UC Merced UC Merced Electronic Theses and Dissertations
Title Bacterial endophytes of California conifers: cultures, genomes, and community analysis.
Permalink https://escholarship.org/uc/item/0p54q4mt
Author Wilson, Emily Catherine
Publication Date 2015
Peer reviewed|Thesis/dissertation
eScholarship.org Powered by the California Digital Library University of California
UNIVERSITY OF CALIFORNIA, MERCED
Bacterial endophytes of California conifers: cultures, genomes, and community analysis.
A dissertation submitted in partial satisfaction of the requirements for
the degree Doctor of Philosophy
in
Quantitative and Systems Biology
by
Emily Catherine Wilson
Committee in Charge:
J. Michael Beman, Chair Miriam Barlow A. Carolin Frank Clarissa Nobile
Chapters 1- 3 © Emily Catherine Wilson, 2015
All rights reserved
The dissertation of Emily C. Wilson is approved, and it is acceptable in quality and form for publication on microfilm and electronically:
______Miriam Barlow
______A. Carolin Frank
______Clarissa Nobile
______J. Michael Beman, Chair
University of California, Merced 2015
iii Dedication
William Shakespeare once wrote: “Some are born great, some achieve greatness, and some have greatness thrust upon them.” - Twelfth Night
Shakespeare also wrote: “Sweet are the uses of adversity, Which, like the toad, ugly and venomous, Wears yet a precious jewel in his head; And this our life, exempt from public haunt, Finds tongues in trees, books in the running brooks, Sermons in stones, and good in every thing.” - As You Like It
I dedicate this dissertation to those adversities which have helped me realize the greatness to which I was born, that which I have striven to achieve, and that which has been thrust upon me in this struggle.
I have indeed found good in every thing.
TGBTG.
iv
Table of Contents List of Tables ...... viii List of Figures...... ix Acknowledgements...... viii Curriculum Vita...... xi Abstract of the Dissertation ...... xiii
1 Introduction...... 1 1.1 Organization of the Dissertation ...... 2 1.2 References...... 2
2 Isolation and identification of bacterial endophytes from buds of lodgepole pine, ponderosa pine and European black pine...... 5 2.1 Abstract ...... 5 2.2 Introduction...... 6 2.3 Methods...... 8 2.3.1 Sample collection and sterilization ...... 8 2.3.2 Tissue preparation...... 8 2.3.3 Culturing and isolation...... 8 2.3.4 DNA extraction ...... 9 2.3.5 DNA amplification...... 9 2.3.6 Sequence processing and identification...... 9 2.4 Results...... 9 2.5 Discussion...... 10 2.6 Concluding Remarks...... 12 2.7 References ...... 12 2.8 Tables ...... 19 2.9 Figures...... 22
3 Bacterial endophytes of Monterey pine: community analysis and culture-based identification...... 23 3.1 Abstract ...... 23 3.2 Introduction...... 24 3.3 Methods...... 25 3.3.1 Sample collection and sterilization ...... 25 3.3.2 Bacterial Community Analysis...... 25 3.3.2.1 Tissue Preparation and DNA extraction ...... 25 3.3.2.2 DNA amplification ...... 26
v 3.3.2.3 Sequence processing and identification ...... 27 3.3.3 Bacterial Culture Isolation ...... 27 3.3.3.1 Tissue processing and Culture Conditions ...... 27 3.3.3.2 Isolate DNA Extraction...... 28 3.3.3.3 Isolate DNA Amplification ...... 29 3.3.3.4 Isolate Sequence Processing and Identification...... 29 3.4 Results...... 30 3.4.1 Community Analysis...... 30 3.4.2 Isolates ...... 31 3.5 Discussion...... 31 3.6 Concluding Remarks...... 33 3.7 References ...... 33 3.8 Tables ...... 39 3.9 Figures...... 44
4 Draft genome analysis of Monterey pine endophytes suggests that the aboveground endosphere is colonized by host-adapted bacteria and is a source of previously uncultured bacterial diversity...... 46 4.1 Abstract ...... 46 4.2 Introduction...... 47 4.3 Methods...... 48 4.3.1 DNA extraction ...... 48 4.3.2 DNA shearing ...... 48 4.3.3 Size-select processing ...... 49 4.3.4 Shearing quality control...... 49 4.3.5 Library prep ...... 49 4.3.6 Library quality control ...... 50 4.3.7 Library Pooling and Sequencing ...... 50 4.3.8 Sequence Processing and Assembly...... 50 4.3.9 Genome BLAST searches...... 50 4.3.10 Ribsomal Database Project 16S rRNA comparison to isolates and uncultured bacteria...... 51 4.4 Results...... 51 4.4.1 Genome assembly statistics...... 51 4.4.2 Identity of the isolates...... 51 4.4.3 Presence of known endophyte genes ...... 52 4.4.3.1 Motility and colonization...... 52 4.4.3.2 Secretion systems ...... 52 4.4.3.3 Quorum sensing ...... 53 4.4.3.4 Growth Promotion...... 53 4.4.3.5 Drought Tolerance and Stress tolerance...... 53 4.5 Discussion...... 54 4.6 Concluding Remarks...... 55
vi 4.7 References ...... 55 4.8 Tables ...... 60 4.9 Figures...... 64
5 Culture methods to maximize the recovery of bacterial endophytes isolated from the needles of Adult pines...... 68 5.1 Abstract ...... 68 5.2 Introduction...... 69 5.3 Methods...... 70 5.4 Results ...... 71 5.4.1 Week one...... 71 5.4.1.1 Media type...... 71 5.4.1.2 Tissue preparation...... 71 5.4.2 Week two ...... 72 5.4.2.1 Media type...... 72 5.4.2.2 Tissue preparation...... 72 5.4.3 Week three...... 72 5.4.3.1 Media type...... 72 5.4.3.2 Tissue preparation...... 73 5.4.4 Week four...... 73 5.4.4.1 Media type...... 73 5.4.4.2 Tissue preparation...... 73 5.5 Discussion...... 73 5.7 References...... 74 5.8 Tables ...... 76
6 Conclusion ...... 79
vii List of Tables
Chapter 2, Table 1: BLAST identification of isolates 16S sequence against greengenes and NCBI bacterial 16S rRNA databases. ……………………19 Chapter 3, Table 1: Samples successfully characterized by 16S rRNA sequences in this study with number of sequences after quality control and removal of plant DNA ………………………………………………………….39 Chapter 3, Table 2: Bacteria isolated from surface-sterilized needle and bud samples……………………………………………………………………...….40 Chapter 4, Table 1: Sequence data and assembly information for each isolate…………………………………………………………………………...60 Chapter 4, Table 2: Top BLAST hits from which the best blast hit for each belonged, based on a database of proteins from 2801 completely sequenced genomes.……………………………………………………..…...61 Chapter 4, Table 3: Endophytic gene presence or absence. Specific genes involved in an endophytic lifestyle were assembled and BLAST searched in the assembled isolate genomes. Presence is indicated by a check mark and absence is indicated with an X.…………………………………..……..63 Chapter 5, Table 1: Colony counts for a four-week, comparative study of media types and tissue preparation for isolation of needle endophytes. Absence of colony growth is indicated by an “X.” The positive control was a pooled consortia of previously successful bacterial endophytes incubated with all other plates. The negative controls were blank plates.………….77
viii List of Figures
Chapter 2, Figure 1: Maximum-likelihood phylogenetic tree of 16S rRNA gene sequences from bud isolates and closely related bacterial species. The best scoring maximum-likelihood phylogenetic tree was computed with RAxML (1000 bootstraps).The Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup. Isolates are indicated by PN# ,PP#, and PC# representing isolates from Pinus nigra, Pinus ponderosa, Pinus contorta bud/shoot tissue. Gammaproteobacteria are boxed in green, Alphas in blue, Actinobacteria in red, and Firmicutes in yellow……………………………………………………….…………….……...22 Chapter 3, Figure 1: Rarefaction curves of observed species and number of sequences per sample indicate the number of OTUs at 97% similarity at each location.………………………………………………………...... 44 Chapter 3, Figure 2: Heatmap showing the relative abundance of sequences as percentages of all 16S rRNA gene sequences recovered in each of our 19 samples, along with the closest match in the Genbank 16S rRNA database, classified to the lowest possible taxonomic level, and matches above 99% to sequences from isolates recovered in this study, if any. Color tones range from light to dark blue to indicate the lowest to highest relative abundance values. Bud samples are marked with an asterisk; all other samples are from needles……………………………………...…….…44 Chapter 3, Figure 3: RAxML 1000 bootstraps, maximum likelihood tree including all isolate sequences and close matches in RDP and NCBI. The tree was rooted with the 16S rRNA gene from Aquifex pyrophilus………..45 Chapter 4, Figure 1: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate CR7 and close hits in RDP to isolate and uncultured sampes were used in the tree. …...64 Chapter 4, Figure 2: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate CR6 and close hits in RDP to isolate and uncultured sampes in the tree……………..…..65 Chapter 4, Figure 3: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate PL12 and close isolate and uncultured hits in RDP were used in the tree………….66 Chapter 4, Figure 4: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate SW10 and close hits in RDP to isolate and uncultured sampes were used to build the tree. ……………………………………………………………………………..67
ix Acknowledgements
This dissertation represents the conclusion of six years of research that would not have been possible without the guidance, support, and assistance of many people. Since this dissertation is only possible because of growth and personal development achieved over time, it is only fitting that I start my thanks where I began, with my family. I am grateful for my parents, John and Marlene Wilson, my first teachers, who inspire me with their positivity and perseverance. Much love and thanks to you both for always encouraging me to be an individual. Special thanks to Dad for going on sampling trips with me so I wouldn’t be alone in the wilderness!
I am grateful to my former professors especially Frank Yancey, Mireya Macias, Megan Igo, Marcos García-Ojeda, and Mónica Medina, for the key roles they each played in shaping the scientist I have become today. I thank my advisor Carolin Frank and committee members, Mike Beman, Miriam Barlow, Clarissa Nobile, for their guidance, correction, redirection, and support through this maze called graduate school. Thanks also to my collaborator and mentor, Megan Rúa.
I acknowledge the funding sources that made this work possible since the second semester of my graduate work: Edward Hildebrand Fellowship, UC NRS Mildred E. Mathias Graduate Student Research Grant, GRC Summer Fellowship, QSB Summer Fellowship, USAP funding assistance, NSF Graduate Research Fellowship, Graduate Bobcat Award, UC Global Food Initiative, the Graduate Dean Dissertation Year Fellowship and the School of Natural Sciences Dean, Juan Meza.
I would not be where I am today without the supporting work of my amazing team of undergraduate researchers and friends. A million thanks to: Bridget A. Schick (sampling, tissue sterilization and prep, comparative tissue prep study, and hours of good conversation), Hari P. Kota (sampling, culturing, and inspiring chats, I am so proud of you!), Meghana Shah (sampling, tissue sterilization and culturing), Mohammad Qasim (BARDOT scanning), Kelvin Cheung (BARDOT scanning), Christina Celis Puga (comparative culture media study), and Arielle Munters (Sample sterilization and prep). Thanks also to Robert Zellers for 6+ years of friendship and helping me through hours on the trails for summer sampling trips. Many thanks to Sarah Brown for all the final hour help with my genome prep struggles, and thanks to Lolo Cardenas for loading my samples the day before vacation! You both went above and beyond. Thanks to Jill Micheau for the writing retreat and Stacey Cool for the editing and proofreading help, for feeding me, and keeping me focused!!!
Last but never least, I thank my friends and mentors Jason and Mallisa Baumsteiger and “big sister” Nicole, the Sunday Dinner Bunch, my theatre families, the Wolf Pack, Linda and Jerry Pringle, and the Zellers family for keeping me from feeling the full brunt of the storm by giving me refuge, love, and support to get me through everything I’ve faced to reach this day. I hope someday I will be able to return the kindnesses you’ve shown me. Thank you all for your contributions to my success!
x Curriculum Vitae
Education
2009 – 2015 Doctor of Philosophy in Quantitative and Systems Biology, University of California, Merced
2006 – 2009 Bachelor of Science in Biological Sciences – emphasis in
Microbiology & Immunology, University of California, Merced
2005 – 2006 Transfer courses
Merced College
2003-2005 Associate of Arts in General Studies, State Center Community College District - Oakhurst Campus
Laboratory Positions
2009 – 2015 Graduate Student Researcher, Frank Lab, bacterial endophyte culturing and identification through sequencing University of California, Merced
2008 – 2009 Undergraduate Researcher, Frank Lab, fungal genome annotation and horizontal gene transfer study, University of California, Merced
2008 – 2009 Undergraduate Researcher, Medina Lab, sea anemone and endosymbiont transcriptomic database construction, University of California, Merced
2007 – 2008 Undergraduate Researcher, Dawson Lab, barnacle tissue dissection and sample processing, University of California, Merced
2007 – 2007 Undergraduate Researcher, Barlow Lab, bacterial antibiotic resistance genes, University of California, Merced
Teaching Assignments
2014 – 2014 Discussion Teaching Assistant for Genetics
University of California, Merced
2010 – 2010 Laboratory Teaching Assistant for General Chemistry 2 University of California, Merced
Publications
2009 Sunagawa, S; Wilson EC; Thaler, M; Smith, ML; Caruso, C; Pringle, JR; Weis,VM; Medina, M; Schwarz, JA. (2009). Generation and analysis of transcriptomic resources for a model system on the rise: the sea anemone Aiptasia pallida and its dinoflagellate endosymbiont. BMC Genomics 10:258.
xi Selected Contributions to Scientific Conferences and Events
Oral Presentations
2014 “Identifying potential contamination in bacterial cultures” at the German
Ambassador to the United States, campus visit January 21, 2014.
2013 “Light scattering identification of symbiotic bacterial strains” at University of
California President Napolitano’s campus visit, October 3, 2013.
2012 “Bacterial endophytes of conifer buds” at the 33rd Annual Central California
Research Symposium in Fresno, CA.
2012 “Understanding the relationship between conifers and bacterial endophytes” at Mathias Research Symposium at Bodega Bay Natural Reserve.
2011 “Bacterial endophyte diversity in the lodgepole pine” at University of California,Merced Research Week Quantitative & Systems Biology Retreat in Merced, CA
Poster Presentations
2015 “Culturing Methylobacterium Endophytes of California Conifers” Quantitative and Systems Biology Department Retreat, Midpines, CA.
2014 “Culturing Methylobacterium Endophytes of California Conifers” Symbiosis
2014, Wawona, CA.
2013 “Characterizing potential growth promoting bacterial endophytes associated with Pinus contorta, Pinus ponderosa and Pinus nigra.” 98th Annual Meeting of ESA in Minneapolis, MN.
2012 “Bacterial endophytes of California conifers” at University of California, Merced Research Week in Merced, CA.
Selected Awards and Achievements
2015 Best Poster Presentation, Quantitative and Systems Biology Retreat
2015 Leadership Award for Contribution to Student Affairs, University of California, Merced Leadership Awards
2014 Graduate Dean Dissertation Year Fellowship, University of California, Merced
2011 Passed Qualifying Exam and Advanced to Candidacy
2010 Earned National Science Foundation Graduate Research Fellowship
xii
Abstract of the Dissertation
Bacterial endophytes of California conifers: cultures, genomes, and community analysis.
by
Emily C. Wilson
Doctor of Philosophy, Quantitative and Systems Biology
University of California, Merced, 2015
Dr. J. Michael Beman, Chair
The aims of my dissertation research were to (1) refine culture techniques to maximize recovery of bacterial endophytes from conifer tissues and (2) identify these bacterial isolates through the sequencing of 16S rRNA and genome sequencing. Bacterial endophytes are found in many plant hosts and in every plant tissue studied thus far. Generally thought to be neutral or to have a beneficial impact on their hosts, these bacteria have been widely studied in agricultural plants. Our understanding of how bacterial endophytes associate with and impact plants in natural ecosystems lags behind and therefore studying endophytes from conifer hosts is an important approach. I improved current culture techniques to capture bacterial endophyte isolates from Pinus contorta, Pinus ponderosa and Pinus nigra bud/shoot tissue, and Pinus radiata needle and bud/shoot tissue. I identified the 16S rRNA sequences of these isolates through Sanger sequencing and picked four isolates for genome sequencing and further study. I found that liquid nitrogen tissue preparation (with or without cryopreservation) was the most effect tissue preparation method for maximum isolate recovery and that that Tris- buffered, R2A agar with multiple carbon sources was the most effective culture media for maximum isolate growth. Alphaproteobacteria dominated
xiii isolates from Pinus contorta. Actinobacteria dominated the isolates from Pinus nigra. Firmicutes dominated isolates from Pinus ponderosa. The isolates from Pinus radiata were dominated by Gammaproteobacteria, as was the culture-independent study completed to identify the community of bacterial endophytes present. Four isolates from Pinus radiata were chosen for genome sequencing with Illumina MiSeq. Genome BLAST searches against a database of NCBI completed bacterial genomes revealed that one isolate is likely an Erwinia spp. and that another isolate is likely a Sodalis spp. or represents a new genus in the family Enterobacteriaceae. A third isolate likely represents a new family in the order Rhizobiales, and the fourth isolate was identified to the family level as Enterobacteriales and is likely a new genus in the Enterobacteriaceae. Some known beneficial genes were identified however; more sequencing is needed to finalize identification of these isolates and to clarify their relationships with their host.
xiv 1
1 Introduction
Bacterial endophytes are widely found in healthy plant tissue (Compant et al, 2011, Hardoim et al., 2015, Reinhold-Hurek & Hurek, 2011). Endophytes have been studied mainly in agricultural systems due to their beneficial potential for plant growth and development as well as the contribution to tolerance of abiotic and biotic stress (Hardoim et al., 2015, Hardoim et a., 2008, Freisen et al., 2011, Siddikee et al., 2011, Pirttilä et al., 2004). Important because of their potential for beneficial impacts on their hosts, bacterial endophytes have relatively few sequenced genomes and therefore much remains to be explored concerning the genetic basis for these beneficial traits (Frank, 2011). Many endophytes are closely related to species or strains known to be plant pathogens and therefore understanding their relationship to the host plant and how they establish this relationship is very important (Taghavi et al., 2009, Kube et al., 2010, Mitter et al., 2010). Genome sequencing usually requires isolate cultures, especially for successful, high quality, full-coverage sequencing.
Bacterial endophytes have been cultured from many agricultural plants and some deciduous trees and conifers (Lodewyckx et al., 2002, Ryan et al., 2007, Reinhold-Hurek & Hurek, 2011 Izumi et al, 2008). Bacterial endophytes can be very difficult to culture, shown by the relatively low numbers of isolates compared to community analysis (Izumi et al, 2008, Ulrich et al., 2008, Shen, 2015). This could be because of their adaptation to their host or perhaps that we do not know enough to target our growth conditions to capturing more difficult or inactive bacterial species (Kell, 1998, Izumi et al., 2008, Ulrich et al., 2008). Bacterial endophytes have not been cultured from very many conifer species, which limits our understanding of how these beneficial microbes help their hosts live in challenging environments such as marginal soils, and in harsh, high elevation climates. Improving culture methods to better capture and isolate bacterial endophytes is key to making progress in genome sequencing and inoculation experiments to test the activity of beneficial traits in single isolate and consortia of beneficial bacteria. Genome sequencing would yield the information to target beneficial traits and future inoculation experiments would show if these genes are actively used. Up until this point, most studies of conifer endophytes have been culture-independent, community analyses, which set a baseline for our understanding but don’t allow us to explore the presence of beneficial traits.
The aims of my dissertation research were to (1) refine culture techniques to maximize recovery of bacterial endophytes from conifer tissues and (2) identify these isolates through 16S sequencing and genome sequencing.
1 2
1.1 Organization of the Dissertation The dissertation research is divided into four self-contained chapters written in manuscript format. In Chapter 2, “Isolation and identification of bacterial endophytes from buds of lodgepole pine, ponderosa pine and European black pine,” I cultured the endophyte isolates from the bud/shoot tissue of Pinus contorta, P. ponderosa and P. nigra. In Chapter 3, “Bacterial endophytes of Monterey pine: community analysis and culture-based identification,” I completed both culture-independent and -dependent studies of P. radiata needles and bud/shoot tissue sampled from three sites in California. In Chapter 4, “Draft genome analysis of Monterey pine endophytes suggests that the aboveground endosphere is colonized by host-adapted bacteria and is a source of previously uncultured bacterial diversity,” I sequenced the genomes of four P. radiata isolates to study their relationship with the host and to determine their identity. Finally, in Chapter 5, “Culture methods to maximize the recovery of bacterial endophytes isolated from the needles of Adult pines,” I describe the development of culture methods to best isolate these difficult to grow bacterial species.
