DOCSLIB.ORG

Cfjayter 5 Mocecucar Characterization of V(P4, V(P6, V(P7 Ancfm<P4 Genes of Group ^B Rotavirus Strains from Outsrea^ of Gastr

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cfjayter 5 Mocecucar Characterization of V(P4, V(P6, V(P7 Ancfm<P4 Genes of Group ^B Rotavirus Strains from Outsrea^ of Gastr CfJayter 5 MoCecuCar characterization of V(P4, V(P6, V(P7 ancfm<P4 genes of group ^B rotavirus strains from outSrea^ of gastroenteritis CHapterS: CliaracterizationofV(P4, VP6, lApz and!KS<P4 genes Molecular characterization of VP4, VP6, VP7 and NSP4 genes of group B rotavirus strains from outbreaks of gastroenteritis 5.1 Materials and methods 5.1.1 Specimens In the outbreaks of gastroenteritis that occurred in Daman, Union territory of India (Kelkar et al., 2007); Surat, Gujarat state; Kalambi and Khanderajuri villages of Sangli district, Maharashtra state and Bhabwadi village of Bhor Taluk of Pune district, Maharashtra state respectively in the years 2000, 2004, 2009 and 2011, RVB was detected to be the major etiologic agent by NSP2 gene targeted RT-PCR (Chapter 4). Fecal or rectal swab specimens received from these outbreaks of gastroenteritis were stored at -20°C. One specimen each of the four RVB outbreaks (NIV-005625, NIV-04622, NIV-094456 and NIV-119429) was selected for characterization of VP4, VP6, VP7 and NSP4 genes. All four specimens belonged to the adult cases examined during the outbreak period. 5.1.2 RNA extraction. RT-PCR amplification of RVB VP4. VPS. VP7 and NSP4 genes and agarose gel electrophoresis Viral RNA was extracted from fecal specimens using TRIzol® LS reagent as per manufacturer's instructions (Invitrogen, CA, U.S.A). RT-PCR was carried out for RVB VP4, VP6, VP7 and NSP4 genes by using one step RT-PCR kit (Qiagen Co., Hilden, Germany). Full length VP4 (2306 bp), VP6 (1269 bp), VP7 (814 bp) and NSP4 (751 bp) genes of RVB strains were amplified using primers published earlier (Chen et al. 1990a; Ahmed et al., 2004) as well as designed for the study (Table 5.1). Briefly, PCR conditions involved an initial reverse transcription of 30 min at 50°C, followed by PCR activation at 95°C for 15 min, 35 cycles of amplification (1 min at 94''C, 30 sec at 50°C and 1 min at 72°C) with final extension at 72°C for 7 min for VP7 and NSP4. The same procedure was used for VP4 and VP6 except that the annealing was carried out for 30 sec at 52°C and 55°C respectively. All PCR products were analyzed on 2% agarose gel containing 0.5 pg / ml EtBr and visualized under UV transilluminator. 67 CHapterS: ClMracterizationof1^4, V<P6, 1^7 an(f!N'S<P4 genes Table 5.1: List of primers used for the study Viral Primer Primer sequence {5'-3') Position* Product gene name size (bp) VP4 BVP4-1F GGCAATATATTTGCTATGTTGACG 1-24 758 BVP4-1R CCTCCCATTGTTCCGTAAGC 758-739 BVP4-2F GTGGGATATGAACTGTGCAAACG 609-631 830 BVP4-2R CTCCCCCGGTTACAAAATCTGGATC 1438-1414 BVP4-3F GGTGGAGACTTTTACAGACAAGG 1306-1328 730 BVP4-3R CGTGCGCTAAATCCGGGTC 2035-2017 BVP4-4F CAATAGCTACTGAAGTCAAACTTCC 1832-1856 475 BVP4-4R GGGTTTTTATATGTATTTGCAACA 2306-2283 VP6 FLCD-6F GGTTTAAATAGCCCAACCGGTGAT 1-24 704 ADG5-1R3 CCAGCTGTAGGTATGTAGACGATG 704-681 GBR-6F GTGGTCAGGTAATAAAGGGGTTG 582-604 688 GBR-6R GGGTTTTATTGCTTATTTTTTCGCA 1269-1245 VP7 ADG9-1F'' GGCAATAAAATGGCTTCATTGC 1-22 814 ADG9-1R^ GGGTTTTTACAGCTTCGGCT 814-795 NSP4 GBlO-lb GGCAATTAAAAGTCCAGTTATGG 1-23 751 GBR-IOR GGGTCCTTATCAGTTTGATCAG 751-730 Note: * - Positions of primer sequences are expressed as nucleotide numbers in individual genes of ADRV/CAL-1 strains of RVB. 'a' denotes the primer sequences described by Chen et al. (1990a), while 'b' stands for the primer mentioned by Ahmed et al. (2004). 