnostic marker of opportunistic central nervous system infection? Scand J Infect Dis 23:687. 491. Cuida, M., J. G. Brun, T. Tynning, and R. Jonsson. 1995. Calprotectin levels in oral fluids: the importance of collection site. Eur J Oral Sci 103:8. 492. Brun, J. G., M. Cuida, H. Jacobsen, R. Kloster, A. C. Johannesen, H. M. Hoyeraal, and R. Jonsson. 1994. Sjogren's syndrome in inflammatory rheumatic diseases: analysis of the leukocyte protein calprotectin in plasma and saliva. Scand J Rheumatol 23:114. 493. Muller, F., S. S. Froland, P. Brandtzaeg, and M. K. Fagerhol. 1993. Oral candidiasis is associated with low levels of parotid calprotectin in individuals with infection due to human immunodeficiency virus. Clin Infect Dis 16:301. 494. Holt, J., M. K. Fagerhol, and I. Dale. 1983. Quantitation of a leukocyte protein (L1) in urine. Acta Paediatr Scand 72:615. 495. Roseth, A. G., M. K. Fagerhol, E. Aadland, and H. Schjonsby. 1992. Assessment of the neutrophil dominating protein calprotectin in feces. A methodologic study. Scand J Gastroenterol 27:793. 496. Roseth, A. G., J. Kristinsson, M. K. Fagerhol, H. Schjonsby, E. Aadland, K. Nygaard, and B. Roald. 1993. Faecal calprotectin: a novel test for the diagnosis of colorectal cancer? Scand J Gastroenterol 28:1073. 497. Gilbert, J. A., D. A. Ahlquist, D. W. Mahoney, A. R. Zinsmeister, J. Rubin, and R. D. Ellefson. 1996. Fecal marker variability in colorectal cancer: calprotectin versus hemoglobin. Scand J Gastroenterol 31:1001. 498. Gebhardt, C., J. Nemeth, P. Angel, and J. Hess. 2006. S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol 72:1622. 499. Foell, D., M. Frosch, C. Sorg, and J. Roth. 2004. Phagocyte-specific calcium-binding S100 proteins as clinical laboratory markers of inflammation. Clin Chim Acta 344:37. 500. Wang, G., S. Zhang, D. G. Fernig, M. Martin-Fernandez, P. S. Rudland, and R. Barraclough. 2005. Mutually antagonistic actions of S100A4 and S100A1 on normal and metastatic phenotypes. Oncogene 24:1445. 501. Siegenthaler, G., K. Roulin, D. Chatellard-Gruaz, R. Hotz, J. H. Saurat, U. Hellman, and G. Hagens. 1997. A heterocomplex formed by the calcium-binding proteins MRP8 (S100A8) and MRP14 (S100A9) binds unsaturated fatty acids with high affinity. J Biol Chem 272:9371. 502. Roth, J., F. Burwinkel, C. van den Bos, M. Goebeler, E. Vollmer, and C. Sorg. 1993. MRP8 and MRP14, S-100-like proteins associated with myeloid differentiation, are translocated to plasma membrane and intermediate filaments in a calcium-dependent manner. Blood 82:1875. 503. Berthier, S., M. H. Paclet, S. Lerouge, F. Roux, S. Vergnaud, A. W. Coleman, and F. Morel. 2003. Changing the conformation state of cytochrome b558 initiates NADPH oxidase activation: MRP8/MRP14 regulation. J Biol Chem 278:25499. 504. Kuwayama, A., R. Kuruto, N. Horie, K. Takeishi, and R. Nozawa. 1993. Appearance of nuclear factors that interact with genes for myeloid calcium binding proteins (MRP-8 and MRP-14) in differentiated HL-60 cells. Blood 81:3116. 505. Kerkhoff, C., C. Sorg, N. N. Tandon, and W. Nacken. 2001. Interaction of S100A8/S100A9- arachidonic acid complexes with the scavenger receptor CD36 may facilitate fatty acid uptake by endothelial cells. Biochemistry 40:241. 506. Viemann, D., K. Barczyk, T. Vogl, U. Fischer, C. Sunderkotter, K. Schulze-Osthoff, and J. Roth. 2007. MRP8/MRP14 impairs endothelial integrity and induces a caspase-dependent and - independent cell death program. Blood 109:2453. 507. Viemann, D., A. Strey, A. Janning, K. Jurk, K. Klimmek, T. Vogl, K. Hirono, F. Ichida, D. Foell, B. Kehrel, V. Gerke, C. Sorg, and J. Roth. 2005. Myeloid-related proteins 8 and 14 induce a specific inflammatory response in human microvascular endothelial cells. Blood 105:2955. 508. Heizmann, C. W., and W. Hunziker. 1991. Intracellular calcium-binding proteins: more sites than insights. Trends Biochem Sci 16:98. 509. Sengelov, H., L. Kjeldsen, M. S. Diamond, T. A. Springer, and N. Borregaard. 1993. Subcellular localization and dynamics of Mac-1 (alpha m beta 2) in human neutrophils. J Clin Invest 92:1467. 510. Airaksinen, M. S., J. Eilers, O. Garaschuk, H. Thoenen, A. Konnerth, and M. Meyer. 1997. Ataxia and altered dendritic calcium signaling in mice carrying a targeted null mutation of the calbindin D28k gene. Proc Natl Acad Sci U S A 94:1488.

265 511. Xiong, Z., D. O'Hanlon, L. E. Becker, J. Roder, J. F. MacDonald, and A. Marks. 2000. Enhanced calcium transients in glial cells in neonatal cerebellar cultures derived from S100B null mice. Exp Cell Res 257:281. 512. Klempt, M., H. Melkonyan, W. Nacken, D. Wiesmann, U. Holtkemper, and C. Sorg. 1997. The heterodimer of the Ca2+-binding proteins MRP8 and MRP14 binds to arachidonic acid. FEBS Lett 408:81. 513. Kerkhoff, C., M. Klempt, V. Kaever, and C. Sorg. 1999. The two calcium-binding proteins, S100A8 and S100A9, are involved in the metabolism of arachidonic acid in human neutrophils. J Biol Chem 274:32672. 514. Kerkhoff, C., T. Vogl, W. Nacken, C. Sopalla, and C. Sorg. 1999. Zinc binding reverses the calcium-induced arachidonic acid-binding capacity of the S100A8/A9 protein complex. FEBS Lett 460:134. 515. Sopalla, C., N. Leukert, C. Sorg, and C. Kerkhoff. 2002. Evidence for the involvement of the unique C-tail of S100A9 in the binding of arachidonic acid to the heterocomplex S100A8/A9. Biol Chem 383:1895. 516. Roulin, K., G. Hagens, R. Hotz, J. H. Saurat, J. H. Veerkamp, and G. Siegenthaler. 1999. The fatty acid-binding heterocomplex FA-p34 formed by S100A8 and S100A9 is the major fatty acid carrier in neutrophils and translocates from the cytosol to the membrane upon stimulation. Exp Cell Res 247:410. 517. Hazan, I., R. Dana, Y. Granot, and R. Levy. 1997. Cytosolic phospholipase A2 and its mode of activation in human neutrophils by opsonized zymosan. Correlation between 42/44 kDa mitogen-activated protein kinase, cytosolic phospholipase A2 and NADPH oxidase. Biochem J 326 ( Pt 3):867. 518. Veerkamp, J. H. 1995. Fatty acid transport and fatty acid-binding proteins. Proc Nutr Soc 54:23. 519. Harmon, C. M., and N. A. Abumrad. 1993. Binding of sulfosuccinimidyl fatty acids to adipocyte membrane proteins: isolation and amino-terminal sequence of an 88-kD protein implicated in transport of long-chain fatty acids. J Membr Biol 133:43. 520. Abumrad, N. A., M. R. el-Maghrabi, E. Z. Amri, E. Lopez, and P. A. Grimaldi. 1993. Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation. Homology with human CD36. J Biol Chem 268:17665. 521. Feinmark, S. J., and P. J. Cannon. 1986. Endothelial cell leukotriene C4 synthesis results from intercellular transfer of leukotriene A4 synthesized by polymorphonuclear leukocytes. J Biol Chem 261:16466. 522. Gerritsen, M. E. 1996. Physiological and pathophysiological roles of eicosanoids in the microcirculation. Cardiovasc Res 32:720. 523. Maclouf, J. A., and R. C. Murphy. 1988. Transcellular metabolism of neutrophil-derived leukotriene A4 by human platelets. A potential cellular source of leukotriene C4. J Biol Chem 263:174. 524. Serhan, C. N., J. Z. Haeggstrom, and C. C. Leslie. 1996. Lipid mediator networks in cell signaling: update and impact of cytokines. Faseb J 10:1147. 525. Warner-Bartnicki, A. L., S. Murao, F. R. Collart, and E. Huberman. 1993. Regulated expression of the MRP8 and MRP14 genes in human promyelocyticleukemic HL-60 cells treated with the differentiation-inducing agents mycophenolic acid and 1 alpha,25-dihydroxyvitamin D3. Exp Cell Res 204:241. 526. DiSepio, D., M. Malhotra, R. A. Chandraratna, and S. Nagpal. 1997. Retinoic acid receptor- nuclear factor-interleukin 6 antagonism. A novel mechanism of retinoid-dependent inhibition of a keratinocyte hyperproliferative differentiation marker. J Biol Chem 272:25555. 527. Klempt, M., H. Melkonyan, H. A. Hofmann, I. Eue, and C. Sorg. 1998. The transcription factors c-myb and C/EBP alpha regulate the monocytic/myeloic gene MRP14. Immunobiology 199:148. 528. Lodie, T. A., R. Savedra, Jr., D. T. Golenbock, C. P. Van Beveren, R. A. Maki, and M. J. Fenton. 1997. Stimulation of macrophages by lipopolysaccharide alters the phosphorylation state, conformation, and function of PU.1 via activation of casein kinase II. J Immunol 158:1848. 529. Koike, T., K. Kondo, T. Makita, K. Kajiyama, T. Yoshida, and M. Morikawa. 1998. Intracellular localization of migration inhibitory factor-related protein (MRP) and detection of cell surface MRP binding sites on human leukemia cell lines. J Biochem 123:1079. 530. Schweyer, S., and A. Fayyazi. 2002. Activation and apoptosis of macrophages in cat scratch disease. J Pathol 198:534.

266 531. Lichanska, A. M., C. M. Browne, G. W. Henkel, K. M. Murphy, M. C. Ostrowski, S. R. McKercher, R. A. Maki, and D. A. Hume. 1999. Differentiation of the mononuclear phagocyte system during mouse embryogenesis: the role of transcription factor PU.1. Blood 94:127. 532. Brandon, J. M. 1993. Leucocyte distribution in the uterus during the preimplantation period of pregnancy and phagocyte recruitment to sites of blastocyst attachment in mice. J Reprod Fertil 98:567. 533. McMaster, M. T., S. K. Dey, and G. K. Andrews. 1993. Association of monocytes and neutrophils with early events of blastocyst implantation in mice. J Reprod Fertil 99:561. 534. Orlando-Mathur, C. E., and T. G. Kennedy. 1993. An investigation into the role of neutrophils in decidualization and early pregnancy in the rat. Biol Reprod 48:1258. 535. Springer, T. A. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301. 536. Lemarchand, P., M. Vaglio, J. Mauel, and M. Markert. 1992. Translocation of a small cytosolic calcium-binding protein (MRP-8) to plasma membrane correlates with human neutrophil activation. J Biol Chem 267:19379. 537. Lominadze, G., M. J. Rane, M. Merchant, J. Cai, R. A. Ward, and K. R. McLeish. 2005. Myeloid-related protein-14 is a p38 MAPK substrate in human neutrophils. J Immunol 174:7257. 538. Mueller, A., T. Bachi, M. Hochli, B. W. Schafer, and C. W. Heizmann. 1999. Subcellular distribution of S100 proteins in tumor cells and their relocation in response to calcium activation. Histochem Cell Biol 111:453. 539. Davey, G. E., P. Murmann, M. Hoechli, T. Tanaka, and C. W. Heizmann. 2000. Calcium- dependent translocation of S100A11 requires tubulin filaments. Biochim Biophys Acta 1498:220. 540. Hsieh, H. L., B. W. Schafer, J. A. Cox, and C. W. Heizmann. 2002. S100A13 and S100A6 exhibit distinct translocation pathways in endothelial cells. J Cell Sci 115:3149. 541. Nauseef, W. M. 2004. Assembly of the phagocyte NADPH oxidase. Histochem Cell Biol 122:277. 542. Vignais, P. V. 2002. The superoxide-generating NADPH oxidase: structural aspects and activation mechanism. Cell Mol Life Sci 59:1428. 543. DeLeo, F. R., J. B. Burritt, L. Yu, A. J. Jesaitis, M. C. Dinauer, and W. M. Nauseef. 2000. Processing and maturation of flavocytochrome b558 include incorporation of heme as a prerequisite for heterodimer assembly. J Biol Chem 275:13986. 544. Cross, A. R., and A. W. Segal. 2004. The NADPH oxidase of professional phagocytes-- prototype of the NOX electron transport chain systems. Biochim Biophys Acta 1657:1. 545. Lambeth, J. D. 2002. Nox/Duox family of nicotinamide adenine dinucleotide (phosphate) oxidases. Curr Opin Hematol 9:11. 546. Koshkin, V., O. Lotan, and E. Pick. 1996. The cytosolic component p47(phox) is not a sine qua non participant in the activation of NADPH oxidase but is required for optimal superoxide production. J Biol Chem 271:30326. 547. Freeman, J. L., and J. D. Lambeth. 1996. NADPH oxidase activity is independent of p47phox in vitro. J Biol Chem 271:22578. 548. Paclet, M. H., A. W. Coleman, S. Vergnaud, and F. Morel. 2000. P67-phox-mediated NADPH oxidase assembly: imaging of cytochrome b558 liposomes by atomic force microscopy. Biochemistry 39:9302. 549. Dana, R., T. L. Leto, H. L. Malech, and R. Levy. 1998. Essential requirement of cytosolic phospholipase A2 for activation of the phagocyte NADPH oxidase. J Biol Chem 273:441. 550. Doussiere, J., F. Bouzidi, A. Poinas, J. Gaillard, and P. V. Vignais. 1999. Kinetic study of the activation of the neutrophil NADPH oxidase by arachidonic acid. Antagonistic effects of arachidonic acid and phenylarsine oxide. Biochemistry 38:16394. 551. Doussiere, J., F. Bouzidi, and P. V. Vignais. 2001. A phenylarsine oxide-binding protein of neutrophil cytosol, which belongs to the S100 family, potentiates NADPH oxidase activation. Biochem Biophys Res Commun 285:1317. 552. Doussiere, J., F. Bouzidi, and P. V. Vignais. 2002. The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils. Eur J Biochem 269:3246. 553. Kerkhoff, C., W. Nacken, M. Benedyk, M. C. Dagher, C. Sopalla, and J. Doussiere. 2005. The arachidonic acid-binding protein S100A8/A9 promotes NADPH oxidase activation by interaction with p67phox and Rac-2. Faseb J 19:467. 554. Paclet, M. H., S. Berthier, L. Kuhn, J. Garin, and F. Morel. 2007. Regulation of phagocyte NADPH oxidase activity: identification of two cytochrome b558 activation states. Faseb J 21:1244.

267 555. Nacken, W., F. C. Mooren, M. P. Manitz, G. Bode, C. Sorg, and C. Kerkhoff. 2005. S100A9 deficiency alters adenosine-5'-triphosphate induced calcium signalling but does not generally interfere with calcium and zinc homeostasis in murine neutrophils. Int J Biochem Cell Biol 37:1241. 556. Geiszt, M., A. Kapus, and E. Ligeti. 2001. Chronic granulomatous disease: more than the lack of superoxide? J Leukoc Biol 69:191. 557. Eue, I., S. Konig, J. Pior, and C. Sorg. 2002. S100A8, S100A9 and the S100A8/A9 heterodimer complex specifically bind to human endothelial cells: identification and characterization of ligands for the myeloid-related proteins S100A9 and S100A8/A9 on human dermal microvascular endothelial cell line-1 cells. Int Immunol 14:287. 558. Boussac, M., and J. Garin. 2000. Calcium-dependent secretion in human neutrophils: a proteomic approach. Electrophoresis 21:665. 559. Taguchi, A., D. C. Blood, G. del Toro, A. Canet, D. C. Lee, W. Qu, N. Tanji, Y. Lu, E. Lalla, C. Fu, M. A. Hofmann, T. Kislinger, M. Ingram, A. Lu, H. Tanaka, O. Hori, S. Ogawa, D. M. Stern, and A. M. Schmidt. 2000. Blockade of RAGE-amphoterin signalling suppresses tumour growth and metastases. Nature 405:354. 560. Boyd, J. H., B. Kan, H. Roberts, Y. Wang, and K. R. Walley. 2008. S100A8 and S100A9 mediate endotoxin-induced cardiomyocyte dysfunction via the receptor for advanced glycation end products. Circ Res 102:1239. 561. Bours, M. J., E. L. Swennen, F. Di Virgilio, B. N. Cronstein, and P. C. Dagnelie. 2006. Adenosine 5'-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol Ther 112:358. 562. Koike, T., N. Harada, T. Yoshida, and M. Morikawa. 1992. Regulation of myeloid-specific calcium binding protein synthesis by cytosolic protein kinase C. J Biochem 112:624. 563. Nacken, W., C. Sorg, and C. Kerkhoff. 2004. The myeloid expressed EF-hand proteins display a diverse pattern of lipid raft association. FEBS Lett 572:289. 564. Dykstra, M., A. Cherukuri, H. W. Sohn, S. J. Tzeng, and S. K. Pierce. 2003. Location is everything: lipid rafts and immune cell signaling. Annu Rev Immunol 21:457. 565. Sohnle, P. G., C. Collins-Lech, and J. H. Wiessner. 1991. The zinc-reversible antimicrobial activity of neutrophil lysates and abscess fluid supernatants. J Infect Dis 164:137. 566. Clohessy, P. A., and B. E. Golden. 1995. Calprotectin-mediated zinc chelation as a biostatic mechanism in host defence. Scand J Immunol 42:551. 567. Nisapakultorn, K., K. F. Ross, and M. C. Herzberg. 2001. Calprotectin expression inhibits bacterial binding to mucosal epithelial cells. Infect Immun 69:3692. 568. Versieck, J., R. Cornelis, G. Lemey, and J. De Rudder. 1980. Determination of manganese in whole blood and serum. Clin Chem 26:531. 569. Yui, S., M. Mikami, and M. Yamazaki. 1995. Induction of apoptotic cell death in mouse lymphoma and human leukemia cell lines by a calcium-binding protein complex, calprotectin, derived from inflammatory peritoneal exudate cells. J Leukoc Biol 58:650. 570. Yui, S., M. Mikami, K. Tsurumaki, and M. Yamazaki. 1997. Growth-inhibitory and apoptosis- inducing activities of calprotectin derived from inflammatory exudate cells on normal fibroblasts: regulation by metal ions. J Leukoc Biol 61:50. 571. Seeliger, S., T. Vogl, I. H. Engels, J. M. Schroder, C. Sorg, C. Sunderkotter, and J. Roth. 2003. Expression of calcium-binding proteins MRP8 and MRP14 in inflammatory muscle diseases. Am J Pathol 163:947. 572. Yui, S., Y. Nakatani, M. J. Hunter, W. J. Chazin, and M. Yamazaki. 2002. Implication of extracellular zinc exclusion by recombinant human calprotectin (MRP8 and MRP14) from target cells in its apoptosis-inducing activity. Mediators Inflamm 11:165. 573. Baggiolini, M., B. Dewald, and B. Moser. 1994. Interleukin-8 and related chemotactic cytokines--CXC and CC chemokines. Adv Immunol 55:97. 574. Lackmann, M., C. J. Cornish, R. J. Simpson, R. L. Moritz, and C. L. Geczy. 1992. Purification and structural analysis of a murine chemotactic cytokine (CP-10) with sequence homology to S100 proteins. J Biol Chem 267:7499. 575. Passey, R. J., K. Xu, D. A. Hume, and C. L. Geczy. 1999. S100A8: emerging functions and regulation. J Leukoc Biol 66:549. 576. Ryckman, C., S. R. McColl, K. Vandal, R. de Medicis, A. Lussier, P. E. Poubelle, and P. A. Tessier. 2003. Role of S100A8 and S100A9 in neutrophil recruitment in response to monosodium urate monohydrate crystals in the air-pouch model of acute gouty arthritis. Arthritis Rheum 48:2310.

268 577. Ryckman, C., K. Vandal, P. Rouleau, M. Talbot, and P. A. Tessier. 2003. Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion. J Immunol 170:3233. 578. Vandal, K., P. Rouleau, A. Boivin, C. Ryckman, M. Talbot, and P. A. Tessier. 2003. Blockade of S100A8 and S100A9 suppresses neutrophil migration in response to lipopolysaccharide. J Immunol 171:2602. 579. Cohen-Hillel, E., I. Yron, T. Meshel, and A. Ben-Baruch. 2007. Interleukin 8 and cell migration to inflammatory sites: the regulation of focal adhesion kinase under conditions of migratory desensitization. Isr Med Assoc J 9:579. 580. Geczy, C. 1996. Regulation and proinflammatory properties of the chemotactic protein, CP-10. Biochim Biophys Acta 1313:246. 581. Nishimura, F., V. P. Terranova, T. Sawa, and Y. Murayama. 1999. Migration inhibitory factor related protein-8 (MRP-8) is an autocrine chemotactic factor for periodontal ligament cells. J Dent Res 78:1251. 582. Rouleau, P., K. Vandal, C. Ryckman, P. E. Poubelle, A. Boivin, M. Talbot, and P. A. Tessier. 2003. The calcium-binding protein S100A12 induces neutrophil adhesion, migration, and release from bone marrow in mouse at concentrations similar to those found in human inflammatory arthritis. Clin Immunol 107:46. 583. Sakaguchi, T., S. F. Yan, S. D. Yan, D. Belov, L. L. Rong, M. Sousa, M. Andrassy, S. P. Marso, S. Duda, B. Arnold, B. Liliensiek, P. P. Nawroth, D. M. Stern, A. M. Schmidt, and Y. Naka. 2003. Central role of RAGE-dependent neointimal expansion in arterial restenosis. J Clin Invest 111:959. 584. Erzurum, S. C., G. P. Downey, D. E. Doherty, B. Schwab, 3rd, E. L. Elson, and G. S. Worthen. 1992. Mechanisms of lipopolysaccharide-induced neutrophil retention. Relative contributions of adhesive and cellular mechanical properties. J Immunol 149:154. 585. Devery, J. M., N. J. King, and C. L. Geczy. 1994. Acute inflammatory activity of the S100 protein CP-10. Activation of neutrophils in vivo and in vitro. J Immunol 152:1888. 586. Kumar, R. K., C. A. Harrison, C. J. Cornish, M. Kocher, and C. L. Geczy. 1998. Immunodetection of the murine chemotactic protein CP-10 in bleomycin-induced pulmonary injury. Pathology 30:51. 587. Lau, W., J. M. Devery, and C. L. Geczy. 1995. A chemotactic S100 peptide enhances scavenger receptor and Mac-1 expression and cholesteryl ester accumulation in murine peritoneal macrophages in vivo. J Clin Invest 95:1957. 588. Lazoura, E., M. J. McLeish, and M. I. Aguilar. 2000. Studies on the conformational properties of CP-10(42-55), the hinge region of CP-10, using circular dichroism and RP-HPLC. J Pept Res 55:411. 589. Watt, K. W., I. L. Brightman, and E. J. Goetzl. 1983. Isolation of two polypeptides comprising the neutrophil-immobilizing factor of human leucocytes. Immunology 48:79. 590. Freemont, P., N. Hogg, and J. Edgeworth. 1989. Sequence identity. Nature 339:516. 591. Eue, I., B. Pietz, J. Storck, M. Klempt, and C. Sorg. 2000. Transendothelial migration of 27E10+ human monocytes. Int Immunol 12:1593. 592. Brun, J. G., E. Ulvestad, M. K. Fagerhol, and R. Jonsson. 1994. Effects of human calprotectin (L1) on in vitro immunoglobulin synthesis. Scand J Immunol 40:675. 593. Isaksen, B., and M. K. Fagerhol. 2001. Calprotectin inhibits matrix metalloproteinases by sequestration of zinc. Mol Pathol 54:289. 594. Page-McCaw, A., A. J. Ewald, and Z. Werb. 2007. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol 8:221. 595. Visse, R., and H. Nagase. 2003. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 92:827. 596. Ito, A., A. Mukaiyama, Y. Itoh, H. Nagase, I. B. Thogersen, J. J. Enghild, Y. Sasaguri, and Y. Mori. 1996. Degradation of interleukin 1beta by matrix metalloproteinases. J Biol Chem 271:14657. 597. Schonbeck, U., F. Mach, and P. Libby. 1998. Generation of biologically active IL-1 beta by matrix metalloproteinases: a novel caspase-1-independent pathway of IL-1 beta processing. J Immunol 161:3340. 598. Haro, H., H. C. Crawford, B. Fingleton, K. Shinomiya, D. M. Spengler, and L. M. Matrisian. 2000. Matrix metalloproteinase-7-dependent release of tumor necrosis factor-alpha in a model of herniated disc resorption. J Clin Invest 105:143. 599. Yong, H. Y., and A. Moon. 2007. Roles of calcium-binding proteins, S100A8 and S100A9, in invasive phenotype of human gastric cancer cells. Arch Pharm Res 30:75.