1.2 References
Compant, S., Mitter, B., Colli-Mull, J.G., Gangl, H., Sessitsch, A., 2011. Endophytes of grapevine flowers, berries, and seeds: identification of cultivable bacteria, comparison with other plant parts, and visualization of niches of colonization. Microb. Ecol., 62,188-197.
Frank, A.C., 2011. In: Pirttilä, AM, Frank, AC (Eds.), Endophytes For. Trees Biol. Appl., vol. 80, Springer Verlag Berlin, Heidelberg, pp. 139–149.
Friesen, M.L., Porter, S.S., Stark, S.C., von Wettberg, E.J., et al., 2011. Microbially mediated plant functional traits. Annu. Rev. Ecol. Evol. Syst., 42, 23–46.
Hardoim, P.R., van Overbeek, L.S., Elsas, J.D., 2008. Properties of bacterial endophytes and their proposed role in plant growth. Trends Microbiol., 16, 463–471.
Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compante, S., Campisano, A., Döringg, M., and Sessitsche, A., 2015. The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiol. Mol. Biol. Rev. 79(3),293-320.
3
Izumi, H., Anderson, I.C., Killham, K., Moore, E.R., 2008. Diversity of predominant endophytic bacteria in European deciduous and coniferous trees. Can. J. Microbiol., 54, 173–179.
Kell, D.B., Kaprelyants, A.S., Weichart, D.H., Harwood, C.R., Barer, M.R., 1998. Viability and activity in readily culturable bacteria: a review and discussion of the practical issues. Antonie van Leeuwenhoek 73: 169– 187.
Kube, M., Migdoll, A.M., Gehring, I., Heitmann, K., Mayer, Y., Kuhl, H., Knaust, F., Geider, K., Reinhardt, R., 2010. Genome comparison of the epiphytic bacteria Erwinia billingiae and E. tasmaniensis with the pear pathogen E. pyrifoliae. BMC Genomics.11, 393-408.
Lodewyckx, C., Vangronsvel, J., Porteous, F., Moore, E.R.B., Taghavi, S., Mezgeay, M., van der Lelie, D., 2002. Endophytic Bacteria and Their Potential Applications. Crit. Rev. Plant Sci., 21, 583–606.
Mitter, B., Petric, A., Shin, M.W>, Chain, P.S.G., Hauberg-Lotte, L., Reinhold- Hurek, B., Nowak, J., Sessittsch, A., 2013. Comparative genome analysis of Burkholderia phytofirmans PsJN reveals a wide spectrum of endophytic lifestyles based on interaction strategies with host plants. Front. Plant Sci. 4, 1-15.
Pirttilä, A.M., Joensuu, P., Pospiech, H., Jalonen, J., Hohtola, A., 2004. Bud endophytes of Scots pine produce adenine derivatives and other compounds that affect morphology and mitigate browning of callus cultures. Physiol. Plant, 121, 305–312.
Quambusch, M., Pirttila, A.M., Tejesvi, M.V., Winkelmann, T., Bartsch, M., 2014. Endophytic bacteria in plant tissue culture: differences between easy- and difficult-to-propagate Prunus avium genotypes. Tree Physiol., 34, 524–533.
Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Curr. Opin.Plant. Biol., 14, 435–443.
Ryan, R.P., Germaine, K., Franks, A., Ryan, D.J., Dowling, D.N., 2007. Bacterial endophytes: recent developments and applications. FEMS Microbiol Lett. 278, 1–9.
Shen, S.Y., Fulthorpe, R., 2015. Seasonal variation of bacterial endophytes in urban trees. Frontiers in Microbiology, 6(427)1-13.
4
Siddikee, M.A., Glick, B.R., Chauhan, P.S., Yim, W., Sa, T., 2011. Enhancement of growth and salt tolerance of red pepper seedlings (Capsicum annuum L.) by regulating stress ethylene synthesis with halotolerant bacteria containing 1-aminocyclopropane-1-carboxylic acid deaminase activity. Plant Physiol. Biochem., 49, 427–434.
Taghavi, S., Garafola, C., Monchy, S., Newman, L., Hoffman, A., Weyens, N., Barac, T., Vangronsveld, J., van der Leilie, D., 2009. Genome survey and characterization of endophytic bacteria exhibiting a beneficial effect on growth and development of poplar trees. Appl. Environ. Microbiol. 75(3),748-757.
Ulrich, K., Ulrich, A., Ewald, D., 2008b. Diversity of endophytic bacterial communities in poplar grown under field conditions. FEMS Microbiol. Ecol., 63, 169–180.
2 Isolation and identification of bacterial endophytes from buds of lodgepole pine, ponderosa pine and European black pine
2.1 Abstract Endophytes—bacteria and fungi that live inside healthy plant tissue—are emerging as an important part of the plant microbiome, with potential roles in host health and development. While endophytes have been studied extensively in agricultural ecosystems, less is known about endophytes in natural populations, including ecologically and economically important forest tree species. Conifer tissue culture started from shoot tips (buds) have been shown to harbor bacteria that stimulate plant growth, but the full spectrum of bud-associated bacteria may not be present in tissue culture. The objective was to isolate of bacteria directly from actively growing conifer buds. We were successful in isolating bacterial endophytes from buds of the native California conifers Pinus contorta growing in Tuolumne Meadows, CA, Pinus ponderosa growing in Yosemite Valley, CA, and the ornamental non-native conifer Pinus nigra. Isolates were identified through amplification and sequencing of the 16S rRNA gene, and belonged to genera Bacillus, Paenibacillus, Kocuria, Brachybacterium, Micrococcus, Methylobacterim, Moraxella, Rhodococcus, Sphinogomonas, Bosea, Williamsia, and Nocardioides. These isolates were closely related to species that have been identified as endophytes, several as shoot- and reproductive tissue endophytes.
5 6
2.2 Introduction Endophytes are bacteria or fungi that colonize the interior of healthy plant leaves, roots, stems, seeds, and reproductive organs (Hardoim et al. 2008, Reinhold-Hurek, and Hurek, 2011). Bacterial endophytes have documented roles in plant host growth promotion, nutrient cycling, stress protection, and disease resistance (Siddikee et al. 2008, Anand and Chanway, 2013, Knoth et al. 2014). Because of their potential for being involved in plant health, a significant amount of research has been devoted to bacterial endophytes of agricultural crops (Berg and Hallman, 2006). However, the roles and diversity of bacterial endophytes colonizing natural populations remains relatively unknown (Pirttilä and Frank, 2011). A thorough understanding of the role of endophytes and other unexplored components of the plant microbiome may be necessary to understanding various phenomena ranging from basic plant traits (Friesen et al. 2011), to whole-ecosystem processes such as nitrogen (N) and carbon (C) cycling (Poole et al. 2012). Moreover, by broadening the range of plant species and tissues examined for endophytes, the potential to find new and interesting endophytic species with important roles in host health and development increases.
Conifers are able to grow in a wide range of soils and climates, including marginal soils and exposed high elevation habitats. Their adaptation to a broad habitat range could be due to adaptive microbial symbiosis. In addition, because conifers are of huge ecological and economic importance, their interactions with microbes are of interest in basic research as well as for applications in forestry and silviculture (Pirttilä and Frank, 2011, Anand et al. 2006). Bacterial endophytes have been isolated from several conifer tissues, including seeds, roots, stems, and needles (Anand and Chanway, 2013, Bal & Chanway, 2012, Anand and Chanway 2013b, Anand et al. 2013c). Although little is known about the role of bacterial endophytes in conifers, there is growing evidence that they may fix and provide the host with nitrogen (Anand & Chanway, 2013, Bal & Chanway 2012). Another potential role for conifer endophytes is promotion of tree growth and development (Pirttilä, 2011). The research on endophytic bacteria of plant meristematic tissues is generally considered to be important, as these tissues are responsible for plant growth. Thus, the conifer bud may be an important niche for bacteria with growth-promoting roles, which can be harnessed for applications in forestry. In conifers, this tissue has not been directly used for bacterial isolation or culture-independent characterization. However, it is known that an endophytic strain of Methylobacterium extorquens (DSM13060) colonizes shoot meristem and resin duct cells intracellularly in Pinus sylvestris (Scots pine) (Pirttilä et al. 2000). M. extorquens DSM13060 has been found consistently associated with its host across geographic locations in Northern
7
Finland, and is most active and abundant right before bud elongation and differentiation (Pirttilä et al. 2005), suggesting that the bacterium assists the host in those processes. Furthermore, M. extorquens stimulates P. sylvestris seedling growth in vitro (Pohjanen et al. 2014), and is necessary for proper morphological development in P. sylvestris tissue culture (Pirttilä et al. 2014). Genome analysis and confocal microscopy analysis of this strain suggests that it may use novel mechanisms to promote growth from inside the host cell (Koskimäki et al. 2015) In general, bacteria in the tissues responsible for growth, probably use different mechanisms when stimulating plant growth, than the more commonly studied endophytes of root apoplasts (Pirttilä, 2011). Bacterial endophytes found in the shoot tissue of various plants include species from the genera Mycobacterium, Paenibacillus, Bacillus, Stenotrophomonas, Pseudomonas, and Methylobacterium (Reed et al. 1998, Laukkanen et al. 2000, Van Aken et al. 2004, Ulrich et al. 2008a, Thomas and Soly, 2009, Quambusch et al. 2014). These bacteria are typically discovered tissue culture, where shoot meristems or embryos are used as the starting material. However, it is possible that some of the bacteria that naturally occur in the bud meristem may be lost in the tissue culture process. An alternative approach to isolating growth-promoting bacteria from this niche may be to culture them directly from actively growing shoot tips. It is important to note that it can be difficult to isolate bacteria from certain tissues and plant types (e.g. conifer needles) (Izumi et al. 2008). Here, new culture methods are described, demonstrating that the isolation of bacterial endophytes from conifer buds is feasible.
Using a modified liquid culture and a layered agar culturing protocol, we isolated endophytes directly from surface-sterilized, actively growing buds of the California natives Pinus ponderosa (Ponderosa pine) and Pinus contorta (Lodgepole pine), and the non-native ornamental species Pinus nigra (European black pine). Isolates were identified through amplification and sequencing of the 16S rRNA gene, and belonged to the phyla Firmicutes, Protobacteria and Actinobacteria, the most common endophyte phyla (Hardoim et al., 2015) and the genera Bacillus, Paenibacillus, Kocuria, Brachybacterium, Micrococcus, Methylobacterim, Moraxella, Rhodococcus, Sphinogomonas, Bosea, Williamsia, and Nocardioides. Our isolates were closely related to species that have been isolated as endophytes before, several from shoot and reproductive tissues.
8
2.3 Methods
2.3.1 Sample collection and sterilization Samples were collected from Pinus contorta, spring 2012 (Tuolumne Meadows, CA), Pinus ponderosa, spring 2011 (Yosemite Valley, CA) and non-native decorative Pinus nigra spring 2011 (Merced, CA). Fifteen to twenty buds were collected from each tree. Samples were collected with sterile supplies to minimize contamination and large sample bags were used to minimize tissue damage. Samples were stored in cool conditions for transport back to the lab for surface sterilization.
To eliminate surface bacteria, we used a hydrogen peroxide-based sterilization protocol and saved the third water rinse to test sterilization success (Izumi et al. 2008). After the sterilization protocol was completed, seven additional 250 mL ultrapure water rinses were completed to minimize residual hydrogen peroxide.
2.3.2 Tissue preparation Scales were removed from the buds. Buds were then pooled by conifer species and pulverized into a fine powder using a mortar and pestle with liquid nitrogen cooling. Samples from Pinus contorta were abundant so half of the sample pool was cryopreserved with 10% dimethylsulfoxide before liquid nitrogen preparation for recovery comparison (Hubálek, 2003, Latutrie and Aronen, 2013).
2.3.3 Culturing and isolation Approximately one gram of pulverized tissue was inoculated into 10 mL R2A broth, incubated at 25°C for one hour, and plated in two sets of triple replicates on 1.7% agar R2A. One set of triple replicate plates was then sealed with another layer of agar R2A (35°C) to mimic the oxygen-limited plant tissue interior. To inhibit fungal endophyte growth, we added cyclohexamide (0.05 g per liter) to both broth and agar culture media (Izumi et al. 2008). Cultures were incubated at 25°C-27°C until isolates grew on the surface of the agar or between the layers of agar and up to the surface to visible colony size (one to six weeks). Isolates were re-streaked on agar until isolates were confirmed. Several isolates were picked from agar plate cultures based on unique colony morphology, color, and colony size. Single colonies were then transferred to a liquid culture for one hour liquid incubation, and plated again on agar plates to maximize cell counts for DNA extractions.
9
2.3.4 DNA extraction DNA was extracted from individual isolates using a modified CTAB- chloroform extraction protocol with 1.5 minute bead beating step (Zidani et al. 2005). Chloroform protein removal was performed twice, and double centrifugation to remove ethanol from precipitated DNA was completed before drying and resuspension of clean DNA.
2.3.5 DNA amplification The majority of the 16S rRNA gene was amplified using the universal primer pair 27F and 1492R with an amplification protocol optimized with adjustments for the optimal primer melting temperatures (Frank et al. 2008, Ulrich et al. 2008b). Thermal cycling conditions were as follows: 4 minute 94°C incubation followed by 30 cycles of 1 minute denaturation at 94°C, 30 second annealing at 50°C, 2 minute extension at 72°C, with a final extension of 5 minutes at 72°C. PCR products were cleaned electrophoretically using E-Gel® SizeSelect™ Gels to result in a ∼1500-bp PCR product for Sanger sequencing using primers primers 27F and 1492R.
2.3.6 Sequence processing and identification Sequence reads were manually prepared for assembly and basecalls were corrected with Geospiza FinchTV1.4. The online Greengenes sequence massager (DeSantis et al. 2006) was used to make reverse complement and CAP3 (Huang and Madan, 1999) was used to assemble sequences. The sequences for Ponderosa pine and European black pine have been deposited in GenBank under accession numbers KF554075-KF554099. The sequences from lodgepole pine have been submitted to GenBank under accession numbers (submitted, waiting for numbers). The 16S rRNA sequences were assigned to bacterial taxa through BLAST searches against the Greengenes 16S rRNA database (DeSantis et al. 2006) and the online NCBI 16S nucleotide BLAST database (Altschul et al. 1990). The Ribosomal Database Project (Cole et al, 2009) online database and online tools were used to identify and align similar sequences with the Infernal secondary-structure based alignment method (Nawrocki et al. 2009). The phylogenetic tree was inferred using Maximum Likelihood with the CAT model of rate heterogeneity as implemented in RAxML (Stamatakis, 2006) using Aquifex pyrophilus (accession number NR_029172.1) as an outgroup.
2.4 Results We obtained at least 50 apparently different isolates. From the set of all isolates, 12 from P. contorta, 12 from P. ponderosa, and 13 from P. nigra (Chapter 2, Table 1, and Chapter 2, Figure 1) were chosen for further
10
analysis. Similarity searches using BLAST and phylogenetic analysis showed that most of the isolates belong to the Actinobacteria, Firmicutes, or Proteobacteria (Chapter 2, Figure 1). Bacteria from these phyla are commonly isolated from surface-sterilized plant tissue (Izumi et al. 2008, Coombs and Franco, 2003, Compant et al. 2011, Leite et al. 2013). Bacillus spp. were isolated from all three conifer species, but there were many differences between the conifer species in the culturable endophytic community. For example, Kocuria spp. were present in P. nigra and P. contorta buds, but were not isolated from P. ponderosa. Paenibacillus spp. were only isolated from P. ponderosa and Methylobacterium were only isolated from P. contorta.
All genera isolated here have previously been found as endophytes, several in shoot- and reproductive tissues: Bacillus firmus has been detected in rice seeds (Kaga et al. 2009) and from the growing shoot tips of banana (Thomas and Soly, 2009). Kocuria spp. has been isolated from the seeds of both papaya and rice (Thomas and Soly, 2009, Krishnan et al. 2012) as well as from growing shoot tips of banana (Thomas and Soly, 2009). Micrococcus spp. have been isolated from the root of Polyspora axillaris (fried eggplant) (Zhao et al. 2009), from fern leaves (De Araújo Barros et al. 2010), and from maize seeds (Orole and Adjumo, 2011) and Micrococcus luteus has been isolated from rice seeds (Kaga et al. 2009). Brachybacterium spp. have previously been found in the leaves and roots of radish plants (Seo et al. 2010). Paenibacillus spp. have been isolated from poplar tissue (Ulrich et al. 2008a), as well as from needle, stem and root of lodgepole pine (Pinus contorta) and western red cedar (Thuja plicata) (Bal et al. 2012). Moraxella spp. have been detected intracellularly in tissue culture from peach palm (Bertalan et al. 2009). Rhodococcus spp. have been found in the medicinal plant Artemisia annua L. Methylobacterium spp. are found in many plants including Scots pine (Pirttilä et al. 2000, Pohjanen et al. 2014, Koskimäki et al. 2015). Williamsia spp. have been found in Australian apricot and pine trees (Kaewkla and Franco 2013). Microvirga spp. have been identified as nitrogen fixing endophytes in legumes (Ardley et al. 2013, Xu et al. 2013). Bosea spp. have been found in the seeds of Arabidopsis thaliana (Truyens et al. 2013). Nocardioides have been identified as endophytes of the medicinal plant Jatropha curcas L. (Qin et al. 2012). Finally, Sphingomonas spp. have been identified as endophytes in many plants including the herb Sedum alfredii and in tomatoes (Chen et al. 2014, Halo et al. 2015).
2.5 Discussion Isolation of bacteria from conifer above-ground tissue appears to be somewhat difficult; for example Izumi and co-workers (Izumi, 2008) were able
11
to culture bacteria from leaves of Betula pendula (silver birch), and Sorbus aucuparia (rowan), but not from P. sylvestris needles. We did not experience such difficulties, perhaps due to a relatively high abundance of bacteria in actively growing shoot tissues compared to needles (Pirttilä et al. 2005). We cultured bacteria from the phyla Actinobacteria, Firmicutes and Proteobactera. Our isolates were closely related to species that have been isolated as endophytes before, several from shoot- and reproductive tissues.
Endophytic Bacillus spp. have been shown to stimulate plant growth (Leite et al. 2013), and to be antagonistic against fungal pathogens and nematodes (Giannakou et al. 2004, Bent et al. 2001, Schreiber et al. 1988, Wilhelm et al. 1998). In addition, Bacillus firmus was shown to be present in high relative abundance in Sequoia sempervirens (coast redwood) and Sequoiadendron giganteum (giant sequoia) (Carrell and Frank, in review), and may be common in conifers. Most notably, Paenibacillus, which was only isolated from the native conifer in our study (P. ponderosa), is commonly isolated from tissue culture of woody plants (Ulrich et al. 2008a), and has been isolated from the inside of needles, stems and roots of conifers (Bal et al. 2012). Paenibacillus polymyxa is an nitrogen fixing endophyte in conifer above- ground tissue (Berg and Hallman, 2006). P. ponderosa can thrive in soils that lack essential nutrients including N (Jenkinson, 1974), and it is possible that nitrogen fixing Paenibacillus spp. are transmitted to new needle growth via buds. However, it is not known whether the relationship between the conifer host and the bud endophytes isolated here is mutualistic; future experimental and genomic analyses are needed to determine if and how these bacteria can provide benefits for the host.
Despite a possible role for Methylobacterium spp. in shoot tissue growth of another pine species, we only recovered isolates from the Pinus contorta samples. Addionally, Alphaproteobacteria dominate the endophytic community in our cultivation-independent studies of conifer needle tissue (Carrell and Frank, 2014), and are only found in the P. contorta here perhaps suggesting that we need to improve our isolation techniques to capture a broader range of conifer bud endophytic community members or that some of these species are intracellular as demonstrated by Koskimäki et al 2015. On the other hand, it is not uncommon that culturable and unculturable endophytic communities from the same tissue differ by composition. For example, in a study of poplar endophytes, Actinobacteria dominated the isolates, whereas Proteobacteria dominated the 16S rRNA clone libraries (Ulrich et al. 2008b). Alternatively, the structure of the bud endophytic community, which should mostly include endophytes recently transferred from older tissues to new growth, might be significantly different from the needle endophytic community, which likely harbors a larger fraction species acquired from the environment over the lifetime of individual needles.
12
2.6 Concluding Remarks These results of successful isolation of bacterial endophytes from actively growing conifer buds provide a baseline for optimizing isolation protocols, expanding the number of strains and species isolated from this niche. Improvements to the protocol could include using a sample homogenizer to grind fresh conifer tissue instead of frozen tissue, using plant tissue based water agar (Blodgett et al. 2003), adding antioxidants that counteract microbial inhibitors present in plant tissue (Kaewkla and Franco, 2013), or adjusting growth media to target specific endophytic phyla (Lodewyckx et al. 2002). Further research including inoculation experiments and next- generation sequencing of uncultured bacteria will determine if the endophytic species isolated here are beneficial to their conifer host and whether they are dominant community members.