5.1.3 Nucleotide sequencing and phyloqenetic analyses The excised PCR products were purified using QIAquick gel extraction kit (Qiagen Co., Hilden, Germany) and sequencing was carried out using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied biosystems, Foster city, USA) on an automated DNA sequencer (ABI PRISM 3100 Genetic analyser, Applied biosystems, USA). The nucleotide/deduced amino acid sequences of VP4, VP6, VP7 and NSP4 genes of RVB strains of the present study were aligned with the sequences of RVB strains available in GenBank by using CLUSTAL W program (Thompson et al., 1994). The phylogenetic analyses were carried out in MEGA version 5 software package by using Kimura 2-parameter and Neighbour-joining algorithm (Tamura et al., 2011). The reliability of phylogenetic trees was supported statistically by bootstrapping with 1000 replicates. 68 chapters-. Cliaracterizationof'W4,1^6,1^7and!NS'P4genes 5.1.4 Genetic distance and percent identity calculation The percent identity of individual gene sequences was calculated using p- distance parameter available in MEGA version 5 software package (Tamura et al., 2011). Detailed procedure is described in Chapter 4, section 4.1.10.5. 5.1.5 Identification of unique amino acid Unique amino acids defined as the presence of specific amino acid residues at specific positions not reported in the sequences of other RVB strains available in the GenBank were identified by using tBIastn server available at NCBI website. 5.1.6 Accession numbers The nucleotide sequences derived in this study were submitted to GenBank under the accession numbers JN009771-JN009782, KF689789, KF689791, KF689793 and KF689795. GenBank accession numbers assigned for the individual genes of the four strains examined in this study are provided in Table 5.2 and those of the reference strains utilized in this study are provided in Table 5.3. 69 CHapterS: Characterization of ^^4, V(P6, 1^7 andJiS'P4 genes Table 5.2: GenBank accession numbers assigned for the gene segments VP4, VP6, VP7 and NSP4 of the RVB strains representing four outbreaks of acute gastroenteritis investigated in the study Gene segments RVB strain GenBank accession numbers NIV-005625 JN009773 NIV-04622 JN009772 NSP4 NIV-094456 JN009771 NIV-119429 KF689789 NIV-005625 JN009776 NIV-04622 JN009775 VP4 NIV-094456 JN009774 NIV-119429 KF689791 NIV-005625 IN009779 NIV-04622 JN009778 VP6 NIV-094456 JN009777 NIV-119429 KF689793 NIV-005625 JN009782 NIV-04622 IN009781 VP7 NIV-094456 JN009780 NIV-119429 KF689795 Table 5.3: GenBank accession numbers of reference RVB strains included in the study RVB strain GenBank accession numbers of gene segments VP4 VP6 VP7 NSP4 ADRV M91434 M55982 M33872 AY548957 WH-1 AY539857 AY539858 AY539856 AY539864 WH-2 - - AY215070 - IDH-084 GU377227 GU377228 GU377229 GU377233 IC-008 GU377216 GU377217 GU377218 GU377222 CAL-1 AF184084 AB037931 AF184083 AY238387 MMR-Bl FI811826 FI811827 FJ811825 FJ811828 Bang-117 GU391304 GU391305 GU391306 GU391310 Bang-373 AY238388 AY238389 AY238385 AY238384 Bang-544 F)851391 FJ851392 FJ851390 FJ851393 Nemuro - AB106542 AB016818 - DBlOl - - AY158155 - Table 5.3 (cont.) 70 chapter S: Cliaracterizationof1^4, ^^6, 1^7 and9^S<P4 genes RVB strain GenBank accession numbers of gene segments VP4 VP6 VP7 NSP4 DB176 GQ358710 GQ358713 AF531910 - DB180 - - AF529214 - RUBV226 GQ358711 GQ358714 - - RUBV282 GQ358712 GQ358715 - - IDIR X16949 M84456 D00911 U03557 PB-F18 - - AB490417 - PB-Talheiyo - - AB490418 - PB-Kyushu - - AB490419 - PB-S3 - - AB490420 - PB-S5 - - AB490421 - PB-S13 - - AB490422 - PB-S15 - - AB490423 - PB-S19-1 - - AB490424 . PB-S22-3 - - AB490425 - PB-S24-11 - - AB490426 - PB-S26-1 - - AB490427 - PB-S37-3 - - AB490428 - PB-S40-1 - - AB490429 - PB-S40-11 - - AB490430 - PB-S43-2 - - AB490431 - PB-S43-11 - - AB490432 - PB-S43-17 - - AB490433 - PB-S48-1 - - AB490434 - PB-S49-2 - - AB490435 - PB-S49-13 - - AB490436 - PB-S59-19 - - AB490437 - PB-S61-4 - - AB490438 - PB-7-2-4 - - AB490439 - PB-7-5-5 - - AB490440 - PB14-29 - - AB490441 - PB-14-31 - - AB490442 - PB-23-5 - - AB490443 - PB-23-10 - - AB490444 - PB-23-44 - - AB490445 - PB-68-C17 - - AB490446 - PB-68-D5 - - AB490447 - PB-68-E4 - - AB490448 - PB-68-G4 - - AB490449 - PB-70-H3 - - AB490450 - PB-70-H5 - - AB490451 - PB-71-H5 - - AB490452 - PB-72-H3 - - AB490453 - PB-72-I2 - - AB490454 - Note:'-' indicate non-availability or exclusion of data. 71 CHapterS: Cliaractenzationof'V(P4, V(p6, VPZ aruf !NS<P4 genes 5.2 Results 5.2.1 RT-PCR amplification of RVB VP4. VP6. VP7 and NSP4 genes RT-PCR carried out for the amplification of VP4, VP6, VP7 and NSP4 genes of RVB generated high intensity bands. Figure 5.1 is the representative picture of electrophoretic migration pattern of fragments of VP4, VP6, VP7 and NSP4 genes of one RVB strain, NIV-04622. Lane Product size Amplified no. gene 1 Blank 2 758 bp 3 830 bp 4 730 bp VP4 5 475 bp 6 DNA ladder 7 Negative control 8 704 bp VP6 9 688 bp 10 814 bp VP7 11 751 bp NSP4 12 DNA ladder Figure 5.1: Electrophoretic migration pattern of PCR products of RVB genes 5.2.2 Phylogenetic analysis of the VP7 gene Phylogenetic analysis of VP7 genes of all of the four RVB strains representing four outbreaks displayed clustering of their sequences with the corresponding sequences of other strains placed in the Indian-Bangladeshi lineage of genotype G2 (Figure 5.2). Comparison of the sequences with those of the other strains belonging to Indian-Bangladeshi lineage and Chinese lineage showed <3% and 9% nucleotide diversity respectively (Table 5.4). 72 chapters: Characterization 0/1^4, V(P6, 'U(P7and!N'S<P4genes 99 -RVB/Pig-wt/JPN/PB-70-H3/2007/G20P[)q 96 RVB/Pig-wt/JPN/PB-23-10/2005/G20P[X] RVB/Pig-wt/JPN/PB-58-G4/2007/G19P[X] •RVB/Pig-wt/JPN/PB-23-5/2005/G18P[Xl RVB/Pig-wt/JPN/PB-68-C17/2007/G16P[)q RVB/Pig-wt/USA/OK09-51/2009/G17P[X| RVB/Pig-wt/JPN/PB-S49-2/2003/G15P[X1 RVB/Pig-wt/JPN/PB-68-D5/2007/G14P[)q 93 RVB/Pig-wt/JPN/PB-2344/2005/G13P[X1 90 RVB/Pig-wt/JPN/PB-S40-1/2003/G12PlXl RVB/Pig-wt/JPN/PB-S5/2002/G11P[X] RVB/Pig-wt/JPN/PB-70-H5/2007/G4P[>q RVB/Pig-wt/JPN/PB-S49-13/2003/G8P[X| 100 RVB/Pig-wt/JPN/PB-FI 8/2001/G6P[Xl 90 RVB/Pig-wt/USA/MO09-34/2009/G10PlX| 92 RVB/Pig-wt/JPN/PB-72-12/2007/G7P[)q 100 RVB/Pig-wt/JPN/PB-68-E4/2007/G9P[X]
Load more

Recommended publications
  • 0001S07 Prashant M.Nijasure F 3/302 Rutu Enclave,Opp.Muchal
    Effective Membership ID Name Address Contact Numbers from Expiry F 3/302 Rutu MH- Prashant Enclave,Opp.Muchala 9320089329 12/8/2006 12/7/2007 0001S07 M.Nijasure Polytechnic, Ghodbunder Road, Thane (W) 400607 F 3/302 Rutu MH- Enclave,Opp.Muchala Jilpa P.Nijasure 98210 89329 8/12/2006 8/11/2007 0002S07 Polytechnic, Ghodbunder Road, Thane (W) 400607 MH- C-406, Everest Apts., Church Vianney Castelino 9821133029 8/1/2006 7/30/2011 0003C11 Road-Marol, Mumbai MH- 6, Nishant Apts., Nagraj Colony, Kiran Kulkarni +91-0233-2302125/2303460 8/2/2006 8/1/2007 0004S07 Vishrambag, Sangli, 416415 MH- Ravala P.O. Satnoor, Warud, Vasant Futane 07229 238171 / 072143 2871 7/15/2006 7/14/2007 0005S07 Amravati, 444907 MH MH- Jadhav Prakash Bhood B.O., Khanapur Taluk, 02347-249672 8/2/2006 8/1/2007 0006S07 Dhondiram Sangli District, 415309 MH- Rajaram Tukaram Vadiye Raibag B.O., Kadegaon 8/2/2006 8/1/2007 0007S07 Kumbhar Taluk, Sangli District, 415305 Hanamant Village, Vadiye Raibag MH- Popat Subhana B.O., Kadegaon Taluk, Sangli 8/2/2006 8/1/2007 0008S07 Mandale District, 415305 Hanumant Village, Vadiye Raibag MH- Sharad Raghunath B.O., Kadegaon Taluk, Sangli 8/2/2006 8/1/2007 0009S07 Pisal District, 415305 MH- Omkar Mukund Devrashtra S.O., Palus Taluk, 8/2/2006 8/1/2007 0010S07 Vartak Sangli District, 415303 MH MH- Suhas Prabhakar Audumbar B.O., Tasgaon Taluk, 02346-230908, 09960195262 12/11/2007 12/9/2008 0011S07 Patil Sangli District 416303 MH- Vinod Vidyadhar Devrashtra S.O., Palus Taluk, 8/2/2006 8/1/2007 0012S07 Gowande Sangli District, 415303 MH MH- Shishir Madhav Devrashtra S.O., Palus Taluk, 8/2/2006 8/1/2007 0013S07 Govande Sangli District, 415303 MH Patel Pad, Dahanu Road S.O., MH- Mohammed Shahid Dahanu Taluk, Thane District, 11/24/2005 11/23/2006 0014S07 401602 3/4, 1st floor, Sarda Circle, MH- Yash W.
