Comparative Gene Expression Profiles Following UV Exposure In

Comparative Gene Expression Proﬁles Following UV Exposure in Wild-Type and SOS-Deﬁcient Escherichia coli

Justin Courcelle,*,1 Arkady Khodursky,†,1 Brian Peter,‡ Patrick O. Brown† and Philip C. Hanawalt§ †Department of Biochemistry, Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, ‡Department of MCB, UC-Berkeley, Berkeley, California 94720, *Department of Biological Science, Mississippi State University, Mississippi State, Mississippi 39762 and §Department of Biological Sciences, Stanford University, Stanford, California 94305 Manuscript received October 4, 2000 Accepted for publication January 29, 2001

ABSTRACT The SOS response in UV-irradiated Escherichia coli includes the upregulation of several dozen genes that are negatively regulated by the LexA repressor. Using DNA microarrays containing amplified DNA fragments from 95.5% of all open reading frames identified on the E. coli chromosome, we have examined the changes in gene expression following UV exposure in both wild-type cells and lexA1 mutants, which are unable to induce genes under LexA control. We report here the time courses of expression of the genes surrounding the 26 documented lexA-regulated regions on the E. coli chromosome. We observed 17 additional sites that responded in a lexA-dependent manner and a large number of genes that were upregulated in a lexA-independent manner although upregulation in this manner was generally not more than twofold. In addition, several transcripts were either downregulated or degraded following UV irradiation. These newly identified UV-responsive genes are discussed with respect to their possible roles in cellular recovery following exposure to UV irradiation.

RRADIATION of growing Escherichia coli cultures the genes normally suppressed by LexA are more fre- I with ultraviolet light (UV) produces DNA lesions quently transcribed (Sassanfar and Roberts 1990 and that at least transiently block the essential processes of references therein; Friedberg et al. 1995). An interest- replication and transcription. A large amount of work ing feature of the LexA/RecA regulatory circuit is that has demonstrated that the cell responds to this stress the timing, duration, and level of induction can vary by upregulating the expression of several genes that for each LexA-regulated gene, depending upon the lo- function to repair the DNA lesions, restore replication, cation and binding affinity of the LexA box(es) relative and prevent premature cell division. A number of other to the strength of the promoter. As a result of these genes are known to be upregulated, yet remain function- properties, some genes may be partially induced in re- ally uncharacterized. The changes in gene expression sponse to even endogenous levels of DNA damage, while in response to DNA damage produced by UV and some other genes appear to be induced only when high or other environmental agents have been collectively ter- persistent DNA damage is present in the cell. In fact, med the SOS response, after the international distress the SOS response may represent a continuum in the signal (Radman 1974 and reviewed in Friedberg et al. monitoring of environmental stress, rather than simply 1995; Koch and Woodgate 1998). operating as an emergency switch following acute injury. Many of the DNA damage-induced genes are nega- The first systematic search for damage-inducible (din) tively regulated by the LexA repressor protein, which genes was carried out by Kenyon and Walker (1980) binds to a 20-bp consensus sequence in the operator by randomly inserting a lac reporter gene into the E. region of the genes, suppressing their expression (Brent coli chromosome to identify promoters that were upreg- and Ptashne 1981; Little et al. 1981). Derepression ulated following DNA damage in a recA/lexA-dependent of these genes occurs when the RecA protein binds to fashion. Using this same technique, subsequent studies single-stranded regions of DNA created at replication identified additional din genes and in some cases identi- forks when they are blocked by DNA damage. RecA fied genes previously characterized to be involved in the bound to single-strand DNA becomes conformationally recovery from DNA damage (Bagg et al. 1981; Fogliano active, serving as a coprotease to cleave the LexA repres- and Schendel 1981; Huisman and D’Ari 1981; Kenyon sor. As the cellular concentration of LexA diminishes, and Walker 1981; Shurvinton and Lloyd 1982; Lloyd et al. 1983; Siegel 1983; Bonner et al. 1990; Iwasaki et al. 1990; Ohmori et al. 1995b). Analysis of the known din genes revealed a 20-bp consensus LexA- Corresponding author: Justin Courcelle, Department of Biological Science, P.O. Box GY, Mississippi State University, Mississippi State, binding motif, or “SOS box,” shared by these genes MS 39762. E-mail: [email protected] in their promoter/operator regions (Walker 1984), 1 These authors contributed equally to this work. which has been used in more recent studies to systemati-

Genetics 158: 41–64 (May 2001) 42 J. Courcelle et al. cally search and identify additional lexA-regulated genes from a fresh overnight culture into 200 ml Davis media and (Lewis et al. 1994; Ohmori et al. 1995a; Fernandez De incubated in a 1-liter Erlenmeyer flask at 37Њ in a New Bruns- wick Scientific (Edison, NJ) model G76 gyrotory water bath Henestrosa et al. 2000). These studies in total have 8 ϫ 10 cells/ml). A 15-W 2ف ,at 220 rpm to midlog (OD600 0.4 identified 31 genes under lexA/recA control. germicidal lamp (254 nm, 0.66 J/m2/sec at the sample posi- Other genes have been reported to be upregulated tion) provided the UV irradiation. A total of 70 ml of culture following DNA damage but are believed to be indepen- was placed into a 15-cm-diameter glass petri dish and irradi- dent of the lexA regulon. In some cases, the induction ated for 60 sec with gentle agitation. Two 65-ml unirradiated samples were also agitated in a 15-cm petri dish but were not is thought to be dependent on recA, but independent exposed to UV. A total of 70 ml of irradiated culture (in a from the LexA repressor. In other cases, genes have 500-ml Erlenmeyer flask) and 30 ml of unirradiated culture been shown to be upregulated independently from both (in a 250-ml Erlenmeyer flask) were then returned to the recA and lexA (Friedberg et al. 1995; Koch and Wood- shaking water bath for the duration of the time course. At gate 1998). The mechanism of regulation in these cases the appropriate times, 10-ml samples were placed into 20 ml of ice-cold NET (100 mm NaCl, 10 mm Tris, 10 mm EDTA), is not understood. An additional, although as yet unex- pelleted by centrifugation, washed with 1 ml cold NET, re- plored, possibility is that some genes may be repressed pelleted, and frozen at Ϫ80Њ. The limited availability of mi- or their transcripts may be degraded in response to croarray chips constrained this experiment to a single time DNA damage. course containing seven samples (five irradiated, two unirradi- It was of interest to us not only to learn whether ated) for each strain. Microarray procedures: Relative mRNA levels were deter- additional genes can be regulated in a LexA-dependent mined by parallel two-color hybridization to cDNA microarrays manner but also to determine whether other cellular representing 4101 open reading frames (ORFs) representing responses to UV irradiation exist that are lexA indepen- 95.5% of E. coli ORFs according to Blattner et al. (1997). dent. The lexA1 allele encodes an amino acid change cDNA arrays were manufactured as described in MGuide at at a position that is essential for the cleavage and inacti- http://cmgm.stanford.edu/pbrown/mguide/index.html. To- tal mRNA was extracted from 2–5 ϫ 109 cells using QIAGEN vation of LexA (Slilaty and Little 1987). Thus, in (Chatsworth, CA) RNeasy spin columns. A total of 25–30 ␮g lexA1 mutants, the LexA1 concentration remains high of total RNA was labeled with Cy-3-dUTP (or Cy-5-dUTP) in and LexA-regulated genes are not induced, even in the a standard reverse transcriptase (RT) reaction by Superscript presence of high levels of activated RecA. Therefore II (ϩ) (GIBCO BRL, Gaithersburg, MD) with 1 ␮g of random this system should allow an analysis of gene expression hexamer (Pharmacia, Piscataway, NJ) primers. Following puri- fication through Microcon-30 (Millipore, Bedford, MA) that occurs independent of the LexA repressor. (MGuide), Cy-3- and Cy-5-labeled cDNA were combined with The changes in gene expression in the entire genome SSC (2.5ϫ final), SDS (0.25%), and 40 ␮gofE. coli rRNA can be measured simultaneously using high-density (Boehringer Mannheim, Indianapolis) in a final volume of cDNA microarrays (Schena et al. 1995). DNA microar- 16 ml and hybridized to a DNA microarray for 5 hr at 65Њ. rays contain PCR-amplified DNA fragments of known Slides were washed as described in MGuide and scanned using and predicted genetic sequences that are printed on an AxonScanner (Axon Instruments, Foster City, CA; GenPix 1.0) at 10 mm per pixel resolution. Acquired 16-bit TIFF im- the surface of a glass slide. Through the comparative ages were analyzed using ScanAlyze software, which is publicly hybridization of two cellular RNA preparations, the rela- available at http://rana.stanford.edu/software/. tive difference between transcript levels of any gene Comparative measurements of transcript abundance: Time in these preparations can be determined. Using the course samples were analyzed directly by comparing the abun- complete sequence of the E. coli genome (Blattner et dance of each gene’s transcripts relative to the t0 sample. RNA samples taken during the time course were labeled with Cy-5, al. 1997), DNA microarrays were prepared containing and RNA from the t0 sample was labeled with Cy-3. PCR products corresponding to 95.5% (4101 out of Sequence analysis: Nucleotide sequences in the regions of 4295) of all annotated open reading frames in the E. induced genes were examined using the COLIBRI program coli genome (Khodursky et al. 2000). We utilized these provided by the Pasteur Institute at http://genolist.pasteur.fr/ microarrays to follow the changes in gene expression colibri/. Regions surrounding induced genes were searched for the consensus sequence CTG(N)10CAG, allowing for one occurring during the first hour following UV irradiation mismatch. Matching sequences that fell between Ϫ400 and in the wild-type strain, MG1655, and in an isogenic lexA1 ϩ100 bp of a start codon were then examined for their heterol- mutant. ogy index. The heterology index was determined as reported in Lewis et al. (1994) on the basis of the formula developed by Berg and von Hipple (1988). Heterology index ϭ MATERIALS AND METHODS ͚ ln[(n(consensus) ϩ 0.5)/(n(actual) ϩ 0.5)], where n(consensus) refers to the number of times that the most common, or Bacteria: Strain MG1655 was used as the wild-type strain consensus, base occurs at a given position in the set of known in this study since its genome has been completely sequenced binding sites, and n(actual) refers to the number of times that (Blattner et al. 1997). The MG1655 lexA1(IndϪ) malB::Tn9 the base being analyzed occurs at the same position in the was constructed by P1-mediated transduction of the lexA1 al- set of known binding sites. n values for each position of the lele from strain GC2281 (Taddei et al. 1995) into strain 20-bp LexA binding site were determined using the known MG1655. Transfer of the lexA1 allele was verified by resistance LexA-binding sites shown in Figure 1A and their respective to chloramphenicol and hypersensitivity to UV irradiation. complementary sequences. Growth and irradiation: Cells were grown in Davis medium Nomenclature: All genes are named according to the Rudd plus 0.4% glucose. Cultures were inoculated at a 1:200 dilution system at http://bmb.med.miami.edu/ecogene/ecoweb (Rudd E. coli Gene Expression Profiles After UV 43

2000). In cases where we found no corresponding Rudd gene plotted in Figure 2A. For most of the LexA-regulated for the open reading frame examined, the original identifica- genes, the level and timing of the induction observed tion numbers of Blattner, b#### (Blattner et al. 1997), were used. in our experiments are in good agreement with previous Raw data: The raw data from these experiments are avail- observations. In confirmation of previous studies, we able for download at the following web address http://www2. find that recN, recA, and sulA are heavily induced within jcc129. the first 5 min of irradiation whereas the uvrD inductionف/msstate.edu is much less robust (Casaregola et al. 1982; Arthur and Eastlake 1983; Salles and Paoletti 1983; Pick- RESULTS AND DISCUSSION sley et al. 1984; Sandler 1994). umuCumuD are also We examined the response of E. coli strain MG1655 known to be strongly induced; however, full induction following a dose of 40 J/m2 (254 nm). Previous studies of these genes is not observed until 20 min after UV in our laboratory have shown that exposing an exponen- irradiation (Woodgate and Ennis 1991). We were un- tially growing culture of E. coli to 40 J/m2 of UV produces able to assay ftsK induction in wild-type cells due to approximately one cyclobutane pyrimidine dimer on a problem amplifying the ftsK fragment when con- each strand per 6 kb of DNA (Mellon and Hanawalt structing the bacterial microarray. However, some lexA- 1989; Crowley and Hanawalt 1998). This dose tran- dependent induction is observed in lolA, possibly repre- siently inhibits both replication and transcription, and senting some transcriptional readthrough from the ftsK induces a strong SOS response (Courcelle et al. 1997; gene. In some cases, we observed co-upregulation of Crowley and Hanawalt 1998). More than half of the the neighboring ORFs that are transcribed in the same cells survive and genomic replication fully recovers orientation. This effect can clearly be seen in the induc- -min following UV irradiation. Within that tion of dinB transcription, which also renders an in 45ف within time, most of the DNA lesions have also been repaired crease in yafN, yafO, and yafP mRNA. Similarly, yebF and (Mellon and Hanawalt 1989; Courcelle et al. 1999). yebE are also induced along with LexA-regulated yebG. To examine the changes in gene expression in re- In the case of recN, the downstream genes smpA and smpB sponse to this dose of UV irradiation, we compared also appear to be upregulated following UV irradiation. samples of total RNA taken 5, 10, 20, 40, and 60 min after However, for b2619 and b2618 it is actually the antisense irradiation to samples made just prior to irradiation. To strand that would be transcribed following UV irradia- control for UV-independent changes, total RNA prepa- tion if this induction represents transcriptional read- rations from nonirradiated samples at 20 and 60 min through. The actual mechanism of such coregulation were also prepared. This analysis was carried out with could be produced by: (1) transcriptional readthrough the wild-type MG1655 strain as well as the isogenic lexA1 resulting from inefficient transcriptional termination; derivative and represents the changes in transcript levels (2) the actual operon spanning across the entire group of each gene from up to seven independent comparative of neighboring genes; or (3) a regional effect conferred hybridizations for each cell line, which were observed through protein factors or DNA structural conforma- within the same experiment. tions within the region under consideration. The average change in transcript level in the irradi- Some of the transcripts from documented LexA-regu- ated samples compared to those in the unirradiated lated genes, dinG, molR, uvrD, and uvrA, did not signifi- samples for each gene along the E. coli chromosome is cantly rise following UV irradiation. However, in each plotted sequentially in Figure 1. In some cases, no data of these cases, the samples of these transcripts in the were plotted for a gene, because either the PCR reaction unirradiated (control) culture were significantly de- failed during microarray construction or the fluorescent creased during the time course. The reason for this signal in the unirradiated samples was too low for reli- observation is unclear. However, both initial and unirra- able detection. However, raw data for any or all genes diated samples were “mock” UV treated by gentle agita- are available for downloading at the web addresses indi- tion for 60 sec in a 15-cm glass petri dish and it is cated in materials and methods or upon request to possible that some genes were affected by this treatment. the authors. Importantly, however, when comparing the net change Genes induced in a LexA-dependent manner follow- in irradiated and unirradiated samples, the lexA-depen- ing UV irradiation: Twenty-six functional LexA-binding dent induction of these genes is clearly evident: 1.77-, regions controlling at least 31 genes have been pre- 1.78-, 2.51-, and 3.85-fold increases, respectively. viously demonstrated to be functionally active following Of the reported LexA-regulated genes, we did not irradiation. At the time at which these bacterial microar- detect significant induction of either hokE or ssb in our rays were constructed, 3 of these genes, ysdAB, dinQ, experiment. recA/lexA-dependent transcription from and dinS, had not yet been identified as open reading hokE has previously been shown to occur in the E. coli frames (Fernandez De Henestrosa et al. 2000) and strain RW118 following mitomycin C treatment (Fer- were not included in our analysis. The time courses nandez De Henestrosa et al. 2000). However, the observed for all other genes/operons known to be regu- SOS induction of ssb is less clear. Although a plasmid- lated by LexA and that contain LexA-binding sites are encoded ssb has been shown to be slightly upregulated 44 J. Courcelle et al.

Figure 1.—Changes in gene expression within the E. coli genome following UV irradiation. The average change in transcript levels in the irradiated samples compared to unirradiated samples for each gene along the E. coli chromosome is plotted sequentially. Open squares, wild type; solid circles, lexA1. The location of genes on the chromosome, in kilobase pairs, is indicated along the top of each graph. The average change in transcript levels was calculated as the (average change in irradiated samples)/ (average change in unirradiated samples). The data for all plotted genes represent an average of between 3 and 5 irradiated time points and at least one unirradiated time point. Time points for which the PCR or hybridization failed, or the fluorescent signal generated by the unirradiated sample was Ͻ30% above the background level of fluorescence, were not included in the averages. E. coli Gene Expression Profiles After UV 45

Figure 1.—Continued. 46 J. Courcelle et al.

Figure 1.—Continued. E. coli Gene Expression Proﬁles After UV 47

Figure 1.—Continued. 48 J. Courcelle et al.

Figure 1.—Continued. E. coli Gene Expression Proﬁles After UV 49

Figure 1.—Continued. 50 J. Courcelle et al. E. coli Gene Expression Profiles After UV 51 following SOS induction, no induction of the chromo- lation, or through other regulatory proteins that are somally encoded ssb has been reported and SOS induc- inactivated by a similar RecA-catalyzed proteolysis. The tion does not lead to higher levels of SSB protein (Brand- activated form of RecA is also known to induce proteo- sma et al. 1983; Perrino et al. 1987). lytic cleavage of other proteins containing “LexA-like” If the LexA-binding site is located within the operator cleavage motifs such as those found in UmuD, the plas- regions of two diverging transcripts, it is possible that mid-encoded MucA, and the repressor proteins of sev- a single site may regulate the transcription of both oper- eral bacteriophage (Little 1984; Perry et al. 1985). ons. This is presumed to be the case at uvrA and ssb This possibility is especially attractive considering that and also appears to occur between ybiA and dinG as well several of the newly identified genes, borD, the lit-intE as umuCD and hylE. region, and ogrK, share homology with cryptic prophage In addition to the previously reported lexA-regulated genes. The borD gene product is a homolog of the phage genes, we observed several other genes that appeared ␭ Bor protein, a lipoprotein expressed during lysogeny to be upregulated in a LexA/RecA-dependent manner that is present in the outer membrane. The borD gene (Figure 2B). However, to determine whether these product shares homology to other bacterial virulence genes are directly under LexA control will require fur- proteins and its expression increases E. coli survival in ther investigation. Some of these genes do appear to animal serum (Barondess and Beckwith 1990, 1995). have potential candidate LexA boxes (Table 1B). One lit, intE, and several genes of unknown function in method of predicting whether a LexA-like sequence will this same region are expressed at relatively late times bind LexA is to examine its heterology index (HI), following UV exposure (Figure 3). lit encodes a prote- which is a value derived from a mathematical formula ase specific for elongation factor EF-tu. Expression of ranking the relatedness of a potential sequence to that lit is induced at late times following phage T4 infection of known LexA-binding sequences (Lewis et al. 1994). and prevents late phase phage amplification through Low HI values predict that a potential sequence is more its EF-tu proteolysis (Georgiou et al. 1998). Following likely to bind LexA protein. Previous studies found that T4 infection, the endogenous lit gene has been sug- lexA sequences with an HI value of Ͻ15 generally bound gested to trigger an apoptotic-like death of the infected LexA (Lewis et al. 1994) and recently this method was cell, thereby thwarting the reproduction of the virus and used to identify seven new lexA-regulated genes (Fer- precluding the widespead infection of the population. nandez De Henestrosa et al. 2000). However, there Further characterization is required to know whether are exceptions to the predictions from HI values. On this activity or any of the genes in this region affect the basis of earlier calculations that were based upon a recovery following DNA damage. smaller set of lexA sequences, Fernandez De Henes- ogrK is a prophage gene from a phage P2. Ogr has trosa et al. (2000) found that although dinJ had an HI been shown to regulate late P2 gene transcription value of 7.06, it did not bind LexA. Yet ybfE, which they through an interaction with the host RNA polymerase calculated to have an HI value of 14.07, did bind LexA (Wood et al. 1997). Additionally, an ogr-like gene, regC (Lewis et al. 1994). This observation suggests that all in Serratia marcescens, has been shown to be induced factors comprising a functional LexA box have not yet following mitomycin C treatment in an SOS-dependent been identified. Therefore, we have recalculated the HI manner (Jin et al. 1996). values using all 28 functional LexA sequences found on grxA is a glutoredoxin that acts as a hydrogen donor the chromosome and we have included any potential for the E. coli ribonucleotide reductases. Several thiore- LexA-binding sequence with an HI value of Ͻ20 in doxin and glutoredoxin genes in E. coli are coregulated Table 1B. with ribonucleotide reductase gene expression (Prieto- While some of these newly identified genes appear Alamo et al. 2000). From this perspective, it is interesting to have potential LexA-binding sequences, many of the to note that the ribonucleotide reductase genes nrdA induced genes do not, suggesting that in some cases and nrdB are among the strongest lexA-independent the regulation may occur indirectly. Indirect lexA-depen- induced genes following UV exposure (Figure 4). grxA dent induction of these genes might occur through is also induced in an oxyR-dependent manner under regulatory proteins that are themselves under lexA regu- some conditions (Prieto-Alamo et al. 2000).

Figure 2.—Transcriptional induction following UV irradiation in the genes surrounding known LexA boxes. The change in transcript levels for the indicated gene is plotted over time. The arrows indicate the direction of transcription within the operon relative to the LexA box. Arrows pointing left are transcribed on the minus strand and arrows pointing right are transcribed on the plus strand. The locations and distances, in base pairs, of the LexA box from the initial ATG codon are indicated in the boxes. The graphs of genes that are directly adjacent on the chromosome are joined together. The location of the gene(s) on the chromosome, in kilobase pairs, is indicated along the top of each plot. Solid squares, irradiated wild type; open squares, unirradiated wild type; solid circles, irradiated lexA1; open circles, unirradiated lexA1. Time points in which the PCR or hybridization failed, or the ﬂuorescent signal generated by the unirradiated sample was Ͻ30% above the background level of ﬂuorescence, are not plotted. 52 J. Courcelle et al.

TABLE 1 TABLE 1 Known and potential LexA boxes surrounding induced genes (Continued)

HI Bases A. Known genes LexA box sequence valuea HI from B. Potential LexA box valueb start ysdAB tactgtttatttatacagta 1.81 umuDC tactgtatataaaaacagta 2.12 intE region sbmC tactgtatataaaaacagta 2.12 intE ggctgctgaaaaatacagaa 16.94 Ϫ195 pcsA aactgtatataaatacagtt 2.19 ymfI ttctgtaccagaaaacagtt 15.48 84 recN no. 1 tactgtatataaaaccagtt 3.53 ymfM agctgcaggagcatgcagca 19.32 Ϫ122 dinQ tactgtatgattatccagtt 3.92 lit tgatgacagagtgtccagtg 20.32 Ϫ193 urvB aactgtttttttatccagta 4.26 ymfE cactggacactctgtcatca 20.32 Ϫ280 dinI acctgtataaataaccagta 4.84 intE ggcggtataagcatccagtg 14.76 84 hokE cactgtataaataaacagct 4.92 intE tgctgaaaaatacagaagta 20.81 Ϫ192 recA tactgtatgctcatacagta 4.98 ymfM ggcagttattcaaaacagat 19.98 Ϫ222 sulA tactgtacatccatacagta 5.39 ymfM aaccgcatgagaagacagca 18.91 Ϫ173 uvrA tactgtatattcattcaggt 6.23 ymfN aactgattgcgcttcctgta 16.89 Ϫ312 ssb acctgaatgaatatacagta 6.23 ymfN cgctggttcaaagatcacta 20.90 Ϫ152 yebG tactgtataaaatcacagtt 6.26 ymgF region lexA/denF no. 2 aactgtatatacacccaggg 7.25 ymgF cggtgtaattatagacagct 15.08 Ϫ105 ydjQ cactggatagataaccagca 7.42 ymgH aactgaaaaaactccccggg 19.13 6 lexA/dinF no. 1 tgctgtatatactcacagca 7.45 ydeO region ruvAB cgctggatatctatccagca 7.59 ydeO aaatgcatgcgaccacagtg 20.68 Ϫ272 yjiW tactgatgatatatacaggt 7.92 ydeT region molR aactggataaaattacaggg 8.14 ydeS tactgaaccagcagacagca 16.79 Ϫ43 dinS agctgtatttgtctccagta 8.24 yneL cactgcatacgaaaacacca 18.21 Ϫ57 uvrD atctgtatatatacccagct 8.46 yoaA region recN no. 2 tactgtacacaataacagta 8.50 yoaB ccctgttgatttgaacaggg 13.32 Ϫ123 dinG tattggctgtttatacagta 8.65 yoaA ccctgttcaaatcaacaggg 13.32 Ϫ24 yigN aactggacgtttgtacagca 8.82 ogrK region ydjM1 tactgtacgtatcgacagtt 9.05 ogrK cattgtcctttatgccagca 19.29 8 ftsK tcctgttaatccatacagca 9.18 ogrK gactggacaatcactaaggt 19.35 Ϫ193 dinB cactgtatactttaccagtg 9.40 yqgC region recN no. 3 taatggtttttcatacagga 10.08 yqgC acatggattttccagcagtg 18.78 Ϫ193 ydjM2 cactgtataaaaatcctata 10.85 yqgC ctcagtaactgtaaccagct 20.65 Ϫ41 ybfE aactgattaaaaacccagcg 10.92 yhiL region polB gactgtataaaaccacagcc 12.55 yhiL atctgtttttcagacaagta 18.22 Ϫ63 yhiL tgctgttgttttttacaatt 12.30 Ϫ187 Concensus taCTGtatatatataCAGta glvB region glvG tcctgaagtggcattcagcg 17.45 211 (continued) glvG taatgaccaaattctcagtg 19.17 0 glvB tgctggtgggaattaccgaa 20.04 Ϫ174 glvC ggctggccaaaagtacaaat 20.85 578 glvB induction is unusual in that glvB lies in the mid- glvC tgctgtcggtttacccattg 15.97 214 dle of a predicted operon and encodes a portion of a ipbA region tgctgaaaataacatcatca Ϫ protein transport system. Nevertheless, glvB induction ibpA 17.25 249 yigN region was also observed following exposure to gamma irradia- yigN aactggacgtttgtacagca 8.82 Ϫ61 tion (data not shown) and may be driven from an alternative promoter or alternative open reading frame in a HI values were calculated from all sequences reported by the region. Lewis et al. (1994) and Fernandez de Henestrosa et al. (2000). The HI values reported here were calculated to in- In the case of yigN, a previous study has demonstrated clude the results of Fernandez de Henestrosa et al. (2000) that it contains a functional LexA binding site; however, and therefore differ from the values used in their previous no further increase in yigN expression was observed study. b following treatment with mitomycin C in wild-type, No sequences with HI values Ͻ20 were found for grxA, lexA51 (deﬁcient), or lexA1 (uninducible) E. coli cul- borD, ybiN, arpB, yccF,oryifL. tures. We have no clear explanation of this difference. However, alternative promoters proximal to yigN could ibpA (hslT) and ibpB (hslS), encoding heat-inducible have allowed for full expression to occur in these previ- chaperonins, were also induced in a LexA-dependent ous studies prior to mitomycin treatment since yigN manner. appeared to be heavily expressed under all conditions There has been little functional characterization of in that study (Fernandez De Henestrosa et al. 2000). the remaining induced genes. yoaA shares homology E. coli Gene Expression Proﬁles After UV 53

Figure 3.—Genes that displayed the largest LexA-dependent transcriptional induction following UV irradiation are plotted. The change in transcript levels for the indicated gene is plotted as in Figure 2. Solid squares, irradiated wild type; open squares, unirradiated wild type; solid circles, irradiated lexA1; open circles, unirradiated lexA1. 54 J. Courcelle et al.

Figure 4.—Representation of genes dis- playing a LexA-independent transcriptional induction following UV irradiation. The change in transcript levels for the indicated gene is plotted as in Figure 2. (A) The largest LexA-independent inductions. (B) Typical proﬁles of genes with an early UV- dependent transcriptional induction. (C) Typical proﬁles of genes with a slow UV- dependent transcriptional induction. Solid squares, irradiated wild type; open squares, unirradiated wild type; solid circles, irradiated lexA1; open circles, unirradiated lexA1.

with other ATP-dependent helicases. The gene products ularly impressive considering that these nucleotide me- of ydeT, ydeS, and ydeR share homology to other fimbrial tabolism genes are often found in very small operons proteins. b1169 ycgH has homology with other ATP-bind- spaced throughout the genome. Other categories of ing subunits of transport systems. Both ydeO and ydiW genes that appeared to be upregulated included heat- have motifs that suggest they may function as transcrip- shock or chaperone proteins as well as several of the tional regulators. No significant homology between genes involved in RNA metabolism. It is notable that ybiN, yqgC, yhiJL,oryifL and any other characterized nearly half of the genes that were upregulated have had proteins has been reported. little or no functional characterization. Genes induced independently of LexA following UV Loss of gene expression following UV irradiation: irradiation: The time courses of the largest lexA-inde- Whereas several studies have focused upon the need to pendent inductions are plotted in Figure 4A. Most strik- upregulate certain gene products following UV irradia- ing is precisely how few lexA-independent changes occur tion, it has remained relatively unexplored, yet very pos- following UV exposure. In general, lexA-independent sible, that repression or even active degradation of some inductions, with the exception of nrdA, nrdB, and yeeF, gene transcripts will also be an important factor in cellu- are in the range of twofold effects. Furthermore, many lar recovery. The bacterial microarray offers an opportu- of these lexA-independent profiles appear to rise very nity to address this very question. Indeed, repression rapidly (within the first 5 min) and then either subside was observed in a large number of genes following UV or plateau. A large number of genes and regions were irradiation. However, our results do not allow us to observed to be regulated in this manner and some gen- determine whether the decrease in a given transcript eralizations are apparent from both Figure 1 and Table represents diminished transcription or accelerated deg- 2. Many proteins associated with the replication machin- radation in response to UV irradiation. Nevertheless, a ery are slightly induced following UV irradiation. Addi- large number of genes in the wild-type, but not in the tionally, several genes associated with purine and pyrimi- lexA1, samples were reduced in their transcript levels at dine metabolism seem to be upregulated in a similar the 5-, 10-, and 20-min time points following irradiation. manner. Although not dramatic, these results are partic- This observation may suggest that some inhibition of E. coli Gene Expression Profiles After UV 55 ) continued ( 32 in mutant -subunit ␴ ␤ : minutes post irradiation TABLE 2 lexA1 Replication and repair c Transcription and transcriptional regulation 20 60 20 60 (No (No (No (No Genes with increased transcript levels following UV-irradiation Wild type: minutes post irradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b WT 1.627 1.6331.482 1.6211.622 2.45 1.433 2.06 1.32 1.13 1.52 1.59 0.83 1.32 1.2 0.8 1.64 1.37 1.28 1.1 0.84 1.2 1.11 2.57 1.33 0.91 2.07 0.57 1.68 1.72 0.71 1.41 1.35 1.67 1.54 1.27 1.53 1.88 1.03 1.56 1.92 1.17 1.68 1.15 DNA 1.91 0.93 initiation of 1.14 chromosome DNA replication replication initiation 1.19 and chain Rep elongation helicase, chromosome replication 7.749 1.0984.142 1.4963.846 3.66 1.1673.552 3.16 5.8 1.0433.2 1.96 4.42 7.083.361 4.54 1.79 4 1.098 0.8522.505 5.72 4.6 1.68 1.127 1.461.792 2.78 5.25 1.37 1.675 5.03 3.071.684 1.25 1.7 0.71 3.35 1.59 1.18 1.22 4.62 3.76 1.02 2.13 0.39 1.61 0.94 1.1 3.3 1.83 1.22 0.44 1.11 2.41 1.65 1.07 1.03 1.15 1.06 1.46 1.47 0.99 2.271.931 1.01 1.02 1.11 2.14 1.11 0.63 0.889 0.88 1.09 1.491.375 0.81 1.35 0.52 0.98 1.16 0.91 0.85 0.47 1.452 0.94 1.63 0.55 3.19 1.05 1 0.87 0.83 1.31 1.03 0.56 1.68 0.91 1.01 0.79 0.74 0.59 2.96 0.88 1.1 0.98 1.35 0.764.8 0.68 1.1 0.85 0.66 0.88 0.87 0.81 0.76 0.73 2.66 1.034.461 0.69 DNA 2.01 PolIV DNA 0.8 0.82 repair; 1.07 repair; 0.914 1.17 1.02 excision 0.59 0.89 excision 1.651.479 nuclease 2.78 2.19 nuclease 1.2 subunit 1.2 subunit 0.86 2.25 A 1.11 2.819 B 3.211.71 0.91 0.81 2.22 0.84 1.75 2.46 0.98 1.15 1.33 1.061.92 1.31 1.42 3.07 Putative 1.6 2.131 0.91 0.62 0.97 excinuclease 1.09 DNA 2.81 subunit polymerase 1.442.294 0.86 0.5 II 0.65 Holliday 0.98 3.08 1.15 2.33 junction ND 1.01 1.366 helicase 0.73 3.242.081 DNA subunit 1.08 0.69 excision B; 0.85 1.01 2.77 ssDNA 1.84 repair; branch 1.555 and2.179 3.02 1.02 helicase migration 2.78 1.58 1.84 dsDNA 1.01 II binding, 0.64 1.408 0.95 ATP 2.51 1.36 1.512.412 1.94 1.02 binding 2.19 1.98 1.82 DNA 0.61 1.55 1.009 0.86 polymerase 0.581.75 2.67 1.43 III, 0.49 1.33 1.94 0.61 1.49 1.09 1.77 0.51.474 1.64 0.7 1.595 2.07 0.84 1.64 1.12 0.95 1.35 2.01 1.839 2.161.728 0.59 0.6 1.16 Holliday 0.87 3.37 1.04 1.53 1.77 junction 1.6 1.345 helicase 2.11 0.98 1.221.696 1.96 10.33 0.98 1 subunit 1.53 0.67 A; 1.35 Holliday branch 1.08 2.56 0.83 1.329 2.78 0.89 junction migration 2.07 0.6 1.42 2.98 nuclease; 1.62 0.96 0.98 resolution 2.73 1.01 of 0.82 1.77 1.06 2.32 1.7 structures 0.69 0.49 1.63 2.41 1.16 1.58 1.09 1.1 0.69 0.78 1.43 2.43 1.4 1.47 2.1 0.9 1.54 2.38 0.62 1.56 2.86 0.9 1.24 2.07 0.65 1.44 Regulator 1.28 1.25 1.29 for 1.48 0.97 SOS(lexA) 2.25 0.61 1.52 1.2 regulon 0.69 1.65 1.34 0.88 1.03 2.56 Inducible 1.05 2.1 0.7 ATP-independent 1.13 1.12 RNA RNA Damage-inducible 2.71 1.05 1.17 polymerase, helicase protein 1.4 1.11 sigma(70) 2.78 I factor 1.44 1.69 0.81 DNA 1.19 0.95 inversion 2.4 factor, 1.52 1.64 1.66 0.94 transcription 1.23 1.06 factor 1.58 Enhances 1.76 1.45 2.3 synthesis 1.32 0.85 of 1.44 2.04 1.28 1.18 1.06 2.49 1.17 1.82 1.24 1.19 1.1 2.72 0.94 1.22 1.29 Putative 1.31 ARAC-type Putative 1.03 1.45 1.23 regulatory transcriptional protein 1.45 regulator RNase 0.94 1.48 PH ATP-dependent 1.05 1.08 RNA helicase 0.93 RNase P component; 0.83 processes tRNA, 4.5S Regulation RNA of superoxide response regulon Probable ATP-dependent RNA helicase 20.620.18 0.97417.36 0.937 5.2210.08 28.94 1.046 20.59 26.2 1.251 5.13 15.58 26.7 12.42 39.36 6.16 28.56 22.74 29.76 6.28 27.07 1.11 23.07 0.9 1.36 9.26 8 1.31 0.95 8.49 0.79 0.91 1.18 0.8 0.95 4.57 0.69 0.97 0.6 0.85 0.94 1.04 0.9 1.01 0.78 1.04 1.11 1.09 0.76 0.94 1.01 0.95 0.99 PolV, SOS 1.03 0.93 mutagenesis 0.76 1 1.04 Protein used 1.12 in DNA repair 0.8 0.95 SOS 0.84 mutagenesis; forms complex Homologous with strand PolV pairing, DNA strand exchange a a a a a a a a a a a a a a a a a a dnaA dnaC rep ruvB ttk uvrB uvrA ruvA polB ydjQ uvrD recF dnaN ruvC lexA dinI deaD rpoD hepA fis suhB ydeO rph srmB soxS rnpA recN umuD recA dinB umuC Gene (ave) 56 J. Courcelle et al. ) continued ( -subunit, B2 -subunit, B1 ␤ ␣ -manno-octulosonate transferase d -phosphate decarboxylase Ј : minutes post irradiation TABLE 2 (Continued) lexA1 Nucleoside metabolism Translation/amino acid metabolism c 20 60 20 60 (No (No (No (No Wild type: minutes post irradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b WT 1.708 1.6451.656 1.5761.662 2.51 1.541.485 2.01 2.8 1.7151.598 1.49 2.13 1.5941.698 1.59 1.62 1.28 1.65 1.4921.682 1.97 3.36 1.49 1.75 1.5071.759 1.27 3.63 1.39 2.55 1.1 1.2981.67 1.79 2.2 1.53 1.67 2.7 1.37 0.98 1.33 1.85 1.26 1.375 1.69 1.03 1.73 1.65 1.86 2.71 1.01 1.63 1.98 1.25 3.65 1.7 2.13 1.64 0.98 1.58 2.94 0.87 1.14 0.97 2.84 1.46 2.19 1.68 0.94 1.96 1.82 1.18 1.82 1.4 2.12 1.88 1.83 1.9 1.64 2.04 1.6 1.59 2.24 1.61 3.49 1.07 1.91 1.76 0.93 2.15 1.62 2 1.51 1.08 1.13 0.95 1.59 2.67 1.87 1.46 2.04 1.9 1 0.63 1.95 1.5 1.67 1.38 1.1 1.7 1.58 1.53 1.84 1.28 1.39 Arginine 1.45 1.86 1.68 1.22 1.66 1.03 tRNA Aspartate 1.45 synthetase tRNA 0.96 1.67 synthetase Peptide 1.23 1.9 chain 1.59 1.6 1.03 release 1.45 Biosynthetic factor arginine RF-3 1.04 Peptide decarboxylase chain 1.69 release 1.43 1.03 1.97 factor RF-2 1.2 1.05 (3R)-hydroxymyristol acyl carrier 2.05 1.2 dehydratase 1.24 1.2 tRNA-guanine Putative transglycosylase lysyl-tRNA synthetase 1.41 Glutamate tRNA synthetase, catalytic subunit 1.964 1.3311.833 1.4471.494 4.08 1.7571.728 2.04 2.34 1.5151.601 1.13 1.89 1.61 1.6021.602 3.13 1.06 1.08 2.12 1.561.416 2.9 2.37 0.89 2.09 1.7321.641 1.24 1.27 2.36 0.88 0.93 1.95 1.5041.509 1.47 1.54 1.39 3.24 0.91 1.33 1.5321.479 0.97 1.96 1.68 1.53 1.72 0.96 0.62 1.5261.666 2.17 1.13 2.64 1.51 2.19 1.28 1.72 1.25 0.7 1.31 1.319 1.421.557 3.31 1.89 1.76 1.8 2.65 0.95 1.51 1.76 1.68 1.426 1.51.494 2.85 1.26 1.41 2.82 2.5 1.53 1.49 1.42 1.478 1.231.839 1.39 1.5 8.04 2.01 1.21 1.81 2.39 1.6 1.9 0.85 2.33 0.92 1.1241.457 1.48 0.72 1.05 2.06 5.09 1.11 2 1.19 1.75 3.38 0.84 1.61 1.438 1.091.5 1.81 1.62 1.38 1.61 1.71 0.93 1.55 2.98 0.82 Nucleoside 1.23 1.66 1.8 channel;1.623 2.26 1.67 1.05 3.18 1.79 phage 1.06 1.36 0.49 1.44 0.92 T6 5.8 1.49 1.37 1.25 1.225 1.8 receptor 1.9 1.43 and 1.56 2.01 2.02 0.99 colicinK 1.78 0.85 2.34 GMP 1.51 1.5 synthetase 1.14 0.82 1.98 Agmatinase (glutamine-hydrolyzing) 2.14 1.53 2.73 1.69 2.35 1.88 1.03 1.75 1.3 1.3 1.75 1.73 2.2 2.76 1.11 1.09 1.29 1.55 1.72 1.8 2.68 0.58 1.9 3.57 PRPP 1.97 1.26 0.96 1.86 aminotransferase 1.25 0.66 0.86 1.64 2.02 1.56 1.67 2.6 1 Flavoprotein 0.6 1.51 1.65 affecting 0.99 2.18 1.06 1.7 1.01 DNA 1.51 1.85 panthothenate 1.21 1.63 metabolism 0.93 1.08 0.67 1.36 2.18 1.92 1.17 1.2 1.32 1.06 1.89 Deoxyuridinetriphosphatase Uridylate 1.13 kinase 1.36 1.48 0.7 dATP 1.2 1.48 1.29 1.06 pyrophosphohydrolase IMP 1.34 dehydrogenase 1.55 1.24 0.92 1.4 0.72 1.17 Adenylosuccinate 1.2 0.93 lyase 1.8 1.25 1 1.02 1.01 1.48 1.01 1.46 1.24 1.33 0.93 1.06 1.68 1.37 1.15 Guanine-hypoxanthine 0.94 Dihydro-orotate phosphoribosyltransferase 1.12 1.09 dehydrogenase 0.81 0.86 1.46 1.14 0.87 Orotate 1.05 AICAR 0.81 phosphoribosyltransferase formyltransferase; 1.39 IMP UDP-N-acetylenolpyruvoylglucosamine cyclohydrolase reductase 0.95 1.08 0.85 1.01 0.77 Cytidylatate kinase CTP:CMP-3deoxy- 2.117 2.9562.126 1.9221.734 1.4 14.45 1.701 1.26 9.43 2.13 2.51 7.34 1.97 5.92 8.62 1.2 4.47 3.32 2.66 1.53 3.93 1.41 4.19 2.1 0.81 4 1.05 1.1 2.25 3.53 1.22 5.23 2.26 1.96 1.57 7.14 2.63 1.49 1.15 2.76 1.08 1.76 1.53 Ribonucleoside reductase 1.63 1.98 1, Uracil 0.93 phosphoribosyltransferase 1.13 Orotidine-5 4.515 1.205 2.18 25.25 9.65 1.9 1.2 1.66 1.9 1.07 0.91 1 1.06 1.23 0.95 0.8 Glutaredoxin coenzyme for ribonucleotide reductase 1.747 1.123 1.16 1.15 1.9 1.73 0.96 0.89 0.69 1.16 1.05 1.14 1.34 1.15 1.01 1.07 Putative aminopeptidase 2.051 5.046 2.11 2.06 3.15 8.28 6.5 2.37 1.94 1.06 1.66 4.91 11.74 20.49 1.77 1.39 Ribonucleoside reductase 1, a a A 1.613 1.381 1.22 0.84 0.83 1.05 0.9 0.61 0.59 1.8 1.5 1.55 1.58 1.82 1.14 1.25 Synthesis of queuine in tRNA argS prfC aspS speA prfB fabZ tgt yjeA gltX que yafT tsx guaA speB purF dfp pyrH ntpA dut gauB purB gpt pyrD purH pyrE murB cmk kdsB nrdB upp pyrF Gene (ave) nrdA grxA E. coli Gene Expression Profiles After UV 57 ) continued ( chain ␤ Bor protein homolog ␭ transport, system I ϩ 2 : minutes post irradiation Others TABLE 2 (Continued) Cell Division Prophage genes lexA1 Heat shock, transport proteins c 20 60 20 60 (No (No (No (No Wild type: minutes post irradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b WT 5.823 1.0865.737 0.9023.086 4.16 2.8152.986 1.65 0.913 6.08 3.691.805 0.9 5.67 4.64 20.67 1.63 10.37 2.97 3.84 1.76 1.88 2.07 3.5 3.82 8.271.833 1.29 0.74 1.37 1.2261.559 1.91 1.97 1.22 0.49 1.13 1.498 1.151.501 4.54 1.25 1.05 1.08 1.27 1.08 1.4891.554 1.64 2.21 3.13 1.12 1 4.98 1.381.383 4.53 1.17 1.73 3.8 2.01 1.98 1.4981.61 0.98 3.66 1.58 1.41 2.87 2.85 2.77 1.1 0.931.503 2.03 1.241 1.04 1.75 2.44 2.39 2.07 2.14 1.305 2.06 1.08 1.2 2.3 2.04 0.91 4.43 1.54 2.61 2.38 2.54 0.84 0.88 2.08 3.15 1.11 1.62 Putative 0.9 1.21 1.17 ATP-binding 3.36 2.05 1.99 2.52 transport 1.76 1.17 1.65 2.89 system 1.2 1.17 1.82 component 1.03 1.29 PTS 1.75 1.58 Putative system, 2.38 0.99 2.07 1.43 amino arbutin-like 1.04 1.24 1.12 acid/amine IIB 0.82 transport component 2.44 2.51 1.437.57 1.79 1.23 protein 1.09 2.92 1.37 2.02 1.37 1.04 2.1 1.244.292 1.47 1.034 1.34 2.37 Mg 1.01 1.4 1.52 0.96 0.905 1.983.658 2.05 2.02 1.26 1.75 1.2 0.09 0.97 1.38 1.15 1.004 1.982.514 1.05 1.42 1.05 1.74 2.51 1.28 2.69 Putative 1.31 0.996 1.75 dnaK2.191 Spermidine/putrescine 0.7 1.82 1.17 2.23 protein transport 1.41 1.01 system 1.58 1.38 1.242 permease 1.161.854 0.75 1.17 2.09 1.23 1.32 1.76 1.02 1.19 1.004 Heat-shock 1.06 Spermidine/putrescine 2.98 1.31 protein transport 1.64 1.72 hslVU, system 7.96 1.27 ATPase 1.17 permease 1.16 9.35 subunit 4.7 21.11 1.05 1.5 Uracil 1.54 13.56 transport 1.06 1.65 5.6 1.28 4.5 1.36 1.29 4.95 1.43 6.89 1.12 3.35 Spermidine/putrescine ATP-binding 0.91 periplasmic component 3.68 Third transport of 3.23 6.28 arginine protein 0.96 spermidine 7.12 transport transport system, 1.1 0.95 5.15 ATP-binding 1.59 0.54 1.17 1.69 1.01 0.39 1.11 2.97 1.03 1.85 1.1 0.98 2.61 1.15 0.9 1.12 1.04 3.16 1.03 1.03 1.11 1.03 1.16 0.94 1.14 1.17 1.14 1.05 1.12 0.96 1.1 Prophage 2 1.02 e14 integrase 1.01 0.94 1.03 0.93 1.05 1 1.01 1.09 1.15 1.03 0.9 Orf, 1.02 0.94 hypothetical 0.9 protein 1.08 1.14 Orf, hypothetical Bacteriophage Prophage Orf, protein P2 hypothetical ogr protein protein 2.1591.788 ND 2.2492.743 1.96 1.1892.087 3.05 1.744 1.411.894 2.18 2.231.857 1.83 1.24 ND 3.18 2.53 1.703 1.59 1.73 8.5 2.73 2.52 1.14 1.24 2.08 1.8 2.97 1.29 0.99 1.66 1.38 4.35 1.24 0.8 1.38 0.88 1.3 3.08 0.68 0.78 1.8 1.1 1.09 0.7 1.57 1.89 1.11 1.28 1.97 2.38 1.02 1.17 1.78 2.01 2.24 1.01 0.41 2.13 0.71 1.07 2.95 1.93 1.64 1.02 1.08 1.57 1.84 0.91 1.48 0.94 3-oxoacyl-[acyl-carrier-protein] 1.18 0.84 synthase 1.6 II 1.18 Protein phosphatase Putative 2 dehydrogenase 1.63 0.93 0.93 Riboflavin synthase, Hemolysin E 1.678 1.5581.5951.791 1.14 ND 1.3681.555 0.87 1.29 3.05 ND 0.78 1.18 3.15 0.93 1.25 1.04 1.77 1.02 1.19 1.31 0.52 4.85 1.25 0.61 1.12 2.67 1.39 0.63 1.57 2.03 1.42 0.86 1.43 1.65 1.27 1.61 0.84 1.46 1.31 0.84 1.29 1.44 1.44 0.83 1.06 1.19 Glucose-inhibited division; 0.94 chromosome replication? 1.06 Membrane protein required for colicin V production 4-amino-4-deoxychorismate lyase 1.771 1.5731.762 1.384 2.11 1.82 2.01 1.85 1.27 0.72 2.22 1.89 1.51 1.03 1.43 1.03 1.17 2.27 0.58 1.6 1.7 1.81 1.6 1.79 1.59 1.77 1.54 1.14 1.7 1.21 Putative transport 1.26 1.09 Probable serine transporter a a a a a a * 9.561 1.108 13.74 11.7 13.17 11.55 9.36 1.05 1.44 0.85 0.92 0.76 0.9 0.89 0.89 0.67 Suppressor of lon; inhibits cell division a * 2.216 1.335 2.99 2.71 2.59 3.16 1.9 1.28 1.13 1.19 1.24 1.26 1.39 1.56 1.09 0.9 Heat-shock protein a a a sulA glvB yeeF ybeW ibpB corA hslU potC uraA potD potA artP ymfN intE ymfJ ymfG ogrK ybcU prfB fabF pphB yhdG hlyE ribH gidA prmA cvpA pabC Gene (ave) ycgH yhfC sdaC potB 58 J. Courcelle et al. ) continued ( -helix chain ␣ ) continued : minutes post irradiation TABLE 2 Unknowns (Continued) lexA1 Others ( c 20 60 20 60 (No (No (No (No Wild type: minutes post irradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b WT 1.951.755 0.984 1.1691.606 2.15 1.286 2.641.541 2.05 1.342 1.281.265 2.33 1.576 2.6 3.411.344 1.06 1.67 1.481 2.13 2.91 1.04 1.96 2.39 0.84 1.84 2.97 1.15 1.67 1.81 0.81 1.86 1 1.28 3.279.002 1.05 1.19 1.14 1.087 0.65 2.048.853 2.62 1.23 0.74 1.14 1.175 1.92 3.66 4.83 1.492.18 1.27 1.32 1.03 2.02 1.23 1.3 3.87 1.063.813 3.36 1.01 5.99 2.69 1.23 1.28 1.16 1.057 1.47 0.94 1.34 1.593.969 4.51 6.2 1.45 1.43 1.25 1.24 0.86 0.866 1.23 1 1.843.749 0.6 5.64 1.44 1.37 15.18 0.996 1.08 0.98 0.93 2.11 8.433.621 1.47 1.1 6.1 1.13 1.029 1.05 1.52 3.02 0.94 2.293.486 1.72 2.38 3.13 0.86 Small 0.8 protein 1 1.6 12.29 1.031 0.99 B 0.67 2.1 2.032.034 3.34 2.01 2.13 1.47 1.01 0.6 Multidrug 2.403 5.32 0.44 3.73 resistance; 2.212.182 1.19 0.94 Actate putative 3.13 Small kinase 1.98 4.09 0.62 translocase 1.09 membrane 1.22 2.32 1.06 2.582.738 4.97 protein ND 2.97 0.95 A 1.05 4.14 3-oxoacyl-[acyl-carrier-protein] 1.097 1.26 3.48 reductase 0.822.909 1.85 1.18 1.61 1.08 3.51 0.66 1.19 1.43 0.75 0.859 1.11 1.23 3 1.812.622 0.74 1.04 0.81 0.86 3.35 Periplasmic 1.34 0.84 1.13 0.79 1.2 3.24 sulfate-binding 0.77 1.092.197 1.54 protein 1.04 1.08 1.63 0.82 2.83 0.94 0.98 1.539 0.58 0.872.629 1.01 4.06 0.86 3.71 0.97 0.8 1.78 2.29 0.97 1.08 0.38 1.02 1.104 0.95 0.67 4.65 0.981.944 0.76 3.33 1.02 3.61 0.63 1.08 3.66 0.77 3.29 1.31 1.43 1.69 0.94 Regulator, 1.92 1.062.064 OraA 2.39 0.88 Orf, 0.98 protein 0.71 4.67 4.67 1.06 hypothetical 2.28 0.87 1.555 3.18 3.66 1.35 protein 0.8 0.961.796 3.08 1.85 0.89 2.67 0.87 1.02 3.18 0.6 2.88 0.84 0.86 1.703 2.05 2.652.379 0.93 0.88 0.94 2.53 3.03 0.97 2.1 2.14 0.96 1.047 0.59 Putative 0.84 1.14 Orf, Orf,1.931 0.95 1.29 1.83 2.35 hypothetical hypothetical 2.65 protein protein 1.454 2.17 0.95 Orf, 0.84 1.11 1.561.774 1.1 1.37 hypothetical 1.05 1.08 2.46 protein 0.85 1.18 1.94 1.544 1.25 1.02 1.07 1.26 1.95 1.92.072 1.68 DNA-damage-inducible 1.05 1.18 1.03 1.33 1.05 0.87 1.18 protein 1.01 1.222 0.71 F 2.14 11.732 1.18 1.05 0.89 1.01 1.69 Orf, 2.86 1.08 1.28 hypothetical 1.06 1.498 Orf, 1.03 protein 1 2.9 1.06 1.59 0.95 1.76 hypothetical 0.96 0.97 0.6 protein 1.49 1.01 1.4 0.97 1.98 1.12 0.93 0.85 1.3 0.99 2 0.72 1.61 1.51 0.58 0.87 0.89 1.94 1.28 0.8 1.56 0.63 1.92 0.52 1.23 2.28 1.41 0.8 0.72 0.84 1.64 1.51 2.11 1.18 0.54 1.38 0.82 0.95 1 1.72 1.48 0.74 1.3 2.33 1 1.02 0.83 2.4 0.88 1.44 1.62 0.92 1.85 1.14 2.8 0.83 0.71 1.01 2.36 0.84 1.35 1.59 Orf, 1.48 Orf, 0.84 0.97 hypothetical 1.23 2.65 0.76 hypothetical 1.31 Orf, 1.2 protein protein hypothetical 0.86 2.13 2 Orf, 0.96 1.21 1.63 protein hypothetical 1.26 0.86 protein Orf, 1.15 1.11 0.91 1.21 hypothetical 1.01 protein 1.08 Orf, Orf, 1.74 0.88 1.21 hypothetical 0.97 hypothetical 1.58 protein protein 1.31 1.48 0.71 Putative 0.95 1.7 enzyme 1.16 1.71 Orf, 0.97 hypothetical 1.1 protein 2.33 1.95 Putative membrane protein 1.3 2.18 1.84 1.14 1.16 1.24 1.38 1.19 Putative enzyme Orf, 1.02 Orf, hypothetical hypothetical protein protein 0.98 Orf, hypothetical protein 1.661.567 1.444 1.4921.698 1.72 1.354 2.111.491 1.73 1.474 2.081.594 2.46 1.363 1.14 5.95 1.4 1.23 2.01 2.57 4.41 3.12 1.79 1.37 2.26 4.5 2.48 1.26 1.7 1.1 1.51 1.01 5.5 1.4 1.47 1.52 1.8 1.73 0.85 2.17 3.64 1.76 1.48 1.15 3.29 1.33 1.99 1.53 1.35 3.15 0.99 1.3 1.48 1.8 2.11 0.92 1.39 1.48 1.2 1.32 1.51 1.32 1.31 1.68 1.09 1.31 1.31 1.05 2.11 Phosphotransacetylase 1.35 1.5 NADH dehydrogenase 1 2.22 I chain B 1.17 1.41 1.36 0.98 1.04 Flavodoxin Glucose-inhibited 1.02 1 division; chromosome Glycerolphosphate replication? auxotrophy in plsB background 10.47 1.028 6.71 5.95 6.02 5.48 6.19 0.56 0.6 0.77 0.72 0.57 0.71 0.52 0.78 0.5 DNA-damage-inducible protein a a a a a a a a a a a a a a a a a oraA arpB dinD smpB emrB ackA fabG sbp yebG yfaE yigF yigN dinF yafO yegQ yoaA yafN yebF yafP ydiY ydjM yebC yfgB ygjO yebE ydgN yliG ybiN dcrB Gene (ave) pta nuoB gidB fldA plsX smpA E. coli Gene Expression Profiles After UV 59 . materials and methods materials and methods. ) continued : minutes post irradiation TABLE 2 (Continued) lexA1 Unknowns ( c 20 60 20 60 No (No (No (No Wild type: minutes post irradiation -dependent manner. lexA lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b WT 2.028 1.1831.971 1.2211.826 1.79 1.3551.582 2.33 2.211.641 1.86 ND 1.96 1.93 1.4761.757 3.91 1.41 1.44 1.83 1.3582.255 4.46 4.61 2.08 0.855 1.45 3.122.185 1.89 2.75 0.87 2.73 0.907 1.631.677 2.49 2.99 1.42 0.87 2.53 0.9 1.364 1.731.276 1.55 1 2 3.77 0.96 1.81 3.35 1.01 1.7542.083 2.46 1.43 1.44 1.63 4.47 1.68 0.96 2.21 0.921.78 1.78 1.02 2.5 1.34 1.97 1.63 1.97 1.8 1.03 0.98 1.431.548 1.22 2.12 0.99 1.25 1.76 3.17 2.11 0.99 1.65 0.96 1.467 2.91 1.251.613 1.74 1.71 0.69 1.09 1.2 2.8 1.33 1.394 1.17 0.94 2.271.513 2.71 1.43 3.42 1.46 1.47 1.48 0.77 1.2 1.494 0.8 2.34 1.93 1.01 0.89 0.7 1.48 2.04 1.91 1.5 0.76 1.251.157 1.26 1.5 1.27 0.84 0.95 1.96 2.22 1.32 0.98 2.47 0.82 Orf, 1.91 1.828 Orf, 0.88 0.68 hypothetical 1.431.753 hypothetical 1.44 0.97 protein 0.87 1.53 protein 1.24 2.91 1.95 Orf, 0.89 0.93 1.26 1.229 1.02 hypothetical1.679 0.47 1.41 1.11 1.37 protein 1.08 0.9 1.2 2.07 0.98 1.66 1.06 1.221 1.48 0.77 0.921.706 1.14 2.78 0.88 0.57 1.33 1 1 1.07 0.71 Putative 1.03 1.193 1.7 1.09 nucleolar 1.51.675 1.68 0.92 2.71 1.14 proteins 0.47 1.35 0.9 Orf, 1.285 0.81 hypothetical 1.12 1.53 1.1 1.08 1.15 protein 1.14 2.63 1.31 0.61 1.35 0.95 1.2 1.15 1.051.884 3.39 0.55 0.95 1.43 1.28 0.64 1.11 1.12 2.53 0.86 0.83 1.055 0.57 0.93 0.96 1.08 1.481.481 1.84 3.33 0.87 Orf, 0.99 0.84 1.91 0.42 hypothetical 1.4 1.57 1.77 1.453 1.84 0.62 protein 1.091.627 1.76 0.93 1.01 Orf, 1.44 0.51 3.43 hypothetical 1.85 1.47 0.6 0.9 1.6 protein Orf, 1.3381.496 1.42 1.24 hypothetical 1.34 1.17 1.26 2.17 1 1.38 protein 1.87 3.03 1.385 Orf, 1.1 1.531.395 1.7 1.8 1.04 0.84 hypothetical 1.29 0.77 1.88 1.58 protein 1.87 1.14 1.499 1.98 11.449 1.84 2.79 0.46 Putative 1.32 0.88 1.09 outer 0.93 1.02 1.89 1.68 1.27 membrane 1.31 0.71 1.415 0.63 1.63 protein 1.512 1.1 1.08 1.05 2.66 1.73 1.37 0.99 1.1 1.66 1.22 Putative 1.345 1.71 Orf, 1.31 0.991.532 1.67 6-pyruvoyl 1.48 Putative hypothetical 1.66 tetrahydrobiopterin 2.31 GTP-binding protein 1.26 0.85 Orf, synthase 0.99 0.85 protein 1.15 1.32 1.318 1.88 hypothetical1.424 1.45 1.73 0.9 1.22 1.28 protein 1.04 Orf, 1.08 1.45 1 2.69 0.87 hypothetical 1.423 0.981.765 1.95 protein 1.03 1.28 1.19 1.27 0.91 1.14 0.9 0.77 1.53 0.84 1.067 2.341.624 2.43 0.81 1.12 Orf, Orf, 1.3 1.28 1.01 hypothetical 0.89 hypothetical 0.94 1.72 1.04 1.48 protein 0.99 protein 1.2071.686 2.05 0.99 1.57 1.18 1.18 1.06 1.7 0.91 1.68 1.21 1.34 1.117 0.74 1.98 1.23 1.19 0.74 0.99 0.93 1.7 1.46 1.73 0.92 1.41 0.74 0.92 1.4 0.8 0.96 Orf, 0.82 1.6 2.55 1.61 hypothetical Orf, 1.1 1.41 0.88 protein hypothetical 0.66 Orf, 1.54 0.95 protein 1.84 hypothetical 1.48 1.13 1.53 1.6 protein 1.71 1.47 0.88 1.5 0.81 1.33 1.17 1.24 1.15 1.61 0.88 1.18 3.04 Orf, 1.23 1.47 hypothetical 1.17 1.3 1.29 protein 1.45 1.6 1.1 1.62 2.02 1.34 1.5 1.08 1.02 1.21 1.38 1.09 1.04 1.18 1.13 1.01 1.45 1.13 1.18 1.03 0.82 1.22 0.76 1.17 1.16 1.74 0.92 1.69 1.06 0.61 1.4 0.73 Putative Orf, 0.88 1.24 Orf, enzyme hypothetical 1.65 1.15 hypothetical 0.91 0.71 protein 1.08 protein 0.81 0.89 0.86 0.99 1.09 1.09 1.55 1.33 Orf, 0.9 1.09 hypothetical Putative 1.1 protein 1.07 GTP-binding 1.1 1.21 factor 1.18 1.16 Orf, 1.01 hypothetical 0.74 protein 1.14 1.03 1.02 1.01 0.86 Putative outer 0.98 Orf, 1.11 membrane hypothetical protein 1.1 protein 1.1 0.95 1.17 0.87 Orf, hypothetical Putative protein 0.89 methyltransferase Orf, hypothetical protein a a a a a a Induced in a Ave represents the average transcript level in irradiated samples compared to that in unirradiated samples as described in Values represent the fold change in transcript level at the time indicated compared to the beginning of the experiment as described in a b c yciH yedM ycgW yebU ycfB yjiW yifL ybfE yhbC ydeT ygcM yfjA ychF ygiR IS5KyfhE 1.696yeeA 1.292yaeS 1.82yaaH 1.44ycfQ 1.52b1228 1.624ydjR 1.75 1.33yrfH 1.23ybjF 0.93 0.61 0.9yacL 0.86yfgK 1.05 1.18 0.98ydgO 1.07yleA 1.37 1.15yiaD 1.01 1.04ygeQ 0.56 0.83 0.63yccF 0.87 1.23yabO Orf, 1.15 hypothetical protein 1.17yhdJ 1.27 1.3 0.89 0.95 Orf, hypothetical protein yceP Gene (ave) 60 J. Courcelle et al.