2.7 References
Anand, R., Paul, L., Chanway, C.P., 2006. In: Schulz, C, Boyle, T, Sieber, TN (Eds.), Microb. Root Endophytes, Springer Verlag Berlin, Heidelberg, pp. 89–106.
Anand, R., Chanway, C.P., 2013. N2-fixation and growth promotion in cedar colonized by an endophytic strain of Paenibacillus polymyxa. Biol. Fert. Soils, 49, 235–239.
Anand, R., Chanway, C.P., 2013b. Detection of GFP-labeled Paenibacillus polymyxa in auto-fluorescing pine seedling tissues. Biol. Fert. Soils, 49, 111–118.
Anand, R., Grayston, S., Chanway, C., 2013c. N2-Fixation and Seedling Growth Promotion of Lodgepole Pine by Endophytic Paenibacillus polymyxa. Microb. Ecol., 66, 369–374.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.
Bal, A., Anand, R., Berge, O., Chanway, C.P., 2012. Isolation and identification of diazotrophic bacteria from internal tissues of Pinus contorta and Thuja plicata. Can. J. For. Res, 42, 807–813.
13
Bal, A., Chanway, C.P., 2012. Evidence of nitrogen fixation in lodgepole pine inoculated with diazotrophic Paenibacillus polymyxa. Botany, 90, 891– 896.
Bent, E., Tuzun, S., Chanway, C.P., Enebak, S., 2001. Alterations in plant growth and in root hormone levels of lodgepole pines inoculated with rhizobacteria. Can. J. Microbiol., 47, 793–800.
Berg, G., Hallman, J., 2006. In: Schulz, C, Boyle, T, Sieber, TN (Eds.), Microb. Root Endophytes, Springer Verlag Berlin, Heidelberg, pp. 89–106.
Bertalan, M., Albano, R., de Padua, V., Rouws, L., et al., 2009. Complete genome sequence of the sugarcane nitrogen-fixing endophyte Gluconacetobacter diazotrophicus Pal5. BMC Genomics, 10, 450.
Blodgett, J.T., Bonello, P., Stanoz, G.R., 2003. An effective medium for isolating Sphaeropsis sapinea from asymptomatic pines. For. Pathol., 33, 395–404.
Carrell, A.A., Frank, A.C., 2014. Pinus flexilis and Piceae engelmannii share a simple and consistent needle endophyte microbiota with a potential role in nitrogen fixation. Front Microbiol, Front Microbiol. 5(333) doi:10.3389/fmicb.2014.00333.
Chen, B., Shen, J., Zhang, X., Pan, F., Yang, X., Feng, Y. 2014. The endophytic bacterium, Sphingomonas SaMR12, improves the potential for zinc phytoremediation by its host, Sedum alfredii. PLoS ONE 9(9): e106826. doi: 10.1371/journal.pone.0106826
Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res., 33, 294–296.
Compant, S., Mitter, B., Colli-Mull, J.G., Gangl, H., Sessitsch, A., 2011. Endophytes of grapevine flowers, berries, and seeds: identification of cultivable bacteria, comparison with other plant parts, and visualization of niches of colonization. Microb. Ecol., 62,188-197.
Coombs, J.T., Franco, C.M., 2003. Isolation and identification of actinobacteria from surface-sterilized wheat roots. Appl Environ. Microbiol, 69, 5603–5608.
14
De Araújo Barros, I., Wellington, L.A., Azevedo, J.L., 2010. The effect of different growth regimes on the endophytic bacterial communities of the fern, Dicksonia sellowiana hook (Dicksoniaceae). Braz. J. Microbiol, 41, 956-965.
DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., et al., 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol, 72, 5069– 5072.
Frank, J.A., Reich, C.I., Sharma, S., Weisbaum, J.S., Wilson, B.A., Olsen, G.J., 2008. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ. Microbiol, 74, 2461–2470.
Friesen, M.L., Porter, S.S., Stark, S.C., von Wettberg, E.J., et al., 2011. Microbially mediated plant functional traits. Annu. Rev. Ecol. Evol. Syst., 42, 23–46.
Giannakou, I.O., Karpouzas, D.G., Prophetou-Athanasiadou, D., 2004. A novel non-chemical nematicide for the control of root-knot nematodes. Appl. Soil Ecol., 26, 69–79.
Hardoim, P.R., van Overbeek, L.S., Elsas, J.D., 2008. Properties of bacterial endophytes and their proposed role in plant growth. Trends Microbiol., 16, 463–471.
Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compante, S., Campisano, A., Döringg, M., and Sessitsche, A., 2015. The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiol. Mol. Biol. Rev. 79(3),293-320.
Halo, B.A.,Khan, A.L., Waqas, M., Al-Harrasi, A., Hussain, J., Ali, L.,Adnan, M., Lee, I., 2015. Endophytic bacteria (Sphingomonas sp. LK11) and gibberellin can improve Solanum lycopersicum growth and oxidative stress under salinity. Journal of Plant Interactions, 10(1),1173–125.
Huang, X., Madan, A., 1999. CAP3: A DNA sequence assembly program. Genome Res, 1999, 9, 868–77.
Hubálek, Z., 2003. Protectants used in the cryopreservation of microorganisms. Cryobiology 46:205-229.
15
Izumi, H., Anderson, I.C., Killham, K., Moore, E.R., 2008. Diversity of predominant endophytic bacteria in European deciduous and coniferous trees. Can. J. Microbiol., 54, 173–179.
Jenkinson, J.L., 1974. Ponderosa pine progenies: differential response to ultra-mafic and granitic soils., Pacific Southwest Forest and Range Exp. Stn., Berkeley, Calif. USDA Forest Serv. Res. Paper PSW-101.
Kaga, H., Mano, H., Tanaka, F., Watanabe, A., et al., 2009. Rice seeds as sources of endophytic bacteria. Microbes Env., 24, 154–162.
Kaewkla, O., Franco, C.M., 2013. Rational approaches to improving the isolation of endophytic actinobacteria from Australian native trees. Microb. Ecol., 65, 384–93.
Koskimäki, JJ, Pirttilä, AM, Ihantola, AM, Halonen, O and Frank, AC. The intracellular Scots pine shoot symbiont Methylobacterium extorquens DSM13060 aggregates around the host nucleus and encodes eukaryote-like proteins. MBio, Mar 24;6(2). pii: e00039-15. doi: 10.1128/mBio.00039-15).
Krishnan, P., Bhat, R., Kush, A., Ravikumar, P., 2012. Isolation and functional characterization of bacterial endophytes from Carica papaya fruits. J. Appl. Microbiol.,113, 308–317.
Knoth, J.L., Kim, S.-H., Ettl, G.J., Doty, S.L., 2014. Biological nitrogen fixation and biomass accumulation within poplar clones as a result of inoculations with diazotrophic endophyte consortia. New Phytol., 201, 599–609.
Latutrie, M., Aronen, T., 2013. Long-term cryopreservation of embryogenic Pinus sylvestris cultures. Scandinavian Journal of Forest Research 28:103-109.
Laukkanen, H., Soini, H., Kontunen-Soppela, S., Hohtola, A., Viljanen, M., 2000. A mycobacterium isolated from tissue cultures of mature Pinus sylvestris interferes with growth of Scots pine seedlings. Tree Physiol., 20, 915–920.
Leite, H.A., Silva, A.B., Gomes, F.P., Gramacho, K.P., et al., 2013. Bacillus subtilis and Enterobacter cloacae endophytes from healthy Theobroma cacao L. trees can systemically colonize seedlings and promote growth. Appl Microbiol Biotechnol, 97, 2639–2651.
16
Liu, X. L., Liu, S. L., Liu, M., Kong, B. H., Liu, L., & Li, Y. H. 2014. A primary assessment of the endophytic bacterial community in a xerophilous moss (Grimmia montana) using molecular method and cultivated isolates. Brazilian Journal of Microbiology, 45(1), 163–173.
Lodewyckx, C., Vangronsvel, J., Porteous, F., Moore, E.R.B., Taghavi, S., Mezgeay, M., van der Lelie, D., 2002. Endophytic Bacteria and Their Potential Applications. Crit. Rev. Plant Sci., 21, 583–606.
Nawrocki, E.P., Kolbe, D.L., Eddy, S.R., 2009. Infernal 1.0: inference of RNA alignments. Bioinformatics, 25, 1335–1337.
Orole, O.O., Adejumo, T.O., 2011. Bacterial and fungal endophytes associated with grains and roots of maize. J. Ecol. Nat. Environ., 3, 298–303.
Pirttilä, A.M., Laukkanen, H., Pospiech, H., Myllyla, R., Hohtola, A., 2000. Detection of intracellular bacteria in the buds of Scotch pine (Pinus sylvestris L.) by in situ hybridization. Appl. Environ. Microbiol, 66, 3073–3077.
Pirttilä, A.M., Joensuu, P., Pospiech, H., Jalonen, J., Hohtola, A., 2004. Bud endophytes of Scots pine produce adenine derivatives and other compounds that affect morphology and mitigate browning of callus cultures. Physiol. Plant, 121, 305–312.
Pirttilä, A.M., Pospiech, H., Laukkanen, H., Myllyla, R., Hohtola, A., 2005. Seasonal variations in location and population structure of endophytes in buds of Scots pine. Tree Physiol., 25, 289–297.
Pirttilä, A.M., 2011. In: Pirttilä, AM, Frank, AC (Eds.), Endophytes For. Trees Biol. Appl., vol. 80, Springer Verlag Berlin, Heidelberg, pp. 139–149.
Pohjanen, J., Koskimäki, J.J., Sutela, S., Ardanov, P., et al., 2014. The interaction with ectomycorrhizal fungi and endophytic Methylobacterium affects the nutrient uptake and growth of pine seedlings in vitro. Tree Physiol, In press.
Poole, A.M., Stouffer, D.B., Tylianakis, J.M., 2012. “Ecosystomics”: ecology by sequencer. Trends Ecol. Evol., 27, 309–310.
17
Quambusch, M., Pirttila, A.M., Tejesvi, M.V., Winkelmann, T., Bartsch, M., 2014. Endophytic bacteria in plant tissue culture: differences between easy- and difficult-to-propagate Prunus avium genotypes. Tree Physiol., 34, 524–533.
Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Curr. Opin.Plant. Biol., 14, 435–443.
Reed, B.M., Mentzer, J., Tanprasert, P., 1998. Internal bacterial contamination of micropropagated hazelnut: identification and antibiotic treatment. Plant Cell Tiss. Org. Cult., 1998, 52, 67–70.
Schreiber, L.R., Gregory, G.F., Krause, C.R., Ichida, J.M., 1988. Production, partial purification, and antimicrobial activity of a novel antibiotic produced by a Bacillus subtilis isolate from Ulmus americana. Can. J. Bot., 66, 2338–2346.
Seo, W.T., Lim, W.J., Kim, E.J., Yun, H.D., Cho, K.M., 2010. Endophytic bacterial diversity in the young radish and their antimicrobial activity against pathogens. J. Korean Soc. Appl. Biol. Chem., 53, 493–503.
Siddikee, M.A., Glick, B.R., Chauhan, P.S., Yim, W., Sa, T., 2011. Enhancement of growth and salt tolerance of red pepper seedlings (Capsicum annuum L.) by regulating stress ethylene synthesis with halotolerant bacteria containing 1-aminocyclopropane-1-carboxylic acid deaminase activity. Plant Physiol. Biochem., 49, 427–434.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690.
Thomas, P., Soly, T.A., 2009. Endophytic bacteria associated with growing shoot tips of banana (Musa sp.) cv. Grand Naine and the affinity of endophytes to the host. Microb. Ecol., 2009, 58, 952–964.
Truyens, S., Weyens, N., Cuypers, A., Vangronsveld, J., 2013. Changes in the population of seed bacteria of transgenerationally Cd-exposed Arabidopsis thaliana. Plant Biol. 15(6), 971-81
Ulrich, K., Ulrich, A., Ewald, D., 2008a. Paenibacillus- a predominant endophytic bacterium colonizing tissue cultures of woody plants. Plant Cell Tiss. Organ Cult., 93, 347–351.
18
Ulrich, K., Ulrich, A., Ewald, D., 2008b. Diversity of endophytic bacterial communities in poplar grown under field conditions. FEMS Microbiol. Ecol., 63, 169–180.
Van Aken, B., Peres, C.M., Doty, S.L., Yoon, J.M., Schnoor, J.L., 2004. Methylobacterium populi sp. nov., a novel aerobic, pink-pigmented, facultatively methylotrophic, methane-utilizing bacterium isolated from poplar trees (Populus deltoides x nigra DN34). Int. J Syst. Evol. Microbiol., 54, 1191–1196.
Wilhelm, E., Arthofer, W., Schafleitner, R., Krebs, B., 1998. Bacillus subtilis an endophyte of chestnut (Castanea sativa) as antagonist against chestnut blight (Cryphonectria parasitica). Plant Cell Tiss. Org. Cult., 52, 105–108.
Zhao, G.Z., Li, J., Qin, S., Zhang, Y.Q., Zhu, W.Y., Jiang, C.L, Xu, L.H., Li, W.J., 2009. Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots. Int. J. Syst. Evol. Microbiol., 59,2383–2387.
Zidani, S., Ferchichi, A., Chaieb, M., 2005. Genomic DNA extraction method from pearl millet (Pennisetum glaucum) leaves. Afr. J. Biotechnol., 8, 862–866.
19
2.8 Tables
Chapter 2, Table 1: BLAST identification of isolates 16S sequence against greengenes and NCBI bacterial 16S rRNA databases.
Isolate ID Best Greengenes BLAST hit Best NCBI BLAST hit (Accession number) PN1 99% Bacillus sp. BR028 99% Bacillus spp. (KF554075) PN2 98% Moraxella osloensis (KF554076) PCWCW3 98% Moraxellaceae
PN3 99% Bacillus sp. BR028 99% Bacillus spp. (KF554077) PN4 99% Bacillus sp. BR028 99% Bacillus spp. (KF554078) PN5 100% Kocuria rhizophila TA68 99% Kocuria spp. (KF554079) PN6 99% Bacillus sp. BR028 99% Bacillus spp. (KF554080) PN7 99% Bacillus sp. BR028 99% Bacillus spp. (KF554081) PN8 100% Kocuria rhizophila JPL-9 99% Kocuria spp. (KF554082) PN9 99% Bacillus sp. BR028 99% Bacillus spp. (KF554083) PN10 99% Bacillus sp. BR028 99% Bacillus spp. (KF554084) PN11 99% Kocuria palustris TAGA27 99% Kocuria palustris (KF554085) PN12 99% Micrococcus sp. LJY5 99% Micrococcus spp. (KF554086) PN13 99% Micrococcus sp. TA014 99% Micrococcus spp. (KF554087) PP1 99% Micrococcus sp. WT108 99% Micrococcus spp. (KF554088) PP2 99% Micrococcus sp. TA014 99% Micrococcus spp. (KF554089) PP3 99% Bacillus sp. BR028 99% Bacillus spp. (KF554090)
20
Isolate ID Best Greengenes BLAST hit Best NCBI BLAST hit (Accession number) PP4 99% Brachybacterium sp. SKJH- (KF554091) 25 99% Brachybacterium spp.
PP5 100% Kocuria rhizophila TA68 99% Kocuria spp. (KF554092) PP6 99% Bacillus sp. BR028 99% Bacillus spp. (KF554093) PP7 98% Paenibacillus humicus Pm1 99% Paenibacillus humicus (KF554094) PP8 98% Paenibacillus humicus Pm1 99% Paenibacillus humicus (KF554095) PP9 99% Micrococcus sp. JAM-AC11 99% Micrococcus spp. (KF554096) PP10 99% Bacillus sp. BR028 99% Bacillus spp. (KF554097) PP11 99% Bacillus sp. BR028 99% Bacillus spp. (KF554098) PP12 99% Bacillus sp. BR028 99% Bacillus spp. (KF554099) PC1 99% Rhodococcus sp. 302BRR 99% Rhodococcus spp. (TBD) PC2 99% Sphingomonas sp. Pmxh3 99% Sphingomonas spp. (TBD) PC3 99% Kocuria sp. HY15 99% Kocuria spp. (TBD) PC4 98% Bosea thiooxidans TJ1 98% Microvirga spp. (TBD) PC5 100% Methylobacterium sp. 69 99% Methylobacterium spp. (TBD) PC6 99% Williamsia sp. SY3 99% Williamsia spp. (TBD) PC7 100% Methylobacterium 99% Methylobacterium spp. (TBD) radiotolerans DX-T3-02 PC8 100% Methylobacterium 99% Methylobacterium spp. (TBD) radiotolerans L7-747 PC9 99% Bacillus niacini YM1C7 99% Bacillus niacini (TBD) PC10 99% Nocardioides sp. MWH-CaK6 98% Nocardioides spp. (TBD)
21
Isolate ID Best Greengenes BLAST hit Best NCBI BLAST hit (Accession number) PC11 96% Bacillus spp. 98% Bacillus spp. (TBD) PC12 100% Moraxella sp. BQEN3-02 99% Moraxellaceae (TBD)
22
2.9 Figures
Chapter 2, Figure 1: Maximum-likelihood phylogenetic tree of 16S rRNA gene sequences from bud isolates and closely related bacterial species. The best scoring maximum-likelihood phylogenetic tree was computed with RAxML (1000 bootstraps).The Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup. Isolates are indicated by PN# ,PP#, and PC# representing isolates from Pinus nigra, Pinus ponderosa, Pinus contorta bud/shoot tissue. Gammaproteobacteria are boxed in green, Alphaproteobacterai are boxed in blue, Actinobacteria are boxed in red, and Firmicutes are boxed in yellow.
3 Bacterial endophytes of Monterey pine: community analysis and culture-based identification
3.1 Abstract Monterey pine trees (Pinus radiata D. Don) are an ecologically and economically important conifer species native to three mainland sites in California. These pines require moisture deposition from fog collected on their branches and therefore could be at risk due to climate change and drought. Endophytes have previously been shown to have genes that ameliorate drought stress in their plant hosts, however Monterey pines have never been surveyed for the presence of bacterial endophytes. To determine baseline information about the endophytic community associated with Monterey pine, the needles and buds of three isolated populations of Monterey pine were sampled (Año Nuevo, Monterey and Cambria). Both culture-independent community analysis and culture-based isolate studies were completed for comparison. The culture-independent study revealed that phylum Proteobacteria dominated the endophytic communities and culture-based results followed a similar pattern. Proteobacteria dominated the culturable community (32 isolates) followed by Firmicutes (6 isolates). Three of the ten most dominant operational taxonomic units (OTUs) from the culture- independent study were captured in the culture-based study, revealing that the improved culture methods were successful. These isolates can now be used for genomic studies to determine if they are adapted to the plant host environment (and potentially involved in protecting it against drought), if they were merely opportunistic pathogens preying on stressed trees or that these bacteria are merely transient “visitors” that are present without any effect on the host.
23 24
3.2 Introduction Pinus radiatia (Monterey pine) is native California conifer found in three populations along the central coast. Monterey pine is useful for lumber and pulp because of its rapid growth and tissue consistency and has been planted worldwide for logging industry (Critchfield et al. 1966, Scott, 1960). In its natural range, Monterey pine has been shown to be dependent upon fog for moisture in the summer (McDonald, 1959). The persistent drought in California and decreasing summer fog pose a threat to Monterey pine and other coastal plant species (Fischer et al. 2008, Johnstone and Dawson, 2010). Bacterial endophytes have been shown to ameliorate drought stress in agriculture plants (Sziderics et al., 2007, Bresson et al., 2013, Castillo et al., 2013, Chakraborty et al., 2013) but more exploration of conifer endophytes needs to be done to clarify the role of endophytes in drought-stressed trees.
Stress of any kind can compromise the natural ability of plants to fight off pathogens (Atkinson & Urwin, 2012). Bacterial pathogens are abundant and have been studied extensively in agricultural crops because of their ability to decimate food sources (Dangl & Jones, 2011, Sebaihia et al, 2010, Alfano and Colmer, 1996, Coutinho and Venter 2009, Toth et al., 2006, Abramovitch and Martin, 2004). While bacterial diseases are well described in agricultural angiosperm trees such as Xylella fastidiosa, which causes pear leaf scorch (Leu & Su, 1993). there are no known bacterial diseases that affect conifer species. This could be due to the antimicrobials that many endophytes can produce (Raaijmakers & Mazzola, 2012, Hinton & Bacon, 1995).
This study was designed to lay a baseline for the understanding of the bacterial endophyte community present in native Pinus radiata. Three sites were sampled for healthy needles and buds when present. Five trees per site were sampled and both culture-dependent and independent studies were completed utilizing 16S rRNA sequencing (Sanger for isolates and Illumina for community analysis.) Culture methods were improved by a preliminary culture media and tissue preparation test which revealed that multiple carbon source, Tris-buffered, R2A agar and liquid nitrogen prepared (either cryo-preserved or non-preserved) tissue preparation was most successful for maximum isolate recovery.
The results revealed that our samples were dominated by members of the family Enterobacteriaceae with the most representatives from the phylum Proteobacteria and many well-known endophytic genera (Hardoim et al., 2015). The cultural representatives of this community followed a similar pattern, with isolates corresponding to three of the ten most dominant Illumina OTUs identified. Several isolates are likely to represent previously uncultured,
25
new species, including a strain most similar to the genus Sodalis, which has been only identified as insect symbionts (Dale, & Maudlin, 1999), and a Rhizobiales isolate (PL12) which had a full-length, high-quality 16S rRNA sequence but is likely a new family due to the fact that all BLAST searches were only able to identify to the order level. These isolates and several Enterobacteriaceae isolates would make interesting candidates for genome sequencing for further study.
3.3 Methods
3.3.1 Sample collection and sterilization Needle and bud/shoot tissue samples were collected from five (six from Swanton) apparently healthy trees in three native Monterey pine stands in California: Swanton Pacific Ranch, in Año Nuevo, CA (37° 3.9' N, 122° 14.5’ W), Point Lobos State Natural Reserve, in Monterey, CA (36° 30.9' N, 121° 56.6' W) and the UCOP NRS Kenneth S. Norris Rancho Marino Reserve, in Cambria, CA (35° 32.2' N, 121° 04.7’ W). The abundance and color of needles and reasonable presence of cones was used to measure relative health of the trees sampled. The apparently healthy trees were often found in stands of dead trees. Twenty to twenty-five small needle and bud/shoot samples were collected from each tree, at the North, South, East and West sides of the tree to obtain a representative sampling. Samples were collected with sterile gloves and blades, and large sterile sample bags were used to minimize tissue damage. Samples were stored in cool conditions for transport back to the lab for surface sterilization within one week of sampling.
Needles were collected at all sites, buds were collected when present and pooled by site resulting in a total of 16 needle samples and three bud samples. Sterilization was achieved by submersion in 30% hydrogen peroxide for three minutes, rinsed ten times by shaking with sterile ultrapure water for one minute, and stored at -20°C. Sterility was confirmed by negative PCR amplification of the final rinse and by clear culture plates of the final rinse.
3.3.2 Bacterial Community Analysis
3.3.2.1 Tissue Preparation and DNA extraction Samples were individually (16 needle, 3 bud) ground to a fine powder with a sterile mortar and pestle on a liquid nitrogen filled-base. DNA was extracted using a CTAB extraction protocol adapted from Zidani et al. 2005: 800uL of
26
CTAB solution (1 mL CTAB buffer, 0.04 g of polyvinylpyrollidone, 5 µL of 2- mercaptoethanol) was added to 0.6 g of tissue, incubated for 2 hours at 60°C with periodic vortex mixing, and homogenized with sterile glass beads for 3 minutes. Proteins were removed with the addition of an equal volume of 24:1 molecular grade chloroform/isoamyl alcohol, centrifuged for 10 minutes at 16 rcf, and the top aqueous phase was placed in a sterile tube. Protein removal was repeated twice to ensure sample purity. Nucleic acids were precipitated with the addition of 1/10 volume of cold 3 M sodium acetate and 1/1 volume cold isopropanol, extractions were placed in a –20°C freezer for 12 hours, followed by centrifugation for 30 minutes at 16 rcf to pellet the DNA. The supernatant was removed, 700 µL of 70% ethanol was added then the tube was shaken to dislodge and rinse pellet, followed by centrifugation for 10 minutes. Ethanol was then removed and pellet was air dried in sterile conditions. The air dried pellet was re-suspended with 30 µL of DNA suspension buffer (1.0 M Tris-HCL, 0.1 M EDTA) and stored at –20°C.
3.3.2.2 DNA amplification The 16S rRNA gene amplified using nested PCR targeted to bacterial genes to reduce the occurrence of plastid sequences and improve consistency. Plant DNA amplification was suppressed with the primer pair 16S 799f (AACMGGATTAGATACCCKG) and 16S 1492r (TACGGHTACCTTGTTACGACT) in the first PCR reaction (PCR1). Amplification with 16S 799f and 16S 1492r result in mitochondrial amplicon of about 1000 bp and bacterial amplicon of about 750 bp (Chelius & Triplett, 2001). In the final round of PCR (PCR2), an appropriate amplicon length for Illumina sequences was achieved from PCR1 amplicons with the Illumina adapted, Golay-barcoded primer pair 799f and 1115r (AGGGTTGCGCTCGTTG), an optimized primer set for phylogenetic analysis of short reads (Redford, et al., 2010) and reduced primer bias by a decreased number of PCR cycles (Jiao, et al., 2006) with the following thermocycle profile used for PCR1 and PCR2: one cycle of 3 min at 95°C; 20 cycles of 40 s at 95°C, 40 s at 50°C, 1.5 min at 72°C; and a final 10 min of elongation at 72°C. The 50µL PCR1 reaction contained 5µL of DNA extract, 20µL 5 PRIME Hot Master Mix (5 PRIME, Inc.), 0.5 µg/µl Bovine Serum Albumin (Thermo Scientific), 21.5µL PCR grade water (Fisher BioReagents), and 0.2 µM of forward and reverse primers. The 25µL PCR2 reaction contained 3µL of PCR1 product, 10µL 5 PRIME Hot Master Mix, 0.5 µg/µL Bovine Serum Albumin (Thermo Scientific), 8.75µL PCR grade water (Fisher BioReagents), and 0.2µM of forward and reverse primers. PCR2 amplicons were then cleaned, pooled, and gel extracted (QIAquick Gel Extraction Kit) to ensure selection of the correct band size and to remove as many mitochondrial products as possible. Pooled samples were then submitted for Illumina sequencing at the University of California, Davis Genome Center.
27
3.3.2.3 Sequence processing and identification Sequences were analyzed and processed using the QIIME (1.8.0) package (Caporaso, et al., 2010), with the UPARSE method for clustering operational taxonomic units (OTUs) (Edgar, 2013). Forward and reverse paired-end reads were joined with fastq-join, with the barcode filtered from the dataset if the forward and reverse read did not overlap (Aronesty, 2011). Joined pair- end reads were quality filtered with QIIME defaults settings (maximum number of consecutive low quality base calls of 3 bases; minimum number of consecutive high quality base calls as a fraction of the input read length of 0.5 total read length; maximum unacceptable Phred quality score of 3; no N characters) which have been found to sufficient for community analysis (Bokulich et al., 2012). The remaining sequences were clustered into OTUs at the 97% level. Representative sequences were aligned using PyNAST (Caporaso, et al., 2010) against the Greengenes core set (DeSantis, et al., 2006). Taxonomic assignments were made using uclust (Edgar, 2010) with greengenes representative set of sequences as reference. Sequences classified as “Chloroplast” or “Mitochondria” were removed. An approximate maximum-likelihood tree was constructed from the aligned of representative sequences, using FastTree (Price, et al., 2009). A heatmap of the ten most abundant OTUs was created from the OTU table and plotted using Perl Tk.
3.3.3 Bacterial Culture Isolation
3.3.3.1 Tissue processing and Culture Conditions To test the effectiveness of culture media for maximizing the recovery of bacterial endophytes, a preliminary media test was conducted. LB agar, R2A agar, R2A supplemented with 3 carbon sources (glucose, sucrose and dextrose), and M9 salts were tested with and without the addition of cyclohexamide (0.05 g per liter) and with or without the addition of 3% total volume with Tris-buffer (Pierpoint,1996).
To test the effect of tissue preparation on endophyte recovery, samples were prepared with: 1. liquid nitrogen freezing and pulverization, 2. cryopreservation with 10% dimethylsufoxide before liquid nitrogen freezing and pulverization, 3. fresh tissue grinding without freezing, and 4. fresh tissue grinding with 3% total volume Tris-buffer.
The most successful culture media and tissue preparation method was used for culturing the samples presented in this chapter. For each of the three sites, samples were pooled by tissue type (needles and bud). The pools were then divided into two equal portions and half from each site were treated with 10%
28
dimethylsufoxide (Hubálek, 2003, Latutrie & Aronen, 2013) to confirm the effect of cryopreservation on bacterial recovery.
Cryopreserved and non-cryopreserved samples were pulverized with liquid nitrogen freezing and pulverization with a sterile mortar and pestle on a liquid nitrogen-filled based. Four grams of samples were then transferred to 50mL tubes for liquid culture in 40 mL R2A broth (supplemented with sucrose, glucose and dextrose) buffered to a 3% total volume with Tris buffer (Pierpoint, 1996). Samples were cultured at 22°C and plated in triple- replicates on R2A agar at the following time points: 1 hour liquid culture, 1 day liquid culture and 1 week liquid culture. Parafilm sealed plates were incubated at room temperature on the lab bench in order to expose the cultures to diurnal light changes as well as shifts in temperature (21-25°C). Unique colonies were picked (one day to two weeks) and re-plated on R2A agar until single isolates were obtained. Single isolates were confirmed using BARDOT laser scanning (Banada et al., 2008), a technique that uses a solid state laser and camera on chip device to collect the scatter pattern of light through a bacterial colony. The resulting pattern will reveal a pure colony (clear, defined pattern) or a contaminated or co-colony (distorted, uneven scatter pattern).
3.3.3.2 Isolate DNA Extraction For each isolate, a 10µL loop was scraped until full across the isolate plates and added to sterile tubes. In addition, 200µL of one hour liquid culture was added to maximize fresh cell counts for extraction. 800µL of CTAB solution (from 1 mL CTAB buffer, 0.04 g of polyvinylpyrollidone, 5µL of 2- mercaptoethanol) was added to tubes and samples were incubated at 60°C for two hours with periodic vortex mixing (Zidani et al., 2005). Samples were then homogenized with sterile glass beads for 90 seconds. Protein removal was performed by the addition of 800µL of 24:1 molecular grade chloroform/isoamyl alcohol to each tube, shaking until cloudy emulsion formed and centrifugation for 10 minutes at 16 rcf. The top aqueous phase was transferred to a sterile tube and the protein removal was repeated. Nucleic acids were precipitated with the addition of 1/10 volume of cold 3M sodium acetate and 1/1 volume of cold isopropanol, placed in a -20°C freezer for 12 hours, followed by centrifugation for 30 minutes at 16 rcf. The supernatant was removed, 700µL of 70% ethanol added and shaken until the pellet dislodged to then fully rinse the DNA pellet. Tubes were then centrifuged for 10 minutes and ethanol was removed. Pellets were air-dried in sterile PCR hood. The air-dried pellets were re-suspended with 50µL of DNA suspension buffer (1.0 M Tris-HCL, 0.1 M EDTA) and stored at –20°C.
29
3.3.3.3 Isolate DNA Amplification The 16S rRNA genes of bacterial isolates were amplified using the universal primer pair 27F and 1492R and a thermocycle profile of: 3 minute initial denaturation at 95°C, followed by 40 cycles of 30 second denaturation at 95°C, 30 second annealing at 52°C, extension for 2 min 30 seconds at 72°C (1 min/kb), followed by a final extension for 10 minutes at 72°C and cooling to 4°C. Amplification thermocycles were modified from JA Frank 2008 (Frank et al., 2008), and adapted for the optimal melting temperatures for the primers used and the range constraints of the PCR kit specifications. Life Technologies Thermo Scientific DreamTaq DNA polymerase was used as it is optimized for higher yields and sensitivity and longer PCR products. Bacterial DNA samples were diluted to a consistent concentration of 40 ng/µL. Each 50µL amplification reaction contained: 15.75µL nuclease-free grade water (included in DreamTaq kit), 25µL DreamTaq PCR buffer, 1.25µL BSA, 1.5µL 10 µM 27F primer and 1.25µL BSA, 1.5µL 10 µM 1492R primer and 5 uL 40ng/µL bacterial DNA. PCR products were then screened using the Life Technologies E-gel SizeSelect system with 2% agarose gels. The 1400- 1500bp band/s were selected and removed for Sanger sequencing at the UC Berkeley DNA Sequencing Facility with the primers 27F and 1492R.
3.3.3.4 Isolate Sequence Processing and Identification Sequences were manually processed for quality control and base-call correction with Geospiza FinchTV1.5 and contigs were made using CAP3 (Huang & Madan, 1999). The 16S rRNA contigs were preliminarily assigned to bacterial taxa through BLAST searches against the Greengenes 16S rRNA database (DeSantis, et al., 2006). The Ribosomal Database Project (RDP) (Cole et al, 2005) was used to identify matching sequences and align them using the Infernal alignment algorithm (Nawrocki et al. 2009). A maximum likelihood phylogenetic tree with 1000 bootstrap replicates was inferred using RAxML (Figure 3) (Stamatakis, 2006). Contigs were locally blasted against the top OTUs identified in the community analysis and against all OTUs to determine if cultured isolates were a part of the dominant community and the community at large (Table 1, and Table 2).
30
3.4 Results
3.4.1 Community Analysis 2423 bacterial OTUs were identified in the set of 1.4 million quality Illumina sequences recovered from the 16 needle and 3 bud samples (Chapter 3, Table 1). The rarefaction plot curves were saturated, suggesting that the bacterial communities were not under-sample at the 97% OTU level (Chapter 3, Figure 1). The samples were dominated by the phylum Proteobacteria, mostly the Gammaproteobacterial order Enterobacteriales (83% of total sequences). Within the Proteobacteria, other classes were present in low relative abundance (e.g. Alphaproteobacteria at 1.35%, and Betaproteobacteria at 3.46% of total sequences). The dominance of Gammaproteobacteria in the community sequences is reflected the dominance of a few specific OTUs in most of the samples (Chapter 3, Figure 2). The most common OTU in our dataset (OTU 1) was a Serratia species, which made up 82% (Cambria), 56% (Swanton), 12% (Point Lobos) of the sequences. The OTU sequence is 100% identical to sequences from Serratia liquefaciens, Serratia proteamaculans, Serratia grimesii, and Serratia quinivorans (McInroy & Kloepper, 1995, Taghavi, et al., 2009, Cardoza et al. 2006, Guevara-Avendaño et al., 2014), which include both pathogens and endophytic species (Peterson & Tisa, 2013). The second most common OTU, OTU2 was present at a higher relative abundance in the Point Lobos samples and is 100% identical to Erwinia billingiae, Erwinia rhapontici, and Erwinia persicina. Erwinia species are know for being plant pathogens, but some species and strains can also associate with plants as endophytes or epiphytes (Kube et al., 2010, Bell et al., 2004, Procópio et al., 2009). Two other OTUs from the Enterobacteriaceae were prominent, especially in samples with a lower relative abundance of OTUs 1 and 2, however these OTUs could not be classified below the family level. An interesting result was the presence of a Sodalis species (also in the family Enterobacteriaceae) which was present at relatively low relative abundance in many samples (Chapter 3, Figure 2). Sodalis have previously only been identified as an insect endosymbiont (Chari et al., 2015, Dale & Maudlin, 1999).
Alpha diversity (the diversity within a single foliage sample) was estimated by Chao and Shannon indices. No difference in alpha diversity was found among locations or between tissue types (bud vs needle). Beta diversity (here, the diversity among locations) was assessed using weighted UniFrac. There was clustering of samples based on location (Permanova: Pseudo-F statistic = 0.14572, P = 0.038; Anosim: R = 0.1458, P = 0.023).
31
3.4.2 Isolates The comparative culture media and tissue preparation study yielded the result that Tris-buffered, cycolohexamide-free, multiple carbon R2A grew the highest number of colonies. In addition, liquid nitrogen prepared samples resulted in the highest number of colonies. Cryo-preservation did not seem to have a noticeable effect but since it is traditionally used to preserve plant material or isolated cultures for long-term freezer storage (Hubálek, 2003, Latutrie & Aronen, 2013), 10% dimethylsulfoxide was used for cryopreservation before tissue pulverization as a control to confirm the comparative study findings.
From the bacterial colonies that were cultured, close to 50 bacterial isolates were recovered Monterey pine needles and buds, a subset of these were chosen for sequence analysis (Chapter 3, Table 2, and Chapter 3, Figure 3). The Swanton Ranch samples yielded nine isolates from needles and three from bud tissue with quality 16S contigs. The Point Lobos needle samples yielded 10 isolates with quality contigs, and the Cambria samples yielded 9 needle isolates and 7 bud isolates with quality contigs. Proteobacteria dominated the culturable isolates (32 isolates) followed by Firmicutes (6 isolates). Within the Proteobacteria, Gammaproteobacteria dominated (25 isolates), followed by Alphaproteobacteria (4 isolates) and Betaproteobacteria (3 isolates). Several isolates seemed to be new species, including a Sodalis species which previously has been only identified as an insect symbiont,and a Rhizobiales isolate which only had BLAST hits at the order level even with a high-quality 16S sequence.
Local BLAST searches with 16S rRNA isolates were identical to three of the top ten OTUs identified in the community analysis (Chapter 3, Figure 2, and Chapter 3, Table 2). Two Swanton Ranch and six Cambria isolates matched OTU1, one Swanton Ranch and five Cambria isolates matched OTU_2 and one Cambria isolate matched OTU_10. Overall, 23 of the 38 quality isolate sequences had 99-100% BLAST matches against the community analysis OTUs (Chapter 3, Table 2).
3.5 Discussion In this first description of the endophytic community of Monterey pine, location specific communities were not seen. This result suggests that a core community of bacterial endophytes associate with Monterey. Core endophytic communites have been seen in limber pine and Engelmann spruce although these communites were dominated by potential nitrogen-fixing bacterial
32
bacteria in the Alphaproteobacterial family Acetobacteriaceae (Carrel & Frank, 2014). The dominant OTUs in the community analysis contained members from well-known endophytic species such as Serratia (Chapter 3, Table 2) (Zhang et al., 2005, Liu et al., 2011, Peterson & Tisa, 2013).
While the trees sampled in this study were visibly healthy (abundant, green needles, healthy cones) it is reasonable to assume that the trees sampled were under some kind of stress due to the persistent drought in California (McDonald, 1959, Fischer et al. 2008, Johnstone and Dawson, 2010). Given the stressed conditions of these trees, it is important to consider the possibility of opportunistic pathogens associating with the Monterey pine, however no known cases of bacterial diseases have been found in conifers. Inoculation experiments using Monterey pine seedlings, and isolate genome sequencing of isolates could yield more insight into the nature of the relationships between the Enterobacteriaceae endophytes and their Monterey pine hosts. The genus Enterobacteriaceae,contains both beneficial plant associated bacteria as well as opportunistic pathogens (Hinton & Bacon, 1995, Taghavi et al., 2010, Toth et al., 2006). One of the main indicators of a pathogenic lifestyle is the presence or absence of type III secretion systems (Toth et al., 2006). Type III secretion systems are a sign of bacterial virulence and while some endophytes share virulence related genes for adhesion and cell entry with pathogens, they generally lack type III secretion system genes (Taghavi et al 2010). Isolate cultures are useful for genomic and inoculation experiments to explore the beneficial and/or pathogenic potential of endophytes, however, Monterey pine have never been surveyed for the presence or absence of bacterial endophytes.
Improvements made to culturing methods including buffering, and multiple carbon sources increased the colony numbers of bacterial endophytes. Excluding cyclohexamide (which was used in prior studies including chapter one of this dissertation to limit fungal growth) from the culture media decreases the culture time required to see bacterial endophytes colonies. Without cyclohexamide, we saw bacterial growth within days instead of the 1- 6 weeks seen in chapter one isolation experiments. With cyclohexamide, we were unable to culture bacterial endophytes suggesting either that cyclohexamide limits bacterial growth in these samples or that these bacterial endophytes needed their fungal partners to grow in culture. Protecting the samples against freezing damage did not seem to have an effect on the recoverability of endophyte species (Chapter 3, Table 2). In addition, we cultured these samples within a month of sampling so a short freezer storage time could play a role in the recovery success we saw in this study. These improvements in culture methods may be the reason for the isolation of several bacterial strains that dominated the sequences obtained from the culture-independent analysis.