269 600. Kane, D., J. Roth, M. Frosch, T. Vogl, B. Bresnihan, and O. FitzGerald. 2003. Increased perivascular synovial membrane expression of myeloid-related proteins in psoriatic arthritis. Arthritis Rheum 48:1676. 601. Marnell, L., C. Mold, and T. W. Du Clos. 2005. C-reactive protein: ligands, receptors and role in inflammation. Clin Immunol 117:104. 602. Berger, D., E. Bolke, M. Seidelmann, and H. G. Beger. 1997. Time-scale of interleukin-6, myeloid related proteins (MRP), C reactive protein (CRP), and endotoxin plasma levels during the postoperative acute phase reaction. Shock 7:422. 603. Tibble, J. A., and I. Bjarnason. 2001. Fecal calprotectin as an index of intestinal inflammation. Drugs Today (Barc) 37:85. 604. Wulffraat, N. M., P. J. Haas, M. Frosch, I. M. De Kleer, T. Vogl, D. M. Brinkman, P. Quartier, J. Roth, and W. Kuis. 2003. Myeloid related protein 8 and 14 secretion reflects phagocyte activation and correlates with disease activity in juvenile idiopathic arthritis treated with autologous stem cell transplantation. Ann Rheum Dis 62:236. 605. Strasser, F., P. L. Gowland, and C. Ruef. 1997. Elevated serum macrophage inhibitory factor- related protein (MRP) 8/14 levels in advanced HIV infection and during disease exacerbation. J Acquir Immune Defic Syndr Hum Retrovirol 16:230. 606. Kojima, T., E. Andersen, J. C. Sanchez, M. R. Wilkins, D. F. Hochstrasser, W. F. Pralong, and G. Cimasoni. 2000. Human gingival crevicular fluid contains MRP8 (S100A8) and MRP14 (S100A9), two calcium-binding proteins of the S100 family. J Dent Res 79:740. 607. Lundy, F. T., R. Chalk, P. J. Lamey, C. Shaw, and G. J. Linden. 2000. Identification of MRP-8 (calgranulin A) as a major responsive protein in chronic periodontitis. J Pathol 192:540. 608. Marti, T., K. D. Erttmann, and M. Y. Gallin. 1996. Host-parasite interaction in human onchocerciasis: identification and sequence analysis of a novel human calgranulin. Biochem Biophys Res Commun 221:454. 609. Edgeworth, J. D., A. Abiose, and B. R. Jones. 1993. An immunohistochemical analysis of onchocercal nodules: evidence for an interaction between macrophage MRP8/MRP14 and adult Onchocerca volvulus. Clin Exp Immunol 92:84. 610. Pechkovsky, D. V., O. M. Zalutskaya, G. I. Ivanov, and N. I. Misuno. 2000. Calprotectin (MRP8/14 protein complex) release during mycobacterial infection in vitro and in vivo. FEMS Immunol Med Microbiol 29:27. 611. Lugering, N., R. Stoll, T. Kucharzik, G. Burmeister, C. Sorg, and W. Domschke. 1995. Serum 27E10 antigen: a new potential marker for staging HIV disease. Clin Exp Immunol 101:249. 612. Bordmann, G., G. Burmeister, S. Saladin, H. Urassa, S. Mwankyusye, N. Weiss, and M. Tanner. 1997. MRP 8/14 as marker for Plasmodium falciparum-induced malaria episodes in individuals in a holoendemic area. Clin Diagn Lab Immunol 4:435. 613. Sunderkotter, C., M. Kunz, K. Steinbrink, G. Meinardus-Hager, M. Goebeler, H. Bildau, and C. Sorg. 1993. Resistance of mice to experimental leishmaniasis is associated with more rapid appearance of mature macrophages in vitro and in vivo. J Immunol 151:4891. 614. Yang, T. H., S. Tzeng, I. Cheng, M. G. Burnett, Y. Yoshizawa, K. Fukuyama, S. C. Lee, and W. L. Epstein. 1997. Identification of the mouse calcium-binding proteins, MRP 8 and MRP 14, in Schistosoma mansoni-induced granulomas: biochemical and functional characterization. J Leukoc Biol 61:258. 615. Youssef, P., J. Roth, M. Frosch, P. Costello, O. Fitzgerald, C. Sorg, and B. Bresnihan. 1999. Expression of myeloid related proteins (MRP) 8 and 14 and the MRP8/14 heterodimer in rheumatoid arthritis synovial membrane. J Rheumatol 26:2523. 616. Foell, D., M. Frosch, A. Schulze zur Wiesch, T. Vogl, C. Sorg, and J. Roth. 2004. Methotrexate treatment in juvenile idiopathic arthritis: when is the right time to stop? Ann Rheum Dis 63:206. 617. Kuruto, R., R. Nozawa, K. Takeishi, K. Arai, T. Yokota, and Y. Takasaki. 1990. Myeloid calcium binding proteins: expression in the differentiated HL-60 cells and detection in sera of patients with connective tissue diseases. J Biochem 108:650. 618. Foell, D., J. Hernandez-Rodriguez, M. Sanchez, T. Vogl, M. C. Cid, and J. Roth. 2004. Early recruitment of phagocytes contributes to the vascular inflammation of giant cell arteritis. J Pathol 204:311. 619. Rastaldi, M. P., F. Ferrario, A. Crippa, G. Dell'Antonio, D. Casartelli, C. Grillo, and G. D'Amico. 2000. Glomerular monocyte-macrophage features in ANCA-positive renal vasculitis and cryoglobulinemic nephritis. J Am Soc Nephrol 11:2036. 620. Lawrance, I. C., C. Fiocchi, and S. Chakravarti. 2001. Ulcerative colitis and Crohn's disease: distinctive gene expression profiles and novel susceptibility candidate genes. Hum Mol Genet 10:445.

270 621. Buhling, F., A. Ittenson, D. Kaiser, G. Tholert, B. Hoffmann, D. Reinhold, S. Ansorge, and T. Welte. 2000. MRP8/MRP14, CD11b and HLA-DR expression of alveolar macrophages in pneumonia. Immunol Lett 71:185. 622. Barthe, C., C. Figarella, J. Carrere, and O. Guy-Crotte. 1991. Identification of 'cystic fibrosis protein' as a complex of two calcium-binding proteins present in human cells of myeloid origin. Biochim Biophys Acta 1096:175. 623. Du Chesne, A., R. Cecchi-Mureani, K. Puschel, and B. Brinkmann. 1996. Macrophage subtype patterns in protracted asphyxiation. Int J Legal Med 109:163. 624. Ahmad, A., D. L. Bayley, S. He, and R. A. Stockley. 2003. Myeloid related protein-8/14 stimulates interleukin-8 production in airway epithelial cells. Am J Respir Cell Mol Biol 29:523. 625. Schwab, J. M., T. D. Nguyen, E. Postler, R. Meyermann, and H. J. Schluesener. 2000. Selective accumulation of cyclooxygenase-1-expressing microglial cells/macrophages in lesions of human focal cerebral ischemia. Acta Neuropathol 99:609. 626. Schwab, J. M., T. D. Nguyen, R. Meyermann, and H. J. Schluesener. 2001. Human focal cerebral infarctions induce differential lesional interleukin-16 (IL-16) expression confined to infiltrating granulocytes, CD8+ T-lymphocytes and activated microglia/macrophages. J Neuroimmunol 114:232. 627. Bogumil, T., P. Rieckmann, B. Kubuschok, K. Felgenhauer, and W. Bruck. 1998. Serum levels of macrophage-derived protein MRP-8/14 are elevated in active multiple sclerosis. Neurosci Lett 247:195. 628. Bruck, W., N. Sommermeier, M. Bergmann, U. Zettl, H. H. Goebel, H. A. Kretzschmar, and H. Lassmann. 1996. Macrophages in multiple sclerosis. Immunobiology 195:588. 629. Kiefer, R., B. C. Kieseier, W. Bruck, H. P. Hartung, and K. V. Toyka. 1998. Macrophage differentiation antigens in acute and chronic autoimmune polyneuropathies. Brain 121 ( Pt 3):469. 630. Schluesener, H. J., P. G. Kremsner, and R. Meyermann. 1998. Widespread expression of MRP8 and MRP14 in human cerebral malaria by microglial cells. Acta Neuropathol 96:575. 631. Beschorner, R., S. Engel, M. Mittelbronn, D. Adjodah, K. Dietz, H. J. Schluesener, and R. Meyermann. 2000. Differential regulation of the monocytic calcium-binding peptides macrophage-inhibiting factor related protein-8 (MRP8/S100A8) and allograft inflammatory factor-1 (AIF-1) following human traumatic brain injury. Acta Neuropathol 100:627. 632. Engel, S., H. Schluesener, M. Mittelbronn, K. Seid, D. Adjodah, H. D. Wehner, and R. Meyermann. 2000. Dynamics of microglial activation after human traumatic brain injury are revealed by delayed expression of macrophage-related proteins MRP8 and MRP14. Acta Neuropathol 100:313. 633. Ito, Y., K. Arai, Ryushi, Nozawa, H. Yoshida, C. Tomoda, T. Uruno, A. Miya, K. Kobayashi, F. Matsuzuka, K. Kuma, K. Kakudo, and A. Miyauchi. 2005. S100A9 expression is significantly linked to dedifferentiation of thyroid carcinoma. Pathol Res Pract 201:551. 634. Dale, I., and P. Brandtzaeg. 1989. Expression of the epithelial L1 antigen as an immunohistochemical marker of squamous cell carcinoma of the lung. Histopathology 14:493. 635. Arai, K., T. Teratani, R. Nozawa, and T. Yamada. 2001. Immunohistochemical investigation of S100A9 expression in pulmonary adenocarcinoma: S100A9 expression is associated with tumor differentiation. Oncol Rep 8:591. 636. Stulik, J., K. Koupilova, J. Osterreicher, J. Knizek, A. Macela, J. Bures, P. Jandik, F. Langr, K. Dedic, and P. R. Jungblut. 1999. Protein abundance alterations in matched sets of macroscopically normal colon mucosa and colorectal carcinoma. Electrophoresis 20:3638. 637. Stulik, J., J. Osterreicher, K. Koupilova, Knizek, A. Macela, J. Bures, P. Jandik, F. Langr, K. Dedic, and P. R. Jungblut. 1999. The analysis of S100A9 and S100A8 expression in matched sets of macroscopically normal colon mucosa and colorectal carcinoma: the S100A9 and S100A8 positive cells underlie and invade tumor mass. Electrophoresis 20:1047. 638. Arai, K., T. Yamada, and R. Nozawa. 2000. Immunohistochemical investigation of migration inhibitory factor-related protein (MRP)-14 expression in hepatocellular carcinoma. Med Oncol 17:183. 639. Shen, J., M. D. Person, J. Zhu, J. L. Abbruzzese, and D. Li. 2004. Protein expression profiles in pancreatic adenocarcinoma compared with normal pancreatic tissue and tissue affected by pancreatitis as detected by two-dimensional gel electrophoresis and mass spectrometry. Cancer Res 64:9018. 640. Hemmerlein, B., A. Markus, M. Wehner, A. Kugler, F. Zschunke, and H. J. Radzum. 2000. Expression of acute and late-stage inflammatory antigens, c-fms, CSF-1, and human monocytic

271 serine esterase 1, in tumor-associated macrophages of renal cell carcinomas. Cancer Immunol Immunother 49:485. 641. Gromova, I., P. Gromov, and J. E. Celis. 1999. Identification of true differentially expressed mRNAs in a pair of human bladder transitional cell carcinomas using an improved differential display procedure. Electrophoresis 20:241. 642. Hermani, A., J. Hess, B. De Servi, S. Medunjanin, R. Grobholz, L. Trojan, P. Angel, and D. Mayer. 2005. Calcium-binding proteins S100A8 and S100A9 as novel diagnostic markers in human prostate cancer. Clin Cancer Res 11:5146. 643. Seth, A., R. Kitching, G. Landberg, J. Xu, J. Zubovits, and A. M. Burger. 2003. Gene expression profiling of ductal carcinomas in situ and invasive breast tumors. Anticancer Res 23:2043. 644. Ott, H. W., H. Lindner, B. Sarg, E. Mueller-Holzner, B. Abendstein, A. Bergant, S. Fessler, P. Schwaerzler, A. Zeimet, C. Marth, and K. Illmensee. 2003. Calgranulins in cystic fluid and serum from patients with ovarian carcinomas. Cancer Res 63:7507. 645. Brocker, E. B., G. Zwadlo, B. Holzmann, E. Macher, and C. Sorg. 1988. Inflammatory cell infiltrates in human melanoma at different stages of tumor progression. Int J Cancer 41:562. 646. Czarnetzki, B. M., G. Z. Zwadlo-Klarwasser, E. B. Brocker, and C. Sorg. 1990. Macrophage subsets in different types of urticaria. Arch Dermatol Res 282:93. 647. Kunz, M., U. Henseleit-Walter, C. Sorg, and G. Kolde. 1999. Macrophage marker 27E10 on human keratinocytes helps to differentiate discoid lupus erythematosus and Jessner's lymphocytic infiltration of the skin. Eur J Dermatol 9:107. 648. Sunderkotter, C. H., J. Tomimori-Yamashita, V. Nix, S. M. Maeda, A. Sindrilaru, M. Mariano, C. Sorg, and J. Roth. 2004. High expression of myeloid-related proteins 8 and 14 characterizes an inflammatorily active but ineffective response of macrophages during leprosy. Immunology 111:472. 649. Foell, D., F. Ichida, T. Vogl, X. Yu, R. Chen, T. Miyawaki, C. Sorg, and J. Roth. 2003. S100A12 (EN-RAGE) in monitoring Kawasaki disease. Lancet 361:1270. 650. Ye, F., D. Foell, K. I. Hirono, T. Vogl, C. Rui, X. Yu, S. Watanabe, K. Watanabe, K. Uese, I. Hashimoto, J. Roth, F. Ichida, and T. Miyawaki. 2004. Neutrophil-derived S100A12 is profoundly upregulated in the early stage of acute Kawasaki disease. Am J Cardiol 94:840. 651. Ebihara, T., R. Endo, H. Kikuta, N. Ishiguro, X. Ma, M. Shimazu, T. Otoguro, and K. Kobayashi. 2005. Differential gene expression of S100 protein family in leukocytes from patients with Kawasaki disease. Eur J Pediatr 164:427. 652. Arai, K., K. Mizuno, T. Yamada, and R. Nozawa. 1999. Immunohistochemical evaluation of MRP-14 expression in epithelioid granuloma using monoclonal antibody 60B8. J Investig Allergol Clin Immunol 9:21. 653. Aguiar-Passeti, T., E. Postol, C. Sorg, and M. Mariano. 1997. Epithelioid cells from foreign- body granuloma selectively express the calcium-binding protein MRP-14, a novel down- regulatory molecule of macrophage activation. J Leukoc Biol 62:852. 654. Umekawa, T., and T. Kurita. 1994. Calprotectin-like protein is related to soluble organic matrix in calcium oxalate urinary stone. Biochem Mol Biol Int 34:309. 655. Greitemann, B., B. Mues, J. Polster, T. Pauly, and C. Sorg. 1992. Inflammatory reactions in primary osteoarthritis of the hip and total hip prosthesis loosening. Arch Orthop Trauma Surg 111:138. 656. Boelke, E., M. Storck, K. Buttenschoen, D. Berger, and A. Hannekum. 2000. Endotoxemia and mediator release during cardiac surgery. Angiology 51:743. 657. Burkhardt, K., M. Radespiel-Troger, H. D. Rupprecht, M. Goppelt-Struebe, R. Riess, L. Renders, I. A. Hauser, and U. Kunzendorf. 2001. An increase in myeloid-related protein serum levels precedes acute renal allograft rejection. J Am Soc Nephrol 12:1947. 658. Brandtzaeg, P., T. O. Gabrielsen, I. Dale, F. Muller, M. Steinbakk, and M. K. Fagerhol. 1995. The leucocyte protein L1 (calprotectin): a putative nonspecific defence factor at epithelial surfaces. Adv Exp Med Biol 371A:201. 659. Kleinegger, C. L., D. C. Stoeckel, and Z. B. Kurago. 2001. A comparison of salivary calprotectin levels in subjects with and without oral candidiasis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 92:62. 660. Sweet, S. P., A. N. Denbury, and S. J. Challacombe. 2001. Salivary calprotectin levels are raised in patients with oral candidiasis or Sjogren's syndrome but decreased by HIV infection. Oral Microbiol Immunol 16:119. 661. Myint, M., S. Steinsvoll, Z. N. Yuan, B. Johne, K. Helgeland, and K. Schenck. 2002. Highly increased numbers of leukocytes in inflamed gingiva from patients with HIV infection. Aids 16:235.

272 662. Hashemi, F. B., J. Mollenhauer, L. D. Madsen, B. E. Sha, W. Nacken, M. B. Moyer, C. Sorg, and G. T. Spear. 2001. Myeloid-related protein (MRP)-8 from cervico-vaginal secretions activates HIV replication. Aids 15:441. 663. Ryan, J., and C. Geczy. 1987. Coagulation and the expression of cell-mediated immunity. Immunol Cell Biol 65 ( Pt 2):127. 664. Ryan, J., and C. L. Geczy. 1988. Macrophage procoagulant-inducing factor. In vivo properties and chemotactic activity for phagocytic cells. J Immunol 141:2110. 665. Frosch, M., T. Vogl, S. Seeliger, N. Wulffraat, W. Kuis, D. Viemann, D. Foell, C. Sorg, C. Sunderkotter, and J. Roth. 2003. Expression of myeloid-related proteins 8 and 14 in systemic- onset juvenile rheumatoid arthritis. Arthritis Rheum 48:2622. 666. Frosch, M., T. Vogl, R. Waldherr, C. Sorg, C. Sunderkotter, and J. Roth. 2004. Expression of MRP8 and MRP14 by macrophages is a marker for severe forms of glomerulonephritis. J Leukoc Biol 75:198. 667. Roseth, A. G., E. Aadland, J. Jahnsen, and N. Raknerud. 1997. Assessment of disease activity in ulcerative colitis by faecal calprotectin, a novel granulocyte marker protein. Digestion 58:176. 668. Fagerhol, M. K. 1996. Nomenclature for proteins: is calprotectin a proper name for the elusive myelomonocytic protein? Clin Mol Pathol 49:M74. 669. Carroccio, A., G. Iacono, M. Cottone, L. Di Prima, F. Cartabellotta, F. Cavataio, C. Scalici, G. Montalto, G. Di Fede, G. Rini, A. Notarbartolo, and M. R. Averna. 2003. Diagnostic accuracy of fecal calprotectin assay in distinguishing organic causes of chronic diarrhea from irritable bowel syndrome: a prospective study in adults and children. Clin Chem 49:861. 670. Bunn, S. K., W. M. Bisset, M. J. Main, E. S. Gray, S. Olson, and B. E. Golden. 2001. Fecal calprotectin: validation as a noninvasive measure of bowel inflammation in childhood inflammatory bowel disease. J Pediatr Gastroenterol Nutr 33:14. 671. Schmid, K. W., N. Lugering, R. Stoll, P. Brinkbaumer, G. Winde, W. Domschke, W. Bocker, and C. Sorg. 1995. Immunohistochemical demonstration of the calcium-binding proteins MRP8 and MRP14 and their heterodimer (27E10 antigen) in Crohn's disease. Hum Pathol 26:334. 672. Tibble, J. A., G. Sigthorsson, R. Foster, D. Scott, M. K. Fagerhol, A. Roseth, and I. Bjarnason. 1999. High prevalence of NSAID enteropathy as shown by a simple faecal test. Gut 45:362. 673. Hummerich, L., R. Muller, J. Hess, F. Kokocinski, M. Hahn, G. Furstenberger, C. Mauch, P. Lichter, and P. Angel. 2006. Identification of novel tumour-associated genes differentially expressed in the process of squamous cell cancer development. Oncogene 25:111. 674. Schlingemann, J., J. Hess, G. Wrobel, U. Breitenbach, C. Gebhardt, P. Steinlein, H. Kramer, G. Furstenberger, M. Hahn, P. Angel, and P. Lichter. 2003. Profile of gene expression induced by the tumour promotor TPA in murine epithelial cells. Int J Cancer 104:699. 675. Alowami, S., G. Qing, E. Emberley, L. Snell, and P. H. Watson. 2003. Psoriasin (S100A7) expression is altered during skin tumorigenesis. BMC Dermatol 3:1. 676. McPherson, M. A., and R. L. Dormer. 1988. Cystic fibrosis: a defect in stimulus-response coupling. Trends Biochem Sci 13:10. 677. Renaud, W., M. Merten, and C. Figarella. 1994. Increased coexpression of CFTR and S100 calcium binding proteins MRP8 and MRP14 mRNAs in cystic fibrosis human tracheal gland cells. Biochem Biophys Res Commun 201:1518. 678. Fanjul, M., W. Renaud, M. Merten, O. Guy-Crotte, E. Hollande, and C. Figarella. 1995. Presence of MRP8 and MRP14 in pancreatic cell lines: differential expression and localization in CFPAC-1 cells. Am J Physiol 268:C1241. 679. Quinton, P. M. 1983. Chloride impermeability in cystic fibrosis. Nature 301:421. 680. Pfeffer, K. D., T. P. Huecksteadt, and J. R. Hoidal. 1993. Expression and regulation of tumor necrosis factor in macrophages from cystic fibrosis patients. Am J Respir Cell Mol Biol 9:511. 681. Kammouni, W., C. Figarella, S. Marchand, and M. Merten. 1997. Altered cytokine production by cystic fibrosis tracheal gland serous cells. Infect Immun 65:5176. 682. Khan, T. Z., J. S. Wagener, T. Bost, J. Martinez, F. J. Accurso, and D. W. Riches. 1995. Early pulmonary inflammation in infants with cystic fibrosis. Am J Respir Crit Care Med 151:1075. 683. Bonfield, T. L., J. R. Panuska, M. W. Konstan, K. A. Hilliard, J. B. Hilliard, H. Ghnaim, and M. Berger. 1995. Inflammatory cytokines in cystic fibrosis lungs. Am J Respir Crit Care Med 152:2111. 684. Noah, T. L., and S. Becker. 1993. Respiratory syncytial virus-induced cytokine production by a human bronchial epithelial cell line. Am J Physiol 265:L472. 685. Dosanjh, A. K., D. Elashoff, and R. C. Robbins. 1998. The bronchoalveolar lavage fluid of cystic fibrosis lung transplant recipients demonstrates increased interleukin-8 and elastase and decreased IL-10. J Interferon Cytokine Res 18:851.

273 686. Thomas, G. R., E. A. Costelloe, D. P. Lunn, K. J. Stacey, S. J. Delaney, R. Passey, E. C. McGlinn, B. J. McMorran, A. Ahadizadeh, C. L. Geczy, B. J. Wainwright, and D. A. Hume. 2000. G551D cystic fibrosis mice exhibit abnormal regulation of inflammation in lungs and macrophages. J Immunol 164:3870. 687. Lin, P. Y., and E. Gruenstein. 1987. Identification of a defective cAMP-stimulated Cl- channel in cystic fibrosis fibroblasts. J Biol Chem 262:15345. 688. Li, M., J. D. McCann, C. M. Liedtke, A. C. Nairn, P. Greengard, and M. J. Welsh. 1988. Cyclic AMP-dependent protein kinase opens chloride channels in normal but not cystic fibrosis airway epithelium. Nature 331:358. 689. Luo, A., J. Kong, G. Hu, C. C. Liew, M. Xiong, X. Wang, J. Ji, T. Wang, H. Zhi, M. Wu, and Z. Liu. 2004. Discovery of Ca2+-relevant and differentiation-associated genes downregulated in esophageal squamous cell carcinoma using cDNA microarray. Oncogene 23:1291. 690. Kong, J. P., F. Ding, C. N. Zhou, X. Q. Wang, X. P. Miao, M. Wu, and Z. H. Liu. 2004. Loss of myeloid-related proteins 8 and myeloid-related proteins 14 expression in human esophageal squamous cell carcinoma correlates with poor differentiation. World J Gastroenterol 10:1093. 691. Wang, J., Y. Cai, H. Xu, J. Zhao, X. Xu, Y. L. Han, Z. X. Xu, B. S. Chen, H. Hu, M. Wu, and M. R. Wang. 2004. Expression of MRP14 gene is frequently down-regulated in Chinese human esophageal cancer. Cell Res 14:46. 692. Arai, K., T. Teratani, R. Kuruto-Niwa, T. Yamada, and R. Nozawa. 2004. S100A9 expression in invasive ductal carcinoma of the breast: S100A9 expression in adenocarcinoma is closely associated with poor tumour differentiation. Eur J Cancer 40:1179. 693. Li, C., F. Zhang, M. Lin, and J. Liu. 2004. Induction of S100A9 gene expression by cytokine oncostatin M in breast cancer cells through the STAT3 signaling cascade. Breast Cancer Res Treat 87:123. 694. Fowles, L. F., K. J. Stacey, D. Marks, J. A. Hamilton, and D. A. Hume. 2000. Regulation of urokinase plasminogen activator gene transcription in the RAW264 murine macrophage cell line by macrophage colony-stimulating factor (CSF-1) is dependent upon the level of cell-surface receptor. Biochem J 347 Pt 1:313. 695. Himes, S. R., H. Tagoh, N. Goonetilleke, T. Sasmono, D. Oceandy, R. Clark, C. Bonifer, and D. A. Hume. 2001. A highly conserved c-fms gene intronic element controls macrophage-specific and regulated expression. J Leukoc Biol 70:812. 696. Hume, D. A., X. Yue, I. L. Ross, P. Favot, A. Lichanska, and M. C. Ostrowski. 1997. Regulation of CSF-1 receptor expression. Mol Reprod Dev 46:46. 697. Xie, Y., C. Chen, and D. A. Hume. 2001. Transcriptional regulation of c-fms gene expression. Cell Biochem Biophys 34:1. 698. Nacken, W., M. P. Manitz, and C. Sorg. 1996. Molecular characterisation of the genomic locus of the mouse MRP8 gene. Biochim Biophys Acta 1315:1. 699. Cho, H., G. Orphanides, X. Sun, X. J. Yang, V. Ogryzko, E. Lees, Y. Nakatani, and D. Reinberg. 1998. A human RNA polymerase II complex containing factors that modify chromatin structure. Mol Cell Biol 18:5355. 700. Breathnach, R., and P. Chambon. 1981. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 50:349. 701. Iismaa, S. E., S. Hu, M. Kocher, M. Lackmann, C. A. Harrison, S. Thliveris, and C. L. Geczy. 1994. Recombinant and cellular expression of the murine chemotactic protein, CP-10. DNA Cell Biol 13:183. 702. Carninci, P., A. Sandelin, B. Lenhard, S. Katayama, K. Shimokawa, J. Ponjavic, C. A. Semple, M. S. Taylor, P. G. Engstrom, M. C. Frith, A. R. Forrest, W. B. Alkema, S. L. Tan, C. Plessy, R. Kodzius, T. Ravasi, T. Kasukawa, S. Fukuda, M. Kanamori-Katayama, Y. Kitazume, H. Kawaji, C. Kai, M. Nakamura, H. Konno, K. Nakano, S. Mottagui-Tabar, P. Arner, A. Chesi, S. Gustincich, F. Persichetti, H. Suzuki, S. M. Grimmond, C. A. Wells, V. Orlando, C. Wahlestedt, E. T. Liu, M. Harbers, J. Kawai, V. B. Bajic, D. A. Hume, and Y. Hayashizaki. 2006. Genome- wide analysis of mammalian promoter architecture and evolution. Nat Genet 38:626. 703. Mantovani, R. 1998. A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res 26:1135. 704. Jones, K. A., K. R. Yamamoto, and R. Tjian. 1985. Two distinct transcription factors bind to the HSV thymidine kinase promoter in vitro. Cell 42:559. 705. Zorbas, H., T. Rein, A. Krause, K. Hoffmann, and E. L. Winnacker. 1992. Nuclear factor I (NF I) binds to an NF I-type site but not to the CCAAT site in the human alpha-globin gene promoter. J Biol Chem 267:8478.

274 706. Osada, S., S. Daimon, T. Ikeda, T. Nishihara, K. Yano, M. Yamasaki, and M. Imagawa. 1997. Nuclear factor 1 family proteins bind to the silencer element in the rat glutathione transferase P gene. J Biochem 121:355. 707. Roger, T., X. Ding, A. L. Chanson, P. Renner, and T. Calandra. 2007. Regulation of constitutive and microbial pathogen-induced human macrophage migration inhibitory factor (MIF) gene expression. Eur J Immunol 37:3509. 708. Allore, R. J., W. C. Friend, D. O'Hanlon, K. M. Neilson, R. Baumal, R. J. Dunn, and A. Marks. 1990. Cloning and expression of the human S100 beta gene. J Biol Chem 265:15537. 709. Zimmer, D. B., J. Chessher, and W. Song. 1996. Nucleotide homologies in genes encoding members of the S100 protein family. Biochim Biophys Acta 1313:229. 710. Melkonyan, H., H. A. Hofmann, W. Nacken, C. Sorg, and M. Klempt. 1998. The gene encoding the myeloid-related protein 14 (MRP14), a calcium-binding protein expressed in granulocytes and monocytes, contains a potent enhancer element in the first intron. J Biol Chem 273:27026. 711. Gronostajski, R. M. 2000. Roles of the NFI/CTF gene family in transcription and development. Gene 249:31. 712. Adams, A. D., D. M. Choate, and M. A. Thompson. 1995. NF1-L is the DNA-binding component of the protein complex at the peripherin negative regulatory element. J Biol Chem 270:6975. 713. Meisterernst, M., I. Gander, L. Rogge, and E. L. Winnacker. 1988. A quantitative analysis of nuclear factor I/DNA interactions. Nucleic Acids Res 16:4419. 714. Lekstrom-Himes, J., and K. G. Xanthopoulos. 1998. Biological role of the CCAAT/enhancer- binding protein family of transcription factors. J Biol Chem 273:28545. 715. Ramos, R. A., Y. Nishio, A. C. Maiyar, K. E. Simon, C. C. Ridder, Y. Ge, and G. L. Firestone. 1996. Glucocorticoid-stimulated CCAAT/enhancer-binding protein alpha expression is required for steroid-induced G1 cell cycle arrest of minimal-deviation rat hepatoma cells. Mol Cell Biol 16:5288. 716. Cao, Z., R. M. Umek, and S. L. McKnight. 1991. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5:1538. 717. Osada, S., H. Yamamoto, T. Nishihara, and M. Imagawa. 1996. DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J Biol Chem 271:3891. 718. Williams, S. C., C. A. Cantwell, and P. F. Johnson. 1991. A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes Dev 5:1553. 719. Lin, F. T., and M. D. Lane. 1994. CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3-L1 adipocyte differentiation program. Proc Natl Acad Sci U S A 91:8757. 720. Flodby, P., C. Barlow, H. Kylefjord, L. Ahrlund-Richter, and K. G. Xanthopoulos. 1996. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J Biol Chem 271:24753. 721. Johnson, P. F. 2005. Molecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factors. J Cell Sci 118:2545. 722. Hurst, H. C. 1994. Transcription factors. 1: bZIP proteins. Protein Profile 1:123. 723. Lamb, P., and S. L. McKnight. 1991. Diversity and specificity in transcriptional regulation: the benefits of heterotypic dimerization. Trends Biochem Sci 16:417. 724. Zhuang, S. H., and K. L. Burnstein. 1998. Antiproliferative effect of 1alpha,25- dihydroxyvitamin D3 in human prostate cancer cell line LNCaP involves reduction of cyclin- dependent kinase 2 activity and persistent G1 accumulation. Endocrinology 139:1197. 725. Reddy, V. A., A. Iwama, G. Iotzova, M. Schulz, A. Elsasser, R. K. Vangala, D. G. Tenen, W. Hiddemann, and G. Behre. 2002. Granulocyte inducer C/EBPalpha inactivates the myeloid master regulator PU.1: possible role in lineage commitment decisions. Blood 100:483. 726. Rangatia, J., R. K. Vangala, N. Treiber, P. Zhang, H. Radomska, D. G. Tenen, W. Hiddemann, and G. Behre. 2002. Downregulation of c-Jun expression by transcription factor C/EBPalpha is critical for granulocytic lineage commitment. Mol Cell Biol 22:8681. 727. Wadleigh, D. J., S. T. Reddy, E. Kopp, S. Ghosh, and H. R. Herschman. 2000. Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated RAW 264.7 macrophages. J Biol Chem 275:6259. 728. Gorgoni, B., M. Caivano, C. Arizmendi, and V. Poli. 2001. The transcription factor C/EBPbeta is essential for inducible expression of the cox-2 gene in macrophages but not in fibroblasts. J Biol Chem 276:40769. 729. Dlaska, M., and G. Weiss. 1999. Central role of transcription factor NF-IL6 for cytokine and iron-mediated regulation of murine inducible nitric oxide synthase expression. J Immunol 162:6171.

275 730. Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron. 1994. Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 beta gene. Mol Cell Biol 14:7285. 731. Yang, Z., N. Wara-Aswapati, C. Chen, J. Tsukada, and P. E. Auron. 2000. NF-IL6 (C/EBPbeta ) vigorously activates il1b gene expression via a Spi-1 (PU.1) protein-protein tether. J Biol Chem 275:21272. 732. Plevy, S. E., J. H. Gemberling, S. Hsu, A. J. Dorner, and S. T. Smale. 1997. Multiple control elements mediate activation of the murine and human interleukin 12 p40 promoters: evidence of functional synergy between C/EBP and Rel proteins. Mol Cell Biol 17:4572. 733. Nakajima, T., S. Kinoshita, T. Sasagawa, K. Sasaki, M. Naruto, T. Kishimoto, and S. Akira. 1993. Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. Proc Natl Acad Sci U S A 90:2207. 734. Chano, F., and A. Descoteaux. 2002. Modulation of lipopolysaccharide-induced NF-IL6 activation by protein kinase C-alpha in a mouse macrophage cell line. Eur J Immunol 32:2897. 735. Nacken, W., J. A. Lekstrom-Himes, C. Sorg, and M. P. Manitz. 2001. Molecular analysis of the mouse S100A9 gene and evidence that the myeloid specific transcription factor C/EBPepsilon is not required for the regulation of the S100A9/A8 gene expression in neutrophils. J Cell Biochem 80:606. 736. Christakos, S., F. Barletta, M. Huening, P. Dhawan, Y. Liu, A. Porta, and X. Peng. 2003. Vitamin D target proteins: function and regulation. J Cell Biochem 88:238. 737. Ikezoe, T., S. Gery, D. Yin, J. O'Kelly, L. Binderup, N. Lemp, H. Taguchi, and H. P. Koeffler. 2005. CCAAT/enhancer-binding protein delta: a molecular target of 1,25-dihydroxyvitamin D3 in androgen-responsive prostate cancer LNCaP cells. Cancer Res 65:4762. 738. Laudet, V., C. Hanni, D. Stehelin, and M. Duterque-Coquillaud. 1999. Molecular phylogeny of the ETS gene family. Oncogene 18:1351. 739. Sharrocks, A. D. 2001. The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2:827. 740. Oikawa, T. 2004. ETS transcription factors: possible targets for cancer therapy. Cancer Sci 95:626. 741. Roth, J., M. Goebeler, V. Wrocklage, C. van den Bos, and C. Sorg. 1994. Expression of the calcium-binding proteins MRP8 and MRP14 in monocytes is regulated by a calcium-induced suppressor mechanism. Biochem J 301 ( Pt 3):655. 742. Zenz, R., R. Eferl, L. Kenner, L. Florin, L. Hummerich, D. Mehic, H. Scheuch, P. Angel, E. Tschachler, and E. F. Wagner. 2005. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437:369. 743. Karin, M. 1998. New twists in gene regulation by glucocorticoid receptor: is DNA binding dispensable? Cell 93:487. 744. Herrlich, P. 2001. Cross-talk between glucocorticoid receptor and AP-1. Oncogene 20:2465. 745. Kennedy, R. D., J. J. Gorski, J. E. Quinn, G. E. Stewart, C. R. James, S. Moore, K. Mulligan, E. D. Emberley, T. F. Lioe, P. J. Morrison, P. B. Mullan, G. Reid, P. G. Johnston, P. H. Watson, and D. P. Harkin. 2005. BRCA1 and c-Myc associate to transcriptionally repress psoriasin, a DNA damage-inducible gene. Cancer Res 65:10265. 746. Anderson, S. F., B. P. Schlegel, T. Nakajima, E. S. Wolpin, and J. D. Parvin. 1998. BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat Genet 19:254. 747. Ouchi, T., A. N. Monteiro, A. August, S. A. Aaronson, and H. Hanafusa. 1998. BRCA1 regulates p53-dependent gene expression. Proc Natl Acad Sci U S A 95:2302. 748. Li, H., T. H. Lee, and H. Avraham. 2002. A novel tricomplex of BRCA1, Nmi, and c-Myc inhibits c-Myc-induced human telomerase reverse transcriptase gene (hTERT) promoter activity in breast cancer. J Biol Chem 277:20965. 749. Houvras, Y., M. Benezra, H. Zhang, J. J. Manfredi, B. L. Weber, and J. D. Licht. 2000. BRCA1 physically and functionally interacts with ATF1. J Biol Chem 275:36230. 750. Ouchi, T., S. W. Lee, M. Ouchi, S. A. Aaronson, and C. M. Horvath. 2000. Collaboration of signal transducer and activator of transcription 1 (STAT1) and BRCA1 in differential regulation of IFN-gamma target genes. Proc Natl Acad Sci U S A 97:5208. 751. Sellmayer, A., S. M. Krane, A. J. Ouellette, and J. V. Bonventre. 1992. 1 alpha,25-(OH)2 vitamin D3 enhances expression of the genes encoding Ca(2+)-binding proteins MRP-8 and MRP-14. Am J Physiol 262:C235. 752. Suryono, J. Kido, N. Hayashi, M. Kataoka, Y. Shinohara, and T. Nagata. 2006. Norepinephrine stimulates calprotectin expression in human monocytic cells. J Periodontal Res 41:159.

276 753. Bai, B., K. Yamamoto, H. Sato, H. Sugiura, and T. Tanaka. 2007. Complex regulation of S100A8 by IL-17, dexamethasone, IL-4 and IL-13 in HaCat cells (human keratinocyte cell line). J Dermatol Sci 47:259. 754. Suryono, J. Kido, N. Hayashi, M. Kataoka, and T. Nagata. 2003. Effect of Porphyromonas gingivalis lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-1beta on calprotectin release in human monocytes. J Periodontol 74:1719. 755. Kido, J., N. Hayashi, M. Kataoka, and T. Nagata. 2005. Calprotectin expression in human monocytes: induction by porphyromonas gingivalis lipopolysaccharide, tumor necrosis factor- alpha, and interleukin-1beta. J Periodontol 76:437. 756. Mork, G., H. Schjerven, L. Mangschau, E. Soyland, and P. Brandtzaeg. 2003. Proinflammatory cytokines upregulate expression of calprotectin (L1 protein, MRP-8/MRP-14) in cultured human keratinocytes. Br J Dermatol 149:484. 757. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394. 758. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu Rev Immunol 21:335. 759. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat Rev Immunol 4:499. 760. Medzhitov, R., and C. A. Janeway, Jr. 2002. Decoding the patterns of self and nonself by the innate immune system. Science 296:298. 761. O'Neill, L. A., K. A. Fitzgerald, and A. G. Bowie. 2003. The Toll-IL-1 receptor adaptor family grows to five members. Trends Immunol 24:286. 762. Wagner, H. 2004. The immunobiology of the TLR9 subfamily. Trends Immunol 25:381. 763. Matsumoto, M., K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, and T. Seya. 2003. Subcellular localization of Toll-like receptor 3 in human dendritic cells. J Immunol 171:3154. 764. Tabeta, K., P. Georgel, E. Janssen, X. Du, K. Hoebe, K. Crozat, S. Mudd, L. Shamel, S. Sovath, J. Goode, L. Alexopoulou, R. A. Flavell, and B. Beutler. 2004. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proc Natl Acad Sci U S A 101:3516. 765. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, R. L. Modlin, and S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J Immunol 169:10. 766. Wyllie, D. H., E. Kiss-Toth, A. Visintin, S. C. Smith, S. Boussouf, D. M. Segal, G. W. Duff, and S. K. Dower. 2000. Evidence for an accessory protein function for Toll-like receptor 1 in anti- bacterial responses. J Immunol 165:7125. 767. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, and S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity 11:443. 768. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, and A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 285:736. 769. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning. 1999. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem 274:17406. 770. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, and M. J. Fenton. 1999. Human toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J Immunol 163:3920. 771. Hajjar, A. M., D. S. O'Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, and C. B. Wilson. 2001. Cutting edge: functional interactions between toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin. J Immunol 166:15. 772. Coelho, P. S., A. Klein, A. Talvani, S. F. Coutinho, O. Takeuchi, S. Akira, J. S. Silva, H. Canizzaro, R. T. Gazzinelli, and M. M. Teixeira. 2002. Glycosylphosphatidylinositol-anchored mucin-like glycoproteins isolated from Trypanosoma cruzi trypomastigotes induce in vivo leukocyte recruitment dependent on MCP-1 production by IFN-gamma-primed-macrophages. J Leukoc Biol 71:837. 773. Opitz, B., N. W. Schroder, I. Spreitzer, K. S. Michelsen, C. J. Kirschning, W. Hallatschek, U. Zahringer, T. Hartung, U. B. Gobel, and R. R. Schumann. 2001. Toll-like receptor-2 mediates Treponema glycolipid and lipoteichoic acid-induced NF-kappaB translocation. J Biol Chem 276:22041.

277 774. Massari, P., P. Henneke, Y. Ho, E. Latz, D. T. Golenbock, and L. M. Wetzler. 2002. Cutting edge: Immune stimulation by neisserial porins is toll-like receptor 2 and MyD88 dependent. J Immunol 168:1533. 775. Werts, C., R. I. Tapping, J. C. Mathison, T. H. Chuang, V. Kravchenko, I. Saint Girons, D. A. Haake, P. J. Godowski, F. Hayashi, A. Ozinsky, D. M. Underhill, C. J. Kirschning, H. Wagner, A. Aderem, P. S. Tobias, and R. J. Ulevitch. 2001. Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol 2:346. 776. Hirschfeld, M., J. J. Weis, V. Toshchakov, C. A. Salkowski, M. J. Cody, D. C. Ward, N. Qureshi, S. M. Michalek, and S. N. Vogel. 2001. Signaling by toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect Immun 69:1477. 777. Underhill, D. M., A. Ozinsky, A. M. Hajjar, A. Stevens, C. B. Wilson, M. Bassetti, and A. Aderem. 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811. 778. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition of double- stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413:732. 779. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, and B. Beutler. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085. 780. Kawasaki, K., S. Akashi, R. Shimazu, T. Yoshida, K. Miyake, and M. Nishijima. 2000. Mouse toll-like receptor 4.MD-2 complex mediates lipopolysaccharide-mimetic signal transduction by Taxol. J Biol Chem 275:2251. 781. Kurt-Jones, E. A., L. Popova, L. Kwinn, L. M. Haynes, L. P. Jones, R. A. Tripp, E. E. Walsh, M. W. Freeman, D. T. Golenbock, L. J. Anderson, and R. W. Finberg. 2000. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 1:398. 782. Rassa, J. C., J. L. Meyers, Y. Zhang, R. Kudaravalli, and S. R. Ross. 2002. Murine retroviruses activate B cells via interaction with toll-like receptor 4. Proc Natl Acad Sci U S A 99:2281. 783. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099. 784. Takeuchi, O., T. Kawai, P. F. Muhlradt, M. Morr, J. D. Radolf, A. Zychlinsky, K. Takeda, and S. Akira. 2001. Discrimination of bacterial lipoproteins by Toll-like receptor 6. Int Immunol 13:933. 785. Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, and A. Aderem. 2000. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl Acad Sci U S A 97:13766. 786. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale, A. Iwasaki, and R. A. Flavell. 2004. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A 101:5598. 787. Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, and S. Bauer. 2004. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303:1526. 788. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:1529. 789. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740. 790. Yarovinsky, F., D. Zhang, J. F. Andersen, G. L. Bannenberg, C. N. Serhan, M. S. Hayden, S. Hieny, F. S. Sutterwala, R. A. Flavell, S. Ghosh, and A. Sher. 2005. TLR11 activation of dendritic cells by a protozoan profilin-like protein. Science 308:1626. 791. Ohashi, K., V. Burkart, S. Flohe, and H. Kolb. 2000. Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex. J Immunol 164:558. 792. Beg, A. A. 2002. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol 23:509. 793. Asea, A., M. Rehli, E. Kabingu, J. A. Boch, O. Bare, P. E. Auron, M. A. Stevenson, and S. K. Calderwood. 2002. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J Biol Chem 277:15028. 794. Vabulas, R. M., S. Braedel, N. Hilf, H. Singh-Jasuja, S. Herter, P. Ahmad-Nejad, C. J. Kirschning, C. Da Costa, H. G. Rammensee, H. Wagner, and H. Schild. 2002. The endoplasmic

278 reticulum-resident heat shock protein Gp96 activates dendritic cells via the Toll-like receptor 2/4 pathway. J Biol Chem 277:20847. 795. Smiley, S. T., J. A. King, and W. W. Hancock. 2001. Fibrinogen stimulates macrophage chemokine secretion through toll-like receptor 4. J Immunol 167:2887. 796. Guillot, L., V. Balloy, F. X. McCormack, D. T. Golenbock, M. Chignard, and M. Si-Tahar. 2002. Cutting edge: the immunostimulatory activity of the lung surfactant protein-A involves Toll-like receptor 4. J Immunol 168:5989. 797. Okamura, Y., M. Watari, E. S. Jerud, D. W. Young, S. T. Ishizaka, J. Rose, J. C. Chow, and J. F. Strauss, 3rd. 2001. The extra domain A of fibronectin activates Toll-like receptor 4. J Biol Chem 276:10229. 798. Vabulas, R. M., P. Ahmad-Nejad, S. Ghose, C. J. Kirschning, R. D. Issels, and H. Wagner. 2002. HSP70 as endogenous stimulus of the Toll/interleukin-1 receptor signal pathway. J Biol Chem 277:15107. 799. Bulut, Y., E. Faure, L. Thomas, H. Karahashi, K. S. Michelsen, O. Equils, S. G. Morrison, R. P. Morrison, and M. Arditi. 2002. Chlamydial heat shock protein 60 activates macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88-dependent pathway. J Immunol 168:1435. 800. Dybdahl, B., A. Wahba, E. Lien, T. H. Flo, A. Waage, N. Qureshi, O. F. Sellevold, T. Espevik, and A. Sundan. 2002. Inflammatory response after open heart surgery: release of heat-shock protein 70 and signaling through toll-like receptor-4. Circulation 105:685. 801. Johnson, G. B., G. J. Brunn, Y. Kodaira, and J. L. Platt. 2002. Receptor-mediated monitoring of tissue well-being via detection of soluble heparan sulfate by Toll-like receptor 4. J Immunol 168:5233. 802. Johnson, G. B., G. J. Brunn, and J. L. Platt. 2004. Cutting edge: an endogenous pathway to systemic inflammatory response syndrome (SIRS)-like reactions through Toll-like receptor 4. J Immunol 172:20. 803. Termeer, C., F. Benedix, J. Sleeman, C. Fieber, U. Voith, T. Ahrens, K. Miyake, M. Freudenberg, C. Galanos, and J. C. Simon. 2002. Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4. J Exp Med 195:99. 804. Biragyn, A., P. A. Ruffini, C. A. Leifer, E. Klyushnenkova, A. Shakhov, O. Chertov, A. K. Shirakawa, J. M. Farber, D. M. Segal, J. J. Oppenheim, and L. W. Kwak. 2002. Toll-like receptor 4-dependent activation of dendritic cells by beta-defensin 2. Science 298:1025. 805. Park, J. S., D. Svetkauskaite, Q. He, J. Y. Kim, D. Strassheim, A. Ishizaka, and E. Abraham. 2004. Involvement of toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein. J Biol Chem 279:7370. 806. Kariko, K., H. Ni, J. Capodici, M. Lamphier, and D. Weissman. 2004. mRNA is an endogenous ligand for Toll-like receptor 3. J Biol Chem 279:12542. 807. Lee, J. Y., K. H. Sohn, S. H. Rhee, and D. Hwang. 2001. Saturated fatty acids, but not unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through Toll-like receptor 4. J Biol Chem 276:16683. 808. Miller, Y. I., S. Viriyakosol, C. J. Binder, J. R. Feramisco, T. N. Kirkland, and J. L. Witztum. 2003. Minimally modified LDL binds to CD14, induces macrophage spreading via TLR4/MD-2, and inhibits phagocytosis of apoptotic cells. J Biol Chem 278:1561. 809. Tsan, M. F. 2006. Toll-like receptors, inflammation and cancer. Semin Cancer Biol 16:32. 810. Miyake, K. 2004. Endotoxin recognition molecules, Toll-like receptor 4-MD-2. Semin Immunol 16:11. 811. Bausinger, H., D. Lipsker, U. Ziylan, S. Manie, J. P. Briand, J. P. Cazenave, S. Muller, J. F. Haeuw, C. Ravanat, H. de la Salle, and D. Hanau. 2002. Endotoxin-free heat-shock protein 70 fails to induce APC activation. Eur J Immunol 32:3708. 812. Gao, B., and M. F. Tsan. 2003. Endotoxin contamination in recombinant human heat shock protein 70 (Hsp70) preparation is responsible for the induction of tumor necrosis factor alpha release by murine macrophages. J Biol Chem 278:174. 813. Gao, B., and M. F. Tsan. 2003. Recombinant human heat shock protein 60 does not induce the release of tumor necrosis factor alpha from murine macrophages. J Biol Chem 278:22523. 814. Reed, R. C., B. Berwin, J. P. Baker, and C. V. Nicchitta. 2003. GRP94/gp96 elicits ERK activation in murine macrophages. A role for endotoxin contamination in NF-kappa B activation and nitric oxide production. J Biol Chem 278:31853. 815. Chen, K., J. Lu, L. Wang, and Y. H. Gan. 2004. Mycobacterial heat shock protein 65 enhances antigen cross-presentation in dendritic cells independent of Toll-like receptor 4 signaling. J Leukoc Biol 75:260.

279 816. Osterloh, A., F. Meier-Stiegen, A. Veit, B. Fleischer, A. von Bonin, and M. Breloer. 2004. Lipopolysaccharide-free heat shock protein 60 activates T cells. J Biol Chem 279:47906. 817. Shinobu, N., T. Iwamura, M. Yoneyama, K. Yamaguchi, W. Suhara, Y. Fukuhara, F. Amano, and T. Fujita. 2002. Involvement of TIRAP/MAL in signaling for the activation of interferon regulatory factor 3 by lipopolysaccharide. FEBS Lett 517:251. 818. Kopp, E., and R. Medzhitov. 2003. Recognition of microbial infection by Toll-like receptors. Curr Opin Immunol 15:396. 819. Thompson, A. J., and S. A. Locarnini. 2007. Toll-like receptors, RIG-I-like RNA helicases and the antiviral innate immune response. Immunol Cell Biol 85:435. 820. Beutler, B. 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430:257. 821. Lord, K. A., B. Hoffman-Liebermann, and D. A. Liebermann. 1990. Nucleotide sequence and expression of a cDNA encoding MyD88, a novel myeloid differentiation primary response gene induced by IL6. Oncogene 5:1095. 822. Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat Rev Immunol 1:135. 823. Gohda, J., T. Matsumura, and J. Inoue. 2004. Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor- inducing IFN-beta (TRIF)-dependent pathway in TLR signaling. J Immunol 173:2913. 824. Horng, T., G. M. Barton, R. A. Flavell, and R. Medzhitov. 2002. The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors. Nature 420:329. 825. Yamamoto, M., S. Sato, H. Hemmi, H. Sanjo, S. Uematsu, T. Kaisho, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, K. Takeda, and S. Akira. 2002. Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature 420:324. 826. Kagan, J. C., and R. Medzhitov. 2006. Phosphoinositide-mediated adaptor recruitment controls Toll-like receptor signaling. Cell 125:943. 827. Albiger, B., S. Dahlberg, B. Henriques-Normark, and S. Normark. 2007. Role of the innate immune system in host defence against bacterial infections: focus on the Toll-like receptors. J Intern Med 261:511. 828. Waterfield, M. R., M. Zhang, L. P. Norman, and S. C. Sun. 2003. NF-kappaB1/p105 regulates lipopolysaccharide-stimulated MAP kinase signaling by governing the stability and function of the Tpl2 kinase. Mol Cell 11:685. 829. Sugimoto, K., M. Ohata, J. Miyoshi, H. Ishizaki, N. Tsuboi, A. Masuda, Y. Yoshikai, M. Takamoto, K. Sugane, S. Matsuo, Y. Shimada, and T. Matsuguchi. 2004. A serine/threonine kinase, Cot/Tpl2, modulates bacterial DNA-induced IL-12 production and Th cell differentiation. J Clin Invest 114:857. 830. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the MyD88- independent toll-like receptor signaling pathway. Science 301:640. 831. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124:783. 832. Sato, S., M. Sugiyama, M. Yamamoto, Y. Watanabe, T. Kawai, K. Takeda, and S. Akira. 2003. Toll/IL-1 receptor domain-containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulatory factor-3, in the Toll-like receptor signaling. J Immunol 171:4304. 833. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu Rev Immunol 19:623. 834. Barnes, B., B. Lubyova, and P. M. Pitha. 2002. On the role of IRF in host defense. J Interferon Cytokine Res 22:59. 835. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, and T. Taniguchi. 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13:539. 836. Doyle, S. E., R. O'Connell, S. A. Vaidya, E. K. Chow, K. Yee, and G. Cheng. 2003. Toll-like receptor 3 mediates a more potent antiviral response than Toll-like receptor 4. J Immunol 170:3565. 837. Cusson-Hermance, N., S. Khurana, T. H. Lee, K. A. Fitzgerald, and M. A. Kelliher. 2005. Rip1 mediates the Trif-dependent toll-like receptor 3- and 4-induced NF-{kappa}B activation but does not contribute to interferon regulatory factor 3 activation. J Biol Chem 280:36560.

280 838. Takaoka, A., H. Yanai, S. Kondo, G. Duncan, H. Negishi, T. Mizutani, S. Kano, K. Honda, Y. Ohba, T. W. Mak, and T. Taniguchi. 2005. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 434:243. 839. Albiger, B., L. Johansson, and A. B. Jonsson. 2003. Lipooligosaccharide-deficient Neisseria meningitidis shows altered pilus-associated characteristics. Infect Immun 71:155. 840. Galloway, S. M., and C. R. Raetz. 1990. A mutant of Escherichia coli defective in the first step of endotoxin biosynthesis. J Biol Chem 265:6394. 841. Steeghs, L., R. den Hartog, A. den Boer, B. Zomer, P. Roholl, and P. van der Ley. 1998. Meningitis bacterium is viable without endotoxin. Nature 392:449. 842. Miller, S. I., R. K. Ernst, and M. W. Bader. 2005. LPS, TLR4 and infectious disease diversity. Nat Rev Microbiol 3:36. 843. Tobias, P. S., K. Soldau, J. A. Gegner, D. Mintz, and R. J. Ulevitch. 1995. Lipopolysaccharide binding protein-mediated complexation of lipopolysaccharide with soluble CD14. J Biol Chem 270:10482. 844. Schumann, R. R., S. R. Leong, G. W. Flaggs, P. W. Gray, S. D. Wright, J. C. Mathison, P. S. Tobias, and R. J. Ulevitch. 1990. Structure and function of lipopolysaccharide binding protein. Science 249:1429. 845. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, and J. C. Mathison. 1990. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science 249:1431. 846. Palsson-McDermott, E. M., and L. A. O'Neill. 2004. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology 113:153. 847. Sweet, M. J., and D. A. Hume. 1996. Endotoxin signal transduction in macrophages. J Leukoc Biol 60:8. 848. Ma, W., W. Lim, K. Gee, S. Aucoin, D. Nandan, M. Kozlowski, F. Diaz-Mitoma, and A. Kumar. 2001. The p38 mitogen-activated kinase pathway regulates the human interleukin-10 promoter via the activation of Sp1 transcription factor in lipopolysaccharide-stimulated human macrophages. J Biol Chem 276:13664. 849. Chang, L., and M. Karin. 2001. Mammalian MAP kinase signalling cascades. Nature 410:37. 850. Cavigelli, M., F. Dolfi, F. X. Claret, and M. Karin. 1995. Induction of c-fos expression through JNK-mediated TCF/Elk-1 phosphorylation. Embo J 14:5957. 851. Karin, M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483. 852. Gupta, S., D. Campbell, B. Derijard, and R. J. Davis. 1995. Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267:389. 853. Krieg, A. M. 2002. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 20:709. 854. Deng, J. C., T. A. Moore, M. W. Newstead, X. Zeng, A. M. Krieg, and T. J. Standiford. 2004. CpG oligodeoxynucleotides stimulate protective innate immunity against pulmonary Klebsiella infection. J Immunol 173:5148. 855. Ito, S., K. J. Ishii, H. Shirota, and D. M. Klinman. 2004. CpG oligodeoxynucleotides improve the survival of pregnant and fetal mice following Listeria monocytogenes infection. Infect Immun 72:3543. 856. Ito, S., K. J. Ishii, M. Gursel, H. Shirotra, A. Ihata, and D. M. Klinman. 2005. CpG oligodeoxynucleotides enhance neonatal resistance to Listeria infection. J Immunol 174:777. 857. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. de Waal Malefyt, and Y. J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science 283:1183. 858. Liu, Y. J., H. Kanzler, V. Soumelis, and M. Gilliet. 2001. Dendritic cell lineage, plasticity and cross-regulation. Nat Immunol 2:585. 859. Liu, Y. J. 2001. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106:259. 860. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med 194:863. 861. Muzio, M., D. Bosisio, N. Polentarutti, G. D'Amico, A. Stoppacciaro, R. Mancinelli, C. van't Veer, G. Penton-Rol, L. P. Ruco, P. Allavena, and A. Mantovani. 2000. Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol 164:5998. 862. Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals, T. Giese, H. Engelmann, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Toll-like receptor expression

281 reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur J Immunol 31:3026. 863. Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, and A. Lanzavecchia. 2001. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur J Immunol 31:3388. 864. Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki, H. Tomizawa, S. Akira, and S. Fukuhara. 2002. Interferon-alpha and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J Exp Med 195:1507. 865. Wagner, H. 1999. Bacterial CpG DNA activates immune cells to signal infectious danger. Adv Immunol 73:329. 866. Wagner, H. 2001. Toll meets bacterial CpG-DNA. Immunity 14:499. 867. Oganesyan, G., S. K. Saha, B. Guo, J. Q. He, A. Shahangian, B. Zarnegar, A. Perry, and G. Cheng. 2006. Critical role of TRAF3 in the Toll-like receptor-dependent and -independent antiviral response. Nature 439:208. 868. Hoshino, K., T. Sugiyama, M. Matsumoto, T. Tanaka, M. Saito, H. Hemmi, O. Ohara, S. Akira, and T. Kaisho. 2006. IkappaB kinase-alpha is critical for interferon-alpha production induced by Toll-like receptors 7 and 9. Nature 440:949. 869. Shinohara, M. L., L. Lu, J. Bu, M. B. Werneck, K. S. Kobayashi, L. H. Glimcher, and H. Cantor. 2006. Osteopontin expression is essential for interferon-alpha production by plasmacytoid dendritic cells. Nat Immunol 7:498. 870. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon- dependent immune responses. Nature 434:772. 871. Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M. Matsuda, J. Inoue, S. Uematsu, O. Takeuchi, and S. Akira. 2004. Interferon-alpha induction through Toll- like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat Immunol 5:1061. 872. Seth, R. B., L. Sun, C. K. Ea, and Z. J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122:669. 873. Honda, K., H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, Y. Ohba, A. Takaoka, W. C. Yeh, and T. Taniguchi. 2004. Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling. Proc Natl Acad Sci U S A 101:15416. 874. Gospodarowicz, D., G. Neufeld, and L. Schweigerer. 1986. Molecular and biological characterization of fibroblast growth factor, an angiogenic factor which also controls the proliferation and differentiation of mesoderm and neuroectoderm derived cells. Cell Differ 19:1. 875. Abraham, J. A., A. Mergia, J. L. Whang, A. Tumolo, J. Friedman, K. A. Hjerrild, D. Gospodarowicz, and J. C. Fiddes. 1986. Nucleotide sequence of a bovine clone encoding the angiogenic protein, basic fibroblast growth factor. Science 233:545. 876. Nishimura, T., Y. Utsunomiya, M. Hoshikawa, H. Ohuchi, and N. Itoh. 1999. Structure and expression of a novel human FGF, FGF-19, expressed in the fetal brain. Biochim Biophys Acta 1444:148. 877. Xie, M. H., I. Holcomb, B. Deuel, P. Dowd, A. Huang, A. Vagts, J. Foster, J. Liang, J. Brush, Q. Gu, K. Hillan, A. Goddard, and A. L. Gurney. 1999. FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine 11:729. 878. Gospodarowicz, D., H. Bialecki, and T. K. Thakral. 1979. The angiogenic activity of the fibroblast and epidermal growth factor. Exp Eye Res 28:501. 879. Goldfarb, M. 1996. Functions of fibroblast growth factors in vertebrate development. Cytokine Growth Factor Rev 7:311. 880. Flamme, I., and W. Risau. 1992. Induction of vasculogenesis and hematopoiesis in vitro. Development 116:435. 881. Buntrock, P., K. D. Jentzsch, and G. Heder. 1982. Stimulation of wound healing, using brain extract with fibroblast growth factor (FGF) activity. I. Quantitative and biochemical studies into formation of granulation tissue. Exp Pathol 21:46. 882. Davidson, J. M., and K. N. Broadley. 1991. Manipulation of the wound-healing process with basic fibroblast growth factor. Ann N Y Acad Sci 638:306. 883. Szebenyi, G., and J. F. Fallon. 1999. Fibroblast growth factors as multifunctional signaling factors. Int Rev Cytol 185:45. 884. Rapraeger, A. C., A. Krufka, and B. B. Olwin. 1991. Requirement of heparan sulfate for bFGF- mediated fibroblast growth and myoblast differentiation. Science 252:1705.

282 885. Detillieux, K. A., F. Sheikh, E. Kardami, and P. A. Cattini. 2003. Biological activities of fibroblast growth factor-2 in the adult myocardium. Cardiovasc Res 57:8. 886. Kardami, E., K. Detillieux, X. Ma, Z. Jiang, J. J. Santiago, S. K. Jimenez, and P. A. Cattini. 2007. Fibroblast growth factor-2 and cardioprotection. Heart Fail Rev 12:267. 887. Heit, I., R. J. Wieser, T. Herget, D. Faust, M. Borchert-Stuhltrager, F. Oesch, and C. Dietrich. 2001. Involvement of protein kinase Cdelta in contact-dependent inhibition of growth in human and murine fibroblasts. Oncogene 20:5143. 888. Judware, R., and R. Petryshyn. 1992. Mechanism of action of a cellular inhibitor of the dsRNA- dependent protein kinase from 3T3-F442A cells. J Biol Chem 267:21685. 889. Fiorentino, D. F., M. W. Bond, and T. R. Mosmann. 1989. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med 170:2081. 890. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19:683. 891. Pestka, S., C. D. Krause, D. Sarkar, M. R. Walter, Y. Shi, and P. B. Fisher. 2004. Interleukin-10 and related cytokines and receptors. Annu Rev Immunol 22:929. 892. Williams, L. M., G. Ricchetti, U. Sarma, T. Smallie, and B. M. Foxwell. 2004. Interleukin-10 suppression of myeloid cell activation--a continuing puzzle. Immunology 113:281. 893. Asadullah, K., W. Sterry, and H. D. Volk. 2003. Interleukin-10 therapy--review of a new approach. Pharmacol Rev 55:241. 894. Gerard, C., C. Bruyns, A. Marchant, D. Abramowicz, P. Vandenabeele, A. Delvaux, W. Fiers, M. Goldman, and T. Velu. 1993. Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J Exp Med 177:547. 895. Howard, M., T. Muchamuel, S. Andrade, and S. Menon. 1993. Interleukin 10 protects mice from lethal endotoxemia. J Exp Med 177:1205. 896. Kuhn, R., J. Lohler, D. Rennick, K. Rajewsky, and W. Muller. 1993. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 75:263. 897. Rennick, D. M., M. M. Fort, and N. J. Davidson. 1997. Studies with IL-10-/- mice: an overview. J Leukoc Biol 61:389. 898. Vieira, P., R. de Waal-Malefyt, M. N. Dang, K. E. Johnson, R. Kastelein, D. F. Fiorentino, J. E. deVries, M. G. Roncarolo, T. R. Mosmann, and K. W. Moore. 1991. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein-Barr virus open reading frame BCRFI. Proc Natl Acad Sci U S A 88:1172. 899. Hsu, D. H., R. de Waal Malefyt, D. F. Fiorentino, M. N. Dang, P. Vieira, J. de Vries, H. Spits, T. R. Mosmann, and K. W. Moore. 1990. Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250:830. 900. Gastl, G. A., J. S. Abrams, D. M. Nanus, R. Oosterkamp, J. Silver, F. Liu, M. Chen, A. P. Albino, and N. H. Bander. 1993. Interleukin-10 production by human carcinoma cell lines and its relationship to interleukin-6 expression. Int J Cancer 55:96. 901. Kim, J., R. L. Modlin, R. L. Moy, S. M. Dubinett, T. McHugh, B. J. Nickoloff, and K. Uyemura. 1995. IL-10 production in cutaneous basal and squamous cell carcinomas. A mechanism for evading the local T cell immune response. J Immunol 155:2240. 902. Mocellin, S., E. Wang, and F. M. Marincola. 2001. Cytokines and Immune Response in the Tumor Microenvironment. J Immunother 24:392. 903. Schols, D., and E. De Clercq. 1996. Human immunodeficiency virus type 1 gp120 induces anergy in human peripheral blood lymphocytes by inducing interleukin-10 production. J Virol 70:4953. 904. Giambartolomei, G. H., V. A. Dennis, B. L. Lasater, and M. T. Philipp. 1999. Induction of pro- and anti-inflammatory cytokines by Borrelia burgdorferi lipoproteins in monocytes is mediated by CD14. Infect Immun 67:140. 905. Libraty, D. H., L. E. Airan, K. Uyemura, D. Jullien, B. Spellberg, T. H. Rea, and R. L. Modlin. 1997. Interferon-gamma differentially regulates interleukin-12 and interleukin-10 production in leprosy. J Clin Invest 99:336. 906. van Furth, A. M., E. M. Verhard-Seijmonsbergen, J. A. Langermans, J. T. van Dissel, and R. van Furth. 1999. Anti-CD14 monoclonal antibodies inhibit the production of tumor necrosis factor alpha and interleukin-10 by human monocytes stimulated with killed and live Haemophilus influenzae or Streptococcus pneumoniae organisms. Infect Immun 67:3714. 907. Daftarian, P. M., A. Kumar, M. Kryworuchko, and F. Diaz-Mitoma. 1996. IL-10 production is enhanced in human T cells by IL-12 and IL-6 and in monocytes by tumor necrosis factor-alpha. J Immunol 157:12.

283 908. de Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, and J. E. de Vries. 1991. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174:1209. 909. Brightbill, H. D., S. E. Plevy, R. L. Modlin, and S. T. Smale. 2000. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J Immunol 164:1940. 910. Fredholm, B. B., I. J. AP, K. A. Jacobson, K. N. Klotz, and J. Linden. 2001. International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev 53:527. 911. Hasko, G., C. Szabo, Z. H. Nemeth, V. Kvetan, S. M. Pastores, and E. S. Vizi. 1996. Adenosine receptor agonists differentially regulate IL-10, TNF-alpha, and nitric oxide production in RAW 264.7 macrophages and in endotoxemic mice. J Immunol 157:4634. 912. Hasko, G., D. G. Kuhel, J. F. Chen, M. A. Schwarzschild, E. A. Deitch, J. G. Mabley, A. Marton, and C. Szabo. 2000. Adenosine inhibits IL-12 and TNF-[alpha] production via adenosine A2a receptor-dependent and independent mechanisms. Faseb J 14:2065. 913. Khoa, N. D., M. C. Montesinos, A. B. Reiss, D. Delano, N. Awadallah, and B. N. Cronstein. 2001. Inflammatory cytokines regulate function and expression of adenosine A(2A) receptors in human monocytic THP-1 cells. J Immunol 167:4026. 914. Le Moine, O., P. Stordeur, L. Schandene, A. Marchant, D. de Groote, M. Goldman, and J. Deviere. 1996. Adenosine enhances IL-10 secretion by human monocytes. J Immunol 156:4408. 915. Kambayashi, T., C. O. Jacob, D. Zhou, N. Mazurek, M. Fong, and G. Strassmann. 1995. Cyclic nucleotide phosphodiesterase type IV participates in the regulation of IL-10 and in the subsequent inhibition of TNF-alpha and IL-6 release by endotoxin-stimulated macrophages. J Immunol 155:4909. 916. Platzer, C., C. Meisel, K. Vogt, M. Platzer, and H. D. Volk. 1995. Up-regulation of monocytic IL-10 by tumor necrosis factor-alpha and cAMP elevating drugs. Int Immunol 7:517. 917. Platzer, C., E. Fritsch, T. Elsner, M. H. Lehmann, H. D. Volk, and S. Prosch. 1999. Cyclic adenosine monophosphate-responsive elements are involved in the transcriptional activation of the human IL-10 gene in monocytic cells. Eur J Immunol 29:3098. 918. Platzer, C., W. Docke, H. Volk, and S. Prosch. 2000. Catecholamines trigger IL-10 release in acute systemic stress reaction by direct stimulation of its promoter/enhancer activity in monocytic cells. J Neuroimmunol 105:31. 919. Foey, A. D., S. L. Parry, L. M. Williams, M. Feldmann, B. M. Foxwell, and F. M. Brennan. 1998. Regulation of monocyte IL-10 synthesis by endogenous IL-1 and TNF-alpha: role of the p38 and p42/44 mitogen-activated protein kinases. J Immunol 160:920. 920. Zhang, X., J. P. Edwards, and D. M. Mosser. 2006. Dynamic and transient remodeling of the macrophage IL-10 promoter during transcription. J Immunol 177:1282. 921. Meisel, C., K. Vogt, C. Platzer, F. Randow, C. Liebenthal, and H. D. Volk. 1996. Differential regulation of monocytic tumor necrosis factor-alpha and interleukin-10 expression. Eur J Immunol 26:1580. 922. Tone, M., M. J. Powell, Y. Tone, S. A. Thompson, and H. Waldmann. 2000. IL-10 gene expression is controlled by the transcription factors Sp1 and Sp3. J Immunol 165:286. 923. Liu, Y. W., H. P. Tseng, L. C. Chen, B. K. Chen, and W. C. Chang. 2003. Functional cooperation of simian virus 40 promoter factor 1 and CCAAT/enhancer-binding protein beta and delta in lipopolysaccharide-induced gene activation of IL-10 in mouse macrophages. J Immunol 171:821. 924. Benkhart, E. M., M. Siedlar, A. Wedel, T. Werner, and H. W. Ziegler-Heitbrock. 2000. Role of Stat3 in lipopolysaccharide-induced IL-10 gene expression. J Immunol 165:1612. 925. Cao, S., J. Liu, L. Song, and X. Ma. 2005. The protooncogene c-Maf is an essential transcription factor for IL-10 gene expression in macrophages. J Immunol 174:3484. 926. Bondeson, J., K. A. Browne, F. M. Brennan, B. M. Foxwell, and M. Feldmann. 1999. Selective regulation of cytokine induction by adenoviral gene transfer of IkappaBalpha into human macrophages: lipopolysaccharide-induced, but not zymosan-induced, proinflammatory cytokines are inhibited, but IL-10 is nuclear factor-kappaB independent. J Immunol 162:2939. 927. Nemeth, Z. H., G. Hasko, and E. S. Vizi. 1998. Pyrrolidine dithiocarbamate augments IL-10, inhibits TNF-alpha, MIP-1alpha, IL-12, and nitric oxide production and protects from the lethal effect of endotoxin. Shock 10:49. 928. Ohmori, Y., and T. A. Hamilton. 1994. Regulation of macrophage gene expression by T-cell- derived lymphokines. Pharmacol Ther 63:235.

284 929. Murphy, T. L., M. G. Cleveland, P. Kulesza, J. Magram, and K. M. Murphy. 1995. Regulation of interleukin 12 p40 expression through an NF-kappa B half-site. Mol Cell Biol 15:5258. 930. Grove, M., and M. Plumb. 1993. C/EBP, NF-kappa B, and c-Ets family members and transcriptional regulation of the cell-specific and inducible macrophage inflammatory protein 1 alpha immediate-early gene. Mol Cell Biol 13:5276. 931. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, and S. Akira. 1993. Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc Natl Acad Sci U S A 90:10193. 932. Stein, B., and A. S. Baldwin, Jr. 1993. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappa B. Mol Cell Biol 13:7191. 933. Powell, M. J., S. A. Thompson, Y. Tone, H. Waldmann, and M. Tone. 2000. Posttranscriptional regulation of IL-10 gene expression through sequences in the 3'-untranslated region. J Immunol 165:292. 934. Nemeth, Z. H., C. S. Lutz, B. Csoka, E. A. Deitch, S. J. Leibovich, W. C. Gause, M. Tone, P. Pacher, E. S. Vizi, and G. Hasko. 2005. Adenosine augments IL-10 production by macrophages through an A2B receptor-mediated posttranscriptional mechanism. J Immunol 175:8260. 935. Moore, K. W., P. Vieira, D. F. Fiorentino, M. L. Trounstine, T. A. Khan, and T. R. Mosmann. 1990. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248:1230. 936. Chen, C. Y., and A. B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20:465. 937. Liu, Y., S. H. Wei, A. S. Ho, R. de Waal Malefyt, and K. W. Moore. 1994. Expression cloning and characterization of a human IL-10 receptor. J Immunol 152:1821. 938. Kotenko, S. V., C. D. Krause, L. S. Izotova, B. P. Pollack, W. Wu, and S. Pestka. 1997. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. Embo J 16:5894. 939. Spencer, S. D., F. Di Marco, J. Hooley, S. Pitts-Meek, M. Bauer, A. M. Ryan, B. Sordat, V. C. Gibbs, and M. Aguet. 1998. The orphan receptor CRF2-4 is an essential subunit of the interleukin 10 receptor. J Exp Med 187:571. 940. Finbloom, D. S., and K. D. Winestock. 1995. IL-10 induces the tyrosine phosphorylation of tyk2 and Jak1 and the differential assembly of STAT1 alpha and STAT3 complexes in human T cells and monocytes. J Immunol 155:1079. 941. Weber-Nordt, R. M., J. K. Riley, A. C. Greenlund, K. W. Moore, J. E. Darnell, and R. D. Schreiber. 1996. Stat3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J Biol Chem 271:27954. 942. Novak, U., H. Ji, V. Kanagasundaram, R. Simpson, and L. Paradiso. 1998. STAT3 forms stable homodimers in the presence of divalent cations prior to activation. Biochem Biophys Res Commun 247:558. 943. Haan, S., M. Kortylewski, I. Behrmann, W. Muller-Esterl, P. C. Heinrich, and F. Schaper. 2000. Cytoplasmic STAT proteins associate prior to activation. Biochem J 345 Pt 3:417. 944. Braunstein, J., S. Brutsaert, R. Olson, and C. Schindler. 2003. STATs dimerize in the absence of phosphorylation. J Biol Chem 278:34133. 945. Ota, N., T. J. Brett, T. L. Murphy, D. H. Fremont, and K. M. Murphy. 2004. N-domain- dependent nonphosphorylated STAT4 dimers required for cytokine-driven activation. Nat Immunol 5:208. 946. Schroder, M., K. M. Kroeger, H. D. Volk, K. A. Eidne, and G. Grutz. 2004. Preassociation of nonactivated STAT3 molecules demonstrated in living cells using bioluminescence resonance energy transfer: a new model of STAT activation? J Leukoc Biol 75:792. 947. O'Farrell, A. M., Y. Liu, K. W. Moore, and A. L. Mui. 1998. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and -independent pathways. Embo J 17:1006. 948. Takeda, K., B. E. Clausen, T. Kaisho, T. Tsujimura, N. Terada, I. Forster, and S. Akira. 1999. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10:39. 949. Williams, L., L. Bradley, A. Smith, and B. Foxwell. 2004. Signal transducer and activator of transcription 3 is the dominant mediator of the anti-inflammatory effects of IL-10 in human macrophages. J Immunol 172:567. 950. Rodig, S. J., M. A. Meraz, J. M. White, P. A. Lampe, J. K. Riley, C. D. Arthur, K. L. King, K. C. Sheehan, L. Yin, D. Pennica, E. M. Johnson, Jr., and R. D. Schreiber. 1998. Disruption of the

285 Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93:373. 951. Meraz, M. A., J. M. White, K. C. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, K. Carver-Moore, R. N. DuBois, R. Clark, M. Aguet, and R. D. Schreiber. 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431. 952. Stumpo, R., M. Kauer, S. Martin, and H. Kolb. 2003. IL-10 induces gene expression in macrophages: partial overlap with IL-5 but not with IL-4 induced genes. Cytokine 24:46. 953. Nolan, K. F., V. Strong, D. Soler, P. J. Fairchild, S. P. Cobbold, R. Croxton, J. A. Gonzalo, A. Rubio, M. Wells, and H. Waldmann. 2004. IL-10-conditioned dendritic cells, decommissioned for recruitment of adaptive immunity, elicit innate inflammatory gene products in response to danger signals. J Immunol 172:2201. 954. Williams, L., G. Jarai, A. Smith, and P. Finan. 2002. IL-10 expression profiling in human monocytes. J Leukoc Biol 72:800. 955. Lang, R., D. Patel, J. J. Morris, R. L. Rutschman, and P. J. Murray. 2002. Shaping gene expression in activated and resting primary macrophages by IL-10. J Immunol 169:2253. 956. Cao, S., J. Liu, M. Chesi, P. L. Bergsagel, I. C. Ho, R. P. Donnelly, and X. Ma. 2002. Differential regulation of IL-12 and IL-10 gene expression in macrophages by the basic leucine zipper transcription factor c-Maf . J Immunol 169:5715. 957. Kuwata, H., Y. Watanabe, H. Miyoshi, M. Yamamoto, T. Kaisho, K. Takeda, and S. Akira. 2003. IL-10-inducible Bcl-3 negatively regulates LPS-induced TNF-alpha production in macrophages. Blood 102:4123. 958. Jung, M., R. Sabat, J. Kratzschmar, H. Seidel, K. Wolk, C. Schonbein, S. Schutt, M. Friedrich, W. D. Docke, K. Asadullah, H. D. Volk, and G. Grutz. 2004. Expression profiling of IL-10- regulated genes in human monocytes and peripheral blood mononuclear cells from psoriatic patients during IL-10 therapy. Eur J Immunol 34:481. 959. Perrier, P., F. O. Martinez, M. Locati, G. Bianchi, M. Nebuloni, G. Vago, F. Bazzoni, S. Sozzani, P. Allavena, and A. Mantovani. 2004. Distinct transcriptional programs activated by interleukin- 10 with or without lipopolysaccharide in dendritic cells: induction of the B cell-activating chemokine, CXC chemokine ligand 13. J Immunol 172:7031. 960. Grutz, G. 2005. New insights into the molecular mechanism of interleukin-10-mediated immunosuppression. J Leukoc Biol 77:3. 961. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1994. IL-10 inhibits transcription of cytokine genes in human peripheral blood mononuclear cells. J Immunol 153:811. 962. Aste-Amezaga, M., X. Ma, A. Sartori, and G. Trinchieri. 1998. Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10. J Immunol 160:5936. 963. Niiro, H., T. Otsuka, T. Tanabe, S. Hara, S. Kuga, Y. Nemoto, Y. Tanaka, H. Nakashima, S. Kitajima, M. Abe, and et al. 1995. Inhibition by interleukin-10 of inducible cyclooxygenase expression in lipopolysaccharide-stimulated monocytes: its underlying mechanism in comparison with interleukin-4. Blood 85:3736. 964. Starr, R., T. A. Willson, E. M. Viney, L. J. Murray, J. R. Rayner, B. J. Jenkins, T. J. Gonda, W. S. Alexander, D. Metcalf, N. A. Nicola, and D. J. Hilton. 1997. A family of cytokine-inducible inhibitors of signalling. Nature 387:917. 965. Yasukawa, H., H. Misawa, H. Sakamoto, M. Masuhara, A. Sasaki, T. Wakioka, S. Ohtsuka, T. Imaizumi, T. Matsuda, J. N. Ihle, and A. Yoshimura. 1999. The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. Embo J 18:1309. 966. Ding, Y., D. Chen, A. Tarcsafalvi, R. Su, L. Qin, and J. S. Bromberg. 2003. Suppressor of cytokine signaling 1 inhibits IL-10-mediated immune responses. J Immunol 170:1383. 967. Alexander, W. S., R. Starr, J. E. Fenner, C. L. Scott, E. Handman, N. S. Sprigg, J. E. Corbin, A. L. Cornish, R. Darwiche, C. M. Owczarek, T. W. Kay, N. A. Nicola, P. J. Hertzog, D. Metcalf, and D. J. Hilton. 1999. SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98:597. 968. Naka, T., H. Tsutsui, M. Fujimoto, Y. Kawazoe, H. Kohzaki, Y. Morita, R. Nakagawa, M. Narazaki, K. Adachi, T. Yoshimoto, K. Nakanishi, and T. Kishimoto. 2001. SOCS-1/SSI-1- deficient NKT cells participate in severe hepatitis through dysregulated cross-talk inhibition of IFN-gamma and IL-4 signaling in vivo. Immunity 14:535. 969. Nakagawa, R., T. Naka, H. Tsutsui, M. Fujimoto, A. Kimura, T. Abe, E. Seki, S. Sato, O. Takeuchi, K. Takeda, S. Akira, K. Yamanishi, I. Kawase, K. Nakanishi, and T. Kishimoto. 2002. SOCS-1 participates in negative regulation of LPS responses. Immunity 17:677.