    [Show full text]
  • By Thesis Submitted for the Degree of Vidyavachaspati (Doctor of Philosophy) Faculty for Moral and Social Sciences Department Of
    “A STUDY OF AN ECOLOGICAL PATHOLOGICAL AND BIO-CHEMICAL IMPACT OF URBANISATION AND INDUSTRIALISATION ON WATER POLLUTION OF BHIMA RIVER AND ITS TRIBUTARIES PUNE DISTRICTS, MAHARASHTRA, INDIA” BY Dr. PRATAPRAO RAMGHANDRA DIGHAVKAR, I. P. S. THESIS SUBMITTED FOR THE DEGREE OF VIDYAVACHASPATI (DOCTOR OF PHILOSOPHY) FACULTY FOR MORAL AND SOCIAL SCIENCES DEPARTMENT OF SOCIOLOGY TILAK MAHARASHTRA VIDHYAPEETH PUNE JUNE 2016 CERTIFICATE This is to certify that the entire work embodied in this thesis entitled A STUDY OFECOLOGICAL PATHOLOGICAL AND BIOCHEMICAL IMPACT OF URBANISATION AND INDUSTRILISATION ON WATER POLLUTION OF BHIMA RIVER AND Its TRIBUTARIES .PUNE DISTRICT FOR A PERIOD 2013-2015 has been carried out by the candidate DR.PRATAPRAO RAMCHANDRA DIGHAVKAR. I. P. S. under my supervision/guidance in Tilak Maharashtra Vidyapeeth, Pune. Such materials as has been obtained by other sources and has been duly acknowledged in the thesis have not been submitted to any degree or diploma of any University or Institution previously. Date: / / 2016 Place: Pune. Dr.Prataprao Ramchatra Dighavkar, I.P.S. DECLARATION I hereby declare that this dissertation entitled A STUDY OF AN ECOLOGICAL PATHOLOGICAL AND BIO-CHEMICAL IMPACT OF URBANISNTION AND INDUSTRIALISATION ON WATER POLLUTION OF BHIMA RIVER AND Its TRIBUTARIES ,PUNE DISTRICT FOR A PERIOD 2013—2015 is written and submitted by me at the Tilak Maharashtra Vidyapeeth, Pune for the degree of Doctor of Philosophy The present research work is of original nature and the conclusions are base on the data collected by me. To the best of my knowledge this piece of work has not been submitted for the award of any degree or diploma in any University or Institution.
    [Show full text]
  • Bhor Assembly Maharashtra Factbook
    Editor & Director Dr. R.K. Thukral Research Editor Dr. Shafeeq Rahman Compiled, Researched and Published by Datanet India Pvt. Ltd. D-100, 1st Floor, Okhla Industrial Area, Phase-I, New Delhi- 110020. Ph.: 91-11- 43580781, 26810964-65-66 Email : [email protected] Website : www.electionsinindia.com Online Book Store : www.datanetindia-ebooks.com Report No. : AFB/MH-203-0118 ISBN : 978-93-5293-184-2 First Edition : January, 2018 Third Updated Edition : June, 2019 Price : Rs. 11500/- US$ 310 © Datanet India Pvt. Ltd. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means, mechanical photocopying, photographing, scanning, recording or otherwise without the prior written permission of the publisher. Please refer to Disclaimer at page no. 233 for the use of this publication. Printed in India No. Particulars Page No. Introduction 1 Assembly Constituency - (Vidhan Sabha) at a Glance | Features of Assembly 1-2 as per Delimitation Commission of India (2008) Location and Political Maps Location Map | Boundaries of Assembly Constituency - (Vidhan Sabha) in 2 District | Boundaries of Assembly Constituency under Parliamentary 3-7 Constituency - (Lok Sabha) | Town & Village-wise Winner Parties- 2014-PE and 2014-AE Administrative Setup 3 District | Sub-district | Towns | Villages | Inhabited Villages | Uninhabited 8-30 Villages | Village Panchayat | Intermediate Panchayat Demographics 4 Population | Households | Rural/Urban Population | Towns and Villages by 31-32
