DOCSLIB.ORG

Molecular Analysis of the Reca Gene and SOS Box of the Purple Non-Sulfur Bacterium Rhodopseudomonas Palustris No

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Analysis of the Reca Gene and SOS Box of the Purple Non-Sulfur Bacterium Rhodopseudomonas Palustris No Microbiology (1999), 145, 1275-1 285 Printed in Great Britain Molecular analysis of the recA gene and SOS box of the purple non-sulfur bacterium Rhodopseudomonas palustris no. 7 Valerie Dumay,t Masayuki lnui and Hideaki Yukawa Author for correspondence: Hideaki Yukawa. Tel: +81 774 75 2308. Fax: + 81 774 75 2321. e-mail : yukawa(&rite.or.jp ~~~ ~~ Molecular Microbiology The red gene of the purple non-sulfur bacterium Rhodopseudomonas and Research palustris no. 7 was isolated by a PCR-based method and sequenced. The Institute of Innovative Technology for the Earth, complete nucleotide sequence consists of 1089 bp encoding a polypeptide of 9-2 Kizugawadai, Kizu-cho, 363 amino acids which is most closely related to the RecA proteins from Soraku-gun, Kyoto 619- species of Rhizobiaceae and Rhodospirillaceae. A recA-deficient strain of R. 0292, Japan palustris no. 7 was obtained by gene replacement. As expected, this strain exhibited increased sensitivity to DNA-damaging agents. Transcriptional fusions of the recA promoter region to lacZ confirmed that the R. palustris no. 7 recA gene is inducible by DNA damage. Primer extension analysis of recA mRNA located the recA gene transcriptional start. A sequential deletion of the fusion plasmid was used to delimit the promoter region of the recA gene. A gel mobility shift assay demonstrated that a DNA-protein complex is formed at this promoter region. This DNA-protein complex was not formed when protein extracts from cells treated with DNA-damaging agents were used, indicating that the binding protein is a repressor. Comparison of the minimal R. palustris no. 7 recA promoter region with the recA promoter sequences from other a-Proteobacteria revealed the presence of the conserved sequence GAACA-N,-G(A/T)AC. Site-directed mutations that changed this consensus sequence abolished the DNA-damage-mediated expression of the R. palustris recA gene, confirming that this sequence is the 505 box of R. palustris and probably plays the same role in other a-Proteobacteria. Keywords : uecA, photosynthetic bacteria, gene disruption, SOS box INTRODUCTION relevance. However, the presence of multiple copies of a gene in a bacterium is often a source of genetic instability Rhodopseudomonas palustris no. 7 belongs to the group due to recombination between duplicated genes. Hom- of purple non-sulfur bacteria which can grow either ologous recombination in bacteria is mainly governed phototrophically under anaerobic conditions or chemo- by the recA gene product (Miller & Kokjohn, 1990). trophically under aerobic conditions. R. palustris no. 7 Consequently, various bacterial RecA- strains show is of potential biotechnological interest because of its greatly reduced frequencies of homologous recombi- ability to produce hydrogen at a high rate using alcohol nation. A recA mutant of R. palustris no. 7 is thus as carbon source (Fujii et al., 1983). Several genes expected to stably maintain modified host genes. encoding enzymes involved in key metabolic pathways have already been characterized (Inui et al., 1997). As a prerequisite to the construction of a recombination- Amplification of such genes on plasmid vectors would deficient strain, we have characterized the recA gene of enable genetic engineering of strains of biotechnological R. palustris no. 7. Isolation of the recA gene enabled us to study the SOS response in this bacterium. The RecA t Present address: E. C. Slater Institute, Plantage Muidergracht 12, 1018 protein plays a major role in the induction of the SOS TV Amsterdam, The Netherlands. response (Walker, 1984). Following exposure to DNA- Abbreviation: MMS, methyl methane sulfonate. damaging agents, RecA promotes the autocleavage of The GenBank/DDBJ/EMBL accession number of the sequence reported in LexA, the repressor of some 20 SOS genes including this paper is D84467. recA itself (Little, 1991). Although the RecA-LexA ~. - - 0002-3056 0 1999 SGM 1275 V. DUMAY, M. INUI and H. YUKAWA pathway for the SOS response is well documented in Gram-negative bacteria when provided in trans with Escherichia coli, little is known about the molecular mobilization functions (Miller & Mekalanos, 1988). Plasmid mechanisms of SOS response in other Gram-negative pMG102 is an E. coli-R. palustris no. 7 shuttle vector (M. Inui bacteria. Purple non-sulfur bacteria together with and others, unpublished data). E. coli strains were routinely grown in LB medium (Miller, 1982). R. palustris no. 7 was Rhizobiaceae belong to the a-Proteobacteria. All x- cultivated aerobically at 30 "C in van Niel's medium (van Niel, proteobacterial recA genes so far isolated are intra- 1944). Its sensitivity to commonly used antibiotics was specifically inducible by DNA-damaging agents (Riera evaluated by plating early-stationary-phase cells from aerobic et al., 1994). However, none of them are induced in E. culture on plates of van Niel's medium containing increasing coli (Riera et al., 1994). Accordingly, no E. coli-like levels of antibiotic. When appropriate, antibiotics were added LexA binding site upstream of the coding regions of to the media in the following amounts: for R. palustris no. 7, these genes has been identified. These data suggest that kanamycin was used at a final concentration of 200 pg ml-l for different regulatory sequences are involved in the regu- agar medium or 50 pg ml-' in liquid medium; for E. coli, lation of the expression of the recA genes of x- ampicillin and kanamycin were used at a final concentration Proteobacteria. of 50 pg m1-I. Here we describe the analysis of the recA gene of R. DNA techniques. Standard methods were used for Southern, palustris, the construction of a recA mutant, and the lambda plaque and colony hybridizations (Sambrook et al., 1989). Restriction endonucleases and other commercially regulation of the recA gene in this strain. available enzymes were employed as recommended by the manufacturers. Sequencing was performed using the dideoxy- METHODS nucleotide chain-termination method and a PRISMReady Reaction Dye Cycle Sequencing kit (Applied Biosystems) with Bacterial strains, plasmids and growth conditions. Strains fluorescently labelled M13 and RP1 primers on an Applied and plasmids used in this study are listed in Table 1. Plasmid Biosystems 373A automated DNA sequencer. Plasmid tem- pGP704 is an R6K-based suicide delivery plasmid that is only plate DNA was linearized prior to reaction and 10% DMSO maintained in bacteria producing the TI protein encoded by the was added to the sequencing reaction mixture in order to pir gene. It also carries the conjugal transfer origin of the RP4 improve resolution in read-out of the highly GC-rich plasmid and therefore can be transferred in a broad range of Rhodopseudomonas DNA. DNA sequence data were analysed Table 1. Strains and plasmids Straidplasmid Relevant characteristics Reference/source R. palustris No. 7 Wild-type Fujii et a[. (1983) recA derivative recA : :RKm" This study E. coli JM109 F' Alac-pro hsdR recA1 Yanisch-Perron et al. (1985) JM83 F- Azac-pro (480 lacZAM15) Vieira & Messing (1982) SM 1O(Apii Km" Apir recA : :RP4-2-Tc : : Mu Miller & Mekalanos (1988) Plasmids puc119 Ap", lacZcl Vieira & Messing (1987) pUC4-K Source of Km' cartridge Vieira & Messing (1982) pGP704 Ap', oriR6K mobRP4 Miller & Mekalanos (1988) pMC1871 Tet', source of promoterless lac2 Casadaban et al. (1983) pMG102 Km", shuttle vector Authors' laboratory pMG302 recA in pUC119 This study pMG307 pGP704 recA : : RKm This study pMG308 pMG102 recA : :lacZ This study pMG3 10 pMG102 recA : : lacZAEcoR1 This study pMG318 pMG308 (5' A436 bp of recA :: lacZ) This study pMG3 19 pMG308 (5' A528 bp of recA : :lacz) This study pMG320 pMG308 (5' A61 1 bp of recA : :IaZ) This study pMG315 pMG318 (-3OAGAA+CTAG) This study pMG314 pMG318 (-28AACAtTACT) This study pMG316 pMG318 (-40TTGjAAC) This study pMG321 pMG315 + (-38G+A) This study pMG322 pMG314 + (-38G-A) This study pMG325 pMG318 (- 16A-C) This study pMG326 pMG318 (-26C-T) This study 1276 recA from Rhodopseudomonas pafustris Table 2. Oligonucleotides Primer Sequence (5’”’);’ Strand Position/description Primers used to generate 5‘ progressive deletions of the vecA promoter PX18 GCACGTCGTCUGATTGGG + - 145 to - 127; XbaI site italic PX19 GACAAGTCTAGATTGCGAACG + -52 to -32; XbaI site italic PX20 GCGAATCCGTCIAGAAGGAGC + +29 to +49; XbaI site italic PN GGATTTGTCCATGGAAGAACC - +78 to +99; NcoI site italic Primers used to generate probes for mobility shift assays GR1 GCACGTCGTCAGGATTGGG + -145 to -127 GR2 TCCGGATTTCGACAAGAA + -62 to -45 ST CCGGCAAAATCAACGTACC - -19 to -1 Primers used to introduce base changes in the vecA promoter and operator PM14 CGAACGGAGTACTAATAGGG +I- -37 to - 18; ScaI site italic PM1.5 CGAACGGCTAGCAAATAGGG +I- -37 to - 18; NheI site italic PM16 CAAGAACATAAACCGAACGG +I- -50 to -31 PM25 GGGTCCGTTGATTTTGCCGG +I- -19 to -1 PM26 CGAACGGAGAATAAATAGGG +I- -37 to -18 ‘’. Italic denotes restriction sites (see column 4) ; underlining indicates mutated nucleotides. using the INHERIT (Applied Biosystems/Perkin-Elmer) and the phase by the hot phenol method as described by Wilkinson GENETI x (Software Development, Tokyo, Japan) programs. (1991). The resulting RNA pellet was dissolved in diethