CfJayter 5 MoCecuCar characterization of V(P4, V(P6, V(P7 ancfm Molecular characterization of VP4, VP6, VP7 and NSP4 genes of group B rotavirus strains from outbreaks of gastroenteritis 5.1 Materials and methods 5.1.1 Specimens In the outbreaks of gastroenteritis that occurred in Daman, Union territory of India (Kelkar et al., 2007); Surat, Gujarat state; Kalambi and Khanderajuri villages of Sangli district, Maharashtra state and Bhabwadi village of Bhor Taluk of Pune district, Maharashtra state respectively in the years 2000, 2004, 2009 and 2011, RVB was detected to be the major etiologic agent by NSP2 gene targeted RT-PCR (Chapter 4). Fecal or rectal swab specimens received from these outbreaks of gastroenteritis were stored at -20°C. One specimen each of the four RVB outbreaks (NIV-005625, NIV-04622, NIV-094456 and NIV-119429) was selected for characterization of VP4, VP6, VP7 and NSP4 genes. All four specimens belonged to the adult cases examined during the outbreak period. 5.1.2 RNA extraction. RT-PCR amplification of RVB VP4. VPS. VP7 and NSP4 genes and agarose gel electrophoresis Viral RNA was extracted from fecal specimens using TRIzol® LS reagent as per manufacturer's instructions (Invitrogen, CA, U.S.A). RT-PCR was carried out for RVB VP4, VP6, VP7 and NSP4 genes by using one step RT-PCR kit (Qiagen Co., Hilden, Germany). Full length VP4 (2306 bp), VP6 (1269 bp), VP7 (814 bp) and NSP4 (751 bp) genes of RVB strains were amplified using primers published earlier (Chen et al. 1990a; Ahmed et al., 2004) as well as designed for the study (Table 5.1). Briefly, PCR conditions involved an initial reverse transcription of 30 min at 50°C, followed by PCR activation at 95°C for 15 min, 35 cycles of amplification (1 min at 94''C, 30 sec at 50°C and 1 min at 72°C) with final extension at 72°C for 7 min for VP7 and NSP4. The same procedure was used for VP4 and VP6 except that the annealing was carried out for 30 sec at 52°C and 55°C respectively. All PCR products were analyzed on 2% agarose gel containing 0.5 pg / ml EtBr and visualized under UV transilluminator. 67 CHapterS: ClMracterizationof1^4, V Table 5.1: List of primers used for the study Viral Primer Primer sequence {5'-3') Position* Product gene name size (bp) VP4 BVP4-1F GGCAATATATTTGCTATGTTGACG 1-24 758 BVP4-1R CCTCCCATTGTTCCGTAAGC 758-739 BVP4-2F GTGGGATATGAACTGTGCAAACG 609-631 830 BVP4-2R CTCCCCCGGTTACAAAATCTGGATC 1438-1414 BVP4-3F GGTGGAGACTTTTACAGACAAGG 1306-1328 730 BVP4-3R CGTGCGCTAAATCCGGGTC 2035-2017 BVP4-4F CAATAGCTACTGAAGTCAAACTTCC 1832-1856 475 BVP4-4R GGGTTTTTATATGTATTTGCAACA 2306-2283 VP6 FLCD-6F GGTTTAAATAGCCCAACCGGTGAT 1-24 704 ADG5-1R3 CCAGCTGTAGGTATGTAGACGATG 704-681 GBR-6F GTGGTCAGGTAATAAAGGGGTTG 582-604 688 GBR-6R GGGTTTTATTGCTTATTTTTTCGCA 1269-1245 VP7 ADG9-1F'' GGCAATAAAATGGCTTCATTGC 1-22 814 ADG9-1R^ GGGTTTTTACAGCTTCGGCT 814-795 NSP4 GBlO-lb GGCAATTAAAAGTCCAGTTATGG 1-23 751 GBR-IOR GGGTCCTTATCAGTTTGATCAG 751-730 Note: * - Positions of primer sequences are expressed as nucleotide numbers in individual genes of ADRV/CAL-1 strains of RVB. 'a' denotes the primer sequences described by Chen et al. (1990a), while 'b' stands for the primer mentioned by Ahmed et al. (2004). 5.1.3 Nucleotide sequencing and phyloqenetic analyses The excised PCR products were purified using QIAquick gel extraction kit (Qiagen Co., Hilden, Germany) and sequencing was carried out using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied biosystems, Foster city, USA) on an automated DNA sequencer (ABI PRISM 3100 Genetic analyser, Applied biosystems, USA). The nucleotide/deduced amino acid sequences of VP4, VP6, VP7 and NSP4 genes of RVB strains of the present study were aligned with the sequences of RVB strains available in GenBank by using CLUSTAL W program (Thompson et al., 1994). The phylogenetic analyses were carried out in MEGA version 5 software package by using Kimura 2-parameter and Neighbour-joining algorithm (Tamura et al., 2011). The reliability of phylogenetic trees was supported statistically by bootstrapping with 1000 replicates. 68 chapters-. Cliaracterizationof'W4,1^6,1^7and!NS'P4genes 5.1.4 Genetic distance and percent identity calculation The percent identity of individual gene sequences was calculated using p- distance parameter available in MEGA version 5 software package (Tamura et al., 2011). Detailed procedure is described in Chapter 4, section 4.1.10.5. 5.1.5 Identification of unique amino acid Unique amino acids defined as the presence of specific amino acid residues at specific positions not reported in the sequences of other RVB strains available in the GenBank were identified by using tBIastn server available at NCBI website. 5.1.6 Accession numbers The nucleotide sequences derived in this study were submitted to GenBank under the accession numbers JN009771-JN009782, KF689789, KF689791, KF689793 and KF689795. GenBank accession numbers assigned for the individual genes of the four strains examined in this study are provided in Table 5.2 and those of the reference strains utilized in this study are provided in Table 5.3. 69 CHapterS: Characterization of ^^4, V(P6, 1^7 andJiS'P4 genes Table 5.2: GenBank accession numbers assigned for the gene segments VP4, VP6, VP7 and NSP4 of the RVB strains representing four outbreaks of acute gastroenteritis investigated in the study Gene segments RVB strain GenBank accession numbers NIV-005625 JN009773 NIV-04622 JN009772 NSP4 NIV-094456 JN009771 NIV-119429 KF689789 NIV-005625 JN009776 NIV-04622 JN009775 VP4 NIV-094456 JN009774 NIV-119429 KF689791 NIV-005625 IN009779 NIV-04622 JN009778 VP6 NIV-094456 JN009777 NIV-119429 KF689793 NIV-005625 JN009782 NIV-04622 IN009781 VP7 NIV-094456 JN009780 NIV-119429 KF689795 Table 5.3: GenBank accession numbers of reference RVB strains included in the study RVB strain GenBank accession numbers of gene segments VP4 VP6 VP7 NSP4 ADRV M91434 M55982 M33872 AY548957 WH-1 AY539857 AY539858 AY539856 AY539864 WH-2 - - AY215070 - IDH-084 GU377227 GU377228 GU377229 GU377233 IC-008 GU377216 GU377217 GU377218 GU377222 CAL-1 AF184084 AB037931 AF184083 AY238387 MMR-Bl FI811826 FI811827 FJ811825 FJ811828 Bang-117 GU391304 GU391305 GU391306 GU391310 Bang-373 AY238388 AY238389 AY238385 AY238384 Bang-544 F)851391 FJ851392 FJ851390 FJ851393 Nemuro - AB106542 AB016818 - DBlOl - - AY158155 - Table 5.3 (cont.) 70 chapter S: Cliaracterizationof1^4, ^^6, 1^7 and9^S RVB strain GenBank accession numbers of gene segments VP4 VP6 VP7 NSP4 DB176 GQ358710 GQ358713 AF531910 - DB180 - - AF529214 - RUBV226 GQ358711 GQ358714 - - RUBV282 GQ358712 GQ358715 - - IDIR X16949 M84456 D00911 U03557 PB-F18 - - AB490417 - PB-Talheiyo - - AB490418 - PB-Kyushu - - AB490419 - PB-S3 - - AB490420 - PB-S5 - - AB490421 - PB-S13 - - AB490422 - PB-S15 - - AB490423 - PB-S19-1 - - AB490424 . PB-S22-3 - - AB490425 - PB-S24-11 - - AB490426 - PB-S26-1 - - AB490427 - PB-S37-3 - - AB490428 - PB-S40-1 - - AB490429 - PB-S40-11 - - AB490430 - PB-S43-2 - - AB490431 - PB-S43-11 - - AB490432 - PB-S43-17 - - AB490433 - PB-S48-1 - - AB490434 - PB-S49-2 - - AB490435 - PB-S49-13 - - AB490436 - PB-S59-19 - - AB490437 - PB-S61-4 - - AB490438 - PB-7-2-4 - - AB490439 - PB-7-5-5 - - AB490440 - PB14-29 - - AB490441 - PB-14-31 - - AB490442 - PB-23-5 - - AB490443 - PB-23-10 - - AB490444 - PB-23-44 - - AB490445 - PB-68-C17 - - AB490446 - PB-68-D5 - - AB490447 - PB-68-E4 - - AB490448 - PB-68-G4 - - AB490449 - PB-70-H3 - - AB490450 - PB-70-H5 - - AB490451 - PB-71-H5 - - AB490452 - PB-72-H3 - - AB490453 - PB-72-I2 - - AB490454 - Note:'-' indicate non-availability or exclusion of data. 71 CHapterS: Cliaractenzationof'V(P4, V(p6, VPZ aruf !NS 5.2 Results 5.2.1 RT-PCR amplification of RVB VP4. VP6. VP7 and NSP4 genes RT-PCR carried out for the amplification of VP4, VP6, VP7 and NSP4 genes of RVB generated high intensity bands. Figure 5.1 is the representative picture of electrophoretic migration pattern of fragments of VP4, VP6, VP7 and NSP4 genes of one RVB strain, NIV-04622. Lane Product size Amplified no. gene 1 Blank 2 758 bp 3 830 bp 4 730 bp VP4 5 475 bp 6 DNA ladder 7 Negative control 8 704 bp VP6 9 688 bp 10 814 bp VP7 11 751 bp NSP4 12 DNA ladder Figure 5.1: Electrophoretic migration pattern of PCR products of RVB genes 5.2.2 Phylogenetic analysis of the VP7 gene Phylogenetic analysis of VP7 genes of all of the four RVB strains representing four outbreaks displayed clustering of their sequences with the corresponding sequences of other strains placed in the Indian-Bangladeshi lineage of genotype G2 (Figure 5.2). Comparison of the sequences with those of the other strains belonging to Indian-Bangladeshi lineage and Chinese lineage showed <3% and 9% nucleotide diversity respectively (Table 5.4). 72 chapters: Characterization 0/1^4, V(P6, 'U(P7and!N'S 99 -RVB/Pig-wt/JPN/PB-70-H3/2007/G20P[)q 96 RVB/Pig-wt/JPN/PB-23-10/2005/G20P[X] RVB/Pig-wt/JPN/PB-58-G4/2007/G19P[X] •RVB/Pig-wt/JPN/PB-23-5/2005/G18P[Xl RVB/Pig-wt/JPN/PB-68-C17/2007/G16P[)q RVB/Pig-wt/USA/OK09-51/2009/G17P[X| RVB/Pig-wt/JPN/PB-S49-2/2003/G15P[X1 RVB/Pig-wt/JPN/PB-68-D5/2007/G14P[)q 93 RVB/Pig-wt/JPN/PB-2344/2005/G13P[X1 90 RVB/Pig-wt/JPN/PB-S40-1/2003/G12PlXl RVB/Pig-wt/JPN/PB-S5/2002/G11P[X] RVB/Pig-wt/JPN/PB-70-H5/2007/G4P[>q RVB/Pig-wt/JPN/PB-S49-13/2003/G8P[X| 100 RVB/Pig-wt/JPN/PB-FI 8/2001/G6P[Xl 90 RVB/Pig-wt/USA/MO09-34/2009/G10PlX| 92 RVB/Pig-wt/JPN/PB-72-12/2007/G7P[)q 100 RVB/Pig-wt/JPN/PB-68-E4/2007/G9P[X] 73 100 I RVB/Cow-wt/IND/DB101/2001/G5P[X] 1 RVB/Cow-wt/IND/DB180/2001/G5P[X] 100 - RVB/Cow-wt/JPN/Nemuro/1997/G3PlX| 100-ii— Ir— [ RVB/Cow-wt/JPN/ATI/XXXX/G3P[)q rRVB/Human-wt/IND/CAL-1/1998/G2P(X] RVB/Human-wt/BGD/Bang373/2000/G2P[X] A RVB/Human-wt/BGD/Bang117/2002/G2PM 71 RVB/Human-wt/BGD/Bang544/2001/G2P[)q RVB/Human-wt/INO/NIV-00562S/2000/G2P[X] RVB/Human-wt/INO/NIV-04622/2004/G2P[X] Indian-Bangladeshi lineage RVB/Human-wt/IND/NIV-094456/2009/G2P[X] 80 RVB/Human-wt/IND/IC-008/2008/G2Pl)q 100 92 RVB/Human-wt/IND/NIV-119429/2011/G2P[X] RVB/Human-wt/IND/IDH-084/2007/G2P[Xl L RVB/Human-wt/MMR/MMR-B1 /2007/G2P[X| 98jRVB/Human-wt/CHN/WH-1/2002/G2Pl)q __ I RVB/Human-wt/CHN/WH-2/2002/G2P[)q Chinese lineage 99 -RVB/Human-wt/CHN/ADRV/1982/G2P[X) RVB/Rat-hhp/USA/IDIR/1984/G1P[X] RVH/Human-tc/CHN/J19/1997/GXP[)q 0.1 Figure 5.2: Phylogenetic dendogram of nucleotide sequences of VP7 gene (nt 23-794) of RVB strains. The strains of the present study are highlighted in blue colour. The scale represents genetic distance 73 chapters: Cliaracterizationof'PP4, 1^6, lipZaridyiS(P4gems Table 5.4: Percent nucleotide and amino acid sequence identities of VP4, VP6, VP7 and NSP4 gene segments of strains NIV-005625, NIV-04622, NIV-094456 and NIV-119429 to those of other RVB strains from Indian Bangladeshi lineage, Chinese lineage and within themselves Indian Bangladeshi Chinese lineage Study strains Gene lineage segment Nucleotide Amino Nucleotide Amino Nucleotide Amino acid acid acid VP4 96.9-99.3 97.3-99.7 90.6-91.9 93.3-95.8 97.3-98.8 98.0-99.1 VPS* 96.2-99.8 93.4-99.5 88.4-89.9 90.2-93.9 97.5-99.5 97.5-99.0 VPS* 97.0-99.4 98.5-99.8 91.3-92.8 94.6-96.6 97.2-99.1 98.7-99,6 VP6 97.4-99.3 98.7-100 92.3-94.1 97.1-98.5 98.2-99.4 99.7-100 VP7 96.9-99.6 97.3-100 90.5-92.1 93.6-95.9 97.4-100 97.9-100 NSP4 95.9-99.4 97.2-100 90.1-92.1 92.3-95.3 98.3-99.6 98.6-100 5.2.3 Phvioqenetic analysis of the VP4. VPS and NSP4 gene segments The sequence analyses of VP4, VP6 and NSP4 gene segments of all of the four RVB strains also showed clustering in a single lineage of the Indian- Bangladeshi RVB strains belonging to VP7 genotype G2 (Figure 5.3, 5.4 and 5.5) with nucleotide/deduced amino acid identity of 95.9-99.4% / 97.2-100% with RVB strains of Indian, Bangladeshi and Myanmarese origin, and of 90.1-94.1% / 92.3- 98.5% with Chinese RVB strains (Table 5.4). Among the four genes analyzed for these strains, VP8* and VP5* regions of VP4 genes showed lower nucleotide / amino acid identity (96.2-99.8% / 93.4-99.5% and 97.0-99.4 / 98.5-99.8%) with other strains of Indian-Bangladeshi lineage. The nucleotide/amino acid identities of NIV-005625/2000 and NIV-04622/2004 strains were highest (96.3-99.3% / 97.2-100%) with the Indian (CAL-1) and Bangladeshi (Bang 117, Bang 373 and Bang 544) strains isolated during 2000-2002, while, the nucleotide/amino acid identities of the remaining two RVB strains, NIV-094456/ 2009 and NIV-119429/ 2011, were highest (99,5-98.7% / 98.8-100%) with the Indian (IDH-084 and IC- 008) and the Myanmarese (MMR-B1) strains isolated in 2007-2008. 74 CHapterS: Citaracterization of1^(p4, V(P6, V(P7 and^S(P4 genes gg,R\/B/Hunian-wt/IND/NIV-094456/2009/G2P[X] RVB/Human-wt/IND/NIV-119429/2011/G2P[X] R\/B/Human-wVIND/IC-008/2008/G2P(X] 100 RVB/Human-wt/IND/IDH-084/2007/G2P[X] 96 R\/B/Human-wt/MMR/MMR-B1/2007/G2P[X] RVB/Human-vi/t/IND/NIV-04622/2004/G2P[X] Indian-Bangladeshi lineage RVB/Human-wt/IND/NIV-00S625/2000/G2P[X] 100 R VB/Human-wt/IND/C AL-1/1998/G2P1X] RVB/Human-wVBGD/Bang373/2000/G2P[X] ool RVB;Hunnan-wt/BGD/Bang544/2001 /G2P1X] 79' R\/B/Human-wt/BGD/Bang117/2002/G2P[X] p RVB/Human-wt/CHN/ADRV/1982/G2P[X] Chinese lineage IM1 R\/B/Human-wt/CHN/WH-1/2002/G2P[X] RVB/Rat-hhp/USA/IDIR/1984/G1P[X] r— RVB/Cow-wVIND/DB176/2001/G3P[X] 7o(d|RVB/Cow-wt/IND/RUBV226/2004/G3P[X] 99TR\/B/Cow-wt/IND/RUBV282/2005/G3P[X] RVH/Human-tc/CHN/J19/1997/GXP[X] Figure 5.3: Phylogenetic dendogram of nucleotide sequences of VP4 gene (nt 25-2282) of RVB strains. The strains of the present study are highlighted in blue colour. The scale represents genetic distance. RVB;Human-wt/IND/NIV-0944S£/2009/G2P[X] J RVB/Human-wt/IND/NIV-119429/2011/G2P[X] 99 RVB/Human-wt/IND/IC-008/2008/G2P[Xl R\/B/Human-wt/IND/IDH-084/2007/G2P[X] 96 8f|'R\/B/Human-wt/MMR/MMR-B1/2007/G2P[X] RVB/Human-wt/IND/NIV-04«22/2004/G2P[X] Indian-Bangladeshi lineage RVB/Human-wt/IND/NIV-005625/2000/G2P[X] RVB/Human-wt/BGD/BangI 17/2002/G2P[X) RVB/Human-wt/BGD/Bang373/2000/G2P|X] 8! RVB/Human-wt/BGD/Bang544/2001 /G2P[X] R\/B/Human-wt/IND/CAL-1/1998/G2PlX] p R\/B/Human-wt/CHN/ADRV/1982/G2P[X] lOoL R\/B/Human-wt/CHN/WH-1/2002/G2P[X] Chinese lineage - R\/B/Rat-hhp/USA/IDIR/1984/G1P[Xl — RVB/Cow-wWPN/Nemuro/1997/G3P[X] RVB/Cow-wt/IND/DB 176/2001 /G3P[X1 RVB/Cow-wt/IND/RUB\/226/2004/G3P[X] 100 I RVB/Cow-wt/iND/RUB\/282/2005/G3P[X] RVH/Human-tc/C HN/J19/1997/GXP[X] Figure 5.4: Phylogenetic dendograms of nucleotide sequences of VP6 gene (nt 25-1244) of RVB strains. The strains of the present study are highlighted in blue colour. The scale represents genetic distance. 75 CHapterJ: CHaracterization qfV¥4, V(P6, 'pcpZ an(f[N'S 76 RVBflHuman-wt/lNDftJIV-094456/2009/G2P[X] 85 RVB/Human-wW1NDffJIV-119429/2011/G2P[X] 90 RVB/Human-wt/IND/IC-008/2008/G2PlX] RVB/Human-wUMMR/MMR-B 1 /2007/G2PIX] 86 R\/B/Human-wt/IND/IDH-084/2007/G2P[X] 83 L RVB/Human-wWNDn^lV-04622/2004/G2P[X] Indian-Bangladeshi lineage 73 RVB/Hunian-wt/lND/NIV-005625/2000/G2P[X] rR\/B/Human-wt/BGD/Bang373/2000/G2P[X] 9^lR\/B/Human-wt/BGD/Bang544/2001/G2P[X] - RVB/Hum an-wt/IND/CAL-1 /1998/G2P[X] - R\/B/Human-wt/BGD/Bang117/G2P[X] r RVB/Human-wt/CHN/ADRV/1982/G2PlX] Chinese lineage loot RVB/Human-wt/CHNAA;H-1/2002/G2P[X] - R\/B/Rat-hhp/USA/IDIR/1984/G1PlX] R\«Human-fc/CHN/J19/1997/GXP[XI Figure 5.5: Phylogenetic dendogram of nucleotide sequences of NSP4 gene (nt 24-729) of RVB strains. The strains of the present study are highlighted in blue colour. The scale represents genetic distance. 