33
3.6 Concluding Remarks Characterizing the community of bacterial endophtes in Monterey pine trees has given us important information about the possible core bacterial endophytes that colonize these trees. Successful isolation of several of the dominant community members provides the opportunity to study these endophytes further. Future work should include genome sequencing of these isolates to determine if they are the first opportunistic pathogens described in conifers or if they are involved in helping these drought-stressed trees survive. Future work should also include further study of the potentially new bacterial species isolated.
3.7 References
Abramovitch, R.B., Martin, G.B., 2004. Strategies used by bacterial pathogens to suppress plant defenses. Current Opinion in Plant Biology 7(4), 356-364.
Aronesty,E. 2011. eaUutils: Command-line tools for processing biological sequencing data.
Alfano, J.R., and Collmer, A., 1996. Bacterial pathogens in plants: life up against the wall. Plant Cell. 8(10), 1683–1698.
Atkinson, N.J., and Urwin, P.E., 2012. The interaction of plant biotic and abiotic stresses: from genes to the field. J. Exp. Bot doi:10.1093/jxb/ers100 p1-21.
Banada, P.P., Huff, K., Bae, E., Rajwa, B., Aroonnual, A., Bayraktar, B., Adil, A., Robinson, J.P., Hirleman, E.D., Bhunia, A.K., 2008. Label-free detection of multiple bacterial pathogens using light-scattering sensor. Biosens Bioelectron. 24(6),1685-92.
Bell, K.S., Sebaihia, M., Pritchard, L., Holden, M.T., Hyman, L.J., Holeva, M.C., Thomson, N.R., Bentley, S.D., Churcher, L.J., Mungall, K., Atkin, R., Bason, N., Brooks, K., Chillingworth, T., Clark, K., Doggett, J., Fraser, A., Hance, Z., Hauser, H., Jagels, K., Moule, S., Norbertczak, H., Ormond, D., Price, C., Quail, M.A., Sanders, M., Walker, D., Whitehead, S., Salmond, G.P., Birch, P.R., Parkhill, J., Toth, I.K., 2004. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc Natl Acad Sci 101(30), 11105–11110.
34
Bokulich,N.A., Subramanian, S., Faith, J.J.,Gevers, D., Gordon, J.I., Knight, R., Mills,D.A., Caporaso, J.G., 2012. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods 10,57–59.
Bresson, J.,Varoquaux,F., Bontpart, T., Touraine, B., Vile, D., 2013. The PGPR strain Phyllobacterium brassicacearum STM196 induces a reproductive delay and physiological changes that result in improved drought tolerance in Arabidopsis. New Phyto. 200, 558-569.
Caporaso, J,G,, Kuczynskim J,, Stombaughm J, et al., 2010. QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7,335-336.
Cardoza, Y.J., Klepzig, K.D., Raffa, K.F., 2006. Bacteria in oral secretions of an endophytic insect inhibit antagonistic fungi. Ecological Entomology 31, 636–645.
Carrell, A.A., Frank, A.C., 2014. Pinus flexilis and Piceae engelmannii share a simple and consistent needle endophyte microbiota with a potential role in nitrogen fixation. Front Microbiol. 5(333) doi:10.3389/fmicb.2014.00333.
Castillo, P., Escalante, M., Gallardo, M., Alemano, S., Abdala, G., 2013. Effects of bacterial single inoculation and co-inoculation on growth and phytohormone production of sunflower seedlings under water stress. Acta Physiologiae Plantarum, 35,2299-2309.
Chakraborty, U., Chakraborty, B.N., Chakraborty,A.P., Dey, P.L., 2013. Water stress amelioration and plant growth promotion in wheat plants by osmotic stress tolerant bacteria. World Journal of Microbiology and Biotechnology, 29,789-803.
Chari, A., Oakeson, K.F., Enomoto, S., Jackson, D.G., Fisher, M.A., Dale, C., 2015. Phenotypic characterization of Sodalis praecaptivus sp. nov., a close non-insect-associated member of the Sodalis-allied lineage of insect endosymbionts. Int J Syst Evol Microbiol. 65,1400-5.
Chelius, M. K., and E. W. Triplett. 2001. The Diversity of Archaea and Bacteria in Association with the Roots of Zea mays L. Microb Ecol. 41:252–263.
35
Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res., 33, 294–296.
Coutinho, T.A., and Venter, S.N., 2009. Pantoea ananatis: an unconventional plant pathogen. Mol. Plant Path. 10(3), 325-335.
Critchfield, W.B., Little, E.L. Jr., 1966. Geographic distribution of the pines of the world. U.S. Department of Agriculture, Miscellaneous Publication 991. Washington, DC. 97.
Dale, C., Maudlin, I., 1999. Sodalis gen. nov. and Sodalis glossinidius sp. nov., a microaerophilic secondary endosymbiont of the tsetse fly Glossina morsitans morsitans. Int J Syst Bacteriol. 49(1), 267-75.
Dangl, J.L., Jones, J.D., 2011. Plant pathogens and integrated defense responses to infection. Nature 411, 826-833.
DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., et al., 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol, 72, 5069– 5072.
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26,2460-2461.
Edgar, R.C., 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature Methods 10, 996-998.
Fischer, D.T., Still, C.J., Williams, A.P., 2008. Significance of summer fog and overcast for drought stress and ecological functioning of coastal California endemic plant species. J. Biogeogr epub doi:10.1111/j.1365- 2699.2008.02025.x
Frank, J.A., Reich, C.I., Sharma, S., Weisbaum, J.S., Wilson, B.A., Olsen, G.J., 2008. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ. Microbiol, 74, 2461–2470.
Guevara-Avendaño, E., Luna-Rodríguez, M., Octavio-Aguilar, P., Iglesias- Andreu, L.G., Trigos, A, Martínez-Hernández, J., 2014. Effect of Rhizobacteria Indole producing on the Development of Capsicum annuum var. jalapeño M.Int. Res. J. Biological Sci. 3(10), 22-27.
36
Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compante, S., Campisano, A., Döringg, M., and Sessitsche, A., 2015. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol. Mol. Biol. Rev. 79(3),293-320.
Hinton, D.M., Bacon, C.W., 1995. Enterobacter cloacae is an endophytic symbiont of corn. Mycopathologia, 129(2),117-125.
Huang, X., Madan, A., 1999. CAP3: A DNA sequence assembly program. Genome Res, 1999, 9, 868–77.
Hubálek, Z., 2003. Protectants used in the cryopreservation of microorganisms. Cryobiology 46:205-229.
Izumi, H., Anderson, I.C., Killham, K., Moore, E.R., 2008. Diversity of predominant endophytic bacteria in European deciduous and coniferous trees. Can. J. Microbiol., 54, 173–179.
Jiao, J.Y., Wang, H.X., Zeng, Y., Shen, Y.M., 2006. Enrichment for microbes living in association with plant tissues. Journal of Applied Microbiology 100, 830-837.
Johnstone, J.A., Dawson, T.E., 2010. Climatic context and ecological implications of summer fog decline in the coast redwood region. PNAS 107(10), 4533-4538.
Kube, M., Migdoll, A.M., Gehring, I., Heitmann, K., Mayer, Y., Kuhl, H., Knaust, F., Geider, K., Reinhardt, R., 2010. Genome comparison of the epiphytic bacteria Erwinia billingiae and E. tasmaniensis with the pear pathogen E. pyrifoliae. BMC Genomics.11, 393-408.
Latutrie, M., Aronen, T., 2013. Long-term cryopreservation of embryogenic Pinus sylvestris cultures. Scandinavian Journal of Forest Research 28:103-109.
Leu, L.S., Su, C.C., 1993. Isolation, cultivation, and pathogenicity of Xylella fastidiosa, the causal bacterium of pear leaf scorch disease in Taiwan. Plant Disease. 77(6),642-646.
37
Liu, X., Jia, J., Popat, R., Ortori, C.A., Diggle, S.P., Gao, K., Cámara, M., 2011. Characterisation of two quorum sensing systems in the endophytic Serratia plymuthica strain G3: differential control of motility and biofilm formation according to life-style. BMC Microbiology 11(26) epub http://www.biomedcentral.com/1471-2180/11/26.
McDonald, J.B., 1959. An ecological study of Monterey pine in Monterey County, California. Thesis (M.S.), University of California, Berkeley. 58.
McInroy, J.A., Kloepper, J.W., 1995. Survey of indigenous bacterial endophytes from cotton and sweet corn. Plant and Soil. 173(2), 337- 342.
Nawrocki, E.P., Kolbe, D.L., Eddy, S.R., 2009. Infernal 1.0: inference of RNA alignments. Bioinformatics, 25, 1335–1337.
Peterson, L.M., Tisa, L.S., 2013. Friend or foe? A review of the mechanisms that drive Serratia towards diverse lifestyles. Can J Microbiol. 59(9):627-40
Pierpoint, W.S., 1996. The extraction of enzymes from plant tissues rich in phenolic compounds. Methods in Mo. Bio. 59,69-80.
Price, M.N., Dehal, P.S., Arkin A.P., 2009. FastTree: computing large minimum evolution trees with profiles instead of a distance matrix. Molecular Biology and Evolution 26,1641-1650.
Procópio, R.E., Araújo, W.L., Maccheroni, W., Azevedo, J.L., 2009. Characterization of an endophytic bacterial community associated with Eucalyptus spp. Genet Mol Res. 8(4),1408-1422.
Raaijmakers, J.M., Mazzola, M., 2012. Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria. Annu. Rev. Phytopathol 50,403–424.
Redford, A. J., R. M. Bowers, R. Knight, Y. Linhart, and N. Fierer. 2010. The ecology of the phyllosphere: geographic and phylogenetic variability in the distribution of bacteria on tree leaves. Environ Microbiol 12:2885– 93.
38
Sebaihia, M., Bocsanczy, A.M., Biehl, B.S., Quail. M.A., Perna, N.T., Glasner, J.D., DeClerck, G.A., Cartinhour, S., Schneider, D.J., Bentley, S.D., Parkhill, J., Beer, S.V., 2010. Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946. J. Bacteriol. 192(7), 2020-2021
Scott, C.W., 1960. Pinus radiata. Food and agriculture organization of the United Nations, Forestry and Forest Products Study 14. Rome, Italy. 328 p.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690.
Sziderics, A.H., Rasche,F., Trognitz, F., Sessitsch, A., Wilhelm, E., 2007. Bacterial endophytes contribute to abiotic stress adaptation in pepper plants (Capsicum annuum L.). Can Journal of Microbiol, 53(11),1195- 1202.
Taghavi, S., Garafola, C., Monchy, S., Newman, L., Hoffman, A., Weyens, N., Barac, T., Vangronsveld, J., van der Leilie, D., 2009. Genome survey and characterization of endophytic bacteria exhibiting a beneficial effect on growth and development of poplar trees. Appl. Environ. Microbiol. 75(3),748-757.
Taghavi, S., van der Lelie, D., Hoffman, A., Zhang, Y,-B., Walla, M.D., Vangronsveld, J., Newman, L., Monchy, S., 2010. Genome sequence of the plant growth promoting endophytic bacterium Enterobacter sp. 638. PLoS Genet 6(5): e1000943. doi:10.1371/journal.pgen.1000943
Toth, I.K., Pritchard, L., Birch, P.R.J., 2006. Comparative genomics reveals what makes an Enterobacterial plant pathogen. Annu. Rev. Phytopath. 44,305–36
Zhang, Q., Melcher, U., Zhou, L., Najar, F.Z., Roe, B.A., Fletcher, J., 2005. Genomic comparison of plant pathogenic and nonpathogenic Serratia marcescens strains by suppressive subtractive hybridization. APPL. ENVIRON. MICROBIOL. 71(12), 7716-7723.
Zidani, S., Ferchichi, A., Chaieb, M., 2005. Genomic DNA extraction method from pearl millet (Pennisetum glaucum) leaves. Afr. J. Biotechnol., 8, 862–866.
39
3.8 Tables
Chapter 3, Table 1: Samples successfully characterized by 16S rRNA sequences in this study with number of sequences after quality control and removal of plant DNA.
Sampling Sample ID Tissue No. of No. of 97% location Sequences OTUs Cambria 1 Needle 119971 147 Cambria 2 Needle 56824 146 Cambria 13 Bud 10904 78 Cambria 14 Needle 147519 134 Cambria 15 Needle 108311 163 Cambria 16 Needle 26156 129 Point Lobos 3 Bud 80805 161 Point Lobos 4 Needle 11003 92 Point Lobos 5 Needle 29387 117 Point Lobos 6 Needle 178468 159 Point Lobos 7 Needle 89456 144 Point Lobos 8 Needle 115017 179 Swanton 9 Needle 30076 116 Swanton 10 Needle 80213 109 Swanton 11 Needle 68550 103 Swanton 12 Needle 177387 157 Swanton 17 Bud 46504 105 Swanton 18 Needle 23064 99 Swanton 19 Needle 21785 85
40
Chapter 3, Table 2: Bacteria isolated from surface-sterilized needle and bud samples.
Isolate Location Greengenes NCBI 16S BLAST Local BLAST against Tissue BLAST community analysis Type OTUs (OTU ID) Treatment SW_4 Swanton Bacillus 99% Bacillus 99%, Needle Brevibacterium Cryo 99% SW_7 Swanton Erwinia 99% Erwinia 98% Buds No Cryo
SW_9 Swanton Rahnella 99% Ewingella 98%, 100% OTU_1 Needle Yersinia 98%, (Serratia) No Cryo Rahnella 98%, Serratia 98% SW_10 Swanton Rahnella 99%, Serratia 99% 100% OTU_1 Needle (Serratia) No Cryo
SW_11 Swanton Brevibacterium Brevibacterium Needle 99% 99%, Bacillus 99% No Cryo
SW_15 Swanton Bacillus 99% Bacillus 99% Needle No Cryo
SW_17 Swanton Erwinia 99% Erwinia 98% 100% OTU_195 Buds (Enterobacteriaceae) Cryo
SW_18 Swanton Pseudomonas Pseudomonas 98% Buds 98% Cryo
SW_19 Swanton Methylobacterium Methylobacterium Needle 99% 99% Cryo
SW_20 Swanton Brevibacillus 99% Brevibacillus 99% Needle No Cryo
41
Isolate Location Greengenes NCBI 16S BLAST Local BLAST against Tissue BLAST community analysis Type OTUs (OTU ID) Treatment SW_22 Swanton Erwinia 100% Erwinia 99% 100% OTU_2 Buds (Erwinia) Cryo
SW_23 Swanton Bacillus 100% Bacillus 100% Needle No Cryo
PL_3 Point Lobos Rahnella 99% Serratia 98%, Needle Yersinia 98%, No Cryo
PL_4 Point Lobos Burkholderia 98% Burkholderia 98% 100% OTU_17 Needle (Burkholderia) No Cryo
PL_5 Point Lobos Rahnella 99% Serratia 98% Needle No Cryo
PL_6 Point Lobos Burkholderia 98% Burkholderia 98% 100% OTU_17 Needle (Burkholderia) No Cryo
PL_8 Point Lobos Bacillus 99% Bacillus 99% Needle Cryo
PL_10 Point Lobos Paracoccus 99% Paracoccus 99% Needle Cryo
PL_12 Point Lobos Rhizobiales 91% Rhizobiales 93% Needle No Cryo
PL_13 Point Lobos Burkhoderia 95% Burkholderia 95%, Needle No Cryo
42
Isolate Location Greengenes NCBI 16S BLAST Local BLAST against Tissue BLAST community analysis Type OTUs (OTU ID) Treatment PL_15 Point Lobos Sphingomonas Sphingomonas Needle 96% 96% No Cryo
PL_17 Point Lobos Erwinia 98% Erwinia 98% 99% OTU_195 Needle (Enterobacteriaceae) No Cryo
CR_1 Cambria Erwinia 99% Erwinia 99% 99% OTU_2 Needle (Erwinia) No Cryo
CR_2 Cambria Erwinia 99% Erwinia 99% 100% OTU_2 Needle (Erwinia) No Cryo
CR_3 Cambria Rahnella 99% Ewingella 99%, 100% OTU_1 Needle (Serratia) No Cryo
CR_5 Cambria Rahnella 99% Ewingella 99% 100% OTU_1 Buds (Serratia) No Cryo
CR_6 Cambria Sodalis 98% Sodalis 98%, 99% OTU_139 Buds Biostraticola 98% (Sodalis) No Cryo
CR_7 Cambria Erwinia 100% Erwinia 99% 100% OTU_2 Needle (Erwinia) No Cryo
CR_8 Cambria Rahnella 99% Ewingella 99% 100% OTU_2 Needle (Erwinia) Cryo
CR_10 Cambria Erwinia 99% Erwinia 99% 100% OTU_2 Needle (Erwinia) Cryo
43
Isolate Location Greengenes NCBI 16S BLAST Local BLAST against Tissue BLAST community analysis Type OTUs (OTU ID) Treatment CR_11 Cambria Erwinia 99% Erwinia 98%, 100% OTU_195 Buds (Enterobacteriaceae) No Cryo
CR_15 Cambria Rahnella 99% Ewingella 99% 99% OTU_1 Buds (Serratia 100%) Cryo
CR_16 Cambria Rahnella 99% Ewingella 99% 100% OTU_1 Buds (Serratia) Cryo
CR_17 Cambria Erwinia 99% Erwinia 99% 100% OTU_2 Needle (Erwinia) No Cryo
CR_19 Cambria Erwinia 99% Erwinia 98%, 99% OTU_195 Buds (Enterobacteriaceae) No Cryo
CR_20 Cambria Rahnella 99% Ewingella 99% 100% OTU_1 Buds (Serratia) No Cryo
CR_23 Cambria Pseudomonas Pseudomonas 99% 100% OTU_11 Needle 99% (Pseudomonas) No Cryo
CR_26 Cambria Rahnella 99% Ewingella 99% 100% OTU_1 Needle (Serratia) No Cryo
44
3.9 Figures
Point Lobos Cambria
Swanton observed species
sequences per sample Chapter 3, Figure 1: Rarefaction curves of observed species and number of sequences per sample indicate the number of OTUs at 97% similarity at each location.
OTU # * * * Top 16S Genbank Hit %ID Isolate match to OTU >99% 1 92.6 66.7 60.2 60.8 64.4 64.7 9.7 9.8 1.1 6.5 14.1 27.8 87.6 92.6 60.4 78.0 2.6 13.7 53.7 Serratia sp. 100 SW9, SW10, CR3, CR5, CR15, CR16, CR20, CR26 2 1.6 5.1 14.4 10.7 14.5 16.2 29.2 56.4 20.3 82.7 16.2 40.5 2.6 2.8 32.0 15.4 0.6 3.0 22.5 Erwinia sp. 100 SW22, CR1, CR2, CR7, CR10, CR17 3 0.1 0.1 10.4 12.6 6.2 5.3 27.6 11.8 37.1 0.4 0.3 0.2 0.0 0.0 0.1 0.1 48.4 41.9 9.0 Enterobacteriaceae 100 no hits in isolates
143 0.1 0.1 9.0 11.7 5.7 4.2 25.5 10.1 33.5 0.2 0.3 0.1 0.0 0.1 0.1 0.1 44.2 36.0 7.6 Enterobacteriaceae 100 no hits in isolates
6 0.1 3.7 0.2 0.0 0.1 0.7 0.6 0.6 0.7 1.2 17.4 4.9 0.4 0.0 0.1 0.1 0.1 0.4 0.2 Oxalobacteraceae 98 no hits in isolates 5 0.2 4.8 0.9 0.3 0.4 0.4 0.9 1.2 0.5 0.1 16.0 0.1 0.3 0.3 0.9 1.0 0.5 0.5 0.5 Enterobacteriaceae 100 no hits in isolates 8 0.4 1.6 0.1 0.0 0.3 0.5 0.4 0.6 0.4 1.7 4.5 1.7 1.8 0.1 0.2 0.1 0.0 0.1 0.0 Pandoraea sp. 100 no hits in isolates 211 0.0 1.3 0.0 0.0 0.0 0.0 0.1 0.2 0.0 0.0 8.7 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Massilia sp. 99 no hits in isolates 68 0.2 0.9 0.1 0.1 0.1 0.1 0.3 0.2 0.3 0.5 4.3 0.5 0.3 0.1 0.2 0.2 0.2 0.1 0.2 Oxalobacteraceae 99 no hits in isolates 139 0.1 0.0 0.5 0.0 0.1 0.5 0.1 0.3 0.1 0.0 2.4 0.0 0.3 0.0 1.1 1.0 0.0 0.2 0.8 Sodalis sp. 100 CR6 Cambria Point Lobos Swanton
Chapter 3, Figure 2: Heatmap showing the relative abundance of sequences as percentages of all 16S rRNA gene sequences recovered in each of our 19 samples, along with the closest match in the Genbank 16S rRNA database, classified to the lowest possible taxonomic level, and matches above 99% to sequences from isolates recovered in this study, if any. Color tones range from light to dark blue to indicate the lowest to highest relative abundance values. Bud samples are marked with an asterisk; all other samples are from needles.