286 970. Endo, T. A., M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, A. Matsumoto, S. Tanimura, M. Ohtsubo, H. Misawa, T. Miyazaki, N. Leonor, T. Taniguchi, T. Fujita, Y. Kanakura, S. Komiya, and A. Yoshimura. 1997. A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387:921. 971. Naka, T., M. Narazaki, M. Hirata, T. Matsumoto, S. Minamoto, A. Aono, N. Nishimoto, T. Kajita, T. Taga, K. Yoshizaki, S. Akira, and T. Kishimoto. 1997. Structure and function of a new STAT-induced STAT inhibitor. Nature 387:924. 972. Shames, B. D., C. H. Selzman, D. R. Meldrum, E. J. Pulido, H. A. Barton, X. Meng, A. H. Harken, and R. C. McIntyre, Jr. 1998. Interleukin-10 stabilizes inhibitory kappaB-alpha in human monocytes. Shock 10:389. 973. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1995. Interleukin (IL)-10 inhibits nuclear factor kappa B (NF kappa B) activation in human monocytes. IL-10 and IL-4 suppress cytokine synthesis by different mechanisms. J Biol Chem 270:9558. 974. Schottelius, A. J., M. W. Mayo, R. B. Sartor, and A. S. Baldwin, Jr. 1999. Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB DNA binding. J Biol Chem 274:31868. 975. Baldwin, A. S., Jr. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol 14:649. 976. Baeuerle, P. A. 1995. Transcriptional activators. Enter a polypeptide messenger. Nature 373:661. 977. Ziegler-Heitbrock, H. W., A. Wedel, W. Schraut, M. Strobel, P. Wendelgass, T. Sternsdorf, P. A. Bauerle, J. G. Haas, and G. Riethmuller. 1994. Tolerance to lipopolysaccharide involves mobilization of nuclear factor kappa B with predominance of p50 homodimers. J Biol Chem 269:17001. 978. Driessler, F., K. Venstrom, R. Sabat, K. Asadullah, and A. J. Schottelius. 2004. Molecular mechanisms of interleukin-10-mediated inhibition of NF-kappaB activity: a role for p50. Clin Exp Immunol 135:64. 979. Lenardo, M., and U. Siebenlist. 1994. Bcl-3-mediated nuclear regulation of the NF-kappa B trans-activating factor. Immunol Today 15:145. 980. Bhattacharyya, S., P. Sen, M. Wallet, B. Long, A. S. Baldwin, Jr., and R. Tisch. 2004. Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3K/Akt pathway and of IkappaB kinase activity. Blood 104:1100. 981. Smith, W. L., R. M. Garavito, and D. L. DeWitt. 1996. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 271:33157. 982. Vane, J. R., Y. S. Bakhle, and R. M. Botting. 1998. Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 38:97. 983. Riese, J., T. Hoff, A. Nordhoff, D. L. DeWitt, K. Resch, and V. Kaever. 1994. Transient expression of prostaglandin endoperoxide synthase-2 during mouse macrophage activation. J Leukoc Biol 55:476. 984. Niho, Y., H. Niiro, Y. Tanaka, H. Nakashima, and T. Otsuka. 1998. Role of IL-10 in the crossregulation of prostaglandins and cytokines in monocytes. Acta Haematol 99:165. 985. Strassmann, G., V. Patil-Koota, F. Finkelman, M. Fong, and T. Kambayashi. 1994. Evidence for the involvement of interleukin 10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2. J Exp Med 180:2365. 986. Stolina, M., S. Sharma, Y. Lin, M. Dohadwala, B. Gardner, J. Luo, L. Zhu, M. Kronenberg, P. W. Miller, J. Portanova, J. C. Lee, and S. M. Dubinett. 2000. Specific inhibition of cyclooxygenase 2 restores antitumor reactivity by altering the balance of IL-10 and IL-12 synthesis. J Immunol 164:361. 987. Roesler, W. J., E. A. Park, and P. J. McFie. 1998. Characterization of CCAAT/enhancer-binding protein alpha as a cyclic AMP-responsive nuclear regulator. J Biol Chem 273:14950. 988. Park, E. A., S. Song, C. Vinson, and W. J. Roesler. 1999. Role of CCAAT enhancer-binding protein beta in the thyroid hormone and cAMP induction of phosphoenolpyruvate carboxykinase gene transcription. J Biol Chem 274:211. 989. Pohnke, Y., R. Kempf, and B. Gellersen. 1999. CCAAT/enhancer-binding proteins are mediators in the protein kinase A-dependent activation of the decidual prolactin promoter. J Biol Chem 274:24808. 990. Leung, D. Y., and J. W. Bloom. 2003. Update on glucocorticoid action and resistance. J Allergy Clin Immunol 111:3. 991. Hebbar, P. B., and T. K. Archer. 2003. Nuclear factor 1 is required for both hormone-dependent chromatin remodeling and transcriptional activation of the mouse mammary tumor virus promoter. Mol Cell Biol 23:887.

287 992. Nagpal, S., S. M. Thacher, S. Patel, S. Friant, M. Malhotra, J. Shafer, G. Krasinski, A. T. Asano, M. Teng, M. Duvic, and R. A. Chandraratna. 1996. Negative regulation of two hyperproliferative keratinocyte differentiation markers by a retinoic acid receptor-specific retinoid: insight into the mechanism of retinoid action in psoriasis. Cell Growth Differ 7:1783. 993. Huss, J. M., and D. P. Kelly. 2004. Nuclear receptor signaling and cardiac energetics. Circ Res 95:568. 994. Grigorian, M., E. Tulchinsky, O. Burrone, S. Tarabykina, G. Georgiev, and E. Lukanidin. 1994. Modulation of mts1 expression in mouse and human normal and tumor cells. Electrophoresis 15:463. 995. Whyte, M. K., S. J. Hardwick, L. C. Meagher, J. S. Savill, and C. Haslett. 1993. Transient elevations of cytosolic free calcium retard subsequent apoptosis in neutrophils in vitro. J Clin Invest 92:446. 996. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36:59. 997. Harrison, T., F. Graham, and J. Williams. 1977. Host-range mutants of adenovirus type 5 defective for growth in HeLa cells. Virology 77:319. 998. Southern, P. J., and P. Berg. 1982. Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J Mol Appl Genet 1:327. 999. Warrior, U., X. G. Chiou, M. P. Sheets, R. J. Sciotti, J. M. Parry, R. L. Simmer, B. W. Surber, D. J. Burns, B. A. Beutel, K. W. Mollison, S. W. Djuric, and J. M. Trevillyan. 1999. Development of a p38 Kinase Binding Assay for High Throughput Screening. J Biomol Screen 4:129. 1000. Fox, T., J. T. Coll, X. Xie, P. J. Ford, U. A. Germann, M. D. Porter, S. Pazhanisamy, M. A. Fleming, V. Galullo, M. S. Su, and K. P. Wilson. 1998. A single amino acid substitution makes ERK2 susceptible to pyridinyl imidazole inhibitors of p38 MAP kinase. Protein Sci 7:2249. 1001. Alessi, D. R., A. Cuenda, P. Cohen, D. T. Dudley, and A. R. Saltiel. 1995. PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem 270:27489. 1002. Pang, L., T. Sawada, S. J. Decker, and A. R. Saltiel. 1995. Inhibition of MAP kinase kinase blocks the differentiation of PC-12 cells induced by nerve growth factor. J Biol Chem 270:13585. 1003. Dudley, D. T., L. Pang, S. J. Decker, A. J. Bridges, and A. R. Saltiel. 1995. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci U S A 92:7686. 1004. DeSilva, D. R., E. A. Jones, M. F. Favata, B. D. Jaffee, R. L. Magolda, J. M. Trzaskos, and P. A. Scherle. 1998. Inhibition of mitogen-activated protein kinase kinase blocks T cell proliferation but does not induce or prevent anergy. J Immunol 160:4175. 1005. Duncia, J. V., J. B. Santella, 3rd, C. A. Higley, W. J. Pitts, J. Wityak, W. E. Frietze, F. W. Rankin, J. H. Sun, R. A. Earl, A. C. Tabaka, C. A. Teleha, K. F. Blom, M. F. Favata, E. J. Manos, A. J. Daulerio, D. A. Stradley, K. Horiuchi, R. A. Copeland, P. A. Scherle, J. M. Trzaskos, R. L. Magolda, G. L. Trainor, R. R. Wexler, F. W. Hobbs, and R. E. Olson. 1998. MEK inhibitors: the chemistry and biological activity of U0126, its analogs, and cyclization products. Bioorg Med Chem Lett 8:2839. 1006. Favata, M. F., K. Y. Horiuchi, E. J. Manos, A. J. Daulerio, D. A. Stradley, W. S. Feeser, D. E. Van Dyk, W. J. Pitts, R. A. Earl, F. Hobbs, R. A. Copeland, R. L. Magolda, P. A. Scherle, and J. M. Trzaskos. 1998. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 273:18623. 1007. Bennett, B. L., D. T. Sasaki, B. W. Murray, E. C. O'Leary, S. T. Sakata, W. Xu, J. C. Leisten, A. Motiwala, S. Pierce, Y. Satoh, S. S. Bhagwat, A. M. Manning, and D. W. Anderson. 2001. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 98:13681. 1008. Han, Z., D. L. Boyle, L. Chang, B. Bennett, M. Karin, L. Yang, A. M. Manning, and G. S. Firestein. 2001. c-Jun N-terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis. J Clin Invest 108:73. 1009. Hu, Y., and T. W. Conway. 1993. 2-Aminopurine inhibits the double-stranded RNA-dependent protein kinase both in vitro and in vivo. J Interferon Res 13:323. 1010. Stuehr, D. J., O. A. Fasehun, N. S. Kwon, S. S. Gross, J. A. Gonzalez, R. Levi, and C. F. Nathan. 1991. Inhibition of macrophage and endothelial cell nitric oxide synthase by diphenyleneiodonium and its analogs. Faseb J 5:98. 1011. O'Donnell, B. V., D. G. Tew, O. T. Jones, and P. J. England. 1993. Studies on the inhibitory mechanism of iodonium compounds with special reference to neutrophil NADPH oxidase. Biochem J 290 ( Pt 1):41.

288 1012. Atal, C. K., M. L. Sharma, A. Kaul, and A. Khajuria. 1986. Immunomodulating agents of plant origin. I: Preliminary screening. J Ethnopharmacol 18:133. 1013. Simons, J. M., B. A. Hart, T. R. Ip Vai Ching, H. Van Dijk, and R. P. Labadie. 1990. Metabolic activation of natural phenols into selective oxidative burst agonists by activated human neutrophils. Free Radic Biol Med 8:251. 1014. Tsutsui, H., T. Ide, S. Hayashidani, S. Kinugawa, N. Suematsu, H. Utsumi, and A. Takeshita. 2001. Effects of ACE inhibition on left ventricular failure and oxidative stress in Dahl salt- sensitive rats. J Cardiovasc Pharmacol 37:725. 1015. Tsutsui, H., T. Ide, S. Hayashidani, N. Suematsu, T. Shiomi, J. Wen, K. Nakamura, K. Ichikawa, H. Utsumi, and A. Takeshita. 2001. Enhanced generation of reactive oxygen species in the limb skeletal muscles from a murine infarct model of heart failure. Circulation 104:134. 1016. Perez, M. J., and A. I. Cederbaum. 2001. Spin trapping agents (Tempol and POBN) protect HepG2 cells overexpressing CYP2E1 against arachidonic acid toxicity. Free Radic Biol Med 30:734. 1017. Turcatti, G., S. Zoffmann, J. A. Lowe, 3rd, S. E. Drozda, G. Chassaing, T. W. Schwartz, and A. Chollet. 1997. Characterization of non-peptide antagonist and peptide agonist binding sites of the NK1 receptor with fluorescent ligands. J Biol Chem 272:21167. 1018. Beckman, J. S., T. W. Beckman, J. Chen, P. A. Marshall, and B. A. Freeman. 1990. Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci U S A 87:1620. 1019. Tilly, J. L., and K. I. Tilly. 1995. Inhibitors of oxidative stress mimic the ability of follicle- stimulating hormone to suppress apoptosis in cultured rat ovarian follicles. Endocrinology 136:242. 1020. Keller, J. N., M. S. Kindy, F. W. Holtsberg, D. K. St Clair, H. C. Yen, A. Germeyer, S. M. Steiner, A. J. Bruce-Keller, J. B. Hutchins, and M. P. Mattson. 1998. Mitochondrial manganese superoxide dismutase prevents neural apoptosis and reduces ischemic brain injury: suppression of peroxynitrite production, lipid peroxidation, and mitochondrial dysfunction. J Neurosci 18:687. 1021. Liochev, S. I., and I. Fridovich. 1994. The role of O2.- in the production of HO.: in vitro and in vivo. Free Radic Biol Med 16:29. 1022. Ferrari, G., C. Y. Yan, and L. A. Greene. 1995. N-acetylcysteine (D- and L-stereoisomers) prevents apoptotic death of neuronal cells. J Neurosci 15:2857. 1023. Tsai, J. C., M. Jain, C. M. Hsieh, W. S. Lee, M. Yoshizumi, C. Patterson, M. A. Perrella, C. Cooke, H. Wang, E. Haber, R. Schlegel, and M. E. Lee. 1996. Induction of apoptosis by pyrrolidinedithiocarbamate and N-acetylcysteine in vascular smooth muscle cells. J Biol Chem 271:3667. 1024. Roederer, M., F. J. Staal, P. A. Raju, S. W. Ela, and L. A. Herzenberg. 1990. Cytokine- stimulated human immunodeficiency virus replication is inhibited by N-acetyl-L-cysteine. Proc Natl Acad Sci U S A 87:4884. 1025. Weinander, R., C. Anderson, and R. Morgenstern. 1994. Identification of N-acetylcysteine as a new substrate for rat liver microsomal glutathione transferase. A study of thiol ligands. J Biol Chem 269:71. 1026. Ganitkevich, V. 1999. Clearance of large Ca2+ loads in a single smooth muscle cell: examination of the role of mitochondrial Ca2+ uptake and intracellular pH. Cell Calcium 25:29. 1027. McCarron, J. G., and T. C. Muir. 1999. Mitochondrial regulation of the cytosolic Ca2+ concentration and the InsP3-sensitive Ca2+ store in guinea-pig colonic smooth muscle. J Physiol 516 ( Pt 1):149. 1028. Goncalves, P. P., S. M. Meireles, C. Gravato, and M. G. Vale. 1998. Ca2+-H+ antiport activity in synaptic vesicles isolated from sheep brain cortex. Neurosci Lett 247:87. 1029. Verhoeven, A. J., B. P. Neve, and H. Jansen. 1999. Secretion and apparent activation of human hepatic lipase requires proper oligosaccharide processing in the endoplasmic reticulum. Biochem J 337 ( Pt 1):133. 1030. Alvarado, F., and M. Vasseur. 1998. Direct inhibitory effect of CCCP on the Cl(-)-H+ symporter of the guinea pig ileal brush-border membrane. Am J Physiol 274:C481. 1031. Peng, T. I., M. J. Jou, S. S. Sheu, and J. T. Greenamyre. 1998. Visualization of NMDA receptor- induced mitochondrial calcium accumulation in striatal neurons. Exp Neurol 149:1. 1032. Peng, Y. Y. 1998. Effects of mitochondrion on calcium transients at intact presynaptic terminals depend on frequency of nerve firing. J Neurophysiol 80:186. 1033. Izzo, G., F. Guerrieri, and S. Papa. 1978. On the mechanism of inhibition of the respiratory chain by 2-heptyl-4-hydroxyquinoline-N-oxide. FEBS Lett 93:320.

289 1034. Pietrobon, D., G. F. Azzone, and D. Walz. 1981. Effect of funiculosin and antimycin A on the redox-driven H+-pumps in mitochondria: on the nature of "leaks'. Eur J Biochem 117:389. 1035. Tzung, S. P., K. M. Kim, G. Basanez, C. D. Giedt, J. Simon, J. Zimmerberg, K. Y. Zhang, and D. M. Hockenbery. 2001. Antimycin A mimics a cell-death-inducing Bcl-2 homology domain 3. Nat Cell Biol 3:183. 1036. Cox, D. A., L. Conforti, N. Sperelakis, and M. A. Matlib. 1993. Selectivity of inhibition of Na(+)-Ca2+ exchange of heart mitochondria by benzothiazepine CGP-37157. J Cardiovasc Pharmacol 21:595. 1037. Cox, D. A., and M. A. Matlib. 1993. Modulation of intramitochondrial free Ca2+ concentration by antagonists of Na(+)-Ca2+ exchange. Trends Pharmacol Sci 14:408. 1038. White, R. J., and I. J. Reynolds. 1997. Mitochondria accumulate Ca2+ following intense glutamate stimulation of cultured rat forebrain neurones. J Physiol 498 ( Pt 1):31. 1039. Baron, K. T., and S. A. Thayer. 1997. CGP37157 modulates mitochondrial Ca2+ homeostasis in cultured rat dorsal root ganglion neurons. Eur J Pharmacol 340:295. 1040. Bayer, E. A., and M. Wilchek. 1990. Protein biotinylation. Methods Enzymol 184:138. 1041. Jensen, S., M. P. Gassama, and T. Heidmann. 1999. Cosuppression of I transposon activity in Drosophila by I-containing sense and antisense transgenes. Genetics 153:1767. 1042. Hamilton, A. J., and D. C. Baulcombe. 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950. 1043. Sharp, P. A., and P. D. Zamore. 2000. Molecular biology. RNA interference. Science 287:2431. 1044. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806. 1045. Elbashir, S. M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. Embo J 20:6877. 1046. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494. 1047. Gil, J., and M. Esteban. 2000. Induction of apoptosis by the dsRNA-dependent protein kinase (PKR): mechanism of action. Apoptosis 5:107. 1048. Chalfie, M., H. R. Horvitz, and J. E. Sulston. 1981. Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 24:59. 1049. Ambros, V., and H. R. Horvitz. 1984. Heterochronic mutants of the nematode Caenorhabditis elegans. Science 226:409. 1050. Lee, R. C., R. L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843. 1051. Wightman, B., I. Ha, and G. Ruvkun. 1993. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75:855. 1052. Jovanovic, M., and M. O. Hengartner. 2006. miRNAs and apoptosis: RNAs to die for. Oncogene 25:6176. 1053. Reinhart, B. J., F. J. Slack, M. Basson, A. E. Pasquinelli, J. C. Bettinger, A. E. Rougvie, H. R. Horvitz, and G. Ruvkun. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403:901. 1054. Pasquinelli, A. E., B. J. Reinhart, F. Slack, M. Q. Martindale, M. I. Kuroda, B. Maller, D. C. Hayward, E. E. Ball, B. Degnan, P. Muller, J. Spring, A. Srinivasan, M. Fishman, J. Finnerty, J. Corbo, M. Levine, P. Leahy, E. Davidson, and G. Ruvkun. 2000. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 408:86. 1055. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of novel genes coding for small expressed RNAs. Science 294:853. 1056. Lau, N. C., L. P. Lim, E. G. Weinstein, and D. P. Bartel. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858. 1057. Lee, R. C., and V. Ambros. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294:862. 1058. Xie, X., J. Lu, E. J. Kulbokas, T. R. Golub, V. Mootha, K. Lindblad-Toh, E. S. Lander, and M. Kellis. 2005. Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. Nature 434:338. 1059. Berezikov, E., V. Guryev, J. van de Belt, E. Wienholds, R. H. Plasterk, and E. Cuppen. 2005. Phylogenetic shadowing and computational identification of human microRNA genes. Cell 120:21.

290 1060. Bentwich, I., A. Avniel, Y. Karov, R. Aharonov, S. Gilad, O. Barad, A. Barzilai, P. Einat, U. Einav, E. Meiri, E. Sharon, Y. Spector, and Z. Bentwich. 2005. Identification of hundreds of conserved and nonconserved human microRNAs. Nat Genet 37:766. 1061. Brennecke, J., A. Stark, R. B. Russell, and S. M. Cohen. 2005. Principles of microRNA-target recognition. PLoS Biol 3:e85. 1062. Krek, A., D. Grun, M. N. Poy, R. Wolf, L. Rosenberg, E. J. Epstein, P. MacMenamin, I. da Piedade, K. C. Gunsalus, M. Stoffel, and N. Rajewsky. 2005. Combinatorial microRNA target predictions. Nat Genet 37:495. 1063. Cheng, A. M., M. W. Byrom, J. Shelton, and L. P. Ford. 2005. Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res 33:1290. 1064. Xu, P., M. Guo, and B. A. Hay. 2004. MicroRNAs and the regulation of cell death. Trends Genet 20:617. 1065. Karp, X., and V. Ambros. 2005. Developmental biology. Encountering microRNAs in cell fate signaling. Science 310:1288. 1066. Chen, C. Z., L. Li, H. F. Lodish, and D. P. Bartel. 2004. MicroRNAs modulate hematopoietic lineage differentiation. Science 303:83. 1067. Poy, M. N., L. Eliasson, J. Krutzfeldt, S. Kuwajima, X. Ma, P. E. Macdonald, S. Pfeffer, T. Tuschl, N. Rajewsky, P. Rorsman, and M. Stoffel. 2004. A pancreatic islet-specific microRNA regulates insulin secretion. Nature 432:226. 1068. Pillai, R. S., S. N. Bhattacharyya, and W. Filipowicz. 2007. Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol 17:118. 1069. Lee, Y., I. Hur, S. Y. Park, Y. K. Kim, M. R. Suh, and V. N. Kim. 2006. The role of PACT in the RNA silencing pathway. Embo J 25:522. 1070. Matranga, C., Y. Tomari, C. Shin, D. P. Bartel, and P. D. Zamore. 2005. Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell 123:607. 1071. Khvorova, A., A. Reynolds, and S. D. Jayasena. 2003. Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209. 1072. Schwarz, D. S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P. D. Zamore. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199. 1073. Manjunath, N., P. Kumar, S. K. Lee, and P. Shankar. 2006. Interfering antiviral immunity: application, subversion, hope? Trends Immunol 27:328. 1074. Geiss, G., G. Jin, J. Guo, R. Bumgarner, M. G. Katze, and G. C. Sen. 2001. A comprehensive view of regulation of gene expression by double-stranded RNA-mediated cell signaling. J Biol Chem 276:30178. 1075. Kelley, K. A., and P. M. Pitha. 1985. Characterization of a mouse interferon gene locus I. Isolation of a cluster of four alpha interferon genes. Nucleic Acids Res 13:805. 1076. Kelley, K. A., and P. M. Pitha. 1985. Characterization of a mouse interferon gene locus II. Differential expression of alpha-interferon genes. Nucleic Acids Res 13:825. 1077. Marie, I., J. E. Durbin, and D. E. Levy. 1998. Differential viral induction of distinct interferon- alpha genes by positive feedback through interferon regulatory factor-7. Embo J 17:6660. 1078. Prakash, A., E. Smith, C. K. Lee, and D. E. Levy. 2005. Tissue-specific positive feedback requirements for production of type I interferon following virus infection. J Biol Chem 280:18651. 1079. Billy, E., V. Brondani, H. Zhang, U. Muller, and W. Filipowicz. 2001. Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines. Proc Natl Acad Sci U S A 98:14428. 1080. Sledz, C. A., M. Holko, M. J. de Veer, R. H. Silverman, and B. R. Williams. 2003. Activation of the interferon system by short-interfering RNAs. Nat Cell Biol 5:834. 1081. Zhang, Z., T. Weinschenk, K. Guo, and H. J. Schluesener. 2006. siRNA binding proteins of microglial cells: PKR is an unanticipated ligand. J Cell Biochem 97:1217. 1082. Meurs, E., K. Chong, J. Galabru, N. S. Thomas, I. M. Kerr, B. R. Williams, and A. G. Hovanessian. 1990. Molecular cloning and characterization of the human double-stranded RNA- activated protein kinase induced by interferon. Cell 62:379. 1083. Kim, D. H., M. Longo, Y. Han, P. Lundberg, E. Cantin, and J. J. Rossi. 2004. Interferon induction by siRNAs and ssRNAs synthesized by phage polymerase. Nat Biotechnol 22:321. 1084. Sioud, M. 2005. Induction of inflammatory cytokines and interferon responses by double- stranded and single-stranded siRNAs is sequence-dependent and requires endosomal localization. J Mol Biol 348:1079.

291 1085. Hornung, V., M. Guenthner-Biller, C. Bourquin, A. Ablasser, M. Schlee, S. Uematsu, A. Noronha, M. Manoharan, S. Akira, A. de Fougerolles, S. Endres, and G. Hartmann. 2005. Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7. Nat Med 11:263. 1086. Judge, A. D., V. Sood, J. R. Shaw, D. Fang, K. McClintock, and I. MacLachlan. 2005. Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA. Nat Biotechnol 23:457. 1087. Ui-Tei, K., Y. Naito, F. Takahashi, T. Haraguchi, H. Ohki-Hamazaki, A. Juni, R. Ueda, and K. Saigo. 2004. Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res 32:936. 1088. Rodriguez, A., S. Griffiths-Jones, J. L. Ashurst, and A. Bradley. 2004. Identification of mammalian microRNA host genes and transcription units. Genome Res 14:1902. 1089. Cullen, B. R. 2004. Transcription and processing of human microRNA precursors. Mol Cell 16:861. 1090. Kim, V. N. 2005. Small RNAs: classification, biogenesis, and function. Mol Cells 19:1. 1091. Rana, T. M. 2007. Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8:23. 1092. Han, J., Y. Lee, K. H. Yeom, Y. K. Kim, H. Jin, and V. N. Kim. 2004. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev 18:3016. 1093. Bohnsack, M. T., K. Czaplinski, and D. Gorlich. 2004. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. Rna 10:185. 1094. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17:3011. 1095. Chiu, Y. L., and T. M. Rana. 2002. RNAi in human cells: basic structural and functional features of small interfering RNA. Mol Cell 10:549. 1096. Lewis, B. P., C. B. Burge, and D. P. Bartel. 2005. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120:15. 1097. Saetrom, O., O. Snove, Jr., and P. Saetrom. 2005. Weighted sequence motifs as an improved seeding step in microRNA target prediction algorithms. Rna 11:995. 1098. Tomari, Y., and P. D. Zamore. 2005. Perspective: machines for RNAi. Genes Dev 19:517. 1099. Zamore, P. D., and B. Haley. 2005. Ribo-gnome: the big world of small RNAs. Science 309:1519. 1100. Filipowicz, W. 2005. RNAi: the nuts and bolts of the RISC machine. Cell 122:17. 1101. Brown, K. M., C. Y. Chu, and T. M. Rana. 2005. Target accessibility dictates the potency of human RISC. Nat Struct Mol Biol 12:469. 1102. Overhoff, M., M. Alken, R. K. Far, M. Lemaitre, B. Lebleu, G. Sczakiel, and I. Robbins. 2005. Local RNA target structure influences siRNA efficacy: a systematic global analysis. J Mol Biol 348:871. 1103. Reynolds, A., D. Leake, Q. Boese, S. Scaringe, W. S. Marshall, and A. Khvorova. 2004. Rational siRNA design for RNA interference. Nat Biotechnol 22:326. 1104. Amarzguioui, M., and H. Prydz. 2004. An algorithm for selection of functional siRNA sequences. Biochem Biophys Res Commun 316:1050. 1105. Martinez, J., A. Patkaniowska, H. Urlaub, R. Luhrmann, and T. Tuschl. 2002. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563. 1106. Holen, T., M. Amarzguioui, M. T. Wiiger, E. Babaie, and H. Prydz. 2002. Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res 30:1757. 1107. Schwarz, D. S., G. Hutvagner, B. Haley, and P. D. Zamore. 2002. Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Mol Cell 10:537. 1108. Amarzguioui, M., T. Holen, E. Babaie, and H. Prydz. 2003. Tolerance for mutations and chemical modifications in a siRNA. Nucleic Acids Res 31:589. 1109. Lagos-Quintana, M., R. Rauhut, A. Yalcin, J. Meyer, W. Lendeckel, and T. Tuschl. 2002. Identification of tissue-specific microRNAs from mouse. Curr Biol 12:735. 1110. Cho, J., M. Melnick, G. P. Solidakis, and P. N. Tsichlis. 2005. Tpl2 (tumor progression locus 2) phosphorylation at Thr290 is induced by lipopolysaccharide via an Ikappa-B Kinase-beta- dependent pathway and is required for Tpl2 activation by external signals. J Biol Chem 280:20442. 1111. Channavajhala, P. L., L. Wu, J. W. Cuozzo, J. P. Hall, W. Liu, L. L. Lin, and Y. Zhang. 2003. Identification of a novel human kinase supporter of Ras (hKSR-2) that functions as a negative regulator of Cot (Tpl2) signaling. J Biol Chem 278:47089.