5.2.4 Amino acid substitutions in the RVB strains The deduced amino acid sequences of VP4 (VPS* and VPS* region), VPS, VP7 and NSP4 proteins of NIV-005625, NIV-04622, NIV-094456 and NIV-119429 strains of the present study were compared with those available in GenBank. Potential trypsin cleavage sites (R207, R214) and two hydrophobic regions (aa residues 6-20 and 41-55) of VP4, potential glycosylation sites (aa positions 45, 91 and 105) of VP7 and the two putative enterotoxin regions (aa residues 106- 127 and 191-219) in NSP4 known to be highly conserved (Yamamoto et al., 2010; Ishino et al., 2006) were also detected in all four RVB strains. Based on sequence data, no significant genetic difference was observed in these strains when compared with other RVB strains recovered from sporadic and outbreak cases except the presence of few unique amino acid substitutions detected in the VP4 and NSP4 protein. As compared to ADRV strain, multiple amino acid substitutions were noted in all of the four proteins as reported earlier for other RVB strains (Aung et al., 2009). However, unique amino acid substitutions were detected only in the VP4 and/or NSP4 proteins (Table 5.5). NIV-005625 strain showed two-NilOD, H131R and one-A619V unique amino acid substitutions respectively in VPS* and VPS* regions, while NIV-04622 and NIV-0944S6 strains 76 chapters-. CftaracterizationofV(P4, 'We, 'lApTand%S(P4genes showed respectively VI711 and K19Q substitution only in the VPS* region. NIV- 04622 strain also showed an amino acid substitution, D/S5N in the NSP4 protein. The 2011 RVB strain, NIV-119429 showed one-Q195P and four-l516M, T620A, M627I, IA/698T unique amino acid substitutions respectively in VPS* and VPS* regions. One of the five hydrophobic regions (aa positions 139-160, 375-400, 416-452, 500-530 and 551-573) predicted earlier for this protein (Yamamoto et al., 2010) was not found completely conserved in this study (amino acid changes at 516; isoleucine to methionine). These unique substitutions were also noted in other RVB strains detected in the same outbreaks (data not shown). Table 5.5: Unique amino acid substitutions (in blue) in the VP4 and NSP4 proteins of RVB strains causing outbreaks of gastroenteritis Strain Amino acid positions \ /P4 NSP4 19 110 131 171 195 516 619 620 627 698 5 ADRV K N H V Q I A T M I D WH-1 . , IDH-084 . S IC-008 S CAL-1 . S MMR-Bl . S Bang-117 S Bang-373 , S Bang-544 S NIV-005625 D R V S NIV-04622 N NIV-094456 Q , S NIV-119429 P iM A I T s 77 chapter 5: Cfiaracterizationof'UP4, 'WS, W7 atuf!N'S 5.3 Discussion Since 1982, several outbreaks attributed to RVB infection have been reported from China (Hung et a!., 1984; Fang et a!., 1989a). However, in India, a country in the neighbourhood of China, single outbreak caused by this virus has been documented by Kelkar et al. (2007). To date, all genes of human RVB strains detected from time to time in China, India, Bangladesh and l\/lyanmar