Ato o orsodne([email protected]) correspondence UK. for 3PH, *Author UB8 Middlesex Uxbridge, University, Brunel Health Care, of Social School and Biosciences, Sciences of Division Pharmacogenomics, and Genetics nvriy -- hrkn,Mnt-u oy 0-61 Japan. 108-8641, Tokyo Minato-ku, Shirokane, 5-9-1 University, skb,Iaai3587,Japan. Tennodai, 305-8575, 1-1-1 Ibaraki Tsukuba, Tsukuba, of University Sciences, Human Comprehensive esk Murano Kensaku cells complex mouse SL1 in complete transcription a gene by rRNA human of Reconstitution ARTICLE RESEARCH ß eevd2 oebr21;Acpe 5My2014 May 25 Accepted 2013; November 21 Received 1 ago, decades Three 1995). be species that to demonstrated Grummt, stringent al. its issues et and of Grummt transcription mechanism (Heix rDNA molecular specificity important the most is addressed the of One INTRODUCTION TIF-IB SL1, I, polymerase Species RNA Transcription, specificity, gene, RNA Ribosomal WORDS: KEY human four expressing (TAF the by factors from cells (TBP)-associated transcription mouse protein TATA-binding by in I promoter mRNA Pol this rDNA translatable reconstituted Using human polymerase. we into RNA system, converted RNA-dependent monitoring and virus amplified influenza SL1 is synthesized the gene the I reporter reconstitute been a Pol harboring to by transcript not transcription sensitive a which highly I has in and Pol activity complex novel for a system functional established monitoring we for its complex Here, key but reconstituted. a is specificity, SL1/TIF-IB specificity. species species I (Pol) stringent polymerase its RNA RNA is ribosomal DNA-dependent a by of mediated transcription (rDNA) gene the of characteristic important An ABSTRACT rncito nmueA el ariga nciehuman SL1 Chimeric inactive cluster. TAF an mouse rDNA and carrying the human containing contains cells complexes rDNA that A9 human 21 mouse re-activated chromosome also in SL1 transcription reconstituted The complex. ooecm h are fseisseiiiyfrhmnrDNA human for specificity species cells. of mouse in barrier transcription the overcome to ecnld htfu ua TAF transcription. human rDNA four human that for conclude inactive We were complexes these but UF tterN rmtr(rerc ta. 05 osand factor Moss and UBF 2005; binding I, al., Pol upstream 2006). et Zomerdijk, the (Friedrich and Russell promoter of 2002; Stefanovsky, rDNA binding the SL1/ the RRN3/TIF- at through mice. (UBF) stabilizes promoter in rDNA and TIF-IB the on and IA I multi- humans Pol a in recruits distinct by SL1 TIF-IB mediated This called is versa. I factor not vice Pol subunit is of and rDNA specificity extracts human recognition extracts cell promoter i.e. mouse homologous 1982), in al., completely transcribed et Grummt requires 1981; rDNAs (Grummt, mouse and oetF Newbold F. Robert eateto neto ilg,Fclyo eiieadGaut colof School Graduate and Medicine of Faculty Biology, Infection of Department 04 ulse yTeCmayo ilgssLd|Junlo elSine(04 2,30–39doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal | Ltd Biologists of Company The by Published 2014. 1 isr Okuwaki Mitsuru , 3 n ysk Nagata Kyosuke and 2 iaaoIsiuefrLf cecs Kitasato Sciences, Life for Institute Kitasato nvitro in I r eesr n sufficient and necessary are s rncito fhuman of transcription 1 uiaaMomose Fumitaka , I ol eformed, be could s 3 1, nttt fCancer of Institute I )i h SL1 the in s) * 2 hs ehpteieta TAF that hypothesize we transcription Thus, rDNA in involved rncito ytm(exe l,19) ae,afrhrTAF further a Later, an 1997). in al., activity et TIF-IB (Heix the system reconstitute transcription not did complex h B-nioyafnt-uiidS1fato Grk tal., et (Gorski fraction TAF SL1 2007). affinity-purified TBP-antibody the B r eesr n ufcett eosiuea reconstitute to sufficient TAF al., recombinant et mouse and (Zomerdijk three contrast, complex In SL1 necessary 1994). human active are transcriptionally TBP TAF 92.AogteeS1cmoet,TPi interchangeable TAF that is indicating TBP mice, components, and humans SL1 between these Among 1992). oydnltstensetRAcan osbyb slippage Pol a RdR by segment. viral possibly The chain, the each 2001). RNA by al., nascent initiated et the of is (Li polyadenylates genome mechanism (UTRs) virus snatching 3 influenza cap the the regions at of exist Transcription genome terminal viral the and untranslated of promoter signal transcription The replication 2002). the Pol, Digard, and RdR al., (NP), Portela et viral nucleoprotein (Nagata 2008; complexes and the (vRNP) subunits, ribonucleoprotein with viral PA forming associated and 2007). PB2 is al., PB1, (vRNA) et to comprising eight RNA (Naito belongs polarity viral comprises virus negative The genome of its A RNAs and Influenza single-stranded family, to Pol). Orthomyxoviridae tried We (RdR the proteins. RNA-dependent polymerases virus to influenza translated RNA the using not problem are this products I overcome The and Pol transcription. by I cells Pol synthesized for system mouse monitoring sensitive in barrier. activity species transcription SL1 rDNA the human overcoming the reconstituting TAF o h rmtrslciiyo L/I-B(ulf ta. 1994). al., et (Rudloff SL1/TIF-IB of selectivity promoter the for Vcoslnigeprmnshv eosrtdta TAF that demonstrated have experiments cross-linking UV TAF n A1) TAF TAF1A), and opee Rdofe l,19) hr r contradictory TAF human initiation are recombinant three There productive the that 1994). activity reported of SL1/TIF-IB been al., reconstituting heterologous formation about et the reports to (Rudloff a SL1/TIF-IB complexes of precludes binding promoter a that suggesting dniiaino h L ope Cmie l,19) TAF 1992). al., et (Comai complex initial the SL1 following the years of 10 identification than more for unidentified remained ope otisteTT-idn rti TP n three and (TBP) TAF as protein known al., SL1 TATA-binding factors human et TBP-associated The the 1993). Mishima al., contains 1985; et 1990; Schnapp al., complex al., 1994; et al., et et Learned Rudloff (Bell 1995; 1982; transcription Grummt, rDNA and support the Heix from to and derived species be humans must same complex between SL1/TIF-IB the interchangeable whereas mice, functionally are TIF-IA ihk Kumakura Michiko , oeaieti yohss eetbihdanvladhighly and novel a established we hypothesis, this examine To I I I as nw sTAF as known (also C as nw sTAF as known (also D promoters, heterologous and homologous the both to bind B I omgae ihTPo D-AE oit so SDS-PAGE, on TBP with co-migrates D I as nw sTAF as known (also B 1 hhiUeshima Shuhei , I 1adTFD,wsietfe from identified was TAF1D), and 41 I 1CadTFC Cmie al., et (Comai TAF1C) and 110C nvivo in I safnlcmoetin component final a is D I as nw sTAF as known (also A Grk ta. 2007). al., et (Gorski I 3adTFB and TAF1B) and 63 1 I r responsible are s , I nvitro in n h TBP the and s I n the and s 9 nvitro in thas It . I n 5 and and A 3309 I Dis I 48 I 9 ,

Journal of Cell Science xrsino orTAF four of expression 93.I hssse,a nlez iu eoeRAo nexact an of RNA genome al., virus et influenza Zobel an 1999; system, al., this the et In of (Neumann 1993). of control terminator authentic the and transfection promoter under I genes the the Pol viral particle on the has containing based influenza-virus-like DNAs RNA established plasmid An was synthesized system structure. the generation mRNA Thus, to five 1999). eukaryotic of al., 5 consists the et near which located signal residues uracil adenylation seven the at mechanism ARTICLE RESEARCH 3310 phPolI-vNA- or phPolI-vNS-Luc from expressed are genomes RNA model virus influenza The I. system. Pol by assay ‘ transcription reporter (denoted the I EGFP for Pol system Pol)-mediated assay reporter (RdR Pol-based polymerase RdR An 1. Fig. I Pol this reconstituting exogenously Using by cells in transcription. TAF mouse human in succeeded I expressing rDNA human Pol we from transcription the monitor system, than to monitoring less system activity reporter an systems. with assay be I conventional of might Pol the level contradiction considered detectable reconstituted we species-specificity by as the caused system, this that assay using sensitive possibility property In highly species-specific transcription. and its rDNA novel evaluated of mechanism we described system the particular, viral examined the the 1A), We through Fig. When expressed (see above. I. gene is reporter gene Pol a reporter cellular with the replaced by is region synthesized coding is viral orientation and size o ihhmnTAF human with not RSadPlAidct nitra iooeetyst n oyA inl epciey D xrsino GPi h d o-ae ytm eace HeLa system. Pol-based omissio RdR with the out in carried N EGFP also and was of components Transfection Expression panels). Pol (D) (left RdR respectively. phPolI-vNA-EGFP panels). signal, containing mean and NP, (right poly(A) plasmids are the and NP a of Results to PB2 encoding and transfection PB1, units. normalized PA, site plasmid indicates arbitrary was expressing entry Pol.+NP AU, activity plasmids ribosome with promoter. 