45
Sodalis endosymbiont P131-2
Serratia sp. M24T3
Rahnella sp. WMR58
p. Y2-2010
Rahnella aquatilis PTB2102 PL3 Serratia grimesii I21 CR6 PL5
t
Erwinia sp. EacM2.20 CR2 100 Erwinia s Rahnella sp. 153-Carrot SW9 CR17 100 SW10 CR7 1 CR1 CR10 SW22 100 CR11
CR8 CR19 SW17 CR3 PL17 CR26 99 SW7 CR20 sp. Ob 05 Erwinia 96 100 PS6-4B CR5 99 Erwinia pyrifoliae SGb80 CR15 Erwinia billingiae CR16 Erwinia billingiae Eb661
99 CR23
100 100 Pseudomonas Aquifex pyrophilus sp. ANA69 SW18 100 100 93 Brevibacillus choshinensisSW20 99 Pseudomonas lutea PL6 100 sp. RC5 100 T OK2 PL4 Bacillus SW11 100 Burkholderia andropogonis
100 Burkholderia sp. JSC-R3-522-9 PL8 100 100 Burkholderia
Bacillus simplex 100 PL13 ys6 100 Methylobacterium radiotolerans CCMM B590 SW19 PL12 sp. RK1025 LMG 2129 Rhizobiaceae bacterium SW23 PL10
sp. 210-27 Paracoccus yeei SW15 PL15
SW4 Bacillus megateriumBacillus Bacillus megaterium BCHMAC13
sp. MXG060602
sp. PAMC26567
ES-MS9c DX-T3-02
Bacillus mojavensis
PK2 Bacillus
Bacillus mycoides 0.07
Sphingomonas
Chapter 3, Figure 3: RAxML 1000 bootstraps, maximum likelihood tree including all isolate sequences and close matches in RDP and NCBI. The tree was rooted with the 16S rRNA gene from Aquifex pyrophilus.
4 Draft genome analysis of Monterey pine endophytes suggests that the aboveground endosphere is colonized by host-adapted bacteria and is a source of previously uncultured bacterial diversity.
4.1 Abstract
Endophytes have great potential for helping plants survive challenging environments. It is important to sequence the genomes of these bacteria in order to better understand this potential. The goal of this study was to sequence dominant community members of the bacterial endophyte community associated with Monterey pine to determine their relationship to the host and to sequence new endophyte species to clarify their identity and interactions with their host. The Monterey pine hosts for the endophyte isolates were apparently healthy in the midst of drought-stressed dying Monterey pine stands. Four isolates were chosen and sequenced using Illumina MiSeq Coverage of the genomes ranged from good (in the case of three genomes) and poor in the case of the fourth. Genome BLAST searches against a database of NCBI completed bacterial genomes revealed that isolate CR7 is most likely Erwinia spp. and that CR6 is a Sodalis sp. or represents a new genus in the family Enterobacteriaceae. Isolate PL12 likely represents a new family in the order Rhizobiales, and isolate SW10 that it was identified only to the family level as Enterobacteriales and is likely a new genus in the Enterobacteriaceae. Gene BLAST searches revealed that these genomes encode genes involved plant growth promotion, stress tolerance and drought resistance, suggesting that these isolates represent host- adapted, mutualistic endophytes. Their possible role in protecting Monterey pine against biotic and abiotic stress remains to be determined.
46 47
4.2 Introduction Bacterial endophytes are potentially important for helping their conifer hosts survive challenging environments (Carrel & Frank, 2014, Adonov, et a., 2012). Beneficial traits such as nitrogen fixation, growth promotion and drought tolerance are of special interest but without genomes to explore these traits, progress towards understanding how endophytes can help their hosts is limited (Land et al., 2015, Koskimäki et al. 2015, Frank, 2011, Pirttilä, 2011). Monterey pine (Pinus radiata) trees in California are enduring a drought and decrease in summer fog (McDonald, 1959, Fischer et al. 2008, Johnstone and Dawson, 2010). Bacterial endophyte isolates of these conifers could provide the ideal candidates for exploring the presence of drought tolerance and stress mitigation genes. Drought stress could also mean that opportunistic pathogens could be present in plant tissues (Atkinson & Urwin, 2012). Alternatively, many or most bacteria colonizing the tissues of conifers and other wild plants are transient visitors with little importance for host biology and ecology. Genome analyses will show if they are pathogens, potentially beneficial bacterial endophytes or just random transient species that happened to be present when the trees were sampled.
The goal of this project was to explore the potential beneficial properties of bacterial endophytes associated with Monterey pine. Although the trees these bacterial isolates were sampled from were under drought stress, they had abundant, green needles and were producing cones, so they are assumed to be healthy hosts. Two isolates were chosen for genome sequencing because they were exceptionally interesting. Isolate CR6 (Sodalis from buds) was present in low abundance in all Monterey pine samples, and is an usually found as an endosymbiont of insects (Frank, 2011, Dale & Maudlin, 1999). Isolate PL12 (from needles) was chosen for genome sequencing because chapter two revealed that PL12 was in the Alphaproteobacterial clade of the phylogenetic analysis (Chapter 2, Figure 3), but with no clear best BLAST hits to the genus or species level (Chapter 2, Table 2). 16s rRNA BLAST searches matched 93% to a variety of Rhizobiales genera (Chapter 2, Table 2). Illumina sequencing of the 16S rRNA gene from the same trees (Chapter 2 of this thesis) suggested that the two most abundant taxa in the Monterey pine samples belonged to the genera Serratia.and Erwinia. Isolate SW10 (from needles), a species in the Enterobacteraceae, matched the most common operational taxonomic unit (OTU) from the Illumina sequences at 100% identity.Isolate CR7 (from needles) an Erwinia species, was 100% identical to the second most common OTU in the illumina sequences. Because these two endophytes strains are likely to represent abundant bacteria inside Monterey pine needles, they were chosen for genome sequencing to help clarify their relationship to the host as potential mutualists,
48
pathogens, or commensal endophytes. Serratia spp. and Erwinia spp. can be beneficial endophytes that are associated with growth promotion but some species or strains can be pathogenic to plants (Taghavi et al., 2009, Peterson & Tisa, 2013, Zhang et al., 2005, Bell et al., 2004, Kube et al., 2010).
In order to determine if the isolates are most likely to represent host-adapted endophytes, opportunistic pathogens, or transient 'visitors', we searched for the presence of genes known to be involved in non-pathogenic interaction with the plant host, such as genes involved in growth promotion via nitrogen fixation or plant hormone production, drought and stress tolereance genes, and genes needed for colonization of plant tissues (attachement, motility, cell entry). Sequencing resulted in good coverage for isolates CR6 and CR7, acceptable coverage on isolate PL12 and poor coverage for isolate SW10. This result limits the clear identification of these isolates but gene BLAST searches yielded mostly genes that are involved in endophytic lifestyle.
4.3 Methods
4.3.1 DNA extraction Triple-replicate plates were prepared for each of the four isolates chosen for genome sequencing. Plates were incubated for 5 days and checked for colony purity then plates were scraped clean for triple-replicate extractions. Extraction tubes were incubated at 4°C for one hour to slow growth and DNA replication to ensure maximum length extracts. DNA was extracted following the Joint Genome Institute Bacterial DNA isolation CTAB-2012 protocol from their Protocols website (http://jgi.doe.gov/collaborate-with-jgi/pmo- overview/protocols-sample-preparation-information/). RNA was removed with a 30 minute incubation at 37°C with 5 uL DNAse free RNAse A (10 mg/uL) and an additional protein removal was completed with 24:1 molecular grade chloroform/isoamyl alcohol to remove residual RNA and debris. Genomic DNA was checked for an RNA band and shearing of DNA, quality DNA with no RNA was used for library prep.
4.3.2 DNA shearing DNA was diluted to12 ng/uL and sheared using a Covaris M220 focused- ultrasonicator on the standard 250 bp cycle (Peak Incident power: 50, Duty Factor: 20%, Cycles per burst: 200, Treatment Time: 120 seconds, Temperature: 20°C). 130uL of unsheared genomic DNA was inserted into the Covaris microTUBE AFA Fiber Snap-Cap tube and processed using 6 cycles of the 250bp protocol.
49
4.3.3 Size-select processing Sheared DNA was cleaned using a size-select protocol as described by the Joint Genome Institute standard operating procedure for Unamplified Library 270bp Construction (personal communication with Chris Daum) and re- suspension volume was decreased to 20 uL in order to maximize concentration of desired fragments.
4.3.4 Shearing quality control Sheared DNA was checked for fragment size and concentration with High Sensitivity BioAnalyzer chips and an Agilent BioAnalyzer. Sheared DNA between 200bp and 400bp was confirmed and samples were diluted to 8-10 ng/uL for library prep.
4.3.5 Library prep The KAPA Biosystems Hyper Prep Kit was used for library construction with adapters designated in the Illumina Customer Sequence letter and adapted per the specifications of KAPA adapter ordering (KAPA representative personal communication). The library preparation protocol includes a size- select protocol to remove fragments that fail adapter ligation.
Individual index sequences were:
Universal_P5 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT CTTCCGATC*T 3'
Index 1_P7_1: 5’/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCT CGTATGCCGTCTTCTGCTTG 3'
Index 2_P7_2 5’/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCT CGTATGCCGTCTTCTGCTTG 3'
Index 3_P7_3 5’/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCT CGTATGCCGTCTTCTGCTTG 3'
Index 4_P7_4 5’/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCT CGTATGCCGTCTTCTGCTTG 3'
50
Adapters were duplexed following the instructions provided by KAPA for ordering and duplexing. P5 was paired with each of the P7 indices for a total of four adapters, one for each isolate.
4.3.6 Library quality control Adapter ligation was confirmed using the High Sensitivity BioAnalyzer chips and an Agilent BioAnalyzer, samples between 320bp and 520bp and overall concentration was checked with a Eppendorf BioSpec before dilution for library pooling.
4.3.7 Library Pooling and Sequencing Libraries were pooled following specifications in the MiSeq bulletin, 10 pM concentration for each library was pooled in equal volumes and denatured following the protocols for 4 nM library concentration. Libraries were spiked with 1.5% PhiX as a control and prepared for loading into the MiSeq according to standard loading protocols for 10pM pooled libraries (MiSeq citation). The pooled library was sequenced using v2 MiSeq reagents (300 cycles) on a MiSeq (model number).
4.3.8 Sequence Processing and Assembly Sequences were separated by adapter barcode using Illumina BaseSpace and sequences for each isolate were processed using A5-miseq (Coil et al., 2014, Tritt et al., 2012). The A5-miseq pipeline automates adapter trimming, quality filtering, correction of errors, the construction of contigs and scaffolds and the detection of incorrect assemblies (Coil et al., 2014).
4.3.9 Genome BLAST searches Protein FASTA files from all completely sequenced bacterial genomes (2801) were downloaded from the NCBI ftp genomes directory (ftp.ncbi.nlm.nih.gov/genomes/Bacteria), and used to make a blast database. Blastx was then used to search translated query-protein sequences from assembly contigs against this database to identify the taxonomic belonging of the isolates using the entire genome, not just the 16S rRNA gene. The species identify of the best blast hit (E>e-10) to each scaffold was recorded, and the top ten species that constituted such species are shown in Table 2.
Protein sequences representing known endophyte genes were selected based on previous compilations by Hardoim et al., 2015, Mitter et al., 2013, and Frank, 2011, and were downloaded from GenBank and used as query sequences to a nucleotide database of each assembly using tblastn.
51
4.3.10 Ribsomal Database Project 16S rRNA comparison to isolates and uncultured bacteria
The Ribosomal Database Project (RDP) (Cole et al, 2005) was used to compare isolate sequences to 16S database sequences of both isolates and uncultured bacteria. 16S sequences were aligned using the Infernal alignment algorithm (Nawrocki et al. 2009). Individual maximum likelihood phylogenetic tree with 1000 bootstrap replicates were inferred using RAxML for each isolate (Figures 1-4) (Stamatakis, 2006).
4.4 Results
4.4.1 Genome assembly statistics Sequencing yielded 281,842 reads for CR7, 150,810 reads for CR6, 86,280 reads for PL12, and 41,982 reads for SW10 (Chapter 4, Table 1). Assembly yielded 4,341 contigs for CR7, 4,153 contigs for CR6, 1,299 contigs for PL12 and 293 contigs for SW10. Scaffolds were assembled from contigs for CR7 (4,194), CR6 (4,102) and PL12 (1,293).
4.4.2 Identity of the isolates For isolate CR7, 86% of the top hits from the genome to complete genomes BLAST search were to Erwinia (Chapter 4, Table 2). The 16S tree supports this result (Chapter 4, Figure 1).
Isolate CR6 had 20% top BLAST hits to Sodalis glossinidus, and many best hits to other species and genera in the family Enterobacteraceae (Chapter 4, Table 2). While the 16S tree agrees with this result, there are closer matches to uncultured Enterobacteraceae than to Sodalis isolates (Chapter 4, Figure 2).
6% of isolate genome to complete genomes BLAST search hits for PL12 matched the unclassified Alphaproteobacterium, Polymorphum gilvum (Chapter 4, Table 2) and many hits to different families in the Rhizobiales. The 16S tree supports the association with Rhizobiales but the closest matches were to uncultured bacteria (Chapter 4, Figure 3).
SW10 (the low coverage genome), had 57% BLAST hits to species belonging to the order Enterobacteriales, and in addition to hits Pseudomonadales (Chapter 4, Table 2). The 16S tree puts SW10 as matching most closely to Rahnella spp. which agrees with the isolate data but not the genome (Chapter 4, Figure 4).
52
4.4.3 Presence of known endophyte genes
4.4.3.1 Motility and colonization Type IV Pili are needed for twitching motility, and is important e.g. for the colonization of rice by the endophyte Azoarcus sp. BH72 (Bohm et al., 2007). Homologs of Type four pili genes were found in CR 7, and PL12 (Chapter 4, Table 3).
Flagella and chemotaxis are used for endophyte motility (Frank, 2011), genes homologous to genes for flagella were found in CR6 and CR7 and homologs of genes for chemotaxis were found in CR6, CR7 and SW10 (Chapter 4, Table 3).
Hemagglutinins are found in endophytes and pathogens and seem to be important for colonization Taghavi et al., 2010) and are found in isolate CR6 and CR7(Chapter 4, Table 3).
Cellulases are enzymes that cut through plant cell walls and can be considered important for colonization of plant tissues (Reinhold-Hurek et al., 2006). Homologs of genes for cellulase biosynthesis were found in CR6, CR7 and PL12(Chapter 4, Table 3).
Celluloses are used by endophytes for attachment to plant cells (Frank, 2011). Homologs of genes for cellulose biosynthesis were found in CR6, CR7 and SW10(Chapter 4, Table 3).
4.4.3.2 Secretion systems Secretion systems are used by endophytes to translocate proteins and/or DNA in their host plants (Sankvist, 2001, Preston et al., 2001). Generally considered to be 'virulence factors', Type III secretion systems are used by both pathogens and symbionts to interact with eukaryote hosts. For example a type III secretion system is used in the establishment of symbiosis between Sodalis glossinidius and its tsetse fly host (Dale et al., 2002). Type IV secretion systems have been found in several endophyte genomes and is important in bacterium-host interactions such as protein or DNA delivery to eukaryotic cells (Alvarez-Martinez & Christie, 2009, Frank 2011). CR6 and CR7 were found to encode putative genes for type III and type IV secretion systems (Chapter 4, Table 3).
53
4.4.3.3 Quorum sensing Quorum sensing is important for organization of cooperative behaviors in bacteria (Camilli & Bassler, 2006). The autinducer synthetase LuxI and the autoinducer receptor LuxR have been found in endophytes genomes (Frank, 2011). CR6 and CR7 have homologs of Lux R and Lux I and PL12 has LuxR.
4.4.3.4 Growth Promotion Biological nitrogen fixation by bacteria may be an important source of nitrogen for plants (Chelius & Triplett, 2001). Many endophytes have been found to encode the genes required for nitrogen fixation, e.g. (Doty et al., 2009) however, there were no nitrogen fixation genes present in these isolate genomes (Chapter 4, Table 3).
Indole-3-acetic acid (IAA) is a naturally occurring form of the plant growth hormone auxin. Bacterial endophytes could use IAA production to colonize plant tissues more efficiently (Suzuki et al., 2003) or to avoid the host immune defenses (Spaepen et al., 2007). Homologs of genes for IAA production pathways were found in CR6, CR7 and PL12 (Chapter 4, Table 3).
Gibberellin is a plant hormone important for both growth and development of plants (Hedden, 1997), which may also be involved in helping plants survive drought stress (Cohen, et al., 2009). Homologs of genes for gibberellin production were found in CR6 and CR7 (Chapter 4, Table 3).
Some bacterial endohytes can make 1-aminocyclopropane-1-carboxylate (ACC-deaminase), which can be used to cut the precursor to ethylene, a plant-produced stress hormone (Glick, et al., 1998). ACC-deaminase production could be used by endophytes to keep plant stress levels below what would impact growth rates (Hardoim et al., 2008). Genes for ACC- deaminase pathways were found in CR6 and CR7(Chapter 4, Table 3).
Bacterial volatiles have many purposes in endophytic lifestyle including growth promotion, drought resistance and helping the plant activate its natural defense responses (Frank, 2011). Homologs of genes for bacterial volitiles were found in CR6 (budB, budC, poxB), CR7 (budA, budB, budC and poxB) and PL12 (budC).
4.4.3.5 Drought Tolerance and Stress tolerance Trehalose is a disaccharide with the tendency for high water retention, useful in plants to survive long periods without water (Ali & Ashraf, 2011, Garg et al., 2002,). Polyamines are natural compounds that are similar to phytohormones
54
that increase plants tolerance to stressful conditions such as drought (Perrig et al., 2007). Genes for trehalose production and the genes for the polyamine GABA permease were found in CR6 and CR7 (Chapter 4, Table 3).
4.5 Discussion The goals of this project were to clarify the relationship of bacteria isolate in chapter 2 to their Monterey pine host and to determine the identity of these isolates as closely as possible. Identifying the isolate CR6 – which seemed to be closely related to Sodalis was especially important because of its prior associations only with insects and its low identity to previously sequenced Sodalis spp. Genome sequencing results showed that CR6 only has a 20% identity with proteins from Sodalis glossinidus, and many best hits to other species and genera in the family Enterobacteraceae, leading to the conclusion, that either this is a new Sodalis spp. or we need more coverage to be able to tell what species it belongs to. The genome had many endophyte-associated genes for growth promotion, bacterial volatiles, and quorum sensing. In fact, CR6 has all except two of the endophyte genes BLAST searched for in the isolate genome (Chapter 4, Table 3).
Isolate PL12 was also especially interesting because of its low 16S rRNA matches to cultured isolates and its potential for being a new family in the order Rhizobiales, The order Rhizobiales of alpha-Proteobacteria includes bacteria diverse in their function and ability to occupy niches and known for their beneficial partnerships with plants (Carvalho et al., 2010, Erlacher, 2015, Ivanova et al., 2000; Delmotte et al., 2009). Isolate PL12 does not match other sequenced genomes at the family, genus or species level and while more definite identification will have to wait until a complete draft genome is sequenced, this discovery through isolate culture is exceptional due to the storied difficulties with culturing bacterial endophytes (Reinhold-Hurek &Hurek, 2011, Bressan et al., 2009, Ikeda et al., 2010, Hurek et al., 2002). PL12 has some genes related with the endophytic lifestyle such as Indole-3-acetic acid production genes and bacterial volatiles however more genome sequencing coverage is needed before definitive identification of species and lifestyle of this isolate can be determined. Another option is that this is an isolate never- before cultured, and this is why BLAST searches to the NCBI database of isolates resulted in low identity sequence matches.
Isolates SW10 and CR7 were interesting because of their close relationships to endophytic species as well as potentially pathogenic bacterial speices. Understanding if they are indeed beneficial bacterial endophytes, they should posess genes that would help their host survive a challenging environment. Conversely, if they are opportunistic pathogens, their whole genome BLAST
55
analysis should yield closely related pathogenic species matches. SW10 had unfortunately low sequence coverage making clear identification of this isolate impossible, however it does contain some genes important for colonization of a host such as hemagglutinins (Chapter 4, Table 3). Isolate CR7, (likely Erwinia spp.) had 86% best BLAST hits to Erwinia billingiae, a common plant associated bacterium known to feed on dead plant tissue (Kube et al., 2010) and known to be secondary invaders in plant infections (Billing & Baker, 1963, Mergaert et al., 1999). CR7 also had hits to Enterobacteriaceae from a variety of genera and species (Table 2). CR7 had many genes associated with the endophytic lifestyle (Table 3) however, some of these genes such as growth promotion and colonization could be used by a pathogen to increase their habitat and colonize more of that habitat (Kube et al., 2010, Zhang et al., 2005). Further sequencing should be done to explore genes related to pathogenicity and comparitive analysis should be done to determine how similar CR7 is to other Erwinia spp. both endophytic and pathogenic.