292 1112. Jacobs, A. T., and L. J. Ignarro. 2003. Cell density-enhanced expression of inducible nitric oxide synthase in murine macrophages mediated by interferon-beta. Nitric Oxide 8:222. 1113. Puthenveetil, S., L. Whitby, J. Ren, K. Kelnar, J. F. Krebs, and P. A. Beal. 2006. Controlling activation of the RNA-dependent protein kinase by siRNAs using site-specific chemical modification. Nucleic Acids Res 34:4900. 1114. Davidson, B. L., and R. L. Boudreau. 2007. RNA interference: a tool for querying nervous system function and an emerging therapy. Neuron 53:781. 1115. Zhang, F., C. Li, H. Halfter, and J. Liu. 2003. Delineating an oncostatin M-activated STAT3 signaling pathway that coordinates the expression of genes involved in cell cycle regulation and extracellular matrix deposition of MCF-7 cells. Oncogene 22:894. 1116. Okamura, H., K. Yoshida, E. Sasaki, L. Qiu, B. R. Amorim, H. Morimoto, and T. Haneji. 2007. Expression of PTEN and Akt phosphorylation in lipopolysaccharide-treated NIH3T3 cells. Cell Biol Int 31:119. 1117. Elbashir, S. M., J. Harborth, K. Weber, and T. Tuschl. 2002. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26:199. 1118. Kim, D. H., M. A. Behlke, S. D. Rose, M. S. Chang, S. Choi, and J. J. Rossi. 2005. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat Biotechnol 23:222. 1119. Ui-Tei, K., Y. Naito, and K. Saigo. 2007. Guidelines for the selection of effective short- interfering RNA sequences for functional genomics. Methods Mol Biol 361:201. 1120. Ui-Tei, K., Y. Naito, and K. Saigo. 2006. Essential Notes Regarding the Design of Functional siRNAs for Efficient Mammalian RNAi. J Biomed Biotechnol 2006:65052. 1121. Yi, Y., A. Singh, J. Cutilli, and R. G. Collman. 2004. Use of dual recombinant vaccinia virus vectors to assay viral glycoprotein-mediated fusion with transfection-resistant primary cell targets. Methods Mol Biol 269:333. 1122. Wieser, R. J., D. Renauer, A. Schafer, R. Heck, R. Engel, S. Schutz, and F. Oesch. 1990. Growth control in mammalian cells by cell-cell contacts. Environ Health Perspect 88:251. 1123. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, and R. D. Schreiber. 1998. How cells respond to interferons. Annu Rev Biochem 67:227. 1124. Minks, M. A., S. Benvin, P. A. Maroney, and C. Baglioni. 1979. Synthesis of 2'5'-oligo(A) in extracts of interferon-treated HeLa cells. J Biol Chem 254:5058. 1125. Manche, L., S. R. Green, C. Schmedt, and M. B. Mathews. 1992. Interactions between double- stranded RNA regulators and the protein kinase DAI. Mol Cell Biol 12:5238. 1126. Maitra, R. K., N. A. McMillan, S. Desai, J. McSwiggen, A. G. Hovanessian, G. Sen, B. R. Williams, and R. H. Silverman. 1994. HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes. Virology 204:823. 1127. Bridge, A. J., S. Pebernard, A. Ducraux, A. L. Nicoulaz, and R. Iggo. 2003. Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34:263. 1128. Pebernard, S., and R. D. Iggo. 2004. Determinants of interferon-stimulated gene induction by RNAi vectors. Differentiation 72:103. 1129. Jackson, A. L., and P. S. Linsley. 2004. Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20:521. 1130. Grimm, D., K. L. Streetz, C. L. Jopling, T. A. Storm, K. Pandey, C. R. Davis, P. Marion, F. Salazar, and M. A. Kay. 2006. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 441:537. 1131. Tanaka, M., and A. Miyajima. 2003. Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol 149:39. 1132. Gomez-Lechon, M. J. 1999. Oncostatin M: signal transduction and biological activity. Life Sci 65:2019. 1133. Grant, S. L., and C. G. Begley. 1999. The oncostatin M signalling pathway: reversing the neoplastic phenotype? Mol Med Today 5:406. 1134. Chen, S. H., and E. N. Benveniste. 2004. Oncostatin M: a pleiotropic cytokine in the central nervous system. Cytokine Growth Factor Rev 15:379. 1135. Heinrich, P. C., I. Behrmann, S. Haan, H. M. Hermanns, G. Muller-Newen, and F. Schaper. 2003. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374:1. 1136. Mundschau, L. J., and D. V. Faller. 1995. Platelet-derived growth factor signal transduction through the interferon-inducible kinase PKR. Immediate early gene induction. J Biol Chem 270:3100.

293 1137. Deb, A., M. Zamanian-Daryoush, Z. Xu, S. Kadereit, and B. R. Williams. 2001. Protein kinase PKR is required for platelet-derived growth factor signaling of c-fos gene expression via Erks and Stat3. Embo J 20:2487. 1138. Liu, J., N. Hadjokas, B. Mosley, Z. Estrov, M. J. Spence, and R. E. Vestal. 1998. Oncostatin M- specific receptor expression and function in regulating cell proliferation of normal and malignant mammary epithelial cells. Cytokine 10:295. 1139. Kim, H., C. Jo, B. G. Jang, U. Oh, and S. A. Jo. 2008. Oncostatin M induces growth arrest of skeletal muscle cells in G1 phase by regulating cyclin D1 protein level. Cell Signal 20:120. 1140. Badache, A., and N. E. Hynes. 2001. Interleukin 6 inhibits proliferation and, in cooperation with an epidermal growth factor receptor autocrine loop, increases migration of T47D breast cancer cells. Cancer Res 61:383. 1141. Li, C., T. E. Ahlborn, F. B. Kraemer, and J. Liu. 2001. Oncostatin M-induced growth inhibition and morphological changes of MDA-MB231 breast cancer cells are abolished by blocking the MEK/ERK signaling pathway. Breast Cancer Res Treat 66:111. 1142. Sempere, L. F., S. Freemantle, I. Pitha-Rowe, E. Moss, E. Dmitrovsky, and V. Ambros. 2004. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol 5:R13. 1143. Lu, J., G. Getz, E. A. Miska, E. Alvarez-Saavedra, J. Lamb, D. Peck, A. Sweet-Cordero, B. L. Ebert, R. H. Mak, A. A. Ferrando, J. R. Downing, T. Jacks, H. R. Horvitz, and T. R. Golub. 2005. MicroRNA expression profiles classify human cancers. Nature 435:834. 1144. Garcia, M. A., E. F. Meurs, and M. Esteban. 2007. The dsRNA protein kinase PKR: virus and cell control. Biochimie 89:799. 1145. Lo, W. Y., C. C. Lai, C. H. Hua, M. H. Tsai, S. Y. Huang, C. H. Tsai, and F. J. Tsai. 2007. S100A8 is identified as a biomarker of HPV18-infected oral squamous cell carcinomas by suppression subtraction hybridization, clinical proteomics analysis, and immunohistochemistry staining. J Proteome Res 6:2143. 1146. Pantaleo, G., C. Graziosi, and A. S. Fauci. 1993. New concepts in the immunopathogenesis of human immunodeficiency virus infection. N Engl J Med 328:327. 1147. Garcia-Sastre, A., and C. A. Biron. 2006. Type 1 interferons and the virus-host relationship: a lesson in detente. Science 312:879. 1148. Gwinn, M. R., and V. Vallyathan. 2006. Respiratory burst: role in signal transduction in alveolar macrophages. J Toxicol Environ Health B Crit Rev 9:27. 1149. Brooks, D. G., M. J. Trifilo, K. H. Edelmann, L. Teyton, D. B. McGavern, and M. B. Oldstone. 2006. Interleukin-10 determines viral clearance or persistence in vivo. Nat Med 12:1301. 1150. Bowie, A. G., and K. A. Fitzgerald. 2007. RIG-I: tri-ing to discriminate between self and non- self RNA. Trends Immunol 28:147. 1151. Elco, C. P., J. M. Guenther, B. R. Williams, and G. C. Sen. 2005. Analysis of genes induced by Sendai virus infection of mutant cell lines reveals essential roles of interferon regulatory factor 3, NF-kappaB, and interferon but not toll-like receptor 3. J Virol 79:3920. 1152. Edelmann, K. H., S. Richardson-Burns, L. Alexopoulou, K. L. Tyler, R. A. Flavell, and M. B. Oldstone. 2004. Does Toll-like receptor 3 play a biological role in virus infections? Virology 322:231. 1153. Schroder, M., and A. G. Bowie. 2005. TLR3 in antiviral immunity: key player or bystander? Trends Immunol 26:462. 1154. Sen, G. C., and S. N. Sarkar. 2005. Transcriptional signaling by double-stranded RNA: role of TLR3. Cytokine Growth Factor Rev 16:1. 1155. Fremont, M., F. Vaeyens, C. V. Herst, K. L. De Meirleir, and P. Englebienne. 2006. Double- stranded RNA-dependent protein kinase (PKR) is a stress-responsive kinase that induces NFkappaB-mediated resistance against mercury cytotoxicity. Life Sci 78:1845. 1156. Abraham, N., D. F. Stojdl, P. I. Duncan, N. Methot, T. Ishii, M. Dube, B. C. Vanderhyden, H. L. Atkins, D. A. Gray, M. W. McBurney, A. E. Koromilas, E. G. Brown, N. Sonenberg, and J. C. Bell. 1999. Characterization of transgenic mice with targeted disruption of the catalytic domain of the double-stranded RNA-dependent protein kinase, PKR. J Biol Chem 274:5953. 1157. Honda, K., S. Sakaguchi, C. Nakajima, A. Watanabe, H. Yanai, M. Matsumoto, T. Ohteki, T. Kaisho, A. Takaoka, S. Akira, T. Seya, and T. Taniguchi. 2003. Selective contribution of IFN- alpha/beta signaling to the maturation of dendritic cells induced by double-stranded RNA or viral infection. Proc Natl Acad Sci U S A 100:10872.

294 1158. Hoebe, K., E. M. Janssen, S. O. Kim, L. Alexopoulou, R. A. Flavell, J. Han, and B. Beutler. 2003. Upregulation of costimulatory molecules induced by lipopolysaccharide and double- stranded RNA occurs by Trif-dependent and Trif-independent pathways. Nat Immunol 4:1223. 1159. Diebold, S. S., M. Montoya, H. Unger, L. Alexopoulou, P. Roy, L. E. Haswell, A. Al-Shamkhani, R. Flavell, P. Borrow, and C. Reis e Sousa. 2003. Viral infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 424:324. 1160. Koromilas, A. E., S. Roy, G. N. Barber, M. G. Katze, and N. Sonenberg. 1992. Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science 257:1685. 1161. Lengyel, P. 1993. Tumor-suppressor genes: news about the interferon connection. Proc Natl Acad Sci U S A 90:5893. 1162. Meurs, E. F., J. Galabru, G. N. Barber, M. G. Katze, and A. G. Hovanessian. 1993. Tumor suppressor function of the interferon-induced double-stranded RNA-activated protein kinase. Proc Natl Acad Sci U S A 90:232. 1163. Williams, B. R. 1999. PKR; a sentinel kinase for cellular stress. Oncogene 18:6112. 1164. Lemaire, P. A., J. Lary, and J. L. Cole. 2005. Mechanism of PKR activation: dimerization and kinase activation in the absence of double-stranded RNA. J Mol Biol 345:81. 1165. Fierro-Monti, I., and M. B. Mathews. 2000. Proteins binding to duplexed RNA: one motif, multiple functions. Trends Biochem Sci 25:241. 1166. Stefl, R., L. Skrisovska, and F. H. Allain. 2005. RNA sequence- and shape-dependent recognition by proteins in the ribonucleoprotein particle. EMBO Rep 6:33. 1167. Saunders, L. R., and G. N. Barber. 2003. The dsRNA binding protein family: critical roles, diverse cellular functions. Faseb J 17:961. 1168. Tian, B., P. C. Bevilacqua, A. Diegelman-Parente, and M. B. Mathews. 2004. The double- stranded-RNA-binding motif: interference and much more. Nat Rev Mol Cell Biol 5:1013. 1169. Goh, K. C., M. J. deVeer, and B. R. Williams. 2000. The protein kinase PKR is required for p38 MAPK activation and the innate immune response to bacterial endotoxin. Embo J 19:4292. 1170. Ramana, C. V., N. Grammatikakis, M. Chernov, H. Nguyen, K. C. Goh, B. R. Williams, and G. R. Stark. 2000. Regulation of c-myc expression by IFN-gamma through Stat1-dependent and - independent pathways. Embo J 19:263. 1171. Deb, A., S. J. Haque, T. Mogensen, R. H. Silverman, and B. R. Williams. 2001. RNA-dependent protein kinase PKR is required for activation of NF-kappa B by IFN-gamma in a STAT1- independent pathway. J Immunol 166:6170. 1172. Hovanessian, A. G., and J. Galabru. 1987. The double-stranded RNA-dependent protein kinase is also activated by heparin. Eur J Biochem 167:467. 1173. Ito, T., M. Yang, and W. S. May. 1999. RAX, a cellular activator for double-stranded RNA- dependent protein kinase during stress signaling. J Biol Chem 274:15427. 1174. Ruvolo, P. P., F. Gao, W. L. Blalock, X. Deng, and W. S. May. 2001. Ceramide regulates protein synthesis by a novel mechanism involving the cellular PKR activator RAX. J Biol Chem 276:11754. 1175. Garcia, M. A., J. Gil, I. Ventoso, S. Guerra, E. Domingo, C. Rivas, and M. Esteban. 2006. Impact of protein kinase PKR in cell biology: from antiviral to antiproliferative action. Microbiol Mol Biol Rev 70:1032. 1176. Gil, J., J. Alcami, and M. Esteban. 1999. Induction of apoptosis by double-stranded-RNA- dependent protein kinase (PKR) involves the alpha subunit of eukaryotic translation initiation factor 2 and NF-kappaB. Mol Cell Biol 19:4653. 1177. Williams, B. R. 2001. Signal integration via PKR. Sci STKE 2001:RE2. 1178. Silva, A. M., M. Whitmore, Z. Xu, Z. Jiang, X. Li, and B. R. Williams. 2004. Protein kinase R (PKR) interacts with and activates mitogen-activated protein kinase kinase 6 (MKK6) in response to double-stranded RNA stimulation. J Biol Chem 279:37670. 1179. Gil, J., M. A. Garcia, P. Gomez-Puertas, S. Guerra, J. Rullas, H. Nakano, J. Alcami, and M. Esteban. 2004. TRAF family proteins link PKR with NF-kappa B activation. Mol Cell Biol 24:4502. 1180. Jiang, Z., M. Zamanian-Daryoush, H. Nie, A. M. Silva, B. R. Williams, and X. Li. 2003. Poly(I- C)-induced Toll-like receptor 3 (TLR3)-mediated activation of NFkappa B and MAP kinase is through an interleukin-1 receptor-associated kinase (IRAK)-independent pathway employing the signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J Biol Chem 278:16713. 1181. Horng, T., G. M. Barton, and R. Medzhitov. 2001. TIRAP: an adapter molecule in the Toll signaling pathway. Nat Immunol 2:835.

295 1182. Hacker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, M. P. Kamps, E. Raz, H. Wagner, G. Hacker, M. Mann, and M. Karin. 2006. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 439:204. 1183. Goodbourn, S., L. Didcock, and R. E. Randall. 2000. Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures. J Gen Virol 81:2341. 1184. Hovanessian, A. G. 1991. Interferon-induced and double-stranded RNA-activated enzymes: a specific protein kinase and 2',5'-oligoadenylate synthetases. J Interferon Res 11:199. 1185. Zhou, A., B. A. Hassel, and R. H. Silverman. 1993. Expression cloning of 2-5A-dependent RNAase: a uniquely regulated mediator of interferon action. Cell 72:753. 1186. Samuel, C. E. 1991. Antiviral actions of interferon. Interferon-regulated cellular proteins and their surprisingly selective antiviral activities. Virology 183:1. 1187. Benech, P., Y. Mory, M. Revel, and J. Chebath. 1985. Structure of two forms of the interferon- induced (2'-5') oligo A synthetase of human cells based on cDNAs and gene sequences. Embo J 4:2249. 1188. Williams, B. R., R. R. Golgher, R. E. Brown, C. S. Gilbert, and I. M. Kerr. 1979. Natural occurrence of 2-5A in interferon-treated EMC virus-infected L cells. Nature 282:582. 1189. Laurence, L., D. Roux, H. Cailla, Y. Riviere, R. Marcovistz, and A. Hovanessian. 1985. Comparison of the effects of rabies virus infection and of combined interferon and poly(I).poly(C) treatment on the levels of 2',5'-adenyladenosine oligonucleotides in different organs of mice. Virology 143:290. 1190. Zhou, A., J. Paranjape, T. L. Brown, H. Nie, S. Naik, B. Dong, A. Chang, B. Trapp, R. Fairchild, C. Colmenares, and R. H. Silverman. 1997. Interferon action and apoptosis are defective in mice devoid of 2',5'-oligoadenylate-dependent RNase L. Embo J 16:6355. 1191. Chebath, J., P. Benech, M. Revel, and M. Vigneron. 1987. Constitutive expression of (2'-5') oligo A synthetase confers resistance to picornavirus infection. Nature 330:587. 1192. Coccia, E. M., G. Romeo, A. Nissim, G. Marziali, R. Albertini, E. Affabris, A. Battistini, G. Fiorucci, R. Orsatti, G. B. Rossi, and et al. 1990. A full-length murine 2-5A synthetase cDNA transfected in NIH-3T3 cells impairs EMCV but not VSV replication. Virology 179:228. 1193. Schroder, H. C., D. Ugarkovic, H. Merz, Y. Kuchino, T. Okamoto, and W. E. Muller. 1990. Protection of HeLa-T4+ cells against human immunodeficiency virus (HIV) infection after stable transfection with HIV LTR-2',5'-oligoadenylate synthetase hybrid gene. Faseb J 4:3124. 1194. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730. 1195. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr., S. Akira, S. Yonehara, A. Kato, and T. Fujita. 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175:2851. 1196. Gitlin, L., W. Barchet, S. Gilfillan, M. Cella, B. Beutler, R. A. Flavell, M. S. Diamond, and M. Colonna. 2006. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci U S A 103:8459. 1197. Rothenfusser, S., N. Goutagny, G. DiPerna, M. Gong, B. G. Monks, A. Schoenemeyer, M. Yamamoto, S. Akira, and K. A. Fitzgerald. 2005. The RNA helicase Lgp2 inhibits TLR- independent sensing of viral replication by retinoic acid-inducible gene-I. J Immunol 175:5260. 1198. Kovacsovics, M., F. Martinon, O. Micheau, J. L. Bodmer, K. Hofmann, and J. Tschopp. 2002. Overexpression of Helicard, a CARD-containing helicase cleaved during apoptosis, accelerates DNA degradation. Curr Biol 12:838. 1199. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101. 1200. Saito, T., R. Hirai, Y. M. Loo, D. Owen, C. L. Johnson, S. C. Sinha, S. Akira, T. Fujita, and M. Gale, Jr. 2007. Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proc Natl Acad Sci U S A 104:582. 1201. Garner, B., W. Li, K. Roberg, and U. T. Brunk. 1997. On the cytoprotective role of ferritin in macrophages and its ability to enhance lysosomal stability. Free Radic Res 27:487. 1202. Boyum, A. 1968. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 97:77.

296 1203. Tedla, N., C. Bandeira-Melo, P. Tassinari, D. E. Sloane, M. Samplaski, D. Cosman, L. Borges, P. F. Weller, and J. P. Arm. 2003. Activation of human eosinophils through leukocyte immunoglobulin-like receptor 7. Proc Natl Acad Sci U S A 100:1174. 1204. Budd, A., L. Alleva, M. Alsharifi, A. Koskinen, V. Smythe, A. Mullbacher, J. Wood, and I. Clark. 2007. Increased survival after gemfibrozil treatment of severe mouse influenza. Antimicrob Agents Chemother 51:2965. 1205. Clark, I. A., M. M. Awburn, R. O. Whitten, C. G. Harper, N. G. Liomba, M. E. Molyneux, and T. E. Taylor. 2003. Tissue distribution of migration inhibitory factor and inducible nitric oxide synthase in falciparum malaria and sepsis in African children. Malar J 2:6. 1206. Kocher, M., P. A. Kenny, E. Farram, K. B. Abdul Majid, J. J. Finlay-Jones, and C. L. Geczy. 1996. Functional chemotactic factor CP-10 and MRP-14 are abundant in murine abscesses. Infect Immun 64:1342. 1207. Clark, I. A., M. M. Awburn, C. G. Harper, N. G. Liomba, and M. E. Molyneux. 2003. Induction of HO-1 in tissue macrophages and monocytes in fatal falciparum malaria and sepsis. Malar J 2:41. 1208. Yamamoto, M., S. Sato, K. Mori, K. Hoshino, O. Takeuchi, K. Takeda, and S. Akira. 2002. Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling. J Immunol 169:6668. 1209. Cabanski, M., M. Steinmuller, L. M. Marsh, E. Surdziel, W. Seeger, and J. Lohmeyer. 2008. PKR regulates TLR2/TLR4-dependent signaling in murine alveolar macrophages. Am J Respir Cell Mol Biol 38:26. 1210. Li, J. C., D. C. Lee, B. K. Cheung, and A. S. Lau. 2005. Mechanisms for HIV Tat upregulation of IL-10 and other cytokine expression: kinase signaling and PKR-mediated immune response. FEBS Lett 579:3055. 1211. Marteau, F., D. Communi, J. M. Boeynaems, and N. Suarez Gonzalez. 2004. Involvement of multiple P2Y receptors and signaling pathways in the action of adenine nucleotides diphosphates on human monocyte-derived dendritic cells. J Leukoc Biol 76:796. 1212. Csoka, B., Z. H. Nemeth, L. Virag, P. Gergely, S. J. Leibovich, P. Pacher, C. X. Sun, M. R. Blackburn, E. S. Vizi, E. A. Deitch, and G. Hasko. 2007. A2A adenosine receptors and C/EBPbeta are crucially required for IL-10 production by macrophages exposed to Escherichia coli. Blood 110:2685. 1213. Haschemi, A., O. Wagner, R. Marculescu, B. Wegiel, S. C. Robson, N. Gagliani, D. Gallo, J. F. Chen, F. H. Bach, and L. E. Otterbein. 2007. Cross-regulation of carbon monoxide and the adenosine A2a receptor in macrophages. J Immunol 178:5921. 1214. Moran, J. M., M. A. Moxley, R. M. Buller, and J. A. Corbett. 2005. Encephalomyocarditis virus induces PKR-independent mitogen-activated protein kinase activation in macrophages. J Virol 79:10226. 1215. Iordanov, M. S., J. Wong, J. C. Bell, and B. E. Magun. 2001. Activation of NF-kappaB by double-stranded RNA (dsRNA) in the absence of protein kinase R and RNase L demonstrates the existence of two separate dsRNA-triggered antiviral programs. Mol Cell Biol 21:61. 1216. Wathelet, M. G., I. M. Clauss, F. C. Paillard, and G. A. Huez. 1989. 2-Aminopurine selectively blocks the transcriptional activation of cellular genes by virus, double-stranded RNA and interferons in human cells. Eur J Biochem 184:503. 1217. Haddad, J. J., N. E. Saade, and B. Safieh-Garabedian. 2003. Interleukin-10 and the regulation of mitogen-activated protein kinases: are these signalling modules targets for the anti-inflammatory action of this cytokine? Cell Signal 15:255. 1218. Stewart, M. J., S. B. Kulkarni, T. R. Meusel, and F. Imani. 2006. c-Jun N-terminal kinase negatively regulates dsRNA and RSV induction of tumor necrosis factor- alpha transcription in human epithelial cells. J Interferon Cytokine Res 26:521. 1219. Steer, S. A., J. M. Moran, B. S. Christmann, L. B. Maggi, Jr., and J. A. Corbett. 2006. Role of MAPK in the regulation of double-stranded RNA- and encephalomyocarditis virus-induced cyclooxygenase-2 expression by macrophages. J Immunol 177:3413. 1220. Marra, M. A., S. J. Jones, C. R. Astell, R. A. Holt, A. Brooks-Wilson, Y. S. Butterfield, J. Khattra, J. K. Asano, S. A. Barber, S. Y. Chan, A. Cloutier, S. M. Coughlin, D. Freeman, N. Girn, O. L. Griffith, S. R. Leach, M. Mayo, H. McDonald, S. B. Montgomery, P. K. Pandoh, A. S. Petrescu, A. G. Robertson, J. E. Schein, A. Siddiqui, D. E. Smailus, J. M. Stott, G. S. Yang, F. Plummer, A. Andonov, H. Artsob, N. Bastien, K. Bernard, T. F. Booth, D. Bowness, M. Czub, M. Drebot, L. Fernando, R. Flick, M. Garbutt, M. Gray, A. Grolla, S. Jones, H. Feldmann, A. Meyers, A. Kabani, Y. Li, S. Normand, U. Stroher, G. A. Tipples, S. Tyler, R. Vogrig, D. Ward,