3 Luc internal co-transfected II systems. The an were NP. Pol reporter indicate and typical I PolyA polymerases a Pol and viral promoter, of IRES on SV40 Evaluation system the (C) assay of experiments. reporter control independent I the Pol under the expressed of activity Dependency (B) polarity. negative ntepeetsuy eetbihdavrlRRPol-based RdR viral a established we study, present the In u.o EGFP or Luc. I ,B n nteS1cmlx but complex, SL1 the in D and C B, A, I I o nyidcdtasrpinfrom transcription induced only not s ,TAF A, )b o .TeifunavrsRRPlapiistesnhszdRAadtasrbsmN rmtemdlvrlRAof RNA viral model the from mRNA transcribes and RNA synthesized the amplifies Pol RdR virus influenza The I. Pol by ’) I n TAF and B 9 emnlo RA(Poon vRNA of terminal I .Exogenous C. yteie yteifunavrlRRPluigRNA synthesized The 1999). using al., structure et Pol cap Poon 2001; cellular RdR al., the et and (Li template viral primer a a as influenza as I Pol the by transcribed by synthesized Ipooe Nuane l,19) RAencoding mRNA Pol 1999). the of are al., control NP et and the (Neumann PB2 under promoter PB1, vectors II promoter PA, expression the cells. from of transfected control supplied the in under terminator I Pol and by synthesized vRNA is regions ( 5 engineered between luciferase system, sandwiched firefly this influenza-virus-like a In the containing for system. 1993) generation the al., analyze particle et the to modifying precisely (Zobel by to system 1A) method (Fig. order original assay transcription in rDNA reporter for I barrier sensitive Pol species and by I transcription novel Pol monitor by a transcription developed for system We assay reporter novel A RESULTS vroetebriro pce pcfct uigrDNA during specificity species of cells. and mouse SL1 barrier in active transcription transcriptionally the a reconstitute overcome to sufficient and h ua DApooe narpre lsi u also TAF but four These plasmid human that cluster. the rDNA indicate reporter human containing results inactive cells a an carrying mouse 21 in in chromosome rDNA promoter human rDNA reactivated human the A ceai ersnaino h nlez iu N-eedn RNA RNA-dependent virus influenza the of representation schematic A (A) ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal 9 n 3 and - I nhmnS1aenecessary are SL1 human in s 9 tria i-cigregulatory cis-acting -terminal Luc 6 ..otie rmthree from obtained s.d. eeo an or gene ) Renilla EGFP luciferase Luc fthe of n gene P. lls is

Journal of Cell Science ee fteLcatvt Fg C ae n ) nteRRPol- RdR the In was 4). significant activity and Luc 3 the a lanes above, 1C, the described produce system (Fig. to mediated activity not Luc relative the did activity of level al., system internal et reporter Palmer an IRES-mediated increased reporter by IRES-mediated used was the with I we In background 1993). Pol it (Hannan Next, al., for et system system comparing Palmer promoter. reporter 1996; al., (IRES)-mediated rDNA by et site mouse system entry this ribosome or this designated human a we plasmids evaluated distinguish in 1999), to the 6). easy pPolI it cells al., makes carrying lane or it because et HeLa phPolI 1B, pHH21 as (Fig. (Neumann plasmid in called system report originally detected this previous was was of phPolI activity components Although Luc all the expressing protein. expected, (NS) nonstructural a As encodes which 8, segment WSN/33) eedn nvrlcmoet Fg B.phPolI-vNS-Luc 1B). (Fig. 5 components between an thereby viral was is system contains reporter and on the this to mRNA whether nucleus dependent examined the eukaryotic we from of transport First, its cytoplasm. form after translation typical to subjected a is RNA ARTICLE RESEARCH rmtclylwrcmae ihta ypmPolI-v-NS-Luc by that with compared was The cells lower 5). pmPolI- NIH3T3 mouse and dramatically by in 4 driven pmPolI-G-7,-16A-vNS-Luc lanes and activity Luc 2F, Luc (Fig. Pol-mediated cells NIH3T3 pmPolI- RdR by mouse driven There in activity 2D,E). Luc vNS-Luc (Fig. Pol-mediated RdR activity no the abrogate was in that mutations promoter or carrying system, rDNA human plasmids reporter mouse human reporter the the three carrying in constructed plasmids shown we report As distinguish promoter. previous to rDNA a easy mouse of because it pmPolI in plasmid instead makes this pHMP1 redesignated it we as promoter 2004), Although al., called phPolI-vNS-Luc. et gene (Turan originally in rRNA promoter was gene pmPolI mouse rRNA human the the carries which the about reports promoter. rDNA previous the with of consistent properties were results These 9). phPolI- by driven were activity In Luc 5). Pol-mediated and D 4 RdR lanes the 2C, (Fig. addition, phPolI- eliminated completely by was cells driven HeLa activity RdR The Luc phPolI-G-7,-16A-vNS-Luc. are in Pol-mediated residues residues G A These with gene. replaced rRNA mammalian the the for important of the quite transcription are of site initiation at transcription elements residues the to control G relative respectively. upstream promoter, and rDNA core human the As lacked 1995). phPolI- Stefanovsky, vNS-Luc 2A,B, and Moss Fig. 1985; in al., Kishimotoshown et 1988; Miller promoter al., 1985; et al., Jones rDNA 1982; 1986; et (Grummt, al., human activity et constructed Haltiner abrogate 1998; the that We Grummt, residues I. carrying at mutations Pol plasmids with by reporter reporter transcription Pol-based three monitoring RdR the for I of Pol reliability system for the system confirmed reporter we Pol-based Next, RdR the of Evaluation h GPsga a bevdi h rsneo orviral NP of four absence of the presence in observed the not 1D). in (Fig. was observed it whereas was components, EGFP. signal expressing EGFP system reporter I The a Pol constructed the monitoring also for that We sensitive show activity. highly results is system These Pol-mediated activity. RdR background the than higher C-N-u n hoIG7-6-N-u nHL cells HeLa in phPolI-G-7,-16A-vNS-Luc and UCE-vNS-Luc eas osrce h moIvSLcrpre plasmid, reporter pmPolI-vNS-Luc the constructed also We , 0 fta rvnb hoIvN-u Fg C ae 6– lanes 2C, (Fig. phPolI-v-NS-Luc by driven that of 10% 9 n 3 and - Luc 9 tria Tso h nlez iu (A/ virus influenza the of UTRs -terminal eeo ees retto sandwiched orientation reverse of gene , D oevSLcadphPolI- and Core-vNS-Luc 0fl.I u xeiet,the experiments, our In 30-fold. D oevSLcin Core-vNS-Luc 2 D UCE-vNS- 7and . 10 D D UCE- 4 Core- -fold 2 16 ihu h ua L ope ree ntepeec fthe of presence the in even hTAF or factors: cells complex NIH3T3 three SL1 in human I. transcribed Pol the not for was without system promoter in reporter rDNA examined Pol-based human RdR The was the promoter using rDNA cells NIH3T3 human the from transcription ovninlasyssesmntrn h noprto of incorporation by the serum- monitoring reported a systems in transcription [ previously increased assay I as activity, conventional Luc Pol manner, culture the The by concentration-dependent cell monitored S1A). serum the as 10% Fig. and level, on 2% material 0.5%, depends with maintained (supplementary and cells HeLa Luc in rate Pol-mediated RdR activity examined growth We 1999). (Grummt, cell conditions the our with that activity. I demonstrate Pol clearly detects results system These reporter RdR-mediated 6–9). lanes 2F, (Fig. atr eeepesd(i.3,lns71) hs results hTAF These 7–16). four lanes the two 3D, of that (Fig. combination any expressed indicate or factor were single a stimulated factors when all at cells not NIH3T3 was in transcription rDNA human Importantly, muoltiguigetat rm23 el rnfce with transfected hTAF cells encoding 293T vectors from extracts using immunoblotting Fg D ae –) lhuhalwtasrpinlevel transcription low a promoter hTAF although rDNA either when human 3–6), observed the lanes was by 3D, driven (Fig. activity transcription ecoe orhmnTAF human four cloned we system. is reporter I reporter, Pol-based Pol RdR by human the transcription in species-specific the reproduced that panel). not indicate lower results 3A, but (Fig. These cells NIH3T3 mouse I reporter, in panel). activity Pol Luc upper mouse showed mouse 3A, the the (Fig. when transfected Furthermore, detected was not (pmPolI-vNS-Luc) was vector activity Luc In transfected. the was (phPolI-vNS-Luc) 3Pol+NP) vector contrast, 3, I in (Fig. Pol NP observed human and was the components when activity Pol Luc RdR the viral Turan of cells, 1999; presence and HeLa the al., human human et the In 2004). contain (Neumann the al., 3, respectively et Fig. uncover promoters, in I used to Pol pmPolI, mouse and system phPolI transcription I. reporter Pol species-specific Pol-based by the underlying RdR mechanism the molecular used We cells vivo In rncito rmtehmnPlIpooe nmuecls In cells. mouse in promoter I Pol human the from transcription hTAF h rsneo l obntoso hTAF of in combinations plasmid all reporter NIH3T3 human of Next, the presence (phPolI-vNS-Luc). with the co-transfected reporter were human cells the from eotrsse shgl estv n sflfraayigthe Pol-based analyzing RdR for I. useful this Pol and by Fig. that sensitive mechanism highly transcription material conclude is (supplementary we system when reporter 2011) together, system al., Taken reporter S1D). et Pol-based (Drygin RdR described the or c-Myc- in to normalized reduced I rDNA activity CX-5461 the with Luc on Pol Treatment recruitment the 2011). SL1 al., by of et disruption (Drygin CX-5461 transcription the promoter via 1999). I for UBF, Grummt, Pol Pol-based S1B,C; inhibits of factor Fig. RdR expression material transcription (supplementary exogenous the essential to that an responded confirmed system we reporter Furthermore, 2006). obnto ftetrehTAF three the of combination n ) nsapcnrs,wt hTAF with contrast, sharp In 5). and 3 ]rdn note4SrN rcro Seaosye al., et (Stefanovsky precursor rRNA 45S the into H]uridine h rncito aeo DAb o scoeycorrelated closely is I Pol by rDNA of rate transcription The orcnttt h ua L ciiyi os cells, mouse in activity SL1 human the reconstitute To I Fg C ae n )Lcatvte eedetected were activities Luc 6) and 4 lanes 3C, (Fig. D ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal eosiuino ua DAtasrpini mouse in transcription rDNA human of reconstitution I ,hTAF A, I Fg B.Teefc fhTAF of effect The 3B). (Fig. s b atnecdn RA spreviously as mRNAs -actin-encoding I ,adhTAF and B, I r eurdfrmaximum for required are s I (hTAF s I I eosiue h efficient the reconstituted s rhTAF or A I ,hTAF A, I I )adperformed and s) Fg C ae 3 lanes 3C, (Fig. C I Fg D.No 3D). (Fig. s I I a omitted. was B ,hTAF B, I and C I 3311 son

Journal of Cell Science xeiet.+ad+ niae3 gad9 go lsi N,rsetvl.A,abtayunits. arbitrary AU, respectively. DNA, plasmid of ng 90 and ng 30 indicate ++ and + experiments. el splmnaymtra i.S) xgnu xrsinof hTAF expression Exogenous four S2). the Fig. material (supplementary cells TAF el Fg D ae n ) hsfnigi ossetwith consistent is TAF that finding stating This experiments 6). crosslinking and UV 5 from mouse lanes that in 3D, transcription (Fig. rDNA human cells for proteins cognate human EERHARTICLE RESEARCH 3312 hTAF addition, mean are plasmi F with and C co-transfected in were Results cells lane. each NIH3T3 below mutations. indicated containing as plasmids promoters reporter rDNA representatio and pmPolI- mouse Pol+NP) schematic pmPolI-vNS-Luc. (3 of The in components activity promoter (D) viral rDNA The lane. encoding mouse (F) each the pmPolI-G-7,-16A-vNS-Luc. of below in sequence indicated The residues as (E) promoter. plasmids rDNA reporter mouse and the pmPolI- Pol+NP) in mutants (3 Nucleotide substitution components phPolI-vNS-Luc. and viral in deletion encoding promoter 5 plasmids rDNA the with human indicate transfected the letters of Blue sequence (+1). The site 2 (B) start promoter. transcription rDNA the system. human to phPolI- reporter the relative Pol-based in indicated RdR mutants is the (**) position in substitution expression and element-dependent bar) promoter gray I Pol 2. Fig. ciiyadseisseiiiy(i.3,lns3ad4,and 4), and 3 lanes 3D, (Fig. TAF specificity mouse species and activity Rdofe l,19) sacnrl eeaie h feto all of effect the examined we control, hTAF of a combinations As 1994). al., et (Rudloff vroetebriro pce pcfct nhmnrDNA human in and specificity SL1 species cells. active mouse of in transcriptionally barrier transcription a the Taken reconstitute activity. overcome I to hTAF Pol four sufficient mouse with the interfered together, rather but activity 6aerpae ihArsde npPl--,1AvSLc C h ciiyo h ua DApooescnann uain.HL el eeco- were cells HeLa mutations. containing promoters rDNA human the of activity The (C) phPolI-G-7,-16A-vNS-Luc. in residues A with replaced are 16 I idt ohhmlgu n eeooospromoters heterologous and homologous both to bind B D D oevSLcadphPolI- and core-vNS-Luc C-N-u aktergosidctdb e n rneltes epciey h nelndGrsde at residues G underlined The respectively. letters, orange and red by indicated regions the lack UCE-vNS-Luc I (mTAF A I I i o nraetelvlo h os o I Pol mouse the of level the increase not did s n hTAF and C I ntemuerpre ytmi NIH3T3 in system reporter mouse the on s I )admTAF and A) I nhmnS1aencsayand necessary are SL1 human in s I lyda seta oei h SL1 the in role essential an played D D C-N-u akrgosidctdb h e n rneltes epciey h nelndGrsde at residues G underlined The respectively. letters, orange and red the by indicated regions lack UCE-vNS-Luc I ol atal replace partially could B I and A rncie nmueclsb nuepce fetbetween effect was unexpected hTAF rDNA four an human the by not was and that could cells Pol system we RdR mouse possibility However, reporter in the activity. Pol-based transcribed I exclude RdR Pol completely detecting the for above, sensitive shown As A9 in rDNA human cells inactive of reactivation Transcriptional 1(9h1cls,wihcnan ua DA,btnot but rDNAs, human contains TAF which human chromosome cells), we any human cells, intact (A9ch21 mouse single a in 21 carrying SL1 cells human A9 the mouse of used function the show directly ua DA nAc2 el sn methylation-sensitive using cells A9ch21 on pattern in methylation DNA rDNAs and the Santoro examined human 2012; we al., was et 2001), region (Guetg Grummt, methylated promoter highly left rDNA be 4A, human to (Fig. reported inactive cells the A9ch21 Because in detected panel). be not could transcription 9 T fifunavrssget8 noiganntutrlprotein. nonstructural a encoding 8, segment virus influenza of UTR ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal A h ceai ersnaino eein(ra nthe in (break deletion of representation schematic The (A) I ee Ctbr ta. 95.HmnrDNA Human 1995). al., et (Cuthbert genes I .T xld hspsiiiyand possibility this exclude To s. 6 2 ..otie rmtreindependent three from obtained s.d. and 7 2 6aerpae ihA with replaced are 16 D oevSLcand core-vNS-Luc 2 and 7 ds nof

Journal of Cell Science oee,mcooclnces Mae ieto assays digestion low. quite (MNase) was cells nuclease bound A9ch21 in UBF in rDNAs micrococcal of promoter amount mouse rDNA human However, the on human addition, on the those In (H3K9) to 4C). than 9 (Fig. by higher cells lysine A9ch21 examined slightly H3 were was histone rDNAs at cells acetylation trimethylation Both A9ch21 assays. and not in (ChIP) immunoprecipitation was the promoter chromatin on promoters profile promoter rDNA epigenetic rDNA the Moreover, mouse rDNA human 4B). the (Fig. cells of human A9ch21 that in the from different of significantly cells, status A9ch21 methylation in inactive transcriptionally . were rDNAs human EERHARTICLE RESEARCH ( Hpa 0 fhmnrN rmtr eeumtyae,adthe and unmethylated, were promoters rDNA human of 40% I n isniie( -insensitive and II) Msp )rsrcinezms Although enzymes. restriction I) eut ugs htiatv ua DA r o sebe into assembled not are A9ch21 rDNAs These human in 4D). inactive promoter (Fig. that rDNAs suggest rDNA inactive results and mouse more active the was both comprising region than cells promoter MNase rDNA to human resistant the that demonstrated utfr opc hoai tutr eitn onuclease. to resistant structure rather chromatin they compact but cells, form mouse just in structure heterochromatin typical a bandfo he needn xeiet) B xgnu expression Exogenous TAF (B) human experiments). of independent three from obtained hra he hTAF three whereas rirr units. arbitrary el nadto ota oioe yteRRPlbsdreporter Pol-based RdR the by monitored that system. to addition in cells Fg B.Teerslsidct htmTAF that indicate results These 5B). (Fig. rDNA human that indicate results hTAF four These by reconstituted 2). was transcription lane 4G, (Fig. hmrcS1cmlx nldn B n hTAF and TBP including complex, SL1 chimeric rncito,a hw nFg n .I spsil that possible is It 4. and 3 Figs in shown hTAF as transcription, mTAF niFa nioy Atge hTAF HA-tagged antibody. anti-Flag hTAF and n h os DApooes(moIvSLc,rsetvl (mean respectively (pmPolI-vNS-Luc), (phPolI-vNS-Luc) promoters rDNA rDNA white human mouse the and the from Black and derived respectively. activity promoters, Luc the I indicate Pol bars mouse I cells. and Pol mouse human by in contain transcription transcription species-specific rDNA The human (A) of Reconstitution 3. Fig. ua DAtasrpini os el eurdfu hTAF four required cells mouse in transcription complex rDNA SL1 Human chimeric a of Formation TAF ope ihH-agdhTAF HA-tagged with mTAF complex Flag-tagged Furthermore, n igemTAF single a and ol o eosre nAc2 el nteasneo TAF of absence the in cells A9ch21 in observed be not could muorcpttdwt lgtge mTAF Flag-tagged with immunoprecipitated o h ua DAtasrpini I33cls(mean * cells experiments). NIH3T3 independent in three transcription rDNA human the for lc a n ht asidct h u ciiyfo ua n mouse hTAF and human from * 8). activity experiments). (lane Luc (mean assay the respectively Luc indicate promoters, the bars rDNA of white control and positive bar for Black cells NIH3T3 to introduced Fg C ae4.I diin ocmiaino he hTAF three of combination no rDNA addition, human In of 4). transcription lane confer 5C, not (Fig. did TBP endogenous ihFa-agdhTAF Flag-tagged with A9ch21 hTAF in four the rDNA of human presence the from by in transcription cells reconstituted examined was then activity hTAF We SL1 expressed the exogenously that four cells. confirmed A9ch21 in we promoter rDNA First, human the from transcription on hTAF hTAF Flag-tagged with co-immunoprecipitated noighTAF encoding h nciehmnrN nmueclswsratvtdb four hTAF by reactivated expressed was cells mouse exogenously in pre-rRNA. rDNA 45S human human inactive for The sets primer using RT-PCR quantitative rmAc2 el rninl xrsighTAF expressing transiently cells A9ch21 from os el.NHT el eetasetdwt lsi e o h RdR the expression for and hTAF set phPolI-vNS-Luc) for plasmid and plasmids a (3Pol+NP with system transfected reporter were Pol-based cells NIH3T3 cells. mouse anti- human et eeaie h feto xgnu hTAF exogenous of effect the examined we Next, b I I atnatbde,rsetvl.()Tasrpino h ua DAin rDNA human the of Transcription (C) respectively. antibodies, -actin nLcatvt a xmndb h d o-ae eotrsystem reporter Pol-based RdR the by examined was activity Luc on s (mTAF D I I ,i gemn ihapeiu eot(exe l,1997). al., et (Heix report previous a with agreement in C, hTAF A, b I a oepesdwt Atge hTAF HA-tagged with co-expressed was D ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal atn(Act -actin I n23 el,floe yimnpeiiainwith immunoprecipitation by followed cells, 293T in C I (hTAF s P I .Teepeso eeso aheoeoshTAF exogenous each of levels expression The s. , I I .02 D h feto l osbecmiain of combinations possible all of effect The (D) 0.0002. sidctdblwec ae moIvSLcwas pmPolI-vNS-Luc lane. each below indicated as s I ) oeaieti yohss Flag-tagged hypothesis, this examine To D). b n hTAF and B eedtce yimnbotn sn niFa and anti-Flag using immunoblotting by detected were ) I I ) 9Tclswr rnfce ihplasmids with transfected were cells 293T s). ofre aiu rncito fhuman of transcription maximum conferred I ,hTAF A, I Fg A.Edgnu B a also was TBP Endogenous 5A). (Fig. D P , I 6 I I antitrc ihmouse with interact cannot C Fg F.Hmnpre-rRNA Human 4F). (Fig. s .02 ** 0.0002; n hTAF and B ..otie rmtreindependent three from obtained s.d. I ,hTAF A, I I omdaciei SL1 chimeric a formed D nAc2 el Fg 4E). (Fig. cells A9ch21 in s I ,hTAF A, I .TtlRAwsprepared was RNA Total s. nvivo in P , I .1vru ae1 AU, 1. lane versus 0.01 n hTAF and B I I sal ofr a form to able is D hoIadpmPolI and phPolI . nmueA9ch21 mouse in s I I i o confer not did C I n hTAF and B ,a hywere they as D, 6 I n mTAF and D I I ..otie from obtained s.d. ,hTAF A, ,floe by followed s, I I expression s ,hTAF A, I I and ,and C, I I and B co- C 3313 6 s.d. I I I I D D B I s, s

Journal of Cell Science I-Bcmlxscno soit ihtehmnrDNA expressed human exogenously four the the 6B, TAF with Fig. SL1/ human in associate mouse shown the As cannot that promoter. indicate complexes 6A, clearly (Fig. cells results TIF-IB HeLa These in promoter panel). However, rDNA panel). right human left rDNA the 6A, to human (Fig. bound the cells TBP to A9ch15 not mouse but in promoter, ChIP promoter, rDNA additional TBP mouse antibody. the for anti-TBP to cells using bound assays A9ch21 ChIP performed of we We instead assays. Therefore, cells S3C). A9ch15 Fig. used material (supplementary cells A9ch21 3) h eciainlvlo ua DAtasrpinin transcription rDNA hTAF human four the of by level cells Fig. A9ch15 reactivation material (supplementary The cells A9ch21 S3B). and A9ch15 in rDNA TAF EERHARTICLE RESEARCH 3314 TAF that demonstrated have experiments rDNA crosslinking human UV the to bind not promoter did complexes SL1 Chimeric hTAF four by driven was which rDNA, by detected activity promoter rDNA Human TAF human (E) to four promoters. Resistance of rDNA cells. presence human A9ch21 in was the in and rDNAs immunoprecipitation in rDNAs mouse mouse by of cells for and resistance obtained A9ch21 sets MNase human rDNAs in (D) primer on system of promoters. indicated property reporter input) rDNA the Chromatin human Pol-based of using and (C) RdR (percentage mouse qPCR bar). the amount the by (white for The with determined sets promoters antibodies. determined was primer (rDNA) indicated (RT was indicated MNase rDNA using the transcriptase pattern mouse using performed reverse methylation qPCR and was of The by bar) assay absence cells. determined (black ChIP or A9ch21 human A presence in the cells. the promoters for A9ch21 in rDNA sets panel) human primer (right and using pre-rRNA mouse (qPCR) mouse on and pattern panel) Methylation (left (B) cells. Msp pre-rRNA lane. A9 human each mouse for below in sets indicated rDNA primer human using inactive out of carried reactivation Transcription 4. Fig. arigtehmncrmsm 5(9h5cls.Tefour The cells). (A9ch15 15 hTAF cells expressed chromosome A9 exogenously examine mouse human in to promoter the complex rDNA us carrying chimeric human the and encouraged with complex associated report SL1/TIF-IB are This mouse the 1994). whether al., et (Rudloff i.SA.Teedt ugs htayciei L complex SL1 chimeric any hTAF that three suggest data comprising These S3A). Fig. ucinlS1complexes. SL1 functional el.TtlRAwspeae rmAc2 el rnfce ihpH sacnrlo CAbsdpamdstepesn h orhTAF four the expressing set plasmid pCHA-based or control a as pCHA with transfected cells A9ch21 from prepared was RNA Total cells. ottasrpin h ee fhmnperN a esrdb uniaieR-C n omlzdb ee fmouse of level by normalized and RT-PCR units. quantitative arbitrary by AU, measured experiments. was independent pre-rRNA three human from of obtained level The transcription. post wihi ehlto nestv)or insensitive) methylation is (which I I idt ohhmlgu n eeooospromoters heterologous and homologous both to bind B I erie B ntehmnrN rmtrin promoter rDNA human the on TBP recruited s I n igemTAF single a and s I ciae rncito fhuman of transcription activated s I a .-odhge hnta of that than higher 9.1-fold was s Hpa I splmnaymaterial (supplementary s I(hc smtyainsniie.Rssac orsrcinezm R)wsdtrie yqatttv PCR quantitative by determined was (RE) enzyme restriction to Resistance sensitive). methylation is (which II I antform cannot I and A rncito nmueAc2 el a eciae ytefour the by hTAF reactivated rDNA was expressed cells human exogenously A9ch21 silent mouse that in demonstrated transcription we addition, In complex. promoter. yeoeosyepesn orTAF cells four mouse Pol. in expressing RdR reconstituted exogenously system is by was I by mRNA rDNA reporter human Pol translatable Pol-based of by into Transcription synthesized converted RdR RNA and The because amplified sensitivity, for I. system high reporter Pol showed Pol-based RdR by an describe transcription we report, this In DISCUSSION ua TAF human DAi os 9h5clsb h oreoeosyexpressed exogenously four the the human by TAF on cells human at recruited A9ch15 also UBF mouse was I, in of of Pol rDNA amount of large binding subunit A largest 2005). the the al., RPA194, et stabilizes (Friedrich promoter SL1 rDNA human human that stating 9h5cls ncnrs,ciei L opee n four and complexes SL1 chimeric contrast, mTAF In cells. A9ch15 pce-pcfcbriro ua DAtasrpini mouse in transcription rDNA human cells. of barrier species-specific lgtyi 9h5clsi h rsneo h orexogenous four increased the promoter of presence rDNA the human in cells the hTAF A9ch15 at in UBF slightly of occupancy 9h5clscmae ihtefu hTAF four the with compared cells A9ch15 orhmnTAF human four A ua DAi rncito-nciei 9h1cls TPRwas RT-PCR cells. A9ch21 in transcription-inactive is rDNA Human (A) I (hTAF s I Fg C,wihi ngo gemn ihareport a with agreement good in is which 6C), (Fig. s I ol o eri B ntehmnrN rmtrin promoter rDNA human the on TBP recruit not could s ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal I I I ) FG eciaino ua DAtasrpini A9ch21 in transcription rDNA human of Reactivation (F,G) s). r eurdfrtercgiino h ua rDNA human the of recognition the for required are s .W ocueta L opee opiigfour comprising complexes SL1 that conclude We s. I r eesr n ufcett vroethe overcome to sufficient and necessary are s I .Teerslssgetta the that suggest results These s. b atn eut r mean are Results -actin. I rmtehmnSL1 human the from s I .Frhroe the Furthermore, s. I tteidctdtime indicated the at s 6 s.d. )as

Journal of Cell Science eobnn B n B Hi ta. 97.Tkntogether, Taken hTAF 1997). al., that et conclude (Heix we UBF and TBP recombinant hTAF I-Batvt sntrcntttdb eobnn rti of protein mouse recombinant that by report reconstituted mTAF a their not three by in is present supported activity was is TIF-IB fraction, assumption I This Pol reaction. purified the or UBF hw9% 7,7%ad6%smlrt,rsetvl,t their to respectively, similarity, 68% and 75% 87%, 90%, show EERHARTICLE RESEARCH rnfce ihcmiain fpH rpFa-ae lsisencoding plasmids pCFlag-based TAF or were human pCHA cells of 293T combinations antibody. with anti-Flag transfected complex. with SL1 (IP) chimeric Immunoprecipitation the (A,B) of Formation 5. Fig. uhr sdDAafnt-uiidUFadrecombinant and Those UBF 1994). DNA-affinity-purified al., hTAF et used (Zomerdijk authors background higher relatively ae ntoersls ti ut ieyta o ee of level low a that likely quite is it results, hTAF those on Based rirr units. arbitrary reconstituted opeigteS1activity. SL1 the completing rncito yPlI utemr,i a ensonta UBF that shown been has hTAF it with Furthermore, interacts I. Pol by transcription ae eotrsse.Ac2 el eetasetdwt obntosof combinations TAF with human Pol- transfected encoding RdR were plasmids the cells pCHA-based by A9ch21 detected system. activity reporter promoter based antibodies, rDNA anti-TBP Human and (C) by anti-Flag respectively. followed anti-HA, antibody, using anti-Flag (WB) with immunoblotting out carried was Immunoprecipitation Clgbsdpamd noigmueTAF mouse encoding plasmids pCFlag-based eut r mean are Results thsbe eotdta h ua L ciiycnbe can activity SL1 human the that reported been has It h ormueTAF mouse four The I I I ,wihwsascae ihete DNA-affinity-purified either with associated was which D, hTAF A, hTAF and B I H-At Ah,Fa-D n os TAF mouse and Flag-hD) HA-hD, to (HA-hA s I ,mTAF s, nvitro in 6 I ,hTAF B, ..otie rmtreidpneteprmns AU, experiments. independent three from obtained s.d. I I ,i diint eobnn B,wt a with TBP, recombinant to addition in C, D ytetrercmiathTAF recombinant three the by I ,mABadmAC nadto to addition in mTAFC, and mTAFB A, nvivo in I ,TAF A, I I stepttv ia opnn in component final putative the is D n B o reconstituting for TBP and C and I ,TAF B, nvitro in I H-At Ah)and/or HA-hD) to (HA-hA s I Fa-At Flag-mD). to (Flag-mA s I n TAF and C Grk ta. 2007). al., et (Gorski I (Flag-mD). D I I ,hTAF s, proteins D nvitro in nvitro in I A, pcfct,a hw nFg D efudta os Flag- mouse that found We 3D. Fig. TAF in tagged shown as specificity, hi iiaiyi ngo gemn ihteosrainthat observation the with analyses. agreement (NCBI) good in TAF BLAST2 is to similarity Their according counterparts, human TAF i.6 erimn ftasrpinmcieist h ua rDNA human the TAF human to four machineries exogenous transcription by promoter of Recruitment 6. Fig. upre yarpr htmueadhmnTAF human and mouse that report a by supported * rtis hra TAF whereas proteins, with TAF the transfected human to were encoding TBP cells plasmids of A9ch15 pCHA-based Binding cells. of (B) A9ch15 combinations promoters. in rDNA promoter human rDNA primer and human the mouse using the PCR for quantitative sets by by obtained determined were DNAs were assays ChIP The immunoprecipitation cells. antibody. HeLa anti-TBP and cells using A9ch15 performed in promoter rDNA the to TBP uniaiePRuigtepie esfrtehmnrN promoter. rDNA human the for mean sets are primer Results by the determined I) using were assays Pol PCR immunoprecipitation ChIP of quantitative by cells. subunit obtained A9ch15 (largest DNAs in RPA194 The promoter and antibodies. rDNA anti-UBF human using the performed at were I Pol and UBF Ah)ado Clgbsdpamd noigmueTAF mouse encoding plasmids pCFlag-based and/or HA-hD) lgm) seik indicate Asterisks Flag-mD). P , 0.05. I I ,TAF B, TAF and A ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal I om ope ihhmnH-agdTAF HA-tagged human with complex a forms D I n B Fg ) hsrsl spartially is result This 5). (Fig. TBP and C 6 ..otie rmtreidpnetexperiments. independent three from obtained s.d. I r atal elcal o ua cognate human for replaceable partially are B I n TAF and C P , 1 6 10 2 6 I essln .()Teocpnyof occupancy The (C) 2. lane versus aecuilrlsi species in roles crucial have D I nAc1 cells. A9ch15 in s I I I Fa-Ato (Flag-mA s H-Ato (HA-hA s (hTAF s A idn of Binding (A) 3315 I I A, A,

Journal of Cell Science hmrccmlxbtenTPadteTAF the and TBP between complex chimeric pcfctasrpinb o Hi ta. 97.Tu,to Thus, 1997). hTAF al., of et species- expression (Heix exogenous I and the Pol recognition confirm by promoter transcription of specific mechanism molecular mice. and humans transcription between rDNA different to be barrier(s) HeLa species might in the activity that TIF-IB suggesting preventing cells, factor(s) unknown an is there promoter rDNA mouse the vitro from Pol transcription human nuclear reconstitute and can human al., UBF I reprogram human et to SL1/TIF-IB, mouse (Schnapp I whereas Pol extracts, promoter during mouse rDNA requires extracts TIF-IB mouse 1991). nuclear the can TIF- human but from SL1 1985), transcription reprogram al., human et cannot (Learned the promoter IB that rDNA during human These report the extracts from S4). a nuclear Fig. with mouse material reprogram consistent (supplementary are cells results HeLa in rDNA os n ua DApoia o rmtr Myre al., et (Mayer promoters from I Pol synthesized proximal pRNAs rDNA by human mediated and is of mouse localization 2012; cells Nucleolar NIH3T3 al., 2010). in al., et et NoRC (Guetg Santoro 2006; chromatin al., rDNA et formation Mayer silent the RNA in of and involved rDNA maintenance promoter is PARP1 pRNA and recruits so Noncoding human rDNA, I to polymerase complexes cells. of NoRC RNA by A9 independent synthesized mouse (pRNA) the was on in level promoter transcription methylation rDNA DNA the human of maintenance the addition, muoltiguigetat rm23 el transfected cells 293T hTAF from encoding vectors extracts with using immunoblotting el a .-odhge hnta nAc2 el ntepresence the TAF in A9ch15 human cells A9ch21 four in in the transcription that of rDNA than higher human 9.1-fold of was level cells the that found we el,tefu os TAF mouse four the cells, Hi n rmt 95.Orrslsceryidct htthe that indicate hTAF clearly Grummt four results requires and activity Our SL1 Heix 1995). human by Grummt, and mentioned (Heix as inactive, transcriptionally hTAF ARTICLE RESEARCH 3316 fot,eoeosyepesdTAF expressed exogenously efforts, eetvt yPlI L/I-Batvt hudb reconstituted be should activity promoter vitro SL1/TIF-IB the in I, of Pol mechanism by molecular the selectivity of analysis further For arigahmncrmsm oso h L ciiyi the in activity SL1 TAF the human show four to of chromosome presence human a carrying question. open an level currently low a is maintain SL1 to of mechanism and possible (Hock The MDM2 2014). controlled involving Vousden, are pathway activity Similarly, ubiquitin-proteasome and low. a level by level protein suppressor the SL1 tumor lack the p53 cells the keeps the 293T which under whereas mechanism, be mechanism, might possible unknown SL1 cell an of of abundance HeLa the control or cells, these A9ch21 In A9ch15, extracts. NIH3T3, using immunoblotting epnet xgnu xrsino h orhmnTAF human of four level the the of of determine expression may level exogenous in promoter The to that the S3E). response rDNA than on Fig. human S3D). methylation lower material the DNA significantly Fig. (supplementary on was cells material cells methylation A9ch21 A9ch15 (supplementary DNA in of cell than promoter level smaller A9ch21 was the cell an Notably, A9ch15 an in in that number copy rDNA human Hi ta. 97.I per htsbl ifrne between differences subtle that appears It TAF 1997). individual al., et (Heix h ee fS1TFI nclsi o o osuythe study to low too is cells in SL1/TIF-IB of level The lhuhtehmnS1atvt a eosiue nmouse in reconstituted was activity SL1 human the Although eue w os 9cl ie Ac2 n A9ch15) and (A9ch21 lines cell A9 mouse two used We Bl ta. 90 cnp ta. 91.I sasmdthat assumed is It 1991). al., et Schnapp 1990; al., et (Bell I n hTAF and B yfu TAF four by I ih fetteoealcnomto fthe of conformation overall the affect might s I )cnfr hmrcTBP–TAF chimeric form can C) I n B eobnn proteins. recombinant TBP and s I splmnaymtra i.SC.The S3C). Fig. material (supplementary s I i o ofrtasrpino mouse of transcription confer not did s I I .Drn h oreo hsstudy, this of course the During s. Fg B.Dsieconsiderable Despite 3B). (Fig. s I eentdtce by detected not were s I ,a es nmuecells. mouse in least at s, nvitro in I I ,wihcudbe could which s, ,w performed we s, transcription I complexes nvitro in I .In s. in eotrsse o o ciiywudb ovnetand convenient screening and a transcription. activity Pol-based be I I RdR Pol Pol would for the monitoring activity inhibitors for that I tool possible sensitive Pol is highly for It 2013). system al., et al., reporter re- (Drygin Stefanovsky et being cancer 2006; is treating Hein for machinery al., 2010; target transcription et emerging I an Panova Pol (Bierhoff as 2006; the evaluated cells Thus, al., 2001). cancer et the al., in Lin et through 2008; TIF-IA ERK, transcription al., and and rDNA et UBF II upregulate of 2005). kinase to phosphorylation al., ability casein et the including Grandori have increases kinases, 2005; that and al., protein rDNA known et Several cell to (Arabi well binds cancer transcription is tumorigenesis, to rDNA in It related transcription involved representative again. is a factor focus c-Myc, transcription 2005). a rDNA (White, proliferation become of regulation have the I may Pol epigenetics. 21 rDNA by and studying 15 for chromosomes system conclusion, model human In good human carrying machinery. a line whether I provide cell Pol and A9 mouse promoter, by the transcribed rDNA is human pRNA DNA in on involved raise is methylation S3 pRNA Fig. mouse material whether questions supplementary fundamental in shown results The 2008). rsneo h lsi e 3o+P o h d o-ae reporter Pol-based RdR the for (3Pol+NP) set plasmid the of presence elclue n uieaeassay luciferase and cultures Cell METHODS AND MATERIALS xrsigP,P1adP2sbnt,adN.FrFg C NIH3T3 3C, Fig. For NP. and pCHA-TAF subunits, with transfected PB2 were and cells NIH3T3 PB1 pRL- 2F, of ng), PA, Fig. expression (90 expressing For for plasmids pmPolI-based ng) NP. of (10 and one SV40 subunits, with transfected PB2 were and cells pRL- PB1 HeLa ng), of PA, 2C, (90 expression Fig. plasmids expressing for For phPolI-based ng) phPolI-vNA-EGFP panels). of (10 one right of SV40 with 1D, ng transfected (Fig. plasmid omission 80 were NP the cells each encoding with and out plasmid of carried NP also the ng was of Transfection and 80 panels). left PB2 with 1D, For (Fig. ng). co-transfected PB1, (10 were PA, pRL-SV40 cells with expressing together HeLa lane cells ng, 1D, HeLa (190 Fig. to pSV40-Luc viral introduced 3), and four lane were 4) the ng, 5) lane encoding (190 ng, ng, phPolI-IRES-Luc each) (40 (190 ng). for phPolI-IRES-Luc-PolyA phPolI-vNS-Luc (10 ng were pRL-SV40 or (38 cells and plasmids 1) HeLa components with lane 1C, together Fig. ng, 2) For the (40 lane in 1). phPolI or (lane with 5) components (lane co-transfected viral pCAGGS-NP all or 4), of pCAGGS- (lane absence the 2), mRNAs, pCAGGS-PB2 of (lane 3), one NP either (lane pCAGGS-PA of PB1 and components, omission pCAGGS-PB1, viral under pRL-SV40 PB2 of out encoding ng carried PB1, plasmids also al., 10 pCAGGS-PA, co- and were PA, phPolI-vNS-Luc Assays et of 6). of ng were (lane of Naito 90 synthesis II, 2005; Pol to cells by each respectively, al., leads the et HeLa which to ng 2007), (Kawaguchi 25 1B, according pCAGGS-NP Fig. pCAGGS-PB2, kit with For reagent transfected instructions. transfection (Novagen) manufacturers’ (Invitrogen) 2000 GeneJuice Lipofectamine using or DNA with transfected were Cells transfection DNA 37 for at used maintained were cells were A9ch21 They and experiments. cells A9ch15 transfection cells, NIH3T3 cells, HeLa auatrrspooo.Terltv uiecneitniywas intensity (Berthold). and luminescence MiniLumat a (Promega) with relative seconds 10 reagent The for measured assay protocol. Luciferase manufacturer’s using the and the Luc determined The the cells. were in mouse cultured the were in cells chromosome 50 A9ch21 and of bovine cells fetal presence A9ch15 10% addition, with In supplemented serum. (Nissui) medium Eagle’s modified n pCHA-TAF and tde ntemcaimo DAtasrpinmediated transcription rDNA of mechanism the on Studies Renilla ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal uieaeAsySse Poea codn othe to according (Promega) System Assay Luciferase I m 2 gfrec)a niae eo ahln nthe in lane each below indicated as each) for ng (25 D /lhgoyi IvvGn oke h human the keep to (InvivoGen) B hygromycin g/ml Renilla Renilla I ,pCHA-TAF A, u,adpamd ec 5ng) 25 (each plasmids and Luc, ng) 25 (each plasmids and Luc, Renilla I ˚ ,pCHA-TAF B, nDulbecco’s in C u activities Luc I C