4.6 Concluding Remarks As seen in the results, gene BLAST searches revealed that the genomes encode genes involved plant growth promotion, stress tolerance and drought resistance, suggesting that these isolates represent host-adapted, possibly mutualistic endophytes and not opportunistic pathogens except in the case of CR7. Their possible role in protecting Monterey pine against biotic and abiotic stress remains to be determined. More genome coverage is needed to complete the draft genomes and allow the definitive identification of these isolates and their interactions with their host.
4.7 References
Ali, Q., Ashraf, M., 2011. Induction of Drought Tolerance in Maize (Zea mays L.) due to exogenous application of trehalose: growth, photosynthesis, water relations and oxidative defense mechanism. Journal of Agronomy and Crop Science 197(4), 258–271.
Ardanov, P., Sessitsch, A., Häggman, H., Kozyroska, N., Pirttilä, A.M., 2012. Methylobacterium-induced endophyte community changes correspond with protection of plants against pathogen sttack. PLOS ONE 10(7)e468021-8.
Atkinson, N.J., and Urwin, P.E., 2012. The interaction of plant biotic and abiotic stresses: from genes to the field. J. Exp. Bot doi:10.1093/jxb/ers100 p1-21.
56
Bell, K.S., Sebaihia, M., Pritchard, L., Holden, M.T., Hyman, L.J., Holeva, M.C., Thomson, N.R., Bentley, S.D., Churcher, L.J., Mungall, K., Atkin, R., Bason, N., Brooks, K., Chillingworth, T., Clark, K., Doggett, J., Fraser, A., Hance, Z., Hauser, H., Jagels, K., Moule, S., Norbertczak, H., Ormond, D., Price, C., Quail, M.A., Sanders, M., Walker, D., Whitehead, S., Salmond, G.P., Birch, P.R., Parkhill, J., Toth, I.K., 2004. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc Natl Acad Sci 101(30), 11105–11110.
Billing, E. & Baker, L. A. E., 1963. Characteristics of Erwinia-like organisms found in plant material. J Appl Bacteriol. 26, 59-65.
Bressan, M., Roncato, M.A., Bellvert, F., Comte, G., Haichar, F.Z., Achouak, W., Berge, O., 2009. Exogenous glucosinolate produced by Arabidopsis thaliana has an impact on microbes in the rhizosphere and plant roots. ISME J. 3,1243–1257
Carrell, A.A., Frank, A.C., 2014. Pinus flexilis and Piceae engelmannii share a simple and consistent needle endophyte microbiota with a potential role in nitrogen fixation. Front Microbiol, Front Microbiol. 5(333) doi:10.3389/fmicb.2014.00333.
Carvalho, F.M., Souza, R.C., Barcellos, F.G., Hungria, M., Vasconcelos, A.T.R., 2010. Genomic and evolutionary comparisons of diazotrophic and pathogenic bacteria of the order Rhizobiales. BMC Microbiol. 37(10), 2-15.
Chelius, M.K., Triplett, E.W., 2001. The Diversity of Archaea and Bacteria in Association with the Roots of Zea mays L. Microbial Ecology, 41(3), 252-263.
Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res., 33, 294–296.
Erlacher, A., Cernava, T., Cardinale, M., Soh, J., Sensen, C.W., Grube, M., Berg, G., 2015. Rhizobiales as functional and endosymbiontic members in the lichen symbiosis of Lobaria pulmonaria L. Front in Microbiol. 6(53), 1-9.
57
Fischer, D.T., Still, C.J., Williams, A.P., 2008. Significance of summer fog and overcast for drought stress and ecological functioning of coastal California endemic plant species. J. Biogeogr epub doi:10.1111/j.1365- 2699.2008.02025.x
Frank, A.C., 2011. In: Pirttilä, AM, Frank, AC (Eds.), Endophytes For. Trees Biol. Appl., vol. 80, Springer Verlag Berlin, Heidelberg, pp. 139–149.
Garg, A.K., Kim, J-K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V., Wu, R.J., 2002. Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. PNAS 99(25), 15898– 15903.
Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compant, S., Campisano, A., Döring, M., and Sessitsch, A., 2015. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol. Mol. Biol. Rev. 79(3),293-320.
Hurek, T., Handley, L., Reinhold-Hurek, B., Piché, Y., 2002. Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Mol Plant–Microbe Interact, 15, 233–242
Ikeda, S., Okubo, T., Anda, M., Nakashita, H., Yasuda, M., Sato, S., Kaneko, T., Tabata, S., Eda, S., Momiyama, A., 2010. Community- and genome-based views of plant-associated bacteria: plant–bacterial interactions in soybean and rice. Plant Cell Physiol, 51,1398–1410.
Ilhan, S., Ozdemir, F., Bor, M., 2014. Contribution of trehalose biosynthetic pathway to drought stress tolerance of Capparis ovata. Desf. Plant Biology 17,402–407.
Johnstone, J.A., Dawson, T.E., 2010. Climatic context and ecological implications of summer fog decline in the coast redwood region. PNAS 107(10), 4533-4538.
Koskimäki, JJ, Pirttilä, AM, Ihantola, AM, Halonen, O and Frank, AC. The intracellular Scots pine shoot symbiont Methylobacterium extorquens DSM13060 aggregates around the host nucleus and encodes eukaryote-like proteins. MBio, Mar 24;6(2). pii: e00039-15. doi: 10.1128/mBio.00039-15).
58
Kube, M., Migdoll, A.M., Gehring, I., Heitmann, K., Mayer, Y., Kuhl, H., Knaust, F., Geider, K., Reinhardt, R., 2010. Genome comparison of the epiphytic bacteria Erwinia billingiae and E. tasmaniensis with the pear pathogen E. pyrifoliae. BMC Genomics.11, 393-408.
Land, M., Hauser, L., Jun, S., Nookaew, I., Leuze, M.R., Ahn, T., Karpinets, T., Lund, O., Kora, G., Wassenaar, T., Poudel, A., Ussery, D.W., 2015. Insights from 20 years of bacterial genome sequencing. Funct Integr Genomics 15:141–161.
Mergaert, J., Hauben, L., Cnockaert, M.C., Swings, J., 1999. Reclassification of non-pigmented Erwinia herbicola strains from trees as Erwinia billingiae sp. nov. International Journal of Systematic Bacteriolog. 49, 377-383.
Mitter, B., Petric, A., Shin, M.W>, Chain, P.S.G., Hauberg-Lotte, L., Reinhold- Hurek, B., Nowak, J., Sessittsch, A., 2013. Comparative genome analysis of Burkholderia phytofirmans PsJN reveals a wide spectrum of endophytic lifestyles based on interaction strategies with host plants. Front. Plant Sci. 4, 1-15.
Nawrocki, E.P., Kolbe, D.L., Eddy, S.R., 2009. Infernal 1.0: inference of RNA alignments. Bioinformatics, 25, 1335–1337.
Peterson, L.M., Tisa, L.S., 2013. Friend or foe? A review of the mechanisms that drive Serratia towards diverse lifestyles. Can J Microbiol. 59(9):627-40
Pirttilä, A.M., 2011. In: Pirttilä, AM, Frank, AC (Eds.), Endophytes For. Trees Biol. Appl., vol. 80, Springer Verlag Berlin, Heidelberg, pp. 139–149.
Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Current Opinion in Plant Biology. 14(4), 435–443.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690.
Taghavi, S., Garafola, C., Monchy, S., Newman, L., Hoffman, A., Weyens, N., Barac, T., Vangronsveld, J., van der Leilie, D., 2009. Genome survey and characterization of endophytic bacteria exhibiting a beneficial effect on growth and development of poplar trees. Appl. Environ. Microbiol. 75(3),748-757.
59
Tritt, A., Eisen, J.A., Facciotti, M.T., Darling, A.E., 2012. An Integrated Pipeline for de Novo Assembly of Microbial Genomes. PLoS ONE 7(9): e42304. doi:10.1371/journal.pone.0042304.
Zhang, Q., Melcher, U., Zhou, L., Najar, F.Z., Roe, B.A., Fletcher, J., 2005. Genomic comparison of plant pathogenic and nonpathogenic Serratia marcescens strains by suppressive subtractive hybridization. APPL. ENVIRON. MICROBIOL. 71(12), 7716-7723.
60
4.8 Tables Chapter 4, Table 1: Sequence data and assembly information for each isolate.
CR_7 CR_6 PL_12 SW_10 reads 281,842 150,810 86,280 41,982 contigs 4,341 4,153 1,299 293 scaffolds 4,194 4,102 1,293 N/A longest scaffold 16,448 bp 6,467 bp 5,535 bp N/A
61
Chapter 4, Table 2: Top BLAST hits from which the best blast hit for each belonged, based on a database of proteins from 2801 completely sequenced genomes. CR_7 CR_6 PL_12 SW_10 16S Erwinia spp. 99% Sodalis 98%, Rhizobiales 93%, Serratia 99% BLAST Top OTU_2 (Erwinia OTU_139 (Sodalis 92% OTU_88 OTU_1 (Serratia OTUs spp. 100%) sp. 99%) (Methylobacterium) 100%) Genome 3758 hits Erwinia 889 hits Sodalis 96 hits 470 hits BLAST billingiae glossinidius Polymorphum Escherichia coli gilvum 93 hits Yersinia 241 hits Rahnella 49 hits 250 hits pseudotuberculosis aquatilis Sinorhizobium Rahnella meliloti aquatilis 39 hits Salmonella 225 hits Serratia 45 hits 248 hits enterica marcescens Sinorhizobium fredii Salmonella enterica 36 hits Pantoea 176 hits Serratia 43 hits Starkeya 74 hits Yersinia ananatis plymuthica novella pestis 32 hits Pantoea sp. 144 hits Erwinia 43 hits 74 hits Klebsiella billingiae Azorhizobium pneumoniae caulinodans 25 hits Yersinia 130 hits Dickeya 35 hits 55 hits enterocolitica dadantii Ochrobactrum Enterobacter anthropi cloacae 23 hits Pantoea 120 hits Yersinia 34 hits Rhizobium 49 hits vagans pseudotuberculosis leguminosarum Pseudomonas putida 21 hits Escherichia 113 hits Yersinia 33 hits 32 hits coli enterocolitica Rhodopseudomonas Pseudomonas palustris aeruginosa 20 hits Rahnella 110 hits 33 hits 29 hits Yersinia aquatilis Pectobacterium Chelativorans sp. pseudotuberculo carotovorum sis 102 hits Serratia 32 hits 29 hits Serratia sp. Bradyrhizobium sp. plymuthica 94 hits Pantoea sp. 28 hits 28 hits Mesorhizobium Cronobacter opportunistum sakazakii 82 hits Pantoea 27 hits 26 hits Serratia vagans Mesorhizobium loti sp. 68 hits Salmonella 25 hits 23 hits Dickeya enterica Methylobacterium dadantii radiotolerans 65 hits Pantoea 25 hits 22 hits Rahnella ananatis Mesorhizobium sp. ciceri
62
CR_7 CR_6 PL_12 SW_10 Genome 64 hits Serratia 24 hits Xanthobacter 21 hits BLAST proteamaculans autotrophicus Pseudomonas fluorescens 62 hits 24 hits Pseudovibrio 21 hits Pectobacterium sp. Acinetobacter wasabiae baumannii 62 hits 24 hits 20 hits Shigella Enterobacter Methylobacterium flexneri cloacae nodulans 60 hits Serratia 23 hits 20 hits liquefaciens Methylobacterium Haemophilus extorquens influenzae 60 hits 22 hits Enterobacter sp. Methylobacterium sp. 55 hits 22 hits Azospirillum Pectobacterium brasilense atrosepticum 55 hits Escherichia 21 hits coli Pelagibacterium halotolerans Total 4382 4552 1647 2339 best hits to genomes
63
Chapter 4, Table 3: Endophytic gene presence or absence. Specific genes involved in an endophytic lifestyle were assembled and BLAST searched in the assembled isolate genomes. Presence is indicated by a check mark and absence is indicated with an X.
CR_7 CR_6 PL_12 SW_10_ Erwinia Sodalis new Enterobacteriales
ACC ✓ ✓ X X
Cellulase ✓ ✓ ✓ X
Celluloses ✓ ✓ X ✓
Chemotaxis ✓ ✓ X ✓
Flagella ✓ ✓ X X
Gibberellin ✓ ✓ X X
Hemagglutinins ✓ ✓ X ✓
IAA ✓ ✓ ✓ X
nif X X X X
Polyamines ✓ ✓ X X Quorum ✓ ✓ ✓ X sensing Trehalose ✓ ✓ X X Type III secretion ✓ ✓ X X systems Type IV pili ✓ X ✓ X Type IV secretion ✓ ✓ X X systems Volatiles ✓ ✓ ✓ X
64
4.9 Figures
Erwinia billingiae DTB1-2B uncultured deep sea bacterium Ucd15625 uncultured deep sea bacterium Ucm15592 uncultured deep sea bacterium Ucb15552 uncultured deep sea bacterium Ucb15551 uncultured deep sea bacterium Ucm1555 uncultured deep sea bacterium UncDee25 uncultured deep sea bacterium Ucm1555-3 uncultured deep sea bacterium Ucm1555-1 uncultured deep sea bacterium UncDee45 uncultured deep sea bacterium Ucm1555-2-3 uncultured deep sea bacterium UunDeep
uncultured deep sea bacterium Ucp15622 uncultured deep sea bacterium UunDeep1 uncultured deep sea bacterium Ucd1552 uncultured deep sea bacterium Ucn1540 uncultured deep sea bacterium UncDee22 uncultured deep sea bacterium Ucm1555-2 1 uncultured deep sea bacterium Ulrdd 20 uncultured deep sea bacterium Ulrdd-6 Erwinia billingiae Eb661 Erwinia billingiae Erwinia billingiae LJ13 Erwinia billingiae CIP-106121 Erwinia billingiae 2B2 uncultured Erwinia sp. T-Pd17 Erwinia sp. CO24Nov Erwinia billingiae SGb80 Erwinia billingiae SGb83 Erwinia sp. CYEB-17 Isolate CR7 91 Erwinia sp. Y2-2010 Erwinia sp. EacM2-20 Erwinia sp. CYEB-5 97 Erwinia sp. CYEB-27
0.04
Chapter 4, Figure 1: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate CR7 and close hits in RDP to isolate and uncultured sampes were used to build the tree.
65
Sodalis endosymbiont of Aelia fieberi uncultured bacterium Sodalis endosymbiont of Picromerus lewisi Enterobacteriaceae bacterium HS Sodalis endosymbiont of Dolycoris baccarum Sodalis like secondary symbiont of Antestiopsis thunbergii NRF1 Sodalis endosymbiont of Lelia decempunctata Sodalis endosymbiont of Palomena angulosa Sodalis endosymbiont of Glaucias subpunctatus uncultured bacterium NK-2010-sd-01 uncultured bacterium nk-2010-akg10 Sodalis secondary endosymbiont of Archarius roelofsi P9-6s.s bacterium secondary symbiont of Coelostomidia jenniferae CJ148 9 5 bacterium secondary symbiont of Coelostomidia jenniferae CJ187 bacterium secondary symbiont of Coelostomidia pilosa CP307 bacterium secondary symbiont of Coelostomidia pilosa CP228 bacterium secondary symbiont of Coelostomidia pilosa CP318 bacterium secondary symbiont of Coelostomidia pilosa CP332 bacterium secondary symbiont of Coelostomidia pilos CP262 Sodalis secondary endosymbiont of Curculio hachijoensis P131-4 Sodalis endosymbiont of Curculio hachijoensis P131-2 Sodalis endosymbiont of Curculio hachijoensis P131-7 bacterium endosymbiont of Puto barberi PU2 100 uncultured bacterium PG47 uncultured bacterium kaiwa2013-kunu4 uncultured bacterium kaiwa2013-kunu5 uncultured bacterium kaiwa2013 kunu9 uncultured bacterium kaiwa2013 kunu12 uncultured bacterium kaiwa2013-kunu11 uncultured bacterium kaiwa2013-kunu6 uncultured bacterium kaiwa2013-kunu1 uncultured bacterium kaiwa2013-kunu8 uncultured bacterium kaiwa2013-kunu10 uncultured bacterium kaiwa2013-kunu2 uncultured bacterium kaiwa2013-kunu3 uncultured bacterium kaiwa2013-kunu7 Isolate CR6 100 uncultured bacterium SedUMB52 100 uncultured bacterium SedUMB20 uncultured bacterium kaiwa2013-kunu14 uncultured bacterium kaiwa2013-kunu13
0.05
Chapter 4, Figure 2: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate CR6 and close hits in RDP to isolate and uncultured sampes were used to build the tree.
66
Afifella marina PSB-01 Afifella marina PSB-02 100 Afifella marina DBNRh20 Afifella pfennigii AR-2102 9 8 Afifella pfennigii DSM17143 Methylocystis sp. M212 100 Methylosinus trichosporium IMV3011 Thermovum composti Nis3 Mesorhizobium sp. WSM2622 9 9 Mesorhizobium sp. WSM3310 Rhizobiaceae bacterium_PK2 sediment bacterium 23-01 Rhizobium leguminosarum CNPSO672 Rhizobium sp. CNPSo676 Rhizobium sp. CNPSo668 Rhizobium leguminosarum CNPSO659 Rhizobium sp. CNPSo670 Rhizobium etli CNPSO661 100 Rhizobium leguminosarum CNPSO683 Rhizobium sp. CNPSo669 uncultured_bacterium_AN1C2AC09 uncultured_bacterium_Field_210 uncultured_alpha_proteobacterium_MBMV6 uncultured_bacterium_CT0C1AB04 uncultured_bacterium_1112842459846 uncultured_bacterium_YB_36 100 uncultured_bacterium_TG_38 uncultured_bacterium_HF514 uncultured_bacterium_JSC7_93 uncultured_bacterium_TX2_4K13 uncultured_bacterium_lp35 uncultured_bacterium_TX1A_35 uncultured_bacterium_YJ_102 uncultured_bacterium_YL_39 uncultured_bacterium_TX2_4K23 uncultured_bacterium_ncd1693b06c1 100 uncultured_bacterium_0502TCLN018 uncultured_bacterium_0502TCLN020 uncultured_bacterium_TX2_4K23 uncultured_bacterium_TX1A_35 Isolate PL12
0.3
Chapter 4, Figure 3: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate PL12 and close hits in RDP to isolate and uncultured sampes were used to build the tree.
67
uncultured Rahnella sp. DRL-F6 uncultured Rahnella sp. DR-12A uncultured Rahnella sp. DRL-D6 uncultured bacterium spb27a2 uncultured Rahnella sp. DR-E12 uncultured bacterium spb28c9 uncultured bacterium spb28c12 uncultured Rahnella sp. DR-A3 100 uncultured Rahnella sp. DRL-B3 uncultured Rahnella sp. DR-2A uncultured bacterium nbw501c10c1 uncultured bacterium ncd268e05c1 Rahnella sp. EacLOBA-47 Rahnella sp. 153-Carrot Rahnella sp. 336-Pear Rahnella sp. 39-Strawberry
1 Rahnella genomosp.2 SOT-2-10 uncultured bacterium nbw502h05c1 uncultured Rahnella sp. R707 Rahnella sp. 371-Carrot Rahnella sp. 59-Radish uncultured Rahnella sp. 1-11 Rahnella sp. 17-Carrott Rahnella sp. 305-Carrot uncultured bacterium nbw504d03c1 Rahnella genomosp. 1.CIP-105588 Rahnella sp. CDC-Italy-2383 Rahnella sp. CDC1-576 Rahnella sp. WMR15 Rahnella sp. WMR58 Rahnella sp. 91-Salad Rahnella sp. 285-Celery Rahnella sp. 142-Salad uncultured Rahnella sp. VE45H12
9 9uncultured bacterium uncultured Rahnella sp. CHINA13 Isolate SW10 Rahnella sp. 381-Salad Rahnella sp. “woolbedingensis” FRB-227 Rahnella sp. “woolbedingensis” WAL-10 uncultured compost bacterium FS388
0.05
Chapter 4, Figure 4: 1000 bootstrap, maximum liklihood phylogenetic tree inferred with RAxML. Aquifex pyrophilus 16S ribosomal RNA gene sequence was used as the outgroup to root the tree. Isolate SW10 and close hits in RDP to isolate and uncultured sampes were used to build the tree.
5 Culture methods to maximize the recovery of bacterial endophytes isolated from the needles of Adult pines.
5.1 Abstract
Culturing bacterial endophytes is important to moving our understanding of these potentially beneficial microbes forward. Without isolate cultures we cannot do inoculation experiments to test the effect of bacterial endophytes on their hosts in single inoculations or in defined combinations or consortia. Isolate cultures are also needed for traditional genome sequencing. Culturing conifer endophytes is difficult partially because the microbes could be living intracellular or could be intercellular in plant tissue that has abundant natural antimicrobials. Buffering against these antimicrobials and breaking the plant cells open without damaging the bacterial endophytes living inside the conifer tissue may be important. The goal of this study was to include variations in tissue preparation, media preparation and media types, to determine the best culture methods to maximize the recovery of bacterial endophytes from conifer needle tissue. Liquid nitrogen preparation with or without cryopreservation with dimethylsulfoxide seems to be the best tissue preparation method. R2A media supplemented with three sugars (glucose, sucrose, and dextrose) and buffered with 10% Tris-buffer seems to be the best culture media for culturing conifer needle endophytes.
68 69
5.2 Introduction
Bacterial endophyte isolates are useful for a variety of purposes including genome sequencing to understand the relationship with the host and potential genes that code for beneficial properties and inoculation experiments to test the activity of these beneficial properties (Ryan et al., 2007). Bacterial endophytes have been cultured from a variety of agricultural plants, deciduous trees and attempted from a few conifer species (Lodewyckx et al., 2002, Ryan et al., 2007, Reinhold-Hurek & Hurek, 2011 Izumi et al., 2008, Hardoim et al., 2015, Pirttilä et al., 2004). Culturing experiments with agricultural plants and deciduous trees have yielded a range isolates from few to many genera, but when I used these established methods to culture needle endopytes, I was only able to isolate few if any bacterial colonies. This result agrees with the findings of Izumi et al. (2008) where only three endophyte isolates from adult Scots pine roots were grown and no culturable isolates from adult Scots pine needles or stem tissue were grown.
Many culturing protocols utilize green tissue preparation (Ulrich, et al 2008, Izumi et al., 2008, Lodewyckx et al., 2002). This preparation method is ideal for macerating delicate leaves from agricultural plants (Lodewyckx et al., 2002) however, pine needles have a waxy exterior cuticle and fibrous interior tissue. Lack of clear culturing protocols adapted to dealing with phenolics in pine tissue and the location of endophytes in the woody tissue of the pine needle are challenges that must be overcome to successfully isolate needle endophytes. The goal of this study is improve culturing techniques to isolate bacteria from needles of adult conifers including tissue preparation improvements and culture media improvements.
Green tissue prep supplemented with the addition of PVP to bind to phenolics and Tris-buffer to prevent the oxidation of phenolics was adapted from tissue prep protocols and DNA and protein extraction protocols for plant material (Sahu et al., 2012, Ostrowska et al, 1998, Fido et al., 2004cd, Pierpoint, 2005). Green prep with 10% Tris-buffer was used to see if PVP had an effect in this new application. Green prep with phosphate buffered saline (PBS) was used for comparison. Liquid nitrogen freezing followed by sterile pulverization was used because it is quick which limits the possibility of sample contamination and can break the plant cells into tiny pieces, which could free the bacteria to access the culture media. Cryopreservation before liquid nitrogen freezing and pulverization was also used for comparison. Cryopreservation with 10% dimethylsulfoxide is used to displace water and limit the formation of ice crystals which could pierce and destroy bacterial cells (Hubálek, 2003, Latutrie & Aronen, 2013).
70
Ammonium mineral salts agar (AMS salts) with 0.5% methanol was 0used because of it is a minimal media selective for methylotrophs, which are commonly associated with plants (Atlas, 2005). Trypticase soy agar (TSA) was used as the general-purpose culturing media (Izumi et al., 2008). Reasoner’s 2A or R2A media was used as it is a good minimal media for culturing plant-associated bacteria (Ulrich et al., 2008). Since needle endophyte culture trials using regular R2A media had failed in the past, I adapted this media in two ways. R2A with the addition of 0.5g of three carbon sources (glucose, sugrose and dextrose) to offer more carbon sources to promote endophyte growth and 10% Tris-buffer to control against phenolics, is called R2A3C. Mimicking the interior of pine needle tissue could help bacterial colonies be more “at home” so I added 10% of the volume of Tris- buffered pine needle slurry (to buffer against phenolics) to R2A3C agar before autoclaving and called this media PNPB agar.
5.3 Methods
Pinus radiata adult needles were collected from the Swanton Pacific Ranch, in Año Nuevo, CA. Needles were sterilized using 90 second soak in 30% hydrogen peroxide followed by 10 – 250 mL water rinses to remove as much residual hydrogen peroxide as possible. Samples were then divided into 5 pools to test the effect of tissue preparation on endophyte recovery. The five preparation methods tested were: green tissue prep with 10% Tris-buffer and 5g PVP to absorb phenolics (Ostrowska et al., 2008), green prep with 10% Tris-buffer, green prep with 10% PBS buffer, liquid nitrogen prep and 10% dimethylsulfoxide cryopreservation for 1 hour before liquid nitrogen preparation. I tested four media types for their efficacy in promoting endophyte recovery including two media types I adapted from old methods. R2A3C (R2A agar with 0.5 grams per liter glucose, sucrose and dextrose, and 10% Tris buffer) and PNPB (R2A3C + 10% volume blended needle tissue with sterile 10% Tris-buffer). Standard TSA media and AMS salts + 5% Methanol media was used for comparison to the experimental media types. Large agar plates were made with 2% agar and each of the media types listed.
One gram plant tissue per milliliter of standard R2A broth, was used as the starting liquid culture for each of the trials. Liquid cultures were plated in triple replicates after one hour of shaking incubation at 25°C and 120 rpm in angled tube racks. 1 mL per plate of liquid culture was spread across the surface of the agar plates and plates were stored right-side-up in sealed sterile bags for one day before sealing with Parafilm and incubation in the standard upside down manner. Plates were incubated at ambient lab temperature on the
71
counter. Blank plates and consortia inoculated plates were kept as controls for all media types to monitor success of experimental media types and contamination of agar plates.
Colony counts were performed at one week of incubation, and two, three and four weeks of incubation. Colony counts exceeding 49 per plate were classified as ≥50. All tissue preparation techniques were plated in triple- replicate so colonies were totaled then divided by 3 to report the colony count for an average plate.
5.4 Results
Results varied for media types and tissue preparation methods (Chapter 5, Table 1.) The negative control stayed clean throughout the experiment, indicating media was sterile. The positive control, inoculated with an endophyte consortia grew on all media types by week two of the experiment, indicating that all media were suitable for endophytic colony growth.
5.4.1 Week one 5.4.1.1 Media type R2A3C was the second best media for quick colony growth, with four of the five prep styles showing growth at one week.
PNPB showed minimal growth on the green prep plates and fungal growth on the liquid nitrogen prepped plates.
TSA showed was the best media for quick colony growth, with four of the five prep styles showing growth at one week and the liquid nitrogen prep plats with 50 or more colonies per plate.
AMS + Methanol is selective media so it is not surprising that this was the “least successful” media type at week one. Colonies were seen on green + PBS and cryopreserved liquid nitrogen prepped plates.
5.4.1.2 Tissue preparation At week one, cryopreserved liquid nitrogen prepped plates were the most successful with two media types showing 11-49 colonies per plate and TSA showing 50+ colonies per plate (Chapter 5, Table 1). Second most successful preparation style in week one was the green prep plus PBS with up to 10 colonies per plate for all media types. Green prep plus tris plus PVP showed 10 or less colonies for the R2A based media and green prep plus PBS
72
showed ≤10 colonies only on the TSA agar plates. Liquid nitrogen prep had 50+ colonies per plate for TSA, only fungal growth on PNPB and no growth at one week for R2A3C and AMS.
5.4.2 Week two 5.4.2.1 Media type In week two, R2A3C was still the second most successful took over as most successful media type with an average of 25 colonies per plate.
PNPB had a range of ≤10 colonies per plate for three of the prep styles and 11-49 colonies per plate for cryopreserved liquid nitrogen preparation. Fungal growth was seen on all plates except the green prep plus PBS.
TSA had an average of 24 colonies per plate mainly because no colony growth was seen on the green prep plus Tris plus PVP plates. TSA remains the most successful for liquid nitrogen preparations at week two with 50+ colonies per plate.
AMS + Methanol showed an average of 32 colonies per plate, as it is a selective media, all of the colonies are assumed to be methylotrophs and therefore even though it is the most successful media type at week two, it does not isolate general endophytes.
5.4.2.2 Tissue preparation Liquid nitrogen preparations (cryo and non-cryopreserved) were the most successful tissue preparation styles with ≥44 colonies per plate. Green prep plus PBS was the most successful green preparation method with ≤19 colonies per plate. Green prep plus Tris had an average of ≤10 colonies per plate and green prep plus Tris plus PVP had ≤10 colonies per plate for two of the four media types.
5.4.3 Week three 5.4.3.1 Media type R2A3C show 50+ colonies per plate for liquid nitrogen preps and less than 10 colonies per plate for green preps. Non-cryopreserved plates also showed fungal growth.
PNPB had fungal growth throughout all tissue prep styles, and an average of 40 colonies per plate for liquid nitrogen prepped plates. 11-49 colonies were
73
seen on the Tris-buffered green prep plates and a biofilm and fungus had taken over the green plus PBS plates.
TSA remained the same as at week two with no new colonies on the plates.
AMS + Methanol showed 50+ colonies for liquid nitrogen prepped plates and 0-49 colonies per plate for the green preparations.
5.4.3.2 Tissue preparation Liquid nitrogen preparations (cryo and non-cryopreserved) were still the most successful tissue preparation styles at week three with ≥50 colonies per plate for cryo preserved plates for all media types and ≥50 colonies per plate for all but PNPB agar for the non-cryo preps. Green preps showed few increases in colony counts at week three, with the exceptions of the Tris-buffered preps on PNPB and the Tris plus PVP green prep on AMS which increased from less than 10 colonies per plate to less than 49 colonies per plate.
5.4.4 Week four 5.4.4.1 Media type At week four little had changed for any of the media types. The only change was an increased colony count for liquid nitrogen prep on PNPB agar from less than 10 colonies per plate, to over 50 colonies per plate.
TSA and R2A3C are tied by raw colony counts for the most successful media type for a non-selective media type.
5.4.4.2 Tissue preparation At week four it is clear that liquid nitrogen preparations are the most successful prep method for maximum recovery with all media types showing ≥50 colonies per plate. Non-cryopreserved liquid nitrogen prep also seems to be the best for fungal endophyte culturing, with fungal growth on all plates. This method also had the least issues with contamination.
5.5 Discussion Picking a “best” media type for culturing bacterial endophytes has proven to be difficult. Finding a single media type that encourages the growth of a variety of endophytes is likely not possible, unless a community study is first completed and media is chosen to target interesting community members. My study showed that the general culture media TSA was equally successful in promoting the growth of a variety of bacterial endophyte colonies to minimal
74
media. My innovated R2A3C was as successful when measured by raw colony counts to TSA, however, it would be interesting to explore the diversity recovered by each method. Understanding the diversity of colonies recovered would take isolating the colonies and sequencing those isolates in a parallel study of media types.
More work is needed to refine the plant tissue media PNPB. It seems reasonable to assume that more buffering might be needed to successfully isolate bacterial endophytes. It was clear from my results that fungal endophytes thrived on this media type. More buffering and very low concentration antifungal use could be interesting avenues to explore in the future.
Future work should also include mimicking the environment samples were collected from including temperature fluctuations, humidity control, and diurnal light cycles.
One difference between the failed conifer needle endophyte isolation studies and my study was that I did not use cyclohexamide as an antifungal in my growth media. This could suggest that allowing fungal growth could important in helping bacterial endophytes to grow successfully or that cyclohexamide has a detrimental effect on bacterial endophyte growth. Finally, buffering against phenolics and pH changes with Tris-buffer seems to be important in recovering endophyte colonies from conifer needle tissue. My failed needle endophyte culturing studies did not include buffering in culture media and in this study, I was successful in recovering many needle endophytes. It would be interesting to test the efficacy of different buffers in culture media in combination with these improved media types and tissue preparation methods in the future.
5.7 References
Atlas, R.M., 2005. In: Media for environmental microbiology. CRC Press, pp 29.
Banada, P.P., Huff, K., Bae, E., Rajwa, B., Aroonnual, A., Bayraktar, B., Adil, A., Robinson, J.P., Hirleman, E.D., Bhunia, A.K., 2008. Label-free detection of multiple bacterial pathogens using light-scattering sensor. Biosens Bioelectron. 24(6),1685-92.
Fido, R.J., Mills, N.C., Rigby N.M., and Shewry, P.R., Protein extraction from plant tissues. From: Protein purification protocols (eds) Cutler, P., 2004. Methods in Molecular Biology, 244(3)p21-27.
75
Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compante, S., Campisano, A., Döringg, M., and Sessitsche, A., 2015. The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiol. Mol. Biol. Rev. 79(3),293-320.
Hubálek, Z., 2003. Protectants used in the cryopreservation of microorganisms. Cryobiology 46:205-229.
Izumi, H., Anderson, I.C., Killham, K., Moore, E.R., 2008. Diversity of predominant endophytic bacteria in European deciduous and coniferous trees. Can. J. Microbiol., 54, 173–179.
Latutrie, M., Aronen, T., 2013. Long-term cryopreservation of embryogenic Pinus sylvestris cultures. Scandinavian Journal of Forest Research 28:103-109.
Lodewyckx, C., Vangronsvel, J., Porteous, F., Moore, E.R.B., Taghavi, S., Mezgeay, M., van der Lelie, D., 2002. Endophytic Bacteria and Their Potential Applications. Crit. Rev. Plant Sci., 21, 583–606.
Ostrowska, E., Muralitharan ,M., Chandler, S., Volker, P., Hetherinton, S., Dunshea, F., 1998. Optimizing conditions for DNA isolation from Pinus radiata. In vitro cell. Dev. Biol.- Plant. 34, 108-111.
Pierpoint, W.S., The extraction of enzymes from plant tissues rich in phenolic compounds. From: Protein purification protocols (eds) Cutler, P., 2004. Methods in Molecular Biology, 244(3)p65-74.
Pirttilä, A.M., Joensuu, P., Pospiech, H., Jalonen, J., Hohtola, A., 2004. Bud endophytes of Scots pine produce adenine derivatives and other compounds that affect morphology and mitigate browning of callus cultures. Physiol. Plant, 121, 305–312.
Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Curr. Opin.Plant. Biol., 14, 435–443.
Ryan, R.P., Germaine, K., Franks, A., Ryan, D.J., Dowling, D.N., 2007. Bacterial endophytes: recent developments and applications. FEMS Microbiol Lett. 278, 1–9.
76
Sahu, S.K., Thangaraj, M., Kathiresan, K., 2012. DNA extraction protocol for plants with high levels of secondary metabolites and polysaccharides without using liquid nitrogen and phenol. ISRN Mol Biol. 1-6.
Ulrich, K., Ulrich, A., Ewald, D., 2008. Diversity of endophytic bacterial communities in poplar grown under field conditions. FEMS Microbiol. Ecol., 63, 169–180.
5.8 Tables
77
Chapter 5, Table 1: Colony counts for a four-week, comparative study of media types and tissue preparation for isolation of needle endophytes. Absence of colony growth is indicated by an “X.” The positive control was a pooled consortia of previously successful bacterial endophytes incubated with all other plates. The negative controls were blank plates.
Negative Positive Green prep Green prep Green Cryo Liquid control control + Tris + + Tris prep + before nitrogen (blank) (endophyte PVP PBS liquid consortia) nitrogen
Week one
R2A3C X ≥50 ≤10 ≤10 ≤10 11 - 49 X +Tris colonies colonies colonies colonies colonies buffer
PNPB X X ≤10 ≤10 ≤10 Fungus Fungus colonies colonies colonies TSA X X X ≤10 ≤10 ≥50 ≥50 colonies colonies colonies colonies AMS + X ≤10 X X ≤10 11 - 49 X methanol colonies colonies colonies
Week two
R2A3C X ≥50 ≤10 ≤10 ≤10 11 - 49 ≥50 +Tris colonies colonies colonies colonies colonies colonies buffer
PNPB X ≥50 ≤10 ≤10 biofilm 11 - 49 ≤10 colonies colonies colonies colonies colonies and and and and fungus fungus fungus fungus TSA X ≥50 X ≤10 ≤10 ≥50 ≥50 colonies colonies colonies colonies colonies AMS + X ≤10 Fungus ≤10 11 - 49 11 - 49 ≥50 Methanol colonies colonies colonies colonies colonies
Negative Positive Green prep Green prep Green Cryo Liquid control control + Tris + + Tris prep + before nitrogen (blank) endophyte PVP PBS liquid
78
sortia nitrogen
Week three
R2A3C X ≥50 ≤10 ≤10 ≤10 ≥50 ≥50 +Tris colonies colonies colonies colonies colonies colonies buffer and fungus PNPB X ≥50 11 - 49 11 - 49 biofilm ≥50 ≤10 colonies colonies coloniesand and colonies colonies and fungus fungus and and fungus fungus fungus TSA X ≥50 X ≤10 ≤10 ≥50 ≥50 colonies colonies colonies colonies colonies AMS + X ≥50 11 - 49 ≤10 11 - 49 ≥50 ≥50 Methanol colonies colonies colonies colonies colonies colonies and and fungus fungus
Week four
R2A3C X ≥50 ≤10 ≤10 ≤10 ≥50 ≥50 +Tris colonies colonies colonies colonies colonies colonies buffer and fungus PNPB X ≥50 11 - 49 11 - 49 biofilm ≥50 ≥50 colonies colonies colonies and colonies colonies and fungus and fungus and and fungus fungus fungus TSA X ≥50 ≤10 ≤10 ≤10 ≥50 ≥50 colonies colonies colonies colonies colonies colonies AMS + X ≥50 11 - 49 ≤10 11 - 49 ≥50 ≥50 Methanol colonies coloniesand colonies colonies colonies colonies fungus and fungus
79
6 Conclusion
The aims of my dissertation research were to (1) refine culture techniques to maximize recovery of bacterial endophytes from conifer tissues and (2) identify these bacterial isolates through the sequencing of 16S rRNA and genome sequencing.
In the first chapter, I described the culturable community of the bud/shoot tissue of three conifer species, P. contorta, P. ponderosa, and P. nigra. No clear trend was seen in the culturable isolates recovered with Alphaproteobacteria dominating isolates from Pinus contorta, Actinobacteria dominating the isolates from Pinus nigra, and Firmicutes dominating isolates from Pinus ponderosa. Several interesting isolates were recovered including several common endophytic species.
In the second chapter, I improved my culture methods to capture more isolates and completed a parallel culture-independent study of bud and needle samples collected from Pinus radiata trees growing in three separate locations in California. I was able to show that Gammaproteobacteria dominated both the culturable community and the community survey of all endophytes present in the samples. Some of these bacteria, especially those in the Enterobacteriales are closely related to bacterial pathogens and should be studied further to clarify their relationship with their host.
In the third chapter, I described the genome sequencing of four isolates chosen from the set of P. radiata isolates recovered from drought-stressed trees described in the second chapter. Coverage of the genomes was inconsistent and resequencing is needed to complete the genomes. Genome BLAST searches against a database of NCBI completed bacterial genomes revealed that isolate CR7 is most likely Erwinia spp. and that CR6 is a Sodalis sp. or represents a new genus in the family Enterobacteriaceae. Isolate PL12 likely represents a new family in the order Rhizobiales, and isolate SW10 that it was identified only to the family level as Enterobacteriales and is likely a new genus in the Enterobacteriaceae. Gene BLAST searches revealed that these genomes encode many genes involved in beneficial interactions with plants however more complete genomes are needed to finalize this identification.
In the final chapter, I reveal my process for developing successful culture methods for conifer needle tissue. Buffering against phenolics and pH changes with Tris-buffer seems to increase colony numbers. Adding multiple carbon sources to minimal media or using general nutrition agar seems
79 80
to encourage bacterial colony growth. Allowing fungal growth to occur could be important in helping bacterial endophytes to grow successfully. Finally, liquid nitrogen preparation of tissue with or without cryopreservation aids in the recovery of more bacterial endophyte colonies than green tissue prep.