have been classified into Chinese and Indian-Bangladeshi lineages (Yang et al., 2002; Aung et al., 2009; Ahmed et al., 2004; Yamamoto et al., 2010). In the present study, RVB strains identified to cause the outbreaks of gastroenteritis in western India were also classified in Indian-Bangladeshi lineage on the basis of VP4, VP6, VP7 and NSP4 gene sequences. The nucleotide and amino acid sequences within these strains were almost similar throughout the four gene segments. However, NIV-005625 strain from Daman (2000) and NIV-04622 strain from Surat (2004) carried high nucleotide sequence identities among themselves particularly in VP4 and NSP4 genes as compared to that noted with the NIV-094456 and NIV-119429 strains respectively from Sangli (2009) and Bhor (2011). This increase of genetic divergence might be due to accumulation of point mutations in proportion to the time lag of detection. Interestingly, the amino acid substitutions identified in the VPS* and/or VPS* regions of RVB strains of the present study were unique as compared to those of the RVB strains reported earlier. However, within VPS* and VPS* regions, the VPS* region was more divergent from that of the other RVB strains. This finding of divergent VPS* is corroborated by other studies on RVB strains described previously (Aung et al., 2009; Yamamoto et al., 2010). These data support the possible susceptibility of this region to temporal variations and evolutionary changes required for the adaptation and persistence of RVB in the environment. It has been suggested that the structural and functional features of VP4 protein of RVB are analogous to that of RVA (Gorziglia et al., 1988; Sereno et al., 1994). A study conducted using the strategy of production of recombinant Lactococcus lactis expressing VPS* subunit of RVA has described induction of immune response specific to rotavirus in a mouse model (Marelli et al., 2011). In view of this, it is possible that the unique amino acids detected in the VP4 protein of RVB strains of the present study may contribute to changed antigenic 78 Cftayter5: CliaracterizationofW4,1^6,1^7 amf!N'S(P4 gems properties and influence the host immune response. It may be noted that in the present study occurrence of RVB outbreaks could not be explained on account of genetic relatedness between the strains causing outbreaks and sporadic infections. Moreover, the study is limited to characterization of only four genes. Full length genome sequence analysis would help to understand the genetic differences in the RVB strains, precisely. It may also be speculated that the occurrence of RVB outbreaks was related to the immune status of the affected individuals. However, to clarify this issue, the extent of RVB exposure of the population from different settings needs to be determined by development of RVB specific seroimmunological assays and their large scale applications in different countries. 79
Cfjayter 5 Mocecucar Characterization of V(P4, V(P6, V(P7 Ancfm<P4 Genes of Group ^B Rotavirus Strains from Outsrea^ of Gastr