    [Show full text]
  • 0 0 23 Feb 2021 152000417
    Annexure I Annexure II ' .!'r ' .tu." "ffi* Government of Maharashtra, Directorate of Geology and Mining, "Khanij Bhavan",27, Shivaji Nagar, Cement Road, Nagpur-,1.10010 CERTIFICATE This is hereby certified that the mining lease granted to ]Ws Minerals & Metals over an area 27.45.20 Hec. situated in village Redi, Taluka Vengurla, District- Sindhudurg has no production of mineral since its originally lease deed execution. This certificate is issued on the basis of data provided by the District Collectorate, Sindhudurg. Mr*t, Place - Nagpur Director, Date - l1109/2020 Directorate of Geology and Mining, Government of Maharashtra, Nagpur 'ffi & r6nrr arn;r \k{rc sTrnrr qfrT6{ rtqailEc, ttufrg Qs, rr+at', fula rl-c, ffi qm, - YXo oqo ({lrr{ fF. osRe-?eao\e\\ t-m f. oeit-tlqqeqr f-+d , [email protected], [email protected]!.in *-.(rffi rw+m-12,S-s{r.r- x/?ol./ 26 5 5 flfii6- tocteo?o yfr, ll lsepzolo ifuflRirrs+ew, I J 1r.3TrvfdNfu{-{r rrs. \ffi-xooolq fus-q ti.H m.ffi, tu.frgq,l ffi ql* 1s.yr t ffiTq sF<-qrartq-qrsrufl -srd-d.. vs1{ cl fu€I EFro.{ srfffi, feqi,t fi q* fr.qo7o1,7qoqo. rl enqd qx fl<ato lq/os/?o?o Bq-tn Bqqri' gr{d,rr+ f frflw oTu-s +.€, r}.t* ar.ffi, fii.fufli ++d sll tir.xq t E'fr-qrqr T6 c$ Efurqgr tTer<ir+ RctsTcr{r :-err+ grd ;RrerrqTEkT squrq-d qT€t{d df,r{ +'t"qra *a eG. Tr6qrl :- irftf,fclo} In@r- t qr.{qrroi* qrqi;dqrf,q I fc.vfi.firqr|.
    [Show full text]
  • Sl No. District Taluka / Tehsil Name Village Name 1 Pune Mawal
    Land Schedule Taluka / Tehsil Gat No./ Survey Area Area Sl No. District Village Name Name No. (in Sqm.) (in Ha.) 1 Pune Mawal Parandwadi 264 19808.864 1.9810 265 9326.961 0.9330 266 6468.980 0.6470 267 9803.920 0.9800 268 19488.093 1.9490 273 30220.000 3.0220 275 25485.000 2.5485 276 11240.000 1.1240 Rasta 2305.000 0.2305 32 51920.000 5.1920 33 1420.000 0.1420 259 15160.000 1.5160 258 7355.000 0.7355 257 9115.000 0.9115 255 17795.000 1.7795 254 1425.000 0.1425 253 1455.000 0.1455 248 9530.000 0.9530 252 1485.000 0.1485 251 375.000 0.0375 250 480.000 0.0480 249 475.000 0.0475 245 1820.000 0.1820 244 765.000 0.0765 240 3845.000 0.3845 241 455.000 0.0455 239 570.000 0.0570 238 1320.000 0.1320 237 8340.000 0.8340 236 920.000 0.0920 235 980.000 0.0980 234 1540.000 0.1540 233 6110.000 0.6110 Page 1 of 71 Taluka / Tehsil Gat No./ Survey Area Area Sl No. District Village Name Name No. (in Sqm.) (in Ha.) 232 1430.000 0.1430 231 10040.000 1.0040 230 16245.000 1.6245 256 7740.000 0.7740 229 21345.000 2.1345 228 3175.000 0.3175 227 1820.000 0.1820 226 18620.000 1.8620 225 8230.000 0.8230 224 1260.000 0.1260 214 6555.000 0.6555 215 5665.000 0.5665 216 4230.000 0.4230 217 4235.000 0.4235 218 13820.000 1.3820 212 3135.000 0.3135 209 20.000 0.0020 207 7055.000 0.7055 202A 7145.000 0.7145 201 11305.000 1.1305 170 9270.000 0.9270 169 8690.000 0.8690 159 10690.000 1.0690 160 4590.000 0.4590 Total 46.5115 Page 2 of 71 Taluka / Tehsil Gat No./ Survey Area Area Sl No.