297 B. Watson, R. C. Brunham, M. Krajden, M. Petric, D. M. Skowronski, C. Upton, and R. L. Roper. 2003. The Genome sequence of the SARS-associated coronavirus. Science 300:1399. 1221. Donnelly, C. A., A. C. Ghani, G. M. Leung, A. J. Hedley, C. Fraser, S. Riley, L. J. Abu-Raddad, L. M. Ho, T. Q. Thach, P. Chau, K. P. Chan, T. H. Lam, L. Y. Tse, T. Tsang, S. H. Liu, J. H. Kong, E. M. Lau, N. M. Ferguson, and R. M. Anderson. 2003. Epidemiological determinants of spread of causal agent of severe acute respiratory syndrome in Hong Kong. Lancet 361:1761. 1222. Peiris, J. S., K. Y. Yuen, A. D. Osterhaus, and K. Stohr. 2003. The severe acute respiratory syndrome. N Engl J Med 349:2431. 1223. Gu, J., and C. Korteweg. 2007. Pathology and pathogenesis of severe acute respiratory syndrome. Am J Pathol 170:1136. 1224. Gu, J., E. Gong, B. Zhang, J. Zheng, Z. Gao, Y. Zhong, W. Zou, J. Zhan, S. Wang, Z. Xie, H. Zhuang, B. Wu, H. Zhong, H. Shao, W. Fang, D. Gao, F. Pei, X. Li, Z. He, D. Xu, X. Shi, V. M. Anderson, and A. S. Leong. 2005. Multiple organ infection and the pathogenesis of SARS. J Exp Med 202:415. 1225. Nicholls, J. M., L. L. Poon, K. C. Lee, W. F. Ng, S. T. Lai, C. Y. Leung, C. M. Chu, P. K. Hui, K. L. Mak, W. Lim, K. W. Yan, K. H. Chan, N. C. Tsang, Y. Guan, K. Y. Yuen, and J. S. Peiris. 2003. Lung pathology of fatal severe acute respiratory syndrome. Lancet 361:1773. 1226. Marzi, A., T. Gramberg, G. Simmons, P. Moller, A. J. Rennekamp, M. Krumbiegel, M. Geier, J. Eisemann, N. Turza, B. Saunier, A. Steinkasserer, S. Becker, P. Bates, H. Hofmann, and S. Pohlmann. 2004. DC-SIGN and DC-SIGNR interact with the glycoprotein of Marburg virus and the S protein of severe acute respiratory syndrome coronavirus. J Virol 78:12090. 1227. Kuba, K., Y. Imai, S. Rao, H. Gao, F. Guo, B. Guan, Y. Huan, P. Yang, Y. Zhang, W. Deng, L. Bao, B. Zhang, G. Liu, Z. Wang, M. Chappell, Y. Liu, D. Zheng, A. Leibbrandt, T. Wada, A. S. Slutsky, D. Liu, C. Qin, C. Jiang, and J. M. Penninger. 2005. A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury. Nat Med 11:875. 1228. Hamming, I., W. Timens, M. L. Bulthuis, A. T. Lely, G. J. Navis, and H. van Goor. 2004. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol 203:631. 1229. Law, H. K., C. Y. Cheung, H. Y. Ng, S. F. Sia, Y. O. Chan, W. Luk, J. M. Nicholls, J. S. Peiris, and Y. L. Lau. 2005. Chemokine up-regulation in SARS-coronavirus-infected, monocyte- derived human dendritic cells. Blood 106:2366. 1230. Cheung, C. Y., L. L. Poon, I. H. Ng, W. Luk, S. F. Sia, M. H. Wu, K. H. Chan, K. Y. Yuen, S. Gordon, Y. Guan, and J. S. Peiris. 2005. Cytokine responses in severe acute respiratory syndrome coronavirus-infected macrophages in vitro: possible relevance to pathogenesis. J Virol 79:7819. 1231. Rice, A. P., and M. B. Mathews. 1988. Transcriptional but not translational regulation of HIV-1 by the tat gene product. Nature 332:551. 1232. Nath, A., K. Conant, P. Chen, C. Scott, and E. O. Major. 1999. Transient exposure to HIV-1 Tat protein results in cytokine production in macrophages and astrocytes. A hit and run phenomenon. J Biol Chem 274:17098. 1233. Ryckman, C., G. A. Robichaud, J. Roy, R. Cantin, M. J. Tremblay, and P. A. Tessier. 2002. HIV-1 transcription and virus production are both accentuated by the proinflammatory myeloid- related proteins in human CD4+ T lymphocytes. J Immunol 169:3307. 1234. Wherry, E. J., and R. Ahmed. 2004. Memory CD8 T-cell differentiation during viral infection. J Virol 78:5535. 1235. Blackburn, S. D., and E. J. Wherry. 2007. IL-10, T cell exhaustion and viral persistence. Trends Microbiol 15:143. 1236. Ejrnaes, M., C. M. Filippi, M. M. Martinic, E. M. Ling, L. M. Togher, S. Crotty, and M. G. von Herrath. 2006. Resolution of a chronic viral infection after interleukin-10 receptor blockade. J Exp Med 203:2461. 1237. Haddad, J. J. 2004. Oxygen sensing and oxidant/redox-related pathways. Biochem Biophys Res Commun 316:969. 1238. Sen, C. K., and L. Packer. 1996. Antioxidant and redox regulation of gene transcription. Faseb J 10:709. 1239. Rhee, S. G. 1999. Redox signaling: hydrogen peroxide as intracellular messenger. Exp Mol Med 31:53. 1240. Fridovich, I. 1995. Superoxide radical and superoxide dismutases. Annu Rev Biochem 64:97. 1241. Sturtz, L. A., K. Diekert, L. T. Jensen, R. Lill, and V. C. Culotta. 2001. A fraction of yeast Cu,Zn-superoxide dismutase and its metallochaperone, CCS, localize to the intermembrane

298 space of mitochondria. A physiological role for SOD1 in guarding against mitochondrial oxidative damage. J Biol Chem 276:38084. 1242. Kuo, P. L., C. Y. Chen, T. F. Tzeng, C. C. Lin, and Y. L. Hsu. 2008. Involvement of reactive oxygen species/c-Jun NH(2)-terminal kinase pathway in kotomolide A induces apoptosis in human breast cancer cells. Toxicol Appl Pharmacol. 1243. Nathan, C., and Q. W. Xie. 1994. Nitric oxide synthases: roles, tolls, and controls. Cell 78:915. 1244. Alderton, W. K., C. E. Cooper, and R. G. Knowles. 2001. Nitric oxide synthases: structure, function and inhibition. Biochem J 357:593. 1245. Knowles, R. G., and S. Moncada. 1994. Nitric oxide synthases in mammals. Biochem J 298 ( Pt 2):249. 1246. Ghafourifar, P., and C. Richter. 1997. Nitric oxide synthase activity in mitochondria. FEBS Lett 418:291. 1247. Gross, S. S., and M. S. Wolin. 1995. Nitric oxide: pathophysiological mechanisms. Annu Rev Physiol 57:737. 1248. Stamler, J. S. 1994. Redox signaling: nitrosylation and related target interactions of nitric oxide. Cell 78:931. 1249. Grisham, M. B., D. Jourd'Heuil, and D. A. Wink. 1999. Nitric oxide. I. Physiological chemistry of nitric oxide and its metabolites:implications in inflammation. Am J Physiol 276:G315. 1250. Zhou, J., and B. Brune. 2005. NO and transcriptional regulation: from signaling to death. Toxicology 208:223. 1251. Forman, H. J., J. M. Fukuto, and M. Torres. 2004. Redox signaling: thiol chemistry defines which reactive oxygen and nitrogen species can act as second messengers. Am J Physiol Cell Physiol 287:C246. 1252. Mannick, J. B., and C. M. Schonhoff. 2002. Nitrosylation: the next phosphorylation? Arch Biochem Biophys 408:1. 1253. Muijsers, R. B., G. Folkerts, P. A. Henricks, G. Sadeghi-Hashjin, and F. P. Nijkamp. 1997. Peroxynitrite: a two-faced metabolite of nitric oxide. Life Sci 60:1833. 1254. Moller, M., H. Botti, C. Batthyany, H. Rubbo, R. Radi, and A. Denicola. 2005. Direct measurement of nitric oxide and oxygen partitioning into liposomes and low density lipoprotein. J Biol Chem 280:8850. 1255. Denicola, A., J. M. Souza, and R. Radi. 1998. Diffusion of peroxynitrite across erythrocyte membranes. Proc Natl Acad Sci U S A 95:3566. 1256. Denicola, A., C. Batthyany, E. Lissi, B. A. Freeman, H. Rubbo, and R. Radi. 2002. Diffusion of nitric oxide into low density lipoprotein. J Biol Chem 277:932. 1257. Ghafourifar, P., and C. A. Colton. 2003. Compartmentalized nitrosation and nitration in mitochondria. Antioxid Redox Signal 5:349. 1258. Valko, M., C. J. Rhodes, J. Moncol, M. Izakovic, and M. Mazur. 2006. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact 160:1. 1259. Hensley, K., K. A. Robinson, S. P. Gabbita, S. Salsman, and R. A. Floyd. 2000. Reactive oxygen species, cell signaling, and cell injury. Free Radic Biol Med 28:1456. 1260. Evans, J. L., I. D. Goldfine, B. A. Maddux, and G. M. Grodsky. 2002. Oxidative stress and stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr Rev 23:599. 1261. Kuroki, T., K. Isshiki, and G. L. King. 2003. Oxidative stress: the lead or supporting actor in the pathogenesis of diabetic complications. J Am Soc Nephrol 14:S216. 1262. Mahadev, K., A. Zilbering, L. Zhu, and B. J. Goldstein. 2001. Insulin-stimulated hydrogen peroxide reversibly inhibits protein-tyrosine phosphatase 1b in vivo and enhances the early insulin action cascade. J Biol Chem 276:21938. 1263. Bae, Y. S., S. W. Kang, M. S. Seo, I. C. Baines, E. Tekle, P. B. Chock, and S. G. Rhee. 1997. Epidermal growth factor (EGF)-induced generation of hydrogen peroxide. Role in EGF receptor- mediated tyrosine phosphorylation. J Biol Chem 272:217. 1264. Catarzi, S., D. Degl'Innocenti, T. Iantomasi, F. Favilli, and M. T. Vincenzini. 2002. The role of H2O2 in the platelet-derived growth factor-induced transcription of the gamma-glutamylcysteine synthetase heavy subunit. Cell Mol Life Sci 59:1388. 1265. Neufeld, G., T. Cohen, S. Gengrinovitch, and Z. Poltorak. 1999. Vascular endothelial growth factor (VEGF) and its receptors. Faseb J 13:9. 1266. Chapple, I. L. 1997. Reactive oxygen species and antioxidants in inflammatory diseases. J Clin Periodontol 24:287. 1267. Salmeen, A., and D. Barford. 2005. Functions and mechanisms of redox regulation of cysteine- based phosphatases. Antioxid Redox Signal 7:560.

299 1268. Iles, K. E., and H. J. Forman. 2002. Macrophage signaling and respiratory burst. Immunol Res 26:95. 1269. Torres, M., and H. J. Forman. 1999. Activation of several MAP kinases upon stimulation of rat alveolar macrophages: role of the NADPH oxidase. Arch Biochem Biophys 366:231. 1270. Abe, J., and B. C. Berk. 1999. Fyn and JAK2 mediate Ras activation by reactive oxygen species. J Biol Chem 274:21003. 1271. Esposito, F., G. Chirico, N. Montesano Gesualdi, I. Posadas, R. Ammendola, T. Russo, G. Cirino, and F. Cimino. 2003. Protein kinase B activation by reactive oxygen species is independent of tyrosine kinase receptor phosphorylation and requires SRC activity. J Biol Chem 278:20828. 1272. Baldwin, A. S., Jr. 2001. Series introduction: the transcription factor NF-kappaB and human disease. J Clin Invest 107:3. 1273. Haddad, J. J., R. Lauterbach, N. E. Saade, B. Safieh-Garabedian, and S. C. Land. 2001. Alpha- -related tripeptide, Lys-d-Pro-Val, ameliorates endotoxin-induced nuclear factor kappaB translocation and activation: evidence for involvement of an interleukin-1beta193-195 receptor antagonism in the alveolar epithelium. Biochem J 355:29. 1274. Brownlee, M. 2001. Biochemistry and molecular cell biology of diabetic complications. Nature 414:813. 1275. Brookes, P. S., Y. Yoon, J. L. Robotham, M. W. Anders, and S. S. Sheu. 2004. Calcium, ATP, and ROS: a mitochondrial love-hate triangle. Am J Physiol Cell Physiol 287:C817. 1276. Wolin, M. S., M. Ahmad, and S. A. Gupte. 2005. Oxidant and redox signaling in vascular oxygen sensing mechanisms: basic concepts, current controversies, and potential importance of cytosolic NADPH. Am J Physiol Lung Cell Mol Physiol 289:L159. 1277. Rousset, S., M. C. Alves-Guerra, J. Mozo, B. Miroux, A. M. Cassard-Doulcier, F. Bouillaud, and D. Ricquier. 2004. The biology of mitochondrial uncoupling proteins. Diabetes 53 Suppl 1:S130. 1278. Chaplin, D. D. 2003. 1. Overview of the immune response. J Allergy Clin Immunol 111:S442. 1279. Gilroy, D. W., T. Lawrence, M. Perretti, and A. G. Rossi. 2004. Inflammatory resolution: new opportunities for drug discovery. Nat Rev Drug Discov 3:401. 1280. Sherwood, E. R., and T. Toliver-Kinsky. 2004. Mechanisms of the inflammatory response. Best Pract Res Clin Anaesthesiol 18:385. 1281. Di Virgilio, F., P. Chiozzi, D. Ferrari, S. Falzoni, J. M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, and O. R. Baricordi. 2001. Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97:587. 1282. Di Virgilio, F. 1995. The P2Z purinoceptor: an intriguing role in immunity, inflammation and cell death. Immunol Today 16:524. 1283. Di Virgilio, F., O. R. Baricordi, R. Romagnoli, and P. G. Baraldi. 2005. Leukocyte P2 receptors: a novel target for anti-inflammatory and anti-tumor therapy. Curr Drug Targets Cardiovasc Haematol Disord 5:85. 1284. North, R. A. 2002. Molecular physiology of P2X receptors. Physiol Rev 82:1013. 1285. Ferrari, D., P. Chiozzi, S. Falzoni, S. Hanau, and F. Di Virgilio. 1997. Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin. J Exp Med 185:579. 1286. Laliberte, R. E., D. G. Perregaux, P. McNiff, and C. A. Gabel. 1997. Human monocyte ATP- induced IL-1 beta posttranslational processing is a dynamic process dependent on in vitro growth conditions. J Leukoc Biol 62:227. 1287. Merrill, J. T., C. Shen, D. Schreibman, D. Coffey, O. Zakharenko, R. Fisher, R. G. Lahita, J. Salmon, and B. N. Cronstein. 1997. Adenosine A1 receptor promotion of multinucleated giant cell formation by human monocytes: a mechanism for methotrexate-induced nodulosis in rheumatoid arthritis. Arthritis Rheum 40:1308. 1288. Warny, M., S. Aboudola, S. C. Robson, J. Sevigny, D. Communi, S. P. Soltoff, and C. P. Kelly. 2001. P2Y(6) nucleotide receptor mediates monocyte interleukin-8 production in response to UDP or lipopolysaccharide. J Biol Chem 276:26051. 1289. Bshesh, K., B. Zhao, D. Spight, I. Biaggioni, I. Feokistov, A. Denenberg, H. R. Wong, and T. P. Shanley. 2002. The A2A receptor mediates an endogenous regulatory pathway of cytokine expression in THP-1 cells. J Leukoc Biol 72:1027. 1290. Into, T., K. Okada, N. Inoue, M. Yasuda, and K. Shibata. 2002. Extracellular ATP regulates cell death of lymphocytes and monocytes induced by membrane-bound lipoproteins of Mycoplasma fermentans and Mycoplasma salivarium. Microbiol Immunol 46:667.

300 1291. Elssner, A., M. Duncan, M. Gavrilin, and M. D. Wewers. 2004. A novel P2X7 receptor activator, the human cathelicidin-derived peptide LL37, induces IL-1 beta processing and release. J Immunol 172:4987. 1292. Wilson, H. L., S. E. Francis, S. K. Dower, and D. C. Crossman. 2004. Secretion of intracellular IL-1 receptor antagonist (type 1) is dependent on P2X7 receptor activation. J Immunol 173:1202. 1293. Imai, M., C. Goepfert, E. Kaczmarek, and S. C. Robson. 2000. CD39 modulates IL-1 release from activated endothelial cells. Biochem Biophys Res Commun 270:272. 1294. Enjyoji, K., J. Sevigny, Y. Lin, P. S. Frenette, P. D. Christie, J. S. Esch, 2nd, M. Imai, J. M. Edelberg, H. Rayburn, M. Lech, D. L. Beeler, E. Csizmadia, D. D. Wagner, S. C. Robson, and R. D. Rosenberg. 1999. Targeted disruption of cd39/ATP diphosphohydrolase results in disordered hemostasis and thromboregulation. Nat Med 5:1010. 1295. Koziak, K., J. Sevigny, S. C. Robson, J. B. Siegel, and E. Kaczmarek. 1999. Analysis of CD39/ATP diphosphohydrolase (ATPDase) expression in endothelial cells, platelets and leukocytes. Thromb Haemost 82:1538. 1296. Berchtold, S., A. L. Ogilvie, C. Bogdan, P. Muhl-Zurbes, A. Ogilvie, G. Schuler, and A. Steinkasserer. 1999. Human monocyte derived dendritic cells express functional P2X and P2Y receptors as well as ecto-nucleotidases. FEBS Lett 458:424. 1297. Swennen, E. L., A. Bast, and P. C. Dagnelie. 2005. Immunoregulatory effects of adenosine 5'- triphosphate on cytokine release from stimulated whole blood. Eur J Immunol 35:852. 1298. Swennen, E. L., A. Bast, and P. C. Dagnelie. 2006. Purinergic receptors involved in the immunomodulatory effects of ATP in human blood. Biochem Biophys Res Commun 348:1194. 1299. Kaufmann, A., B. Musset, S. H. Limberg, V. Renigunta, R. Sus, A. H. Dalpke, K. M. Heeg, B. Robaye, and P. J. Hanley. 2005. "Host tissue damage" signal ATP promotes non-directional migration and negatively regulates toll-like receptor signaling in human monocytes. J Biol Chem 280:32459. 1300. Nemeth, Z. H., B. Csoka, J. Wilmanski, D. Xu, Q. Lu, C. Ledent, E. A. Deitch, P. Pacher, Z. Spolarics, and G. Hasko. 2006. Adenosine A2A receptor inactivation increases survival in polymicrobial sepsis. J Immunol 176:5616. 1301. Ding, A. H., C. F. Nathan, and D. J. Stuehr. 1988. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol 141:2407. 1302. Samuni, A., J. B. Mitchell, W. DeGraff, C. M. Krishna, U. Samuni, and A. Russo. 1991. Nitroxide SOD-mimics: modes of action. Free Radic Res Commun 12-13 Pt 1:187. 1303. Samuni, A., D. Winkelsberg, A. Pinson, S. M. Hahn, J. B. Mitchell, and A. Russo. 1991. Nitroxide stable radicals protect beating cardiomyocytes against oxidative damage. J Clin Invest 87:1526. 1304. Purpura, P., L. Westman, P. Will, A. Eidelman, V. E. Kagan, A. N. Osipov, and N. F. Schor. 1996. Adjunctive treatment of murine neuroblastoma with 6-hydroxydopamine and Tempol. Cancer Res 56:2336. 1305. Vejrazka, M., R. Micek, and S. Stipek. 2005. Apocynin inhibits NADPH oxidase in phagocytes but stimulates ROS production in non-phagocytic cells. Biochim Biophys Acta 1722:143. 1306. Heumuller, S., S. Wind, E. Barbosa-Sicard, H. H. Schmidt, R. Busse, K. Schroder, and R. P. Brandes. 2008. Apocynin is not an inhibitor of vascular NADPH oxidases but an antioxidant. Hypertension 51:211. 1307. Ward, N. E., G. Fan, and C. A. O'Brian. 1999. Differential non-redox inhibitory effects of glutathione against protein kinase C isozyme family members. Oncol Rep 6:307. 1308. Camhi, S. L., J. Alam, G. W. Wiegand, B. Y. Chin, and A. M. Choi. 1998. Transcriptional activation of the HO-1 gene by lipopolysaccharide is mediated by 5' distal enhancers: role of reactive oxygen intermediates and AP-1. Am J Respir Cell Mol Biol 18:226. 1309. Cheng, T. H., N. L. Shih, S. Y. Chen, D. L. Wang, and J. J. Chen. 1999. Reactive oxygen species modulate endothelin-I-induced c-fos gene expression in cardiomyocytes. Cardiovasc Res 41:654. 1310. Kremer, K. N., A. Kumar, and K. E. Hedin. 2007. Haplotype-independent costimulation of IL-10 secretion by SDF-1/CXCL12 proceeds via AP-1 binding to the human IL-10 promoter. J Immunol 178:1581. 1311. Cross, A. R., and O. T. Jones. 1986. The effect of the inhibitor diphenylene iodonium on the superoxide-generating system of neutrophils. Specific labelling of a component polypeptide of the oxidase. Biochem J 237:111. 1312. Riganti, C., E. Gazzano, M. Polimeni, C. Costamagna, A. Bosia, and D. Ghigo. 2004. Diphenyleneiodonium inhibits the cell redox metabolism and induces oxidative stress. J Biol Chem 279:47726.

301 1313. Lapperre, T. S., L. A. Jimenez, F. Antonicelli, E. M. Drost, P. S. Hiemstra, J. Stolk, W. MacNee, and I. Rahman. 1999. Apocynin increases glutathione synthesis and activates AP-1 in alveolar epithelial cells. FEBS Lett 443:235. 1314. O'Donnell, V. B., G. C. Smith, and O. T. Jones. 1994. Involvement of phenyl radicals in iodonium inhibition of flavoenzymes. Mol Pharmacol 46:778. 1315. Wyatt, C. N., E. K. Weir, and C. Peers. 1994. Diphenylene iodonium blocks K+ and Ca2+ currents in type I cells isolated from the neonatal rat . Neurosci Lett 172:63. 1316. Weir, E. K., C. N. Wyatt, H. L. Reeve, J. Huang, S. L. Archer, and C. Peers. 1994. Diphenyleneiodonium inhibits both potassium and calcium currents in isolated pulmonary artery smooth muscle cells. J Appl Physiol 76:2611. 1317. Li, Y., and M. A. Trush. 1998. Diphenyleneiodonium, an NAD(P)H oxidase inhibitor, also potently inhibits mitochondrial reactive oxygen species production. Biochem Biophys Res Commun 253:295. 1318. Savina, A., and S. Amigorena. 2007. Phagocytosis and antigen presentation in dendritic cells. Immunol Rev 219:143. 1319. Geiszt, M., and T. L. Leto. 2004. The Nox family of NAD(P)H oxidases: host defense and beyond. J Biol Chem 279:51715. 1320. Doussiere, J., and P. V. Vignais. 1992. Diphenylene iodonium as an inhibitor of the NADPH oxidase complex of bovine neutrophils. Factors controlling the inhibitory potency of diphenylene iodonium in a cell-free system of oxidase activation. Eur J Biochem 208:61. 1321. Tew, D. G. 1993. Inhibition of cytochrome P450 reductase by the diphenyliodonium cation. Kinetic analysis and covalent modifications. Biochemistry 32:10209. 1322. Holland, P. C., M. G. Clark, D. P. Bloxham, and H. A. Lardy. 1973. Mechanism of action of the hypoglycemic agent diphenyleneiodonium. J Biol Chem 248:6050. 1323. Gatley, S. J., and S. A. Sherratt. 1976. The effects of diphenyleneiodonium on mitochondrial reactions. Relation of binding of diphenylene[125I]iodonium to mitochondria to the extent of inhibition of oxygen uptake. Biochem J 158:307. 1324. Ragan, C. I., and D. P. Bloxham. 1977. Specific labelling of a constituent polypeptide of bovine heart mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone reductase by the inhibitor diphenyleneiodonium. Biochem J 163:605. 1325. Majander, A., M. Finel, and M. Wikstrom. 1994. Diphenyleneiodonium inhibits reduction of iron-sulfur clusters in the mitochondrial NADH-ubiquinone oxidoreductase (Complex I). J Biol Chem 269:21037. 1326. Stolk, J., T. J. Hiltermann, J. H. Dijkman, and A. J. Verhoeven. 1994. Characteristics of the inhibition of NADPH oxidase activation in neutrophils by apocynin, a methoxy-substituted catechol. Am J Respir Cell Mol Biol 11:95. 1327. Johnson, D. K., K. J. Schillinger, D. M. Kwait, C. V. Hughes, E. J. McNamara, F. Ishmael, R. W. O'Donnell, M. M. Chang, M. G. Hogg, J. S. Dordick, L. Santhanam, L. M. Ziegler, and J. A. Holland. 2002. Inhibition of NADPH oxidase activation in endothelial cells by ortho-methoxy- substituted catechols. Endothelium 9:191. 1328. Liu, R. H., and J. H. Hotchkiss. 1995. Potential genotoxicity of chronically elevated nitric oxide: a review. Mutat Res 339:73. 1329. Tunctan, B., O. Uludag, S. Altug, and N. Abacioglu. 1998. Effects of nitric oxide synthase inhibition in lipopolysaccharide-induced sepsis in mice. Pharmacol Res 38:405. 1330. Ueno, M., and T. J. Lee. 1993. Endotoxin decreases the contractile responses of the porcine basilar artery to vasoactive substances. J Cereb Blood Flow Metab 13:712. 1331. Guerra, A. N., P. L. Fisette, Z. A. Pfeiffer, B. H. Quinchia-Rios, U. Prabhu, M. Aga, L. C. Denlinger, A. G. Guadarrama, S. Abozeid, J. A. Sommer, R. A. Proctor, and P. J. Bertics. 2003. Purinergic receptor regulation of LPS-induced signaling and pathophysiology. J Endotoxin Res 9:256. 1332. Aga, M., J. J. Watters, Z. A. Pfeiffer, G. J. Wiepz, J. A. Sommer, and P. J. Bertics. 2004. Evidence for nucleotide receptor modulation of cross talk between MAP kinase and NF-kappa B signaling pathways in murine RAW 264.7 macrophages. Am J Physiol Cell Physiol 286:C923. 1333. Hu, Y., P. L. Fisette, L. C. Denlinger, A. G. Guadarrama, J. A. Sommer, R. A. Proctor, and P. J. Bertics. 1998. Purinergic receptor modulation of lipopolysaccharide signaling and inducible nitric-oxide synthase expression in RAW 264.7 macrophages. J Biol Chem 273:27170. 1334. Chen, Y. C., S. C. Shen, W. R. Lee, W. C. Hou, L. L. Yang, and T. J. Lee. 2001. Inhibition of nitric oxide synthase inhibitors and lipopolysaccharide induced inducible NOS and cyclooxygenase-2 gene expressions by rutin, quercetin, and quercetin pentaacetate in RAW 264.7 macrophages. J Cell Biochem 82:537.