Figure 5.—Representation of genes that displayed a reduced level of transcripts following UV irradiation. The change in transcript levels for the indicated gene is plotted as in Figure 2. (A) A typical operon in which the transcript from both wild- type cells and lexA1 mutants was observed to be reduced. (B) An operon in which the transcript from wild-type cells was observed to be severely reduced at the 5Ј end. (C) Three operons in which transcripts were reduced in wild-type cells throughout the operon. transcription or degradation of transcripts occurs in a gat operon, the decrease in transcript levels following lexA-dependent manner, and it may point to a lexA- UV irradiation was observed in both wild-type and lexA1 dependent mechanism for inhibition of transcription cells (Figure 5A). In the wild-type cells, the time at which or enhanced degradation of these transcripts. Due to transcripts recovered to preirradiation levels varied but the small sample size of this experiment, we are inclined generally occurred prior to 40 min postirradiation. In- to interpret these findings cautiously. However, further terestingly, whereas transcripts recovered to pretreat- investigation of these observations is clearly warranted. ment levels in the wild-type cells, transcripts of several The phenomenon of downregulation is also interest- genes failed to recover in lexA1 mutants within the pe- ing to consider with respect to DNA repair. Actively riod observed in these experiments, suggesting that lexA- transcribed genes in E.coli are repaired preferentially regulated genes have an important role in this transcrip- compared to nontranscribed genes (Mellon and Hana- tional recovery (Figure 5A). walt 1989). When the lac operon is actively transcribed The gat operon, controlling galactitol uptake and me- at the time of UV irradiation, repair of the transcribed tabolism, is one of several operons involved in the me- strand occurs within 5 min after irradiation. While it is tabolism of different carbon sources, which were found assumed that this response allows for the rapid transcrip- to have reduced transcript levels following UV irradia- tional recovery of expressed genes, little is known about tion. Other carbon metabolism operons whose tran- the actual inhibition or recovery of transcription for script levels decreased include fru, man, wwb, glg, and operons other than lac in E. coli. mal . Our cultures were grown with glucose as the sole Diminished transcript levels were clearly evident in carbon source. It may be interesting to know how these some operons. Several different temporal profiles were metabolic pathways are regulated when cells are grown observed (Figure 5). In some cases, exemplified by the in the presence of their respective carbon sources. E. coli Gene Expression Profiles After UV 61 ) continued ( activates minC -ribulose-5-phosphate 4-epimerase -arabinose isomerase -ribulokinase l l l : minutes postirradiation TABLE 3 lexA1 b (No (No (No (No Operons with reduced transcript levels following UV-irradiation Wild type: minutes postirradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function a ND 0.79 1.01 0.7 0.79 0.68 0.59 1.04 0.86 Putative ATP-binding component of a transport system ND 0.78 0.81 0.8 1.14 0.79 0.7 1.12 1.06 Putative dihydroxyacetone kinase ND ND 0.68 0.79 0.74 0.84 1.09 Putative enzyme ND 0.71 0.72 0.79 0.77 0.91 0.88 1.24 1.05 Putative peptidase 0.85 1.07 0.82 1.08 0.98 1.33 1.4 1.12 1.51 1.04 1.06 1.01 1.07 1.15 1 1 0.58 ND 0.48 0.38 0.84 0.79 0.93 1.22 0.93 1.08 0.98 0.99 0.96 0.65 1.05 0.63 0.71 0.24 1.04 1.16 1.14 1.19 0.97 1.05 1 1.05 1.13 1 0.99 0.67 0.450.62 0.44 0.54 0.51 0.540.83 1.28 1.37 1.010.63 1.9 0.93 1.04 0.74 0.93 0.73 1.19 0.84 0.93 1.68 0.350.62 1 1.48 0.4 0.42 1.860.6 0.54 0.56 0.68 0.85 0.8 1.52 0.36 0.730.74 0.9 2.22 0.36 0.83 0.68 1.22 1.44 0.43 0.61 0.89 0.44 0.79 0.47 1.59 0.65 0.84 0.58 1.32 0.34 0.88 0.49 0.57 0.32 0.42 0.57 1.06 0.85 1.57 0.44 0.55 0.76 1.38 0.89 1.61 0.63 0.79 0.76 1.42 1.3 0.3 Putative 0.78 0.8 0.71 dehydrogenase 1.13 0.85 0.63 ATP-binding 0.46 1.2 0.91 component 0.63 0.92 of 0.7 0.71 molybdate 0.46 0.95 1.15 transport 0.85 system 0.49 Putative 0.59 Putative ATP-binding 0.85 asparaginase 0.65 component 0.46 of 0.82 0.61 a 0.95 transport 0.71 0.52 system 0.83 0.93 0.89 Putative transport 0.97 0.89 protein Putative Putative transport transport system system permease permease protein protein 0.330.45 0.65 1.31 0.63 0.73 1.520.33 0.52 0.81 0.64 0.6 0.94 0.96 2.45 1.03 0.74 2.61 0.59 0.78 0.46 0.79 2.1 0.58 0.94 0.64 0.83 1.84 1.87 0.82 0.8 0.58 2.17 1.2 0.93 0.96 0.88 0.98 1.23 0.72 1.02 Cell 0.54 1.1 division inhibitor, 1.37 inhibits 0.84 ftsZ 1.1 ring 1.05 formation 1.03 Cell division Cell inhibitor, division a topological membrane specificity ATPase, factor 0.48 0.7 2.29 1.15 1.27 1 1.09 3 2.7 0.99 0.89 0.88 0.8 0.84 1.27 1.25 Trehalase, periplasmic 0.490.69 0.54 0.650.8 0.67 0.65 0.77 0.71 0.52 0.88 ND 0.35 1.23 0.99 0.58 1.39 0.59 0.88 1.96 0.62 0.88 0.54 0.77 0.92 0.59 1.01 0.77 0.58 0.86 0.74 0.56 1.12 0.72 0.4 0.7 0.99 0.67 0.99 1.12 Putative PTS 1.04 system enzyme Putative I dihydroxyacetone kinase 0.95 0.94 1.1 Putative dihydroxyacetone kinase 0.59 0.57 1.97 1.23 1.43 0.9 0.77 2.19 2.05 0.9 0.85 0.72 0.43 0.31 1.3 0.96 Orf, hypothetical protein 0.27 0.79 0.71 0.57 0.73 0.56 0.73 2.29 2.61 0.85 0.97 0.92 0.73 0.88 1.07 1.14 Orf, hypothetical protein 0.380.6 0.66 0.93 0.6 0.87 0.73 0.64 0.5 1.18 1.25 0.84 2.25 1.2 2.54 0.68 1.19 0.83 1.3 0.84 1.19 1.67 1.01 0.96 1.7 1.1 1.08 1.05 1.21 Orf, hypothetical 1.14 protein 1.3 1.22 Putative ATP-binding component of a transport system 0.5 0.63 1.41 1.32 1.46 1.1 0.96 2.86 2.18 0.88 0.93 1.07 0.72 0.58 1.49 1.16 Orf, hytpothetical protein 0.5 0.62 0.61 0.62 0.95 0.58 0.52 1.2 1.44 0.69 0.95 0.84 0.65 0.58 1.21 1.18 Orf, hypothetical protein 0.580.55 0.44 1.160.73 0.55 0.51 1.18 0.39 0.6 0.72 0.54 0.33 0.75 1.23 0.61 1.01 0.65 0.74 1.31 0.48 1.3 0.71 0.55 0.67 0.7 1.31 0.46 0.82 0.92 0.38 0.64 1.05 0.3 0.53 0.82 0.48 1.28 0.74 0.42 1.02 0.57 1.07 PTS 0.49 enzyme 1.04 IIAB, 0.42 mannose-specific PTS 1.06 enzyme IIC, 0.96 mannose-specific PTS enzyme IID, mannose-specific Ϫ Ϫ ϩ ϩ Ϫ Ϫ Ϫ ϩ Ϫ Ϫ ϩ ϩ ϩ 65 791 835 865 strand WT 1223 1244 1246 1500 1561 1570 1864 1866 1900 Location in kb and 20 60 20 60 Operon transcribed (ave) araD araA araB modF ybiC ybiK yliA yliA yliB yliC yliD minC minD minE treA ycgC ycgS ycgT ycgT ydcL yddU yddV pqqL yddB yddA yeaG yeaH manX manY manZ 62 J. Courcelle et al. . . materials and methods materials and methods -acetyl transferase o -glucan branching enzyme ␣ -glucanotransferase (amylomaltase) ␣ -Antigen polymerase o : minutes post irradiation TABLE 3 (Continued) lexA1 b (No (No (No (No Wild type: minutes post irradiation lexA1 (ave) 5 10 20 40 60 UV) UV) 5 10 20 40 60 UV) UV) Possible function b ND 0.88 0.62 0.64 0.62 0.7 0.88 0.79 0.78 UDP-galactopyranose mutase 0.410.53 0.93 0.52 1.14 0.5 0.37 0.3 0.9 0.59 1.37 1.05 1.31 0.95 2 1.14 1.3 2.46 0.6 0.61 0.69 0.59 0.79 0.71 0.87 0.75 0.93 1.04 0.87 0.68 0.8 0.61 Putative Galf transferase 0.760.36 0.90.41 0.43 1.33 1.05 0.80.45 0.33 0.22 1.22 0.710.34 0.16 0.35 0.51 0.94 0.28 1.480.51 0.29 0.35 0.8 0.67 0.46 0.43 1.18 1.10.46 0.25 0.28 0.66 1.15 1.46 0.41 1.71 1.26 0.98 0.37 0.41 0.32 0.87 1.3 0.39 0.96 0.16 0.35 1.47 0.82 0.25 0.9 0.43 0.33 1.6 0.46 0.6 0.54 0.73 0.35 0.45 0.93 0.93 1.61 0.36 0.57 0.39 0.6 0.92 1.29 1.71 0.89 0.32 0.25 0.86 1.14 0.49 0.77 1 0.27 0.24 0.95 0.42 0.39 Galactitol-1-phosphate 0.25 0.17 1.07 dehydrogenase 0.3 0.31 0.22 1.05 Split 0.27 galactitol 1.55 0.97 0.95 0.25 utilization 0.24 operon 1.32 0.88 PTS 0.22 repressor, 1 system fragment 0.45 Galactitol-specific galactitol-specific 0.14 enzyme 2 enzyme IIB 0.41 phosphotransferase IIC system 1 0.36 0.93 0.31 Galactitol-specific 0.21 enzyme IIA 0.89 phosphotransferase system 1.11 Putative tagatose 1.08 6-phosphate kinase Tagatose-bisphosphate 1 aldolase 1 0.980.49 1.16 1.070.47 0.89 0.7 0.610.55 0.66 0.25 0.56 0.49 0.41 0.74 0.76 0.24 1.12 0.76 0.77 0.39 1.25 0.56 0.53 1.3 1.27 1.01 0.79 1.7 1.15 1.41 1.6 1.1 1.65 0.73 1.53 1.64 0.77 1.17 1.91 2.12 0.76 1.31 0.27 0.48 0.86 1.28 0.26 0.54 0.96 1.01 0.29 0.56 0.92 1.06 0.45 0.71 0.91 IS5 0.83 0.71 transposase Putative 0.69 0.79 creatinase 0.58 0.83 Putative Putative glucose transferase 0.60.57 0.90.4 0.58 0.32 0.4 0.42 0.73 0.32 0.41 0.27 0.23 0.44 0.2 0.41 0.66 0.79 0.72 0.11 0.83 0.77 0.37 0.68 0.89 0.9 0.87 0.94 0.61 0.88 1 0.64 0.93 0.62 0.94 0.73 0.96 0.86 1.31 1.07 0.84 1.07 PTS 0.53 system, Fructose-1-phosphate fructose-specific 1.57 kinase transport protein 0.71 0.7 1.13 1.26 PTS system, fructose-specific IIA/fpr component 0.49 0.53 1.66 1.17 0.85 0.88 0.97 2.91 1.61 0.85 0.79 0.85 0.8 0.8 1.44 1.62 Putative enzyme 0.50.56 0.67 0.84 0.97 0.69 0.71 0.32 0.75 0.56 0.61 0.39 1.04 0.47 1.73 0.87 1.55 0.87 0.76 0.98 0.72 0.93 0.92 1.02 0.78 0.95 0.64 0.79 1.28 1.19 1.01 1.04 Maltodextrin phosphorylase 4- 0.56 ND 0.22 0.37 0.4 0.3 0.61 0.66 0.69 sn-glycerol-3-phosphate dehydrogenase (aerobic) 0.620.39 0.55 0.490.63 0.59 0.3 0.30.64 0.63 0.5 0.57 0.260.71 0.54 0.53 0.43 0.51 0.33 0.5 0.62 0.37 0.66 0.480.61 0.49 0.68 0.72 0.5 0.64 0.74 0.9 0.67 0.43 0.87 1.16 0.45 0.61 1.01 1.47 0.44 0.46 0.8 0.86 0.96 1.11 0.5 0.5 0.94 0.5 1.05 0.99 0.81 0.74 0.75 1.9 0.94 0.36 0.66 0.68 0.79 1.11 0.49 0.8 2.4 0.64 0.66 0.56 0.68 1.15 1.1 0.72 0.79 0.57 2.6 1.04 0.84 0.62 0.47 1.06 Glycogen 0.7 1.05 phosphorylase 2.62 0.99 Glycogen synthase 1.1 0.49 0.91 0.64 0.62 A 1.17 glycosyll Glycose-1-phosphate 0.62 hydrolase, adenylyltransferase 1.05 debranching 0.52 enzyme 1,4- 0.46 1.25 1.3 Lipoprotein-28 0.671 0.55 1.480.46 1.23 0.78 0.44 0.64 1.24 0.59 1.82 1.95 0.46 0.56 2.37 0.37 0.57 1.61 0.38 0.49 0.77 0.79 0.97 0.79 1.14 0.81 0.71 1.11 0.96 0.55 0.42 0.74 0.43 0.44 0.67 1.35 0.36 0.58 1.02 0.3 0.53 Malate synthase 0.35 A 0.24 1.01 0.9 0.77 Isocitrate 0.71 lyase Isocitrate dehydrogenase kinase/phosphatase Ϫ Ϫ Ϫ ϩ Ϫ ϩ Ϫ Ϫ ϩ strand WT 2069 2260 2363 3545 3560 3561 3836 4213 Location in kb and 20 60 20 60 Ave represents the average transcript level in irradiated samples compared to that in unirradiated samples as described in Values represent the fold change in transcript level at the time indicated compared to the beginning of the experiment as described in a b Operon transcribed (ave) glf gatR_2 wbbI rfc IS5I 2099 gatD gatC gatB gatA gatZ gatY fruA wbbL wbbK wbbJ fruK fruB yfbE malP glpD malQ glgP nlpA glgA glgC glgX glgB aceB aceA aceK E. coli Gene Expression Profiles After UV 63

A second form of repression profile is exemplified by supported by the National Institutes of Health (NIH), Molecular the rfa operon, which encodes gene products involved Biophysics training grant GM08295-11. The work was supported by NIH grants to Nicholas R. Cozzarelli and David Botstein. P.O.B. was in lipid synthesis in the membrane. The rfa operon supported by the Howard Hughes Medical Institute and NIH grant displayed a loss of transcript following UV irradiation HG00983. P.O.B. is an associate investigator at the Howard Hughes in wild-type cells, but not in the lexA1 mutant. The loss Medical Institute. Research by P.C.H. is supported by an Outstanding of transcript was more severe at the 5Ј end of the operon, Investigator grant CA44349 from the National Cancer Institute. which may at least partially reflect the fact that most RNA degradation in E. coli is believed to occur 3Ј–5Ј (Figure 5B). LITERATURE CITED A third pattern of transcript reduction can be seen in nrdHIEFproVWX and fruAKB operons shown in Figure Arthur, H. M., and P. B. Eastlake, 1983 Transcriptional control of the uvrD gene of Escherichia coli. Gene 25: 309–316. 5C. In these cases, loss of the wild-type transcripts oc- Bagg, A., C. J. Kenyon and G. C. Walker, 1981 Inducibility of curred uniformly throughout the operons. a gene product required for UV and chemical mutagenesis in The most severely reduced transcripts from operons Escherichia coli. Proc. Natl. Acad. Sci. USA 78: 5749–5753. Barondess, J. J., and J. Beckwith, 1990 A bacterial virulence deter- for which we obtained signal are listed in Table 3. Of minant encoded by lysogenic coliphage lambda. Nature 346: interest to note is the repression of operons such as 871–874. minCDE following UV irradiation. These genes are re- Barondess, J. J., and J. Beckwith, 1995 bor gene of phage lambda, involved in serum resistance, encodes a widely conserved outer quired to induce and regulate septum formation prior membrane lipoprotein. J. Bacteriol. 177: 1247–1253. to cell division and it is interesting to consider the loss Berg, O. G., and P. H. von Hippel, 1988 Selection of DNA binding of these transcripts with respect to the induction of sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J. Mol. Biol. 200: other genes that regulate cell division such as sulA and 709–723. ftsK. Also worth noting is that minC, which is severely Blattner, F. R., G. R. Plunkett,C.A.Bloch,N.T.Perna,V. repressed, actually contains a LexA-like box, which is Burland et al., 1997 The complete genome sequence of Esche- richia coli K-12 (comment). Science 277: 1453–1474. predicted to be a very good LexA-binding sequence Bonner, C. A., S. Hays,K.McEntee and M. F. Goodman, 1990 DNA (Fernandez De Henestrosa et al. 2000). Dramatic re- polymerase II is encoded by the DNA damage-inducible dinA gene ductions in transcript levels at predicted LexA boxes of Escherichia coli. Proc. Natl. Acad. Sci. USA 87: 7663–7667. Brandsma,J.A.,D.Bosch,C.Backendorf and P. van de Putte, were also observed for rfaJ and metE (Figure 5B and 1983 A common regulatory region shared by divergently tran- Table 3). While it is impossible from these experiments scribed genes of the Escherichia coli SOS system. Nature 305: to determine if the repression is directly due to a LexA 243–245. Brent, R., and M. Ptashne, 1981 Mechanism of action of the lexA regulation, we did observe cases where functional LexA gene product. Proc. Natl. Acad. Sci. USA 78: 4204–4208. boxes appeared to result in inhibition of gene expres- Casaregola, S., R. D’Ari and O. Huisman, 1982 Quantitative evalu- sion following UV irradiation. The loss of transcription ation of recA gene expression in Escherichia coli. Mol. Gen. Genet. 185: 430–439. from araDAB following UV irradiation seems likely to Courcelle, J., C. Carswell-Crumpton and P. C. Hanawalt, 1997 be due to the upregulation of polB, which is located recF and recR are required for the resumption of replication at proximal to this operon (Figure 1 and Table 3). Thus, DNA replication forks in Escherichia coli. Proc. Natl. Acad. Sci. USA 94: 3714–3719. although LexA serves as a negative regulator for polB, Courcelle, J., D. J. Crowley and P. C. Hanawalt, 1999 Recovery it essentially behaves as a positive regulator of araDAB of DNA replication in UV-irradiated Escherichia coli requires expression. both excision repair and recF protein function. J. Bacteriol. 181: 916–922. The study we have presented should serve as a starting Crowley, D. J., and P. C. Hanawalt, 1998 Induction of the SOS point for follow-up projects. It provides some generaliza- response increases the efficiency of global nucleotide excision tion with respect to the role of LexA in the regulation repair of cyclobutane pyrimidine dimers, but not 6-4 photoprod- ucts, in UV-irradiated Escherichia coli. J. Bacteriol. 180: 3345– (up and possibly down) of genes in response to one 3352. type of environmental stress. Surprisingly, it shows us Fernandez De Henestrosa, A. R., T. Ogi,S.Aoyagi,D.Chafin, that, in the absence of LexA regulation, there are no J. J. Hayes et al., 2000 Identification of additional genes belong- ing to the LexA regulon in Escherichia coli. Mol. Microbiol. 35: other major responses to UV irradiation at the level of 1560–1572. transcriptional regulation. It remains to be determined Fogliano, M., and P. F. Schendel, 1981 Evidence for the inducibil- whether the minor changes are significant in terms of ity of the uvrB operon. Nature 289: 196–198. Friedberg, E. C., C. W. Graham and W. Siede, 1995 DNA Repair the overall stress response. The values and raw data for and Mutagenesis. ASM Press, Washingtion, DC. any or all of the genes can be retrieved either via the web Georgiou, T., Y. N. Yu,S.Ekunwe,M.J.Buttner,A.Zuurmond locations listed in materials and methods or upon et al., 1998 Specific peptide-activated proteolytic cleavage of Escherichia coli elongation factor Tu (comment). Proc. Natl. request. Acad. Sci. USA 95: 2891–2895. We thank Nicholas Cozzarelli and David Botstein for initiating and Huisman, O., and R. D’Ari, 1981 An inducible DNA replication- cell division coupling mechanism in E. coli. Nature 290: 797–799. supporting experiments with bacterial microarrays. We thank C. Rich- Iwasaki,H.,A.Nakata,G.C.Walker and H. Shinagawa, 1990 mond, Y. Wei, and F. Blattner for their help in preparing a library The Escherichia coli polB gene, which encodes DNA polymerase of E. coli ORFs. J.C. is currently being supported by a European II, is regulated by the SOS system. J. Bacteriol. 172: 6268–6273. Molecular Biology Organization fellowship ALTF 265-1999. A.K. is Jin, S., Y. Chen,G.E.Christie and M. J. Benedik, 1996 Regulation a PMMB/NSF Postdoctoral Fellow (grant DMS-9406348). B.P. was of the Serratia marcescens extracellular nuclease: positive control 64 J. Courcelle et al.