    [Show full text]
  • Village Map Sawale Taluka: Mawal Pimpari Malegaon Bk
    Village Map Sawale Taluka: Mawal Pimpari Malegaon Bk. District: Pune Khand Karjat Inglun Kune Ansute !( Malegaon Kh. Andhra Sarovar Khed Kusur Dahuli Kambare Andar Mawal Wahangaon Borivali Kivale µ 3.5 1.75 0 3.5 7 10.5 Nagathali Kashal Kusavali km Thoran Jambhavali Kalhat Shirdhe Vadeshwar Rakaswadi Bhoyare Ukasan Pawalewadi Valavanti Mau Kondivade A.m. Somavadi Location Index Pale Nane Mawal Udhewadi Nigade Bhajgaon Vadivali Lake MoramarwadiKacharewadi Vaund Phalane District Index Vadavali Nandurbar Khandashi Brahmanwadi Ghonshet Bhandara Shiravata Sarovar Ambale Govitri Dhule Amravati Nagpur Gondiya Kondivade N.m Shire Badhalawadi Jalgaon Nesave Sai Velhavali Karanjgaon Takave Bk. Akola Wardha Nandgaon Umbare Navalakh Buldana Nashik Washim Chandrapur Jevare Mendhewadi Yavatmal Sangise Kambare N.m. Nanoli N.m. Aurangabad Pangaloli Belaj Palghar Mangarul Jalna Gadchiroli Budhavadi Nane Hingoli Khalapur Kune N.m. KarandoliVehergaon Shilatane Thane Paravadi Jadhavwadi Ahmednagar Parbhani Dahivali Mumbai Suburban Nanded Valvhan sarovar Valakh Rajpuri Mumbai Bid Takave Kh. Budhele Vadivale Pune Jambhul Raigarh Bidar Devghar Akurdi Latur Mundhavare Osmanabad Khadakale (CT) Kanhe Ambi Nanoli Tarf Chakan Varsoli Sangavi Jambavade Lonavala (M Cl) Waksai Karla Kamshet Nayagaon Sudumbare Satara Solapur Pathargaon Ratnagiri Boraj Brahman Wadi Varale Sangli Sadapur Sudhavadi Malawali N.m. Kusgaon Kh. Mohitewadi Dongargaon WADGAON (MAWAL) Maharashtra State Lonavale Lake Taje Pimpaloli !( Katavi Kolhapur Patan Chikhalse Ahirvade Sate Wadagaon (CT) Induri Devale Bhaje Sindhudurg Talegaon Dabhade (R) Kusgaon Bk. (Ct) Dharwad Aundholi Aundhe kh. Malewadi Kurvande Brahmanwadi Bedse Talegaon Dabhade (M Cl) Karunj Taluka Index Lohagad Sawantwadi Sadavali Ozarde Urse Adhe kh. DhalewadiMahagaon Baur Junnar Dudhivare Kadadhe Parandvadi Apati Somatane Gevhande Apati Prabhachiwadi Ambegaon Adavi Pale Pawan MawalShindgaon Thugaon Atvan Kale Ambegaon Yelase Malawali P.m.
    [Show full text]
  • Govt Land Given on Lease Report 12-13
    CHAPTER V COLLECTOR, PUNE This chapter contains the results of audit of leased land in Pune district. There were 214 lease cases out of which 55 cases were selected for detailed scrutiny. Results of analysis are mentioned below: Sr. No. Category No. of observations 1 Incorrect grant of lease 2 2 Breach of lease conditions leading to change in purpose, 36 transfer of leasehold rights 3 Non-renewal of expired leases 19 4 Irregular sale/transfer of lease hold rights 4 Total 61 The observations are discussed in the following paragraphs: 5.1 Grant of land on lease without fulfillment of mandatory conditions for education purpose 5.1.1 Government Resolution issued in February 1983 stipulated that an education institution applying for the grant of land should be recognised by the Education Department. Further, R&FD should satisfy itself that 25 per cent of the capital expenditure required for putting up the building is immediately available with the applicant and remaining 75 per cent is likely to be available within a period of two years. As per lease agreement the lessee was to complete the construction of building within a period of two years. The Government (August 2009) allotted, land admeasuring 47,300 sq m at mauza Jambe, Taluka Mulshi, Pune to Maharashtra Mahila Udyam Trust, Pune on occupancy basis for a primary school, secondary school, hostel and college building and 32,000 sq m of land for playground on lease of ` one per annum for a period of 30 years. We noticed that: x the estimated capital expenditure of the educational project was ` 13.44 crore.
    [Show full text]
  • Maharashtra State Boatd of Sec & H.Sec Education Pune
    MAHARASHTRA STATE BOATD OF SEC & H.SEC EDUCATION PUNE PAGE : 1 College wise performance ofFresh Regular candidates for HSC March-2018 Exam. Candidates passed College No. Name of the collegeStream Candidates Candidates Total Pass Registerd Appeared Pass UDISE No. Distin- Grade Grade Pass Percent ction I II Grade 11.01.001 ANNASAHEB AWATE COLLLAGE MANCHAR DIST PUNE SCIENCE 154 153 0 38 110 4 152 99.34 27250102212 ARTS 284 284 2 61 166 20 249 87.67 COMMERCE 215 215 35 106 54 11 206 95.81 TOTAL 653 652 37 205 330 35 607 93.09 11.01.002 M G JUNIOR COLLAGE, MANCHER, DIST PUNE SCIENCE 240 240 33 115 91 1 240 100.00 27250102207 TOTAL 240 240 33 115 91 1 240 100.00 11.01.003 JANATA VIDYAMANDIR JR OL OF COM,GHODEGAON SCIENCE 124 124 4 33 64 0 101 81.45 27250105704 AMBEGAON ARTS 107 107 1 22 64 6 93 86.91 COMMERCE 219 219 19 103 78 4 204 93.15 TOTAL 450 450 24 158 206 10 398 88.44 11.01.004 SHRI. SHIVAJI JUNIOR COL, DHAMANI AMBEGAON SCIENCE 45 45 0 5 34 2 41 91.11 27250100702 TOTAL 45 45 0 5 34 2 41 91.11 11.01.005 SHRI BHAIRAVNATH JR COL OF COM AVSARI KD SCIENCE 55 55 1 17 35 2 55 100.00 27250103503 AMBEGAON HSC.VOC 54 54 0 37 13 0 50 92.59 TOTAL 109 109 1 54 48 2 105 96.33 11.01.006 SHRI.BHAIRAVNATH VIDYADHAM HIGHER ARTS 27 27 0 4 13 2 19 70.37 27250105504 SEC.SCH,AMBEGAON COMMERCE 24 24 0 6 13 1 20 83.33 MAHARASHTRA STATE BOATD OF SEC & H.SEC EDUCATION PUNE PAGE : 2 College wise performance ofFresh Regular candidates for HSC March-2018 Exam.