302 1335. Woo, C. H., J. H. Lim, and J. H. Kim. 2004. Lipopolysaccharide induces matrix metalloproteinase-9 expression via a mitochondrial reactive oxygen species-p38 kinase-activator protein-1 pathway in Raw 264.7 cells. J Immunol 173:6973. 1336. Muller, F. L., Y. Liu, and H. Van Remmen. 2004. Complex III releases superoxide to both sides of the inner mitochondrial membrane. J Biol Chem 279:49064. 1337. Parthasarathi, K., H. Ichimura, S. Quadri, A. Issekutz, and J. Bhattacharya. 2002. Mitochondrial reactive oxygen species regulate spatial profile of proinflammatory responses in lung venular capillaries. J Immunol 169:7078. 1338. Lieven, C. J., M. J. Hoegger, C. R. Schlieve, and L. A. Levin. 2006. Retinal ganglion cell axotomy induces an increase in intracellular superoxide anion. Invest Ophthalmol Vis Sci 47:1477. 1339. Hayes, D. J., E. Byrne, E. A. Shoubridge, J. A. Morgan-Hughes, and J. B. Clark. 1985. Experimentally induced defects of mitochondrial metabolism in rat skeletal muscle. Biological effects of the NADH: coenzyme Q reductase inhibitor diphenyleneiodonium. Biochem J 229:109. 1340. Hutchinson, D. S., R. I. Csikasz, D. L. Yamamoto, I. G. Shabalina, P. Wikstrom, M. Wilcke, and T. Bengtsson. 2007. Diphenylene iodonium stimulates glucose uptake in skeletal muscle cells through mitochondrial complex I inhibition and activation of AMP-activated protein kinase. Cell Signal 19:1610. 1341. Watabe, M., and T. Nakaki. 2007. ATP depletion does not account for apoptosis induced by inhibition of mitochondrial electron transport chain in human dopaminergic cells. Neuropharmacology 52:536. 1342. Hirata, Y., and T. Nagatsu. 2005. Rotenone and CCCP inhibit tyrosine hydroxylation in rat striatal tissue slices. Toxicology 216:9. 1343. Vidal-Puig, A. J. 2000. Uncoupling expectations. Nat Genet 26:387. 1344. Inoue, M., N. Fujishiro, and I. Imanaga. 1999. Na+ pump inhibition and non-selective cation channel activation by cyanide and anoxia in guinea-pig chromaffin cells. J Physiol 519 Pt 2:385. 1345. Montero, M., M. T. Alonso, E. Carnicero, I. Cuchillo-Ibanez, A. Albillos, A. G. Garcia, J. Garcia-Sancho, and J. Alvarez. 2000. Chromaffin-cell stimulation triggers fast millimolar mitochondrial Ca2+ transients that modulate secretion. Nat Cell Biol 2:57. 1346. Taylor, S. C., S. M. Shaw, and C. Peers. 2000. Mitochondrial inhibitors evoke catecholamine release from cells. Biochem Biophys Res Commun 273:17. 1347. Inoue, M., N. Fujishiro, I. Imanaga, and Y. Sakamoto. 2002. Role of ATP decrease in secretion induced by mitochondrial dysfunction in guinea-pig adrenal chromaffin cells. J Physiol 539:145. 1348. Lim, D. Y., H. G. Park, and S. Miwa. 2006. CCCP enhances catecholamine release from the perfused rat adrenal medulla. Auton Neurosci 128:37. 1349. Perianayagam, M. C., M. Morena, B. L. Jaber, and V. S. Balakrishnan. 2005. Anti-oxidants reverse uraemia-induced down-regulation of mitochondrial membrane potential and interleukin- 10 production. Eur J Clin Invest 35:148. 1350. Boonstra, A., R. Rajsbaum, M. Holman, R. Marques, C. Asselin-Paturel, J. P. Pereira, E. E. Bates, S. Akira, P. Vieira, Y. J. Liu, G. Trinchieri, and A. O'Garra. 2006. Macrophages and myeloid dendritic cells, but not plasmacytoid dendritic cells, produce IL-10 in response to MyD88- and TRIF-dependent TLR signals, and TLR-independent signals. J Immunol 177:7551. 1351. Berrier, A., G. Siu, and K. Calame. 1998. Transcription of a minimal promoter from the NF-IL6 gene is regulated by CREB/ATF and SP1 proteins in U937 promonocytic cells. J Immunol 161:2267. 1352. Nemeth, Z. H., S. J. Leibovich, E. A. Deitch, B. Sperlagh, L. Virag, E. S. Vizi, C. Szabo, and G. Hasko. 2003. Adenosine stimulates CREB activation in macrophages via a p38 MAPK-mediated mechanism. Biochem Biophys Res Commun 312:883. 1353. Tonetti, M., L. Sturla, M. Giovine, U. Benatti, and A. De Flora. 1995. Extracellular ATP enhances mRNA levels of nitric oxide synthase and TNF-alpha in lipopolysaccharide-treated RAW 264.7 murine macrophages. Biochem Biophys Res Commun 214:125. 1354. Hamon, Y., M. F. Luciani, F. Becq, B. Verrier, A. Rubartelli, and G. Chimini. 1997. Interleukin- 1beta secretion is impaired by inhibitors of the Atp binding cassette transporter, ABC1. Blood 90:2911. 1355. Into, T., M. Fujita, T. Okusawa, A. Hasebe, M. Morita, and K. Shibata. 2002. Synergic effects of mycoplasmal lipopeptides and extracellular ATP on activation of macrophages. Infect Immun 70:3586. 1356. Georgopoulos, K., D. D. Moore, and B. Derfler. 1992. Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment. Science 258:808.

303 1357. Molnar, A., and K. Georgopoulos. 1994. The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol Cell Biol 14:8292. 1358. Funahashi, J., R. Sekido, K. Murai, Y. Kamachi, and H. Kondoh. 1993. Delta-crystallin enhancer binding protein delta EF1 is a zinc finger-homeodomain protein implicated in postgastrulation embryogenesis. Development 119:433. 1359. Funahashi, J., Y. Kamachi, K. Goto, and H. Kondoh. 1991. Identification of nuclear factor delta EF1 and its binding site essential for lens-specific activity of the delta 1-crystallin enhancer. Nucleic Acids Res 19:3543. 1360. Takagi, T., H. Moribe, H. Kondoh, and Y. Higashi. 1998. DeltaEF1, a zinc finger and homeodomain transcription factor, is required for skeleton patterning in multiple lineages. Development 125:21. 1361. Ikeda, K., J. P. Halle, G. Stelzer, M. Meisterernst, and K. Kawakami. 1998. Involvement of negative cofactor NC2 in active repression by zinc finger-homeodomain transcription factor AREB6. Mol Cell Biol 18:10. 1362. Furusawa, T., H. Moribe, H. Kondoh, and Y. Higashi. 1999. Identification of CtBP1 and CtBP2 as corepressors of zinc finger-homeodomain factor deltaEF1. Mol Cell Biol 19:8581. 1363. Postigo, A. A., and D. C. Dean. 1999. ZEB represses transcription through interaction with the corepressor CtBP. Proc Natl Acad Sci U S A 96:6683. 1364. Genetta, T., D. Ruezinsky, and T. Kadesch. 1994. Displacement of an E-box-binding repressor by basic helix-loop-helix proteins: implications for B-cell specificity of the immunoglobulin heavy-chain enhancer. Mol Cell Biol 14:6153. 1365. Postigo, A. A., and D. C. Dean. 1997. ZEB, a vertebrate homolog of Drosophila Zfh-1, is a negative regulator of muscle differentiation. Embo J 16:3935. 1366. Sekido, R., K. Murai, Y. Kamachi, and H. Kondoh. 1997. Two mechanisms in the action of repressor deltaEF1: binding site competition with an activator and active repression. Genes Cells 2:771. 1367. Dillner, N. B., and M. M. Sanders. 2004. Transcriptional activation by the zinc-finger homeodomain protein delta EF1 in estrogen signaling cascades. DNA Cell Biol 23:25. 1368. Postigo, A. A. 2003. Opposing functions of ZEB proteins in the regulation of the TGFbeta/BMP signaling pathway. Embo J 22:2443. 1369. Postigo, A. A., J. L. Depp, J. J. Taylor, and K. L. Kroll. 2003. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. Embo J 22:2453. 1370. Izeradjene, K., L. Douglas, D. M. Tillman, A. B. Delaney, and J. A. Houghton. 2005. Reactive oxygen species regulate caspase activation in tumor necrosis factor-related apoptosis-inducing ligand-resistant human colon carcinoma cell lines. Cancer Res 65:7436. 1371. Liu, X., C. N. Kim, J. Yang, R. Jemmerson, and X. Wang. 1996. Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86:147. 1372. Leist, M., B. Single, A. F. Castoldi, S. Kuhnle, and P. Nicotera. 1997. Intracellular adenosine triphosphate (ATP) concentration: a switch in the decision between apoptosis and necrosis. J Exp Med 185:1481. 1373. Richter, C., M. Schweizer, A. Cossarizza, and C. Franceschi. 1996. Control of apoptosis by the cellular ATP level. FEBS Lett 378:107. 1374. Eguchi, Y., S. Shimizu, and Y. Tsujimoto. 1997. Intracellular ATP levels determine cell death fate by apoptosis or necrosis. Cancer Res 57:1835. 1375. de Rooij, J., F. J. Zwartkruis, M. H. Verheijen, R. H. Cool, S. M. Nijman, A. Wittinghofer, and J. L. Bos. 1998. Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396:474. 1376. Hasko, G., and B. N. Cronstein. 2004. Adenosine: an endogenous regulator of innate immunity. Trends Immunol 25:33. 1377. Sitkovsky, M. V. 2003. Use of the A(2A) adenosine receptor as a physiological immunosuppressor and to engineer inflammation in vivo. Biochem Pharmacol 65:493. 1378. Humphreys, B. D., and G. R. Dubyak. 1998. Modulation of P2X7 nucleotide receptor expression by pro- and anti-inflammatory stimuli in THP-1 monocytes. J Leukoc Biol 64:265. 1379. Chen, B. C., and W. W. Lin. 1999. Potentiation of lipopolysaccharide-induced IL-6 release by uridine triphosphate in macrophages: cross-interaction with cyclooxygenase-2-dependent prostaglandin E(2) production. J Biomed Sci 6:425. 1380. Chen, B. C., and W. W. Lin. 2000. Pyrimidinoceptor potentiation of macrophage PGE(2) release involved in the induction of nitric oxide synthase. Br J Pharmacol 130:777.

304 1381. Lin, W. W. 1997. Priming effects of lipopolysaccharide on UTP-induced arachidonic acid release in RAW 264.7 macrophages. Eur J Pharmacol 321:121. 1382. Nathan, C. 2002. Points of control in inflammation. Nature 420:846. 1383. Gilroy, D. W., A. Tomlinson, and D. A. Willoughby. 1998. Differential effects of inhibitors of cyclooxygenase (cyclooxygenase 1 and cyclooxygenase 2) in acute inflammation. Eur J Pharmacol 355:211. 1384. Gilroy, D. W., P. R. Colville-Nash, D. Willis, J. Chivers, M. J. Paul-Clark, and D. A. Willoughby. 1999. Inducible cyclooxygenase may have anti-inflammatory properties. Nat Med 5:698. 1385. Ji, J. D., H. J. Kim, Y. H. Rho, S. J. Choi, Y. H. Lee, H. J. Cheon, J. Sohn, and G. G. Song. 2005. Inhibition of IL-10-induced STAT3 activation by 15-deoxy-Delta12,14-prostaglandin J2. Rheumatology (Oxford) 44:983. 1386. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager, and J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437:1167. 1387. Li, X. D., L. Sun, R. B. Seth, G. Pineda, and Z. J. Chen. 2005. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc Natl Acad Sci U S A 102:17717. 1388. Loo, Y. M., D. M. Owen, K. Li, A. K. Erickson, C. L. Johnson, P. M. Fish, D. S. Carney, T. Wang, H. Ishida, M. Yoneyama, T. Fujita, T. Saito, W. M. Lee, C. H. Hagedorn, D. T. Lau, S. A. Weinman, S. M. Lemon, and M. Gale, Jr. 2006. Viral and therapeutic control of IFN-beta promoter stimulator 1 during hepatitis C virus infection. Proc Natl Acad Sci U S A 103:6001. 1389. Lin, R., J. Lacoste, P. Nakhaei, Q. Sun, L. Yang, S. Paz, P. Wilkinson, I. Julkunen, D. Vitour, E. Meurs, and J. Hiscott. 2006. Dissociation of a MAVS/IPS-1/VISA/Cardif-IKKepsilon molecular complex from the mitochondrial outer membrane by hepatitis C virus NS3-4A proteolytic cleavage. J Virol 80:6072. 1390. Lee, C. G., and J. Hurwitz. 1992. A new RNA helicase isolated from HeLa cells that catalytically translocates in the 3' to 5' direction. J Biol Chem 267:4398. 1391. Nakajima, T., C. Uchida, S. F. Anderson, C. G. Lee, J. Hurwitz, J. D. Parvin, and M. Montminy. 1997. RNA helicase A mediates association of CBP with RNA polymerase II. Cell 90:1107. 1392. Miki, Y., J. Swensen, D. Shattuck-Eidens, P. A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L. M. Bennett, W. Ding, and et al. 1994. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266:66. 1393. Rowell, S., B. Newman, J. Boyd, and M. C. King. 1994. Inherited predisposition to breast and ovarian cancer. Am J Hum Genet 55:861. 1394. Cole, J. L. 2007. Activation of PKR: an open and shut case? Trends Biochem Sci 32:57. 1395. Maggi, L. B., Jr., M. R. Heitmeier, D. Scheuner, R. J. Kaufman, R. M. Buller, and J. A. Corbett. 2000. Potential role of PKR in double-stranded RNA-induced macrophage activation. Embo J 19:3630. 1396. Matzinger, P. 1994. Tolerance, danger, and the extended family. Annu Rev Immunol 12:991. 1397. Matzinger, P. 2001. Essay 1: the Danger model in its historical context. Scand J Immunol 54:4. 1398. Matzinger, P. 2002. The danger model: a renewed sense of self. Science 296:301. 1399. Heath, W. R., and F. R. Carbone. 2003. Immunology: dangerous liaisons. Nature 425:460. 1400. Jerome, K. R., and L. Corey. 2004. The danger within. N Engl J Med 350:411. 1401. Gallucci, S., M. Lolkema, and P. Matzinger. 1999. Natural adjuvants: endogenous activators of dendritic cells. Nat Med 5:1249. 1402. Seong, S. Y., and P. Matzinger. 2004. Hydrophobicity: an ancient damage-associated molecular pattern that initiates innate immune responses. Nat Rev Immunol 4:469. 1403. Di Virgilio, F. 2003. Novel data point to a broader mechanism of action of oxidized ATP: the P2X7 receptor is not the only target. Br J Pharmacol 140:441. 1404. Bianchi, M. E. 2007. DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol 81:1. 1405. Martell, R. E., J. R. Strahler, and R. U. Simpson. 1992. Identification of lamin B and histones as 1,25-dihydroxyvitamin D3-regulated nuclear phosphoproteins in HL-60 cells. J Biol Chem 267:7511. 1406. Barnes, P. J. 2004. New drugs for asthma. Nat Rev Drug Discov 3:831. 1407. Knight, D. A., and S. T. Holgate. 2003. The airway epithelium: structural and functional properties in health and disease. Respirology 8:432.

305 1408. Gilroy, D. W., J. Newson, P. Sawmynaden, D. A. Willoughby, and J. D. Croxtall. 2004. A novel role for phospholipase A2 isoforms in the checkpoint control of acute inflammation. Faseb J 18:489.

306 APPENDIX I: CHEMICALS AND REAGENTS

General chemicals Potassium dichromate Ajax Chemicals AR388 Sodium bicarbonate Sigma S4019 Sodium chloride (NaCl) Ajax Finechem A465 Potassium hydrogen carbonate (KHCO3) BDH 10206 Ammonium chloride (NH4Cl) Ajax chemical 31 Potassium chloride (KCl) Ajax chemicals 383 Water of irrigation Baxter AHF7114 Hexadimethrine bromide (Polybrene) Sigma H9268 Sulphonic acid BDH BDH0276 Sodium azide Sigma S2002 Sodium phosphate (Na2HPO4) Sigma S-0876 Potassium dihydrogen orthophosphate (KH2PO4) BDH chemicals 10203 T-octylphenoxypolyethoxy-ethanol (Triton X-100) Sigma X100 L-Glutathione reduced Sigma G4251 Boric acid Ajax Chemicals 208535 Ethanolamine Sigma E9508

Tissue culture reagents RPMI 1640 GIBCO Invitrogen 31800-014 Dulbecco’s modified Eagle’s medium (DMEM) GIBCO Invitrogen 12800-058 Bovine calf serum (BCS) HyClone Laboratories 8455 Bovine serum Invitrogen 16170-078 Foetal bovine serum (FBS) JRH Biosciences 12003-500M Dulbecco’s phosphate-buffered saline (DPBS) GIBCO Invitrogen 21600-051 Hanks’ Balanced Salt solution (HBSS) Sigma H4891 -mercaptoethanol 55mM GIBCO Invitrogen 21985-023 L-glutamine Sigma 72K2312 HEPES solution Sigma H0887 Sodium pyruvate solution (100 mM) Sigma S8636 Penicillin-Streptomycin GIBCO Invitrogen 15140-122 Geneticin GIBCO Invitrogen 11811 Blasticidin Invitrogen R210-01 Dimethylsulphoxide (DMSO) Sigma D2650 Trypan blue ICN 1691049 Acid citrate-dextrose (ACD) Baxter Ficoll-Paque PLUS Amersham 71-7167-00 Pharmacia Biotech AF

Activators Lipopolysaccharides from Escherichia coli 0111:B4 Sigma L4391 Polyinosinic polycycytidylic acid potassium Salt Sigma P9582-5MG Polycytidylic acid potassium salt Sigma P4903-10MG Polyinosinic acid potassium salt Sigma P4154-10MG Hydrogen peroxide 30% (H2O2) Riedel-de Haën 18312

Pathway inhibitors SB 202190 Sigma S7067 PD 98059 Sigma P215 U0126 Calbiochem 662005 JNK inhibitor II (SP600125) Calbiochem 420119 2-Aminopurine, minimum 99% (2-AP) Sigma A3509- 100MG Diphenyleiodonium chroride (DPI) Sigma D2926 Acetovanillone (Apocynin) Sigma W508454

307 TEMPOL (4-Hydroxy-2, 2, 6, 6-tetramethyl- Fluka 56516 piperidine 1-oxyl) Superoxide dismutase from bovine Sigma S5395 erythrocytes (SOD) Catalase from bovine liver Sigma C1345 N-Acetyl-L-cysteine Sigma A7250 Carbonyl cyanide 3-chlorophenylhydrazone 97% Sigma C2759- (TLC) (CCCP) 100MG Antimycin A from Streptomyces sp. Sigma A8674 Cycloheximide (CHX) Sigma C7698 CGP 37157 Tocris Bioscience 1114 Dexamethasone Sigma D1756 15-Deoxy-12,14-prostaglandin J2 95% (HPLC), Sigma D8440 methyl acetate solution Prostaglandin E2 99% (TLC), synthetic Sigma P5640 Adenosine 5’-triphosphate disodium salt (ATP) Sigma A6419 Adenosine 5’-diphosphate mono potassium slat Sigma A5285 (ADP) Adenosine Sigma A4036

Cytokines and neutralizing antibodies Recombinant human FGF-2 (effective Sigma F0291 concentration (EC50): 0.05-0.5 ng/ml, endotoxin 0.1 ng/g) Recombinant murine IL-10 R&D Systems 417-ML Murine interferon PBL Biomedical 12400-1 Laboratories Recombinant human IL-10 R&D 217-IL-005 Mouse IFN-beta Polyclonal Ab R&D 32400-1 Recombinant Mouse IL-10 R&D 417-ML-005 Mouse IL-10 Affinity Purified Polyclonal Ab R&D AF-417-NA Recombinant Mouse IFN-beta R&D 12400-1

Bacterial culture reagents Isopropyl -D-1-thiogalactopyranoside 99% Sigma I6758-1G (TLC), 0.1% Dioxane GlutathioneAgarose Sigma G4510-50ML Yeast Extract DIFCO 0127-17-9 Tryptone peptone DIFCO 211705 LB Broth Sigma L3022-1KG Ampicillin sodium salt Sigma A9518 Spectinomycin dihydrochloride pentahydrate Sigma S4014 Kanamycin sulfate Amresco 0408-100G Chrolamphenicol Boehringer 634433 Mannheim One ShotR TOP10 Chemically competent E. coli Invitrogen C4040-03 One ShotR Stbl3 Chemically competent E. coli Invitrogen C7373-03

Protein assay Bovine serum albumin (BSA) Sigma A8022-100G Bicinchoninic acid (BCA) assay reagents Pierce 23223

RNA extraction reagents Formamide Sigma F9037 1-Bromo-3-chloropropane Sigma B9673- 200ML Ethanol, absolute Ajax Finechem A214-2.5L PL AR Propan-2-ol Fronine Laboratory ISOPRO*2G

308 Trizol reagent Invitrogen 15596-018 Glycogen Invitrogen 10814-010 SuperScript III CellsDirect cDNA Synthesis Invitrogen 18080-200 System

Real-time PCR Superscript III First-Strand Synthesis system for Invitrogen 11752-050 RT-PCR E.coli RNase H Invitrogen 55292 Glycogen Invitrogen 10814-010 Platinum SYBR Green ER qPCR superMix UDG Invitrogen 11760-100 TURBO DNase Ambion 2238 Ethylene diaminatetetra acetic acid disodium salt BDH 280254D (EDTA)

Purification of polyclonal antibodies Protein A-Sepharose CL-4B Amersham 71-7089-00 Pharmacia Biotech CNBr-activated Sepharose 4B Amersham 17-0430-01 Biosciences

Western blotting Acrylamide-bis-acrylamide solution Bio-Rad 161-0157 Ammonium persulphate Bio-Rad 161-0700 Chemiluminescence reagents NEN Life Science Complete Protease Inhibitor Cocktail tablets Boehringer 697498001 Mannheim Dithiothreitol (DTT) Bio-Rad 161-0611 Horseradish-peroxidase-conjugated caprine anti- Bio-Rad 170-6515 rabbit IgG N,N,N',N'-tetramethylethylene-diamine (TEMED) Bio-Rad 161-0809 Stabilized goat anti-rabbit HRP- conjugated Pierce 1858415 Tris (hydroxymethyl) aminomethane (Trizma Sigma T6066-1KG Base) Tris Ultra pure ICON Biomedicals 819623 Glycine for electrophoresis, purity 99% Sigma G8898-1KG Polyoxyethylenesorbitan monolaurate (Tween 20) Sigma P7949 Iodoacetamide Sigma I6125 Lauryl sulphate (SDS) Sigma L3771-100G Tricine, purity 99% titration Sigma T0377-1KG Glycerol, for molecular biology, purity 99% Sigma G5516- 500ML

ELISA TMB chromogen Panbio 0-TMB01Y Albumin from bovine serum, 96% purity, Sigma A8022-100G electrophoresis Polyoxyethylenesorbitan monolaurate (Tween 20) Sigma P-1379 Horseradish peroxidase streptavidin (Streptavidin Vector SA-5004 HRP) EZ-Link Sulfo-NHS-LC-Biotin Reagents Pierce 21335

Nitric oxide assay Sodium nitrate Sigma S2252 Griess reagent Sigma G4410

Dual-Luciferase Assay Dual-Luciferase Assay System Promega E1910

309 pRL-TK vector Promega E2241 Chroroquine (diphosphate salt) Sigma C6628 DEAE-Dextran (Diethylaminoethyl- Dextran) Sigma D9985

Transfection of plasmid or siRNA Lipofectamine 2000 Invitrogen 11668-027 RiboJuce Novagen 71115-4 Opti-MEM I Reduced Serum Medium GIBCO 22600-043 Cenix Pre-designed S100A8 siRNA Ambion af 16708 ID 71369, 102851, 71276 GAPDH Mouse & Rat siRNA Ambion 4624 RNAi starter kit Qiagen 301699 Generation of vector BLOCK-iT™ Pol II miR RNAi Expression Vector Invitrogen K4936-00 Kit with EmGFP GatewayR BP Clonase™ II Enzyme Mix Invitrogen 11789-020 GatewayR LR Clonase™ II Enzyme Mix Invitrogen 11791-020 ViraPower™ Bsd Lentiviral Support Kit Invitrogen K4970-00 pDONR 221 Vector Invitrogen 12536-017 pENTR Directional TOPO cloning kit Invitrogen K2400-20 Vivid Colors pcDNA6.2/N-EmGFP-DEST Gateway Invitrogen V356-20 Vector siRNA synthesis Silencer siRNA Construction Kit Ambion # 1620

Supplier Boehringer Mannheim GmbH Mannheim, Germany HyClone Laboratories Logan, UT, USA GIBCO Invitrogen Gaithersburg, MD, USA R&D Systems Minneapolis, MN, USA PBL Biomedical Laboratories Piscataway, NJ, USA Tocris Bioscience Ellisville, MO, USA Bio-Rad Hercules, CA, USA Sigma-Aldrich St. Louis, MO, USA Fluka St. Louis, MO, USA Panbio Sinnamon Park QLD, Australia Ambion Austin, TX, USA IBI New Haven, CT, USA Calbiochem Darmstadt, Germany Baxter Healthcare NSW, Australia Vector Southfield, MI. USA Novagen Darmstadt, Germany Qiagen Doncaster, VIC, Australia Promega Madison, WI, USA Pierce Rockford, IL, USA NEN Life Science Boston, MA, USA Ajax Finechem Taren Point, NSW, Australia Fronine Laboratory Riverstone, NSW, Australia JRH Biosciences KA.USA

310 APPENDIX II: EQUIPMENT

Tissue culture Incubators (37 ºC) Forma Scientific (Marietta) Cryo tubes 1.0ml (sterile) Nalge Nunc International (375353) Tissue culture dishes Becton Dickinson Tissue culture flasks Becton Dickinson Leica DM IRB inverted confocal microscope Leica Microsystems (Mannheim, Germany) attached to a Leica TCS SP scanner Zetapor membranes Cuno (Meriden, CT) Costar 24 well culture cluster Corning (3524) Nunc 24 –well plate Nalge Nunc International Nunc 24 –well plate Nalge Nunc International Beckman Coulter Counter Beckman Coulter

Purification of polyclonal antibodies Poly prep chromatography columns Bio-Rad (731-1550) Snakeskin pleated Dialysis tubing; Pierce (68035) 3500MWCO

Western blotting Mini Protean II electrophoresis Bio-Rad apparatus Western transfer apparatus Bio-Rad Polyvinylidene difluoride (PVDF) Millipore (Bedford, MA) Membranes Speedvac vacuum lyophilizer Savant (Farmingdale, NY) Nunc immuno tube Nalge Nunc International (466982, 468608) Nunc immuno tube cap Nalge Nunc International (343036) FLA3000 imaging system FUJI ECL Amersham Biosciences, Arlington Hights, IL

ELISA Flat-bottomed 96-well Maxisorp microtitre Nalge Nunc International plates Stericap Millipore 0.22m filter Millipore (SUGPV1024) Spectra Max M2 Spectrophotometer Molecular Devices

RNA purification QIAquick PCR purification kit Qiagen Spectrophotometer Titertek Multiscan Irvine, Scotland MCC/340

Real-time PCR ABI Prism machine Applied Biosystems

Dual luciferase assay TD-20/20 Luminometer Turner Dsigen (Sunnyvale, CA) 96W Nunclon delta white microwell plate Nalge Nunc International (136101)

Others Centrifuge tubes (15 and 50 ml) Becton Dickinson (Lincoln Park, NJ, USA) Eppendorf tubes Eppendorf AG (Hamburg, Germany) Gel Doc 2000 Bio-Rad

311