by a homolog of P2 Ogr encoded by a cryptic prophage. J. Mol. DNA double-strand breaks in Escherichia coli K12 requires a Biol. 256: 264–278. functional recN product. Mol. Gen. Genet. 195: 267–274. Kenyon, C. J., and G. C. Walker, 1980 DNA-damaging agents stimu- Prieto-Alamo, M. J., J. Jurado,R.Gallardo-Madueno,F.Monje- late gene expression at specific loci in Escherichia coli. Proc. Casas,A.Holmgren et al., 2000 Transcriptional regulation of Natl. Acad. Sci. USA 77: 2819–2823. glutaredoxin and thioredoxin pathways and related enzymes in Kenyon, C. J., and G. C. Walker, 1981 Expression of the E. coli response to oxidative stress. J. Biol. Chem. 275: 13398–13405. uvrA gene is inducible. Nature 289: 808–810. Radman, M., 1974 Phenomenology of an inducible mutagenic DNA Khodursky, A. B., B. J. Peter,M.B.Schmid,J.DeRisi,D.Botstein repair pathway in Escherichia coli: SOS repair hypothesis, pp. 128– et al., 2000 Analysis of topoisomerase function in bacterial repli- 142 in Molecular and Environmental Aspects of Mutagenesis, edited cation fork movement: use of DNA microarrays. Proc. Natl. Acad. by L. Prakash,F.Sherman,M.Miller,C.Lawrence and H. W. Sci. USA 97: 9419–9424. Tabor. Charles C. Thomas, Springfield, IL. Koch, W. H., and R. Woodgate, 1998 The SOS response, pp. 107– Rudd K. E., 2000 EcoGene: a genome sequence database for Esche- 134 in DNA Damage and Repair: DNA Repair in Prokaryotes and richia coli K-12. Nucleic Acids Res. 28(1): 60–64. Lower Eukaryotes, edited by J. A. Nickoloff and M. F. Hoekstra. Salles, B., and C. Paoletti, 1983 Control of UV induction of recA Humana Press, Totowa, NJ. protein. Proc. Natl. Acad. Sci. USA 80: 65–69. Lewis,L.K.,G.R.Harlow,L.A.Gregg-Jolly and D. W. Mount, Sandler, S. J., 1994 Studies on the mechanism of reduction of UV- 1994 Identification of high affinity binding sites for LexA which inducible sulAp expression by recF overexpression in Escherichia define new DNA damage-inducible genes in Escherichia coli. J. coli K-12. Mol. Gen. Genet. 245: 741–749. Mol. Biol. 241: 507–523. Sassanfar, M., and J. W. Roberts, 1990 Nature of the SOS-inducing Little, J. W., 1984 Autodigestion of lexA and phage lambda repres- signal in Escherichia coli. The involvement of DNA replication. sors. Proc. Natl. Acad. Sci. USA 81: 1375–1379. J. Mol. Biol. 212: 79–96. Little, J. W., D. W. Mount and C. R. Yanisch-Perron, 1981 Puri- Schena,M.,D.Shalon,R.W.Davis and P. O. Brown, 1995 Quanti- fied lexA protein is a repressor of the recA and lexA genes. Proc. tative monitoring of gene expression patterns with a complemen- Natl. Acad. Sci. USA 78: 4199–4203. tary DNA microarray (comment). Science 270: 467–470. Lloyd, R. G., S. M. Picksley and C. Prescott, 1983 Inducible Shurvinton, C. E., and R. G. Lloyd, 1982 Damage to DNA induces expression of a gene specific to the RecF pathway for recombina- expression of the ruv gene of Escherichia coli. Mol. Gen. Genet. tion in Escherichia coli K12. Mol. Gen. Genet. 190: 162–167. 185: 352–355. Mellon, I., and P. C. Hanawalt, 1989 Induction of the Escherichia Siegel, E. C., 1983 The Escherichia coli uvrD gene is inducible by coli lactose operon selectively increases repair of its transcribed DNA damage. Mol. Gen. Genet. 191: 397–400. DNA strand. Nature 342: 95–98. Slilaty, S. N., and J. W. Little, 1987 Lysine-156 and serine-119 Ohmori, H., E. Hatada,Y.Qiao,M.Tsuji and R. Fukuda, 1995a are required for LexA repressor cleavage: a possible mechanism. Proc. Natl. Acad. Sci. USA 84: 3987–3991. dinP, a new gene in Escherichia coli, whose product shows similari- Taddei, F., I. Matic and M. Radman, 1995 cAMP-dependent SOS ties to UmuC and its homologues. Mutat Res 347: 1–7. induction and mutagenesis in resting bacterial populations. Proc. Ohmori,H.,M.Saito,T.Yasuda,T.Nagata,T.Fujii et al., 1995b Natl. Acad. Sci. USA 92: 11736–11740. The pcsA gene is identical to dinD in Escherichia coli. J. Bacteriol. Walker, G. C., 1984 Mutagenesis and inducible responses to deoxy- 177: 156–165. ribonucleic acid damage in Escherichia coli. Microbiol Rev 48: Perrino, F. W., D. C. Rein,A.M.Bobst and R. R. Meyer, 1987 The 60–93. relative rate of synthesis and levels of single-stranded DNA bind- Wood, L. F., N. Y. Tszine and G. E. Christie, 1997 Activation of ing protein during induction of SOS repair in Escherichia coli. P2 late transcription by P2 Ogr protein requires a discrete contact Mol. Gen. Genet. 209: 612–614. site on the C terminus of the alpha subunit of Escherichia coli Perry, K. L., S. J. Elledge,B.B.Mitchell,L.Marsh and G. C. RNA polymerase. J. Mol. Biol. 274: 1–7. Walker, 1985 umuDC and mucAB operons whose products are Woodgate, R., and D. G. Ennis, 1991 Levels of chromosomally required for UV light- and chemical-induced mutagenesis: encoded Umu proteins and requirements for in vivo UmuD cleav- UmuD, MucA, and LexA proteins share homology. Proc. Natl. age. Mol. Gen. Genet. 229: 10–16. Acad. Sci. USA 82: 4331–4335. Picksley, S. M., P. V. Attfield and R. G. Lloyd, 1984 Repair of Communicating editor: P. L. Foster