    [Show full text]
  • PUNE RURAL List of College with Area Coordinators District Coordinator -Dr.Shrikant Fulsundar ,Mo
    SAVITRIBAI PHULE PUNE UNIVERSITY NATIONAL SERVICE SCHEME PUNE RURAL List Of College With Area Coordinators District Coordinator -Dr.Shrikant Fulsundar ,Mo. 9860286411, B-10 , Gramonnati Mandal Arts, Commerce & Science College Addr: Narayangaon Tal: Junnar Dist: Pune, Pincode: 410504 Programme Sr. No. Code College Name Mobile No Officer Name Area Coordinator Rayat Shikshan Sanstha Annasaheb Aawate 1 B-001 College Addr: Manchar Tal: Ambegaon Dist: पोकळे संजयकुमार Pune, Pincode: 410503 तुकाराम 9850652907 Ambegaon Taluka Vidya Vikas Mandal B.D.Kale College Ghodegaon Addr: At Post 2 B-005 Godegaon Tal: Ambegaon Dist: Pune, करंदीकर वभ Pincode: 412408 शंकर 9421001146 Korade Shakurao Gangaram Bhimashankar Shikshan Sanstha Dattatray 9922468295 3 B-SF-085 Govindrao Walse Patil Mahavidhylay Addr: Bhimashankar Shikshan A/P - Dattatray Nagar Pargaon Tal: कोरडे शाकुराव Sanstha Dattatray Govindrao Ambegaon Dist: Pune, Pincode: 412406 गंगाराम 9922468295 Walse Patil Mahavidhylay Addr: A/P - Dattatray Nagar Shri Pandharinath Vidya Vikas Mandal Pargaon Tal: Ambegaon Dist: Pokhari Shri pandharinath Arts Commerce Pune, Pincode: 412406 4 B-SF-118 and Science College Addr: Post pokhari Tal Ambegaon Dist Pune Tal: Ambegaon Dist: कािशदे यादव Pune, Pincode: 410509 मधुकर 7083262996 Maharashtra Shasan Govt. College Of Engg. 5 B-SF-097 & Research Addr: Awasari Khurd Tal: पांचाळ मंगेश Ambegaon Dist: Pune, Pincode: 412405 िदगंबर 8149121404 Programme Sr. No. Code College Name Mobile No Officer Name Area Coordinator Pune Jilha Shikshan Mandal Annasaheb 6 B-004 Waghire College Addr: Post-Otur Tal: Junnar Dist: Pune, Pincode: 412409 बीबे अमोल मनोहर 9623883631 Dnyaneshwar Gramonnati Mandal Hon.Balasaheb Jadhav Arts, Commerce and 7 B-007 Science College Addr: Ale Tal: Junnar Dist: भुजबळ रवीं Pune, Pincode: 412411 िचमाजी 9890460746 Gramonnati Mandal Arts, Commerce & 8 B-010 Science College Addr: Narayangaon Tal: कांबळे िल Junnar Dist: Pune, Pincode: 410504 िदलीप 8446252951 J.T.S.S.P.
    [Show full text]
  • Pune Cdap.Pdf
    PREFACE The process of planned economic development in India began with the launching of the First Five Year Plan in 1951 and currently India is in the 12th Five Year Plan (2012-13 to 2016- 2017). The main objective of policy makers is to promote growth with social justice. During the Eleventh Plan period, the agricultural sector experienced a miniscule growth rate of 3.64 per cent per annum. Indian agriculture is presently at cross roads and one of the major challenges is to reverse deceleration in agricultural growth rates so as to successfully achieve a higher broad based growth. In view of the above, a special Additional Central Assistance Scheme -Rashtriya Krishi Vikas Yojna (RKVY) which is a State Plan scheme administered by the Union Ministry of Agriculture was conceived. The main purpose of the scheme is to supplement state specific strategies with a view to rejuvenate agriculture. The pattern of funding under this scheme is 100 percent Central grant. In order to avail of funds under RKVY, each district is entrusted with the task of preparing a comprehensive district agricultural plan. Accordingly, this plan was prepared for Pune district. The Plan revealed that the city has suitable infrastructure and conducive climate for high value agriculture. Floriculture is also coming up in a big way. Similarly dairy development and poultry have huge potential in the district. As the city is close to Mumbai and well connected by road, rail and air to other major cities there is a ready market available for consumption of agricultural goods, processed goods, dairy and poultry products.
    [Show full text]
  • Maharashtra State Boatd of Sec & H.Sec Education Pune
    MAHARASHTRA STATE BOATD OF SEC & H.SEC EDUCATION PUNE PAGE : 1 College wise performance ofFresh Regular candidates for HSC MARCH-2019 Candidates passed College No. Name of the collegeStream Candidates Candidates Total Pass Registerd Appeared Pass UDISE No. Distin- Grade Grade Pass Percent ction I II Grade 11.01.001 ANNASAHEB AWATE COLLLAGE MANCHAR DIST PUNE SCIENCE 156 156 0 25 116 8 149 95.51 27250102212 ARTS 252 252 2 42 126 25 195 77.38 COMMERCE 209 209 36 118 51 0 205 98.08 TOTAL 617 617 38 185 293 33 549 88.97 11.01.002 M G JUNIOR COLLAGE, MANCHER, DIST PUNE SCIENCE 238 238 16 81 139 2 238 100.00 27250102207 TOTAL 238 238 16 81 139 2 238 100.00 11.01.003 JANATA VIDYAMANDIR JR OL OF COM,GHODEGAON SCIENCE 137 137 1 43 91 0 135 98.54 27250105704 AMBEGAON ARTS 121 121 0 19 70 7 96 79.33 COMMERCE 221 221 14 70 122 11 217 98.19 TOTAL 479 479 15 132 283 18 448 93.52 11.01.004 SHRI. SHIVAJI JUNIOR COL, DHAMANI AMBEGAON SCIENCE 44 44 0 1 29 6 36 81.81 27250100702 TOTAL 44 44 0 1 29 6 36 81.81 11.01.005 SHRI BHAIRAVNATH JR COL OF COM AVSARI KD SCIENCE 18 18 0 2 11 2 15 83.33 27250103503 AMBEGAON HSC.VOC 60 60 1 24 23 0 48 80.00 TOTAL 78 78 1 26 34 2 63 80.76 11.01.006 SHRI.BHAIRAVNATH VIDYADHAM HIGHER ARTS 32 32 0 5 19 1 25 78.12 27250105504 SEC.SCH,AMBEGAON COMMERCE 30 30 3 13 13 0 29 96.66 MAHARASHTRA STATE BOATD OF SEC & H.SEC EDUCATION PUNE PAGE : 2 College wise performance ofFresh Regular candidates for HSC MARCH-2019 Candidates passed College No.
    [Show full text]
  • 2019020192.Pdf
    Pune Muncipal Corporation ( PMC ) Zone Wise Vacant Centers Sr.No District Corporation Name Zone Ward Office Name Vacant Centers Dhanori Vidhyanagar Lohagaon Tingre Pumping Station Kalas Vishrantwadi Nanasaheb Parulekar Vidhyalaya Yerwada Prizen Press 1 Sangawadi 10 PhuleNagar ,Yerwada Netaji Subhashchandra Bose Vidhyalaya Yerwadagaon Parnkuti YerwadaHotmix Plant Deccon Collage Lohagaon Vimantal Kharadigaon Kharadi Infotech Park Sundrabai Marathe Vidhyalaya 2 Pune PMC Yeravda Nagar Road Vadgaon Sheri 11 Ramwadi Agakhan Pallace Don Bosco Highschool NagpurChawl Kamla Nehru Hospital Tilak Aaurved Mahavidhyalaya Rajewadi Harkanagar Jonral Arunkumar vaidya Stedium Doke Talim 3 Bhavani Peth 13 Swami Samarth Mandir Ganesh peth Ghorpade Udhyan Mahatma Phule Smark (Samata Bhumi) Lohianagar Ekbote Colony Gurunanak Nagar Chaturshingi Mandir Model Colony Morden Collage P.M.C Bhavan Dr.Nayadu Hospital Bundgarden 4 Dhole Patil Road Wadiya Collage 10 Koregaon Park Mundhvagaon Vikas Nagar Ghorpadi Dr.Babasaheb Ambedkar Udhyan Sasoon Hospital Juna Bazar Parvatigaon Paravati Jal kendra Dandekar Pul-Dattawadi Pu.La.Deshpande Udhyan Janta Vasahat 5 Tilak Road Anandnagar -Higne Khurd 21 Pune PMC Vitthalwadi Vadgaon Dhayari Vadgaon Budruk Manikbaug Dhayari (Part) (N.V.) Magarpatta Hadapsar Hadapsar Indestrial Estate Sent Patric Town Wanwadi Gaon Ramtekdi Hadapsar Gaon Glayding Center 6 Hadapsar Sadhana Vidhylaya 24 Satavwadi Kaleborate Nagar Mahamodwadi Hadapsar (N.V.) Keshavnagar-Mundwa (N.V.) Uruli-dewachi/mantarwadi Fursungi Kamal Nayan Bajaj Udhyan Setki
    [Show full text]