Journal of Cell Science eefudt emtyae,adtemtyainstswr located were sites methylation positions. primer the reverse and and methylated, forward the be between to found were 2 ie o h os rmtr and promoter, mouse the for site) 2 AAATG-3 TTGACCAGAGGGACCCCGG-3 GGTCCAATAGGAAC-3 ACCTCCCCAGGTATGACTTCCAG-3 TAAGACCGACAGGT-3 B 1. g,pAG-B 1. g,pAG-P(13n)and ng) pCFlag-TAF with (11.3 transfected pCAGGS-NP were cells pCAGGS- ng), NIH3T3 (11.3 ng). ng), (10 (11.3 pCAGGS-PB2 pRL-SV40 pCAGGS-PA ng), (11.3 ng), PB1 (45 phPolI-vNS-Luc system: ARTICLE RESEARCH p ehlto a sae ydgsinwith digestion by assayed was assays methylation sensitivity CpG MNase and enzyme Restriction ATG-3 5 sets, primer CCAGAGGGACCCCGG-3 of presence SYBR AGGT-3 FastStart the using in out TCTCTGTCCCTGTCAC-3 (Roche) assay carried 2008). ChIP Master was the al., PCR for Green et manual Quantitative the (Murano (Upstate). to previously according kit performed described were was assays as Immunoblotting 51841), ChIP assay. essentially (Abcam; ChIP out the TBP and carried and ab8898), immunoblotting C-1) for (Abcam; used Biotechnology; were Cruz H3K9 (Santa histone RPA194 H3 actin histone tri-methylated acetylated M2), H-300), (Sigma; (Upstate/Millipore), Biotechnology; tag Cruz (Santa epitope UBF Flag AC-74), for specific Antibodies ChIP and Immunoblotting YRGenMse Rc)i h rsneo rmrst,5 sets, primer a of presence the in (Roch) FastStart The Master using DNA. PCR Green of quantitative purification by SYBR determined for was K MNase Proteinase to and resistance A RNase with treatment 2. g,pAG-P(26n)adpLS4 2 g.For ng). (20 pRL-SV40 pCHA-TAF with pCAGGS-PB2 and transfected were ng), ng) cells (22.6 (22.6 ng), A9ch21 (90 4F,G, pCAGGS-NP pCAGGS-PB1 phPolI-vNS-Luc Fig. system: ng), plasmid ng), reporter of (22.6 (22.6 presence Pol-based the RdR in lane pCAGGS-PA the each below for indicated as set each) for ng (50 dutdt 0 gwt h mt lsi CAo Clg For pCFlag. TAF together and or encoding 3C, Fig. for plasmids pCHA in ng) pCHA-based mentioned (100 plasmid as set with system plasmid empty reporter the Pol-based with the RdR transfected the was were with cells DNA NIH3T3 plasmid 3D, ng the of Fig. 200 for amount ng) to total (100 The set adjusted plasmid system. of reporter presence Pol-based the RdR in lane each below indicated 8husps rnfcin o i.4,Ac2 el eetransfected at were out cells carried A9ch21 to was 4E, adjusted assay Fig. pCHA-TAF was Luc For DNA The with transfection. plasmid pCHA. post of plasmid, hours amount 48 empty total with The ng 200 each). ng (25 lane . MDT .%N-0.Preblzdclswr rae with treated were cells 37 Permeabilized at Corporation) NP-40). Biochemical 0.1% (Worthington MNase DTT, mM 0.5 TAF 1 MTi-C H74 5m al 0m C,2m CaCl mM 2 KCl, mM 60 NaCl, buffer mM MNase 15 7.4, with pH permeabilization Tris-HCl by mM (15 followed formaldehyde, 1% sn attr YRGenMse Rc)i h rsneo primer a of presence the in PCR (Roch) quantitative 5 Master by set, Green determined SYBR was FastStart enzymes using restriction to Resistance eo ahln.Ttlaon fpamdDAwsajse o40ng 400 to adjusted was DNA pCHA. plasmid plasmid, of empty amount with Total lane. each below 2 MTi-C H79 0m DA %SS.Terato was reaction The SDS). 1% EDTA, mM 10 95 7.9, at 2 incubated pH of volume Tris-HCl same mM by stopped (20 was reaction the then and estv etito nye and enzyme) restriction sensitive pCFlag-TAF etito nye sdsrbdpeiul Gege l,2012; A9ch21 al., from of prepared et units ng) 20 (Guetg (500 with DNA digested previously Genomic was 2002). cells described al., et as Santoro enzyme) restriction 6b o h ua rmtrrltv otetasrpinsatsite start transcription the to relative promoter human the for bp 56 6 p(hr ‘ (where bp 262 o h Ns-estvt sa,Ac2 el (5 cells A9ch21 assay, MNase-sensitivity the For I ,pCHA-TAF B, 9 -AAGCCCTCTCTGTCCCTGTCAC-3 9 o h ua DApromoter. rDNA human the for 9 9 o h os RAgn rN)pooe,5 promoter, (rDNA) gene rRNA mouse the for I o h ua DApooe.Ncetd oiin of positions Nucleotide promoter. rDNA human the for ,pCFlag-TAF B, ˚ o 5mntsfrrvra fcosikn,floe by followed crosslinking, of reversal for minutes 15 for C I 2 ,pCHA-TAF A, I niae h oiinusra ftetranscription the of upstream position the indicates ’ n pCHA-TAF and C 9 9 9 9 o h os DApooe (nucleotide promoter rDNA mouse the for o h os DApooe,ad5 and promoter, rDNA mouse the for I n pCFlag-TAF and C n 5 and n 5 and I 9 ,pCHA-TAF B, n 5 and 9 Hpa -GGAGAACTGATAAGACCGAC- 9 -AATAACCCGGCGGCCCAAA- Msp 2 I 10n o ah sindicated as each) for ng (100 D 9 6 bp, 167 Ior II 9 n 5 and -AATAACCCGGCGGCCCA- amethylation-insensitive (a I I ,a niae eo each below indicated as s, 9 Msp 9 n 5 and -AGTACCTATCTCCA- I I 2 2 gfrec)as each) for ng (25 D Hpa n pCHA-TAF and C o or t37 at hours 3 for I 0bp, 90 6 9 -GGAGAACTGA- 6 10 ˚ I( methylation- (a II o 0minutes, 10 for C 5 rti buffer K Protein eefxdin fixed were ) 2 9 -AAGCCC- I 2b and bp 62 ,pCHA- A, b 9 -TTGA- (Sigma; I ˚ I A, C. D 9 9 2 - - , to TTGGCAGCAGGATAG-3 ci,ad5 and actin, AAATG-3 olwdb eltm C sn rmrst 5 set, primer human a of primer, using analysis a For as PCR oligo(dT) real-time of ACTGGGACGACA-3 presence by the in followed performed was transcription GGCCA-3 GATTCCTATGT-3 TTGACCAGAGGGACCCCGG-3 rncito a efre ntepeec foiod)a primer, a as oligo(dT) of presence the in performed was transcription GATGTGTGAGGCGCCCGGTT-3 olwdb eltm C sn rmrst 5 set, primer a using PCR real-time by followed CGGCCA-3 oiin of positions efre ntepeec fapie,5 primer, a of was presence transcription reverse the pre-rRNA, in 45S mouse performed of analysis For rDNA. GAGCCGATCG-3 CGTGCGTTCAGGCGTTCTCGTC-3 TACATTGATGAG-3 YRGenMse Rc)i h rsneo rmrst 5 set, primer a of presence the FastStart in using (Roch) PCR real-time Master by Green quantitated SYBR was cDNA synthesized a with human 5 transcription of reverse the to analysis and 5 subjected For was (TOYOBO) primer, (Invitrogen). RNA 2008). total I MagExtractor-RNA was pre-rRNA, al., DNase 45S with et RT-qPCR RNase-free prepared (Murano with by previously treated was described levels RNA as Total pre-rRNA essentially out of carried determination Quantitative RT-PCR Quantitative of 5 primers, CGCTCCCCC-3 with PCR by CTTGGCCAGACGG-3 amplified was genome with digested was fragment DNA amplified The template. the of fragment DNA a phPolI-vNS-Luc, construct To vectors plasmid of Construction CCCATATGGTGAGCAAGGGCGAGGAG-3 1999) with al., digested 3 the et 1999) both containing (Neumann backbone al., phPolI-WSN-NA et phPolI-vNA-EGFP, (Neumann generate pHH21 into cloned TACAATTTGGACTTTCCGCCC-3 5 primers, 3 with PCR CAGGGTGACAAAGACATAATGGAAGACGCCAAAAACATAAAG- by amplified satmlt.TeapiidDAfamn a ietdwith digested was fragment DNA amplified The template. a as TACTTGTACAGCTCGTCCATGCCG-3 GATCATAATC-3 PCR by generated 5 was primers, ECMV specific with from pMX-IRES-GFP derived DNA a from IRES I, amplification Pol for of system reporter IRES-mediated fragment the of construction For Bam N rgeto h oyA inl(oy)wsgnrtdb PCR by 5 generated was set (PolyA) primer signal the poly(A) with the amplification of fragment DNA a Not Bam 3 5 CGCGGATCCATGGAAGACGCCAAAAACATAAAGAAAGGC-3 DNA for The phPolI-IRES. of construction fragment in with resulting digested polymerase, was DNA which T4 pHH21, into cloned and 3 GGCCGCATTGGAATTCCCGGGATCC TCTAGATAACGTTACTGGCCGAAGC-3 9 9 9 9 -ATAGTTTAGCGGCCGCTTA kinase polynucleotide T4 with phosphorylated was fragment IRES The . n G- satmlt.TeapiidPRpoutwsdgse with digested was product PCR amplified The template. a as PGV-C and 2 n 5 and ,rsligi hoIIE-u.T osrc phPolI-IRES-Luc-PolyA, construct To phPolI-IRES-Luc. in resulting I, EGFP I n hncoe notesm ieo hoIWNN backbone. phPolI-WSN-NA of site same the into cloned then and HI, Iand HI eaiet rncito tr site). start transcription to relative 1 9 xenltasrbdsae ES ftehmnrN.The rDNA. human the of (ETS) spacer transcribed external ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal 9 -CGTCTCCTATTAGTAGAAACAAGGGTGTTTTTTATTAT- 9 9 -ACACACCACCGTTCGGCCTC-3 9 eewsapiidb C ihpies5 primers with PCR by amplified was gene o nlsso mouse of analysis For . Not o h ua DApooe ncetd oiin of positions (nucleotide promoter rDNA human the for 9 olwdb eltm C sn rmrst 5 set, primer a using PCR real-time by followed , 2 9 -AGCGACTCTGAGGAGGAACA-3 Luc ,adcoe nopPl-RSdgse with digested phPolI-IRES into cloned and I, 1 o+ eaiet rncito tr ie,ad5 and site), start transcription to relative +3 to 110 9 sn hoIWNN satmlt.ADAfragment DNA A template. a as phPolI-WSN-NA using 9 9 orsodn ote5 the to corresponding , 9 eewsapiidb C sn rmr 5 primers using PCR by amplified was gene n 5 and 9 9 n 5 and 9 sn EF-1a epae h amplified The template. a as pEGFP-C1 using b n 5 and n 5 and atn n -y-noigmN,reverse mRNA, c-Myc-encoding and -actin- 9 -GTAAAGCGGCCGCTTACGCCTTAAGA- 9 o c-Myc. for 9 -GGTCATCTTCTCGCGGTT-3 9 9 9 n 5 and GGGGTGTTGAAGGTCTCAAA-3 - -TCCCATATGTTAAACTCCTGCTTT- CAATTTGGACTTTCCGCCCTTCTTG- 9 n 5 and 9 9 9 sn G- TY n)a a as Ink) (TOYO PGV-C using , -GTAAAGCGGCCGCGACTCTA- 9 9 b n 5 and 9 CGTCTCGGGGAGCAAAAG- - T ein fteifunaviral influenza the of regions UTR atnecdn RA reverse mRNA, -actin-encoding GGTTGTGGCAAGCTTATCAT- 9 9 n 5 and -AATAACCCGGCGGCCCA- 9 sn EF-1(Clontech) pEGFP-C1 using 9 n 5 and -GTATGCAACGCCACC- 9 9 9 -GTATGCAACGCCAC- ,whichcorrespondsto 9 n 5 and 9 9 9 -TCCGTAGATTGGT- Kpn 9 -ATGGGTCAGAAG- -CGGCCGGCCAGC- T ftehuman the of ETS -CGGTCTAGAAGC- 9 n lne with blunted and I n 5 and 9 -CCGGATCCT- Bsm 9 -TGTTACCA- Luc 9 Bam -GGGGAT- then and BI, Bsm 9 -CCCTC- 9 eewas gene Nde 9 and I H for I To BI. -CGG- 3317 2 Iand 9 182 and b 9 9 9 9 9 - - - - - .

Journal of Cell Science ein nteepamd srpeetdo i.2. Fig. on represented promoter is rDNA mouse plasmids and these human in of regions structure The kinase, ligation. polynucleotide T4 by by followed phosphorylated were fragments DNA These TA-3 TACCTTCTTCAATAGTC-3 GGCCTCTCTGTCCAGTA-3 o TAF for 5 and AACTGGT-3 GTGACCCCGCTAGCGCCCTTGTC-3 TGAATTCTGTCTGT-3 TAF ATAGATTCTCTTGACC-3 GTGAACACCTGGATTTACAATAGT-3 GATTTCGGTGAAGAGTTGACA-3 3 CG-3 3 3 5 follows: as were here used primers The cells. CTAGCTAGCATGAGTGATTTC HeLa from CAGGTATGACTTCCAGGT-3 AACAGATAGAAAAGATCACAAGCATAAAAG-3 GGGG-3 GCCGCCATGGACTACAAGGATGACGACGACAAGGGCGCTAGC- 5 CTAGCTAGCATGGATGTGGAGGAGGTGAAAGCGTTCA-3 osrc xrsinvcosfrhmnTAF human for vectors expression construct DNA with amplified the digested The into were cloned template. UBF2 a and as UBF1 cells of fragments HeLa from derived cDNA using with treated was fragment ARTICLE RESEARCH 3318 fTAF of rmr sdhr eea olw:5 The follows: cells. as A9ch21 were from prepared here cDNA used using primers PCR by amplified were TAF TAF TAF 5 moIvSLcwr sda epaefrapiiainb C with PCR by amplification for 5 template primers as used were pmPolI-vNS-Luc pmPolI- pmPolI- generate To ligation. vNS-Luc, by followed kinase, polynucleotide GGA-3 9 p a eeae yPRaddgse with digested 5 and follows, as PCR were PCR by the in generated used oligonucleotides was Flag bp) cloning by into(91 constructed fragment was pCFlag tag. DNA epitope Flag of the site containing restriction the into cloned Bgl were fragments cDNA These rget fTAF of fragments Bgl C ihpies 5 by primers, amplified were UBF2 CTG-3 with and UBF1 of cDNAs PCR Flag- UBF2, of and expression UBF1 For tagged phPolI-IRES-Luc-PolyA. in resulting IRES-Luc, rget fTAF of fragments etito ieof site restriction GTTTTTTATTATTA-3 Nhe CGCGCGTCGCCT-3 ptp a.TecN rgeto TAF of fragment cDNA The tag. epitope mlfcto yPRwt rmr,5 for primers, template ATTA-3 with as PCR CCCGG-3 by used amplification phPolI-vNS-Luc phPolI-G-7,-16A-vNS-Luc, 9 9 9 9 9 -CGCGGATCCTCAGAGTCTT -CGCACGCGTTCAGTGTCTTCTTCCTTTCTTGGATCCTGA-3 ocntutepeso etrfrmueTAF mouse for vector expression construct To ognrt phPolI- generate To o TAF for n 5 and o TAF for I n lndit the into cloned and II, Ii CAvco otiiga Aeioetgo Clgvector pCFlag or tag epitope HA an containing vector pCHA in II and I I I I I DA 5 cDNA, B 5 cDNA, A prepared cDNA using PCR by amplified were fragments DNA D, n eedgse with digested were B and A 9 9 9 n 5 and 9 -CGCGGATCCTCAATGTCGTCTCACTTTCTTGGATCTTG-3 n 5 and 9 I n eedgse with digested were B and A epciey hs N rget eepopoyae yT4 by phosphorylated were fragments DNA These respectively. , I 9 DA 5 cDNA, B 9 9 ,5 Bgl -GGAAGATCTTCAGAAGCCCATTCGTGGCTTCTTCTGG- 9 9 n 5 and -ATAGGTAGTAGAAACAAGGGTGTTTTTTA-3 n 5 and I 9 DA n 5 and cDNA, C I 9 DA n 5 and cDNA, C n 5 and -AGCCACACACGGAGCGCCCG-3 -GGAAGATCTTCAGAAGCCCATTCGAGGCTTCTTCC- Ist npCFlag. in site II 9 9 -TCCAGGTCTAATAGGAACAGATAG-3 n 5 and , Eco 9 9 -CCGGAATTCAGTCACTTAAGATATCACGCGTG- 9 -CGCACGCGTATGGACTTCCCTGGCACCCTGCG- I -CTAGCTAGCATGGACCTCGAGGAGGCGGAA-3 Nhe a ietdwith digested was D I Iand RI 9 9 CandTAF D -GTTATTAGTAGAAACAAGGGTGTTTTTTATT- -AAAGAATTCTCAGTTGGAGTCAGAGTCTG-3 9 C-N-u,adpmPolI-G-7,-16A-vNS-Luc, and UCE-vNS-Luc, -CTAGCTAGCATGGACTTCCCCAGCTCCCTC- 9 and I Eco n 5 and , 9 -AATAGGTAGTAGAAACAAGGGTGTTTTT- 9 9 D 9 Bam -AAAGGATCCATGAACGGAGAAGCCGA- oevSLc phPolI- core-vNS-Luc, Ist fpAG.Fa N fragment DNA Flag pCAGGS. of site RI n 5 and n 5 and Not 9 Mlu 9 Mlu -CTAGCTAGCATGGCTCAATCAGAAG- 9 9 9 -CTAGCTAGCATGGATAAATCAGGA- Istso lsi cN31+-lg To pcDNA3.1(+)-Flag. plasmid of sites HI n 5 and n lndit the into cloned and I o TAF for I o TAF for and I 9 Dweredigestedwith npFa etrcnann h Flag the containing vector pCFlag in I 9 9 9 GGATTTACAATACTGTATTTT-3 -AGTTATTAGTAGAAACAAGGGT- AGTGAAGAATT -GGAAGATCTTTATCTATGTTCTT- -CGGCGGCCTAAAATGCCGACTC- n 5 and Nhe 9 9 -GGAAGATCTTCACATTTTCA- Bgl I n 5 and DA hs DAfragments cDNA These cDNA. D Nhe 9 9 Nhe I -CTAGCTAGCATGATGAGT- . DA DAfamnsof fragments cDNA cDNA. D and I I Ist npFa.TecDNA The pCFlag. in site II a ietdwith digested was C 9 9 9 -CGGACCTCAAAGGAAC- Iand -CGAAAGATATACCTCC- and I 9 o TAF for -CGCACGCGTCTAGGT- Mlu I ,TAF A, 9 Eco Bgl D ,adcoe nothe into cloned and I, n 5 and Bam I AAAAGGGC-3 C-N-u and UCE-vNS-Luc ,cN fragments cDNA s, Not 9 I n lndinto cloned and II, Iand RI ,5 9 I -CCGGAATTC- DA 5 cDNA, A I n cDNA and HI, Nhe iei phPolI- in site I I 9 ,TAF B, 9 -GTCCGTGT- respectively. , 9 -ACCTCCA- Eco Iand Bam 9 Mlu Nhe I The RI. n 5 and 9 I Iand HI D and C Bgl and I 9 Iand core- 9 9 and and for for II. 9 9 9 9 9 9 - - - , el .P,Jnzn .M n ja,R. Tjian, and M. H. Jantzen, P., S. Bell, rmt . oh .adPue .R. M. Paule, and E. Roth, I., Grummt, I. Grummt, I. Grummt, I. Grummt, Fel N., Gomez-Roman, C., Grandori, ut,C,Shiee . oeta,F,Htie,M .adSnoo R. Santoro, and O. M. Hottiger, F., Rosenthal, F., Scheifele, C., Guetg, irof . ud,M,Mces .A n rmt I. Grummt, and A. A. Michels, M., Dundr, H., Bierhoff, Ridderstra S., Wu, A., Arabi, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.146787/-/DC1 online available material Supplementary material Supplementary to K.N.]. 25118504 to Education, numbers 24115002 of [grant and Ministry 24115001 Japan the and of from Technology K.M., grants-in-aid and by Science, part Sports, in Culture, supported was work This Funding and lines; cell paper. A9 the provided R.F.N. wrote F.M., vectors; K.N. experiments; plasmid and performed the K.M. M.O. provided and S.U. K.M. and research; M.K. designed K.N. and K.M. contributions Author interests. competing no declare authors The interests Competing for Japan) Tsukuba, of (University Sugiyama discussion. Kenji valuable and Sekiya Takeshi thank We Acknowledgements osi .J,Pta,S,Pnv . acuoi,T,Pnv,T,Rsel J. Russell, T., Panova, T., Kasciukovic, K., Panov, S., Pathak, J., J. Gorski, C. J. Zomerdijk, and J. Russell, P., Cabart, I., K. Panov, K., J. Friedrich, M., Omori, C., Proffitt, E., S. O’Brien, B., C. Ho, J., I. Bliesath, A., Lin, Grummt, D., Drygin, and G. W. Rice, D., Drygin, Themis, L., N. England, S., Jezzard, M., R. Ekong, A., D. Trott, P., A. Cuthbert, R. Tjian, and N. Tanese, L., Comai, atnr .M,Sae .T n ja,R. Tjian, and T. S. Smale, M., M. Haltiner, ann .D,Seaosy . alr . os .adRtbu,L I. L. Rothblum, and T. Moss, L., Taylor, V., Stefanovsky, D., R. Hannan, en . ann .M,Gog,A . ai,E n ann .D. R. Hannan, and E. Sanij, J., A. George, M., K. Hannan, N., Hein, ex .adGum,I. Grummt, and J. Heix, ihrbsmlDAadatvtsRAplmrs transcription. I polymerase RNA activates and Biol. DNA ribosomal with N oyeaeI. polymerase RNA I. polymerase RNA by transcription vivo. RNA in control by mimics genes that system rRNA of J. transcription R. stimulates White, I. and and polymerase DNA N. R. ribosomal Eisenman, human A., D. Galloway, utpoencmlxsdrcsrN rmtrselectivity. promoter rRNA 954. directs complexes multiprotein So P., Hydbring, S., ir sseisspecific. species is vitro promoter. transcription. I M. rDNA polymerase B. RNA the C. in complex functions J. at Zomerdijk, pre-initiation factor and I binding polymerase upstream Chem. RNA Biol. stabilizes J. directs and RNA SL1 ribosomal formation inhibits complex CX-5461 TBP-TAF molecule small growth. tumor oral solid an and synthesis with al. et I A. Siddiqui-Jain, polymerase K., M. Schwaebe, M., Haddach, cancer. of treatment the Toxicol. for Pharmacol. target Rev. emerging an machinery: transcription genetic for panel hybrid monochromosomal 76. studies. rodent mapping genome human: and stable complementation F. highly R. a Newbold, and of M. C. Todd, M., co integral SL1. factor, are transcription factors associated I. polymerase dissociation RNA promoting by elongating transcription from gene TIF-IA rRNA of facilitates 2 kinase casein by neiac fsln DAcrmtni eitdb AP i ocdn RNA. noncoding via PARP1 by mediated Cell is Mol. chromatin rDNA silent of Inheritance iooa N rncito nnoaa adoycts mlctosfor increase to implications sufficient cardiomyocytes: is neonatal UBF1 in factor hypertrophy. transcription cardiac transcription DNA the ribosomal of Overexpression mutagenesis. scanning linker by identified gene Biol. rRNA human the in ulou:a mrigtre o acrtherapy. cancer for target emerging an nucleolus: oyeaeI. polymerase 654. 7 6 303-310. , 227-235. , ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal 45 18) pcfctasrpino os iooa N nacell-free a in DNA ribosomal mouse of transcription Specific (1981). 18) uloiesqec eurmnsfrseii ntainof initiation specific for requirements sequence Nucleotide (1982). 19) euaino amla iooa eetasrpinby transcription gene ribosomal mammalian of Regulation (1998). 790-800. , a.Cl Biol. Cell Nat. ur pn ee.Dev. Genet. Opin. Curr. 280 29551-29558. , rg uli cdRs o.Biol. Mol. Res. Acid Nucleic Prog. ebr,O,Gum,I tal. et I. Grummt, O., derberg, ¨ rc al cd c.USA Sci. Acad. Natl. Proc. Nature Cell 19) pce pcfct ftasrpinb RNA by transcription of specificity Species (1995). 50 l,K,Behf,H,Sie . ayl . Fahle K., Fatyol, C., Shiue, H., Bierhoff, K., ˚le, 131-156. , 7 68 311-318. , 20) oe B-soitdfco fSL1 of factor TBP-associated novel A (2007). 296 965-976. , acrRes. Cancer rc al cd c.USA Sci. Acad. Natl. Proc. rc al cd c.USA Sci. Acad. Natl. Proc. 173-174. , 19) osrcinadcharacterization and Construction (1995). pnnso h N oyeaeI polymerase RNA the of mponents 18) iooa N rncito in transcription RNA Ribosomal (1982). 19) h AAbnigpoenand protein TATA-binding The (1992). 5 18) w itntpooe elements promoter distinct Two (1986). 652-656. , o-dis .A,Noee,C., Ngouenet, A., Z. ton-Edkins, 21) h N oyeaeI polymerase RNA The (2010). MOJ. EMBO 19) sebyo alternative of Assembly (1990). o.Cl.Biol. Cell. Mol. 71 yoee.Cl Genet. Cell Cytogenet. 93 1418-1430. , rnsMl Med. Mol. Trends 8750-8755. , 20) -y associates c-Myc (2005). 62 20) Phosphorylation (2008). 26 20) -y id to binds c-Myc (2005). 21) agtn RNA Targeting (2011). 109-154. , 1560-1568. , ee Dev. Genes 28 78 4988-4998. , 79 727-731. , 6908-6911. , 21) The (2013). o.Cell. Mol. a.Cell Nat. 19 4 (2005). (1996). (2012). 71 643- , 943- , Annu. 68- , ´n,

Journal of Cell Science i .L,Ro .adKu,R M. R. Krug, and P. Rao, L., M. Li, R. Tjian, and S. Cordes, M., R. Learned, R. Kominami, T., Miwa, N., Takakusa, T., Sasaki, M., Nagamine, T., Kishimoto, K. Nagata, and T. Naito, A., Kawaguchi, R. Tjian, and M. R. Learned, H., M. Jones, ok .K n ose,K H. K. Vousden, and I. K. Grummt, A. Hock, and R. Tjian, A., Ravanpay, C., J. Zomerdijk, J., Heix, ARTICLE RESEARCH uao . kwk,M,Hsoa .adNgt,K. Nagata, and M. Hisaoka, M., Okuwaki, K., Murano, Y. V. Stefanovsky, and T. Moss, I. Grummt, and R. M. Neubert, Santoro, C., and L. Mayer, I. Grummt, Comai, J., Li, and K.-M., Schmitz, S. C., Mayer, Reddy, S., Navarro, Y., C. Lin, emn,G,Wtnb,T,Io . aaae . oo . a,P,Hge,M., Hughes, P., Gao, H., Goto, S., Watanabe, H., Ito, T., Watanabe, G., Neumann, K. Nagata, and A. Kawaguchi, F., Momose, T., Naito, T. Naito, and A. Kawaguchi, K., Nagata, os .adSeaosy .Y. V. Stefanovsky, M. and T. Muramatsu, Moss, and R. Kominami, I., Financsek, Y., Mishima, B. Sollner-Webb, and J. Tower, G., K. Miller, fatasrpinfco htcnespooe pcfct ohmnRNA human to specificity promoter confers that factor I. transcription polymerase gene. a RNA ribosomal of mouse of region promoter Res. Acids the in M. nucleotides Muramatsu, and complexes. polymerase RNA functional of 732-744. assembly in subunit PA expression transient by promoter gene RNA vivo. ribosomal in human the in mutations euaino h RAgn yamliucinlncelrpoen B23/ protein, nucleolar multifunctional a by gene rRNA the of regulation 545-548. genes. rRNA of state epigenetic the regulate transcripts interaction. UBF-SL1 of stabilization by Res. transcription Acids I Pol of stimulation subunits. polymerase different on 2078-2086. are endonuclease dependent conserved p53. of factors: regulation TAF initiation transcription I-specific species-specific the polymerase TIF-IB/SL1. of factor subunits RNA the between murine interactions of Cloning ee,D . oi,R,Hfmn,E tal. et cDNAs. cloned E. polymerase from Hoffmann, entirely RNA R., viruses Donis, virus R., D. influenza Perez, of import nuclear and subunits. assembly in Hsp90 genome. virus influenza the of transcription activity. 3126. chaperone histone its through nucleophosmin, rncito nekroe yRAplmrs I. polymerase RNA Biol. by species-dependent eukaryotes a in transcription of transcription identification accurate genes: for RNA factor. required initiation ribosomal factors mammalian of of I. reconstitution polymerase and RNA Fractionation by initiation accurate directs Biol. the gene Cell. to rRNA NoRC mouse complex the remodelling chromatin the targeting for nucleolus. crucial is RNA 50 25-66. , rc al cd c.USA Sci. Acad. Natl. Proc. .Virol. J. 5 MORep. EMBO 554-562. , 13 34 3515-3532. , 4752-4766. , o.Cl.Biol. Cell. Mol. uli cd Res. Acids Nucleic 81 ici.Bohs Acta Biophys. Biochim. rc al cd c.USA Sci. Acad. Natl. Proc. 1339-1349. , 18) rsneo iie ubro essential of number limited a of Presence (1985). 9 774-780. , 5 1358-1369. , 20) ttecne fekroi life. eukaryotic of center the At (2002). 21) h oeo bqii oiiaini the in modification ubiquitin of role The (2014). 19) rmto n euaino ribosomal of regulation and Promotion (1995). 20) h ciestso h nlez cap- influenza the of sites active The (2001). 10 85 rc al cd c.USA Sci. Acad. Natl. Proc. 20) h tutr fNoRC-associated of structure The (2008). 6659-6670. , 669-673. , 18) uiiainadcharacterization and Purification (1985). 20) otfcosfrrpiainand replication for factors Host (2008). 20) novmn fifunavirus influenza of Involvement (2005). 1843 18) nlsso lsee point clustered of Analysis (1988). 18) ope oto einof region control complex A (1985). e.Md Virol. Med. Rev. 19) eeaino nlez A influenza of Generation (1999). 94 137-149. , 1733-1738. , rg uli cdRs Mol. Res. Acid Nucleic Prog. o.Cl.Biol. Cell. Mol. 20) novmn of Involvement (2007). 20) CK2-mediated (2006). o.Cell Mol. 20) Transcription (2008). 20) Intergenic (2006). 18 96 247-260. , MOJ. EMBO 9345-9350. , 22 .Virol. J. 351-361. , 28 Cell Nucleic Nucleic (1982). (1997). 3114- , 109 Mol. 79 20 , , , oedj,J . ekan . oa,L n ja,R. Tjian, and L. Comai, H., Beckmann, C., J. G. Zomerdijk, Hobom, and G. Neumann, A., Zobel, J. R. White, K. Nagata, and A. Numajiri, S., Saito, K., Sugiyama, M., Mibayashi, K., Turan, T. Moss, and I. L. Rothblum, T., Gagnon-Kugler, F., Langlois, V., Stefanovsky, tfnvk,V . elte,G,Hna,R,Ggo-ulr . ohlm L. Rothblum, T., Gagnon-Kugler, R., Hannan, G., Pelletier, Y., V. Stefanovsky, cnp,A,Shap . ry .adGum,I. Grummt, and B. Erny, G., Schnapp, A., Schnapp, C. J. Zomerdijk, and I. J. Grummt, Russell, and H. Stunnenberg, L., Tora, D., Eberhard, U., Rudloff, P. Digard, and A. Portela, cnp,A,Rsnae,H n rmt I. Grummt, and H. Rosenbauer, A., I. Schnapp, Grummt, and J. Sandoval, K.-M., Schmitz, R., Santoro, I. Grummt, and R. Santoro, G. G. Brownlee, and E. Fodor, C. C., D. J. Pritlove, Zomerdijk, L., and L. Poon, J. Russell, I., K. Panov, B. McStay, B., and T. H. Panova, R. Reeder, D., A. Miller, D., T. Palmer, atr,R,L,J n rmt I. Grummt, and J. Li, R., Santoro, rncitoal cieRAplmrs ntainfco L rmrecombinant from SL1 factor initiation I subunits. polymerase RNA active transcriptionally cDNA. viral insert of transcription Biol. Cell Mol. Rev. genome. inhibit virus and influenza NP engineered virus 32 the influenza with of complex transcription a the form proteins I MxA Nuclear polymerase (2004). RNA remodeling. of r-chromatin and elongation Cell phosphorylation regulates UBF Mol. via signaling mammals in factor transcription Growth (2006). rwhfco tmlto nmmasi eitdb R hshrlto of phosphorylation ERK by mediated is mammals in UBF. stimulation factor T. growth Moss, and I. rwhrgltdtasrpiniiito atrTFI niiito complex initiation promoter. in gene ribosomal TIF-IA murine factor the at initiation formation transcription growth-regulated RNA of specificity transcription. species govern I and polymerase DNA with interact factors TBP-associated replication. virus to pivotal 83 protein RNA-binding multifunctional 3476. 6732. rncit rgntn rmasbls frbsmlDArpassilence repeats species-specificit transcription. DNA in ribosomal involved of subclass trans. in a genes RNA from ribosomal originating transcripts machinery. by synthesized is template. RNA mRNA virion virus the A in track influenza U of a tail of copying poly(A) I reiterative the polymerase that transcription. evidence DNA RNA ribosomal initiation-competent in with roles 5957-5968. multiple associates has 2 and I kinase polymerase RNA Casein an of control the under gene coding promoter. protein a of expression oCmdae eeohoai omto n iecn frbsmlgene ribosomal of silencing and formation transcription. heterochromatin mediates NoRC transcription. gene ribosomal 719-725. of silencing methylation-dependent 643-652. , 723-734. , o.Cell Mol. ora fCl cec 21)17 3931 doi:10.1242/jcs.146787 3309–3319 127, (2014) Science Cell of Journal 21 Science uli cd Res. Acids Nucleic 20) N oyeae n I,got oto n cancer. and control growth III, and I polymerases RNA (2005). ice.Sc Symp. Soc. Biochem. 629-639. , o.Cl.Biochem. Cell. Mol. a.Genet. Nat. 8 1063-1073. , 20) nimdaersos frbsmltasrpinto transcription ribosomal of response immediate An (2001). 266 6 69-78. , 2015-2018. , 32 MOJ. EMBO 393-396. , 21 20) h nlez iu ulorti:a nucleoprotein: virus influenza The (2002). MORep. EMBO n oto fmuerbsmlgene ribosomal mouse of control and y 3451-3457. , 20) oeua ehnssmediating mechanisms Molecular (2001). 20) h N oyeaeItranscription I polymerase RNA The (2006). uli cd Res. Acids Nucleic 104 NNN 20) h uloa eoeigcomplex remodeling nucleolar The (2002). 203-216. , 13 137-147. , 2611-2616. , 19) N oyeaeIcatalysed I polymerase RNA (1993). 11 52-58. , 19) rn-cigfactors Trans-acting (1991). o.Cl.Biol. Cell. Mol. 21 19) ucino the of Function (1993). 3607-3614. , 19) sebyof Assembly (1994). o.Cl.Biol. Cell. Mol. uli cd Res. Acids Nucleic .Virol. J. 21) Intergenic (2010). 19) Efficient (1993). 19) Direct (1999). .Gn Virol. Gen. J. o.Cell Mol. 13 73 6723- , (2006). 3473- , (1994). 3319 Nat. 26 8 , ,

Journal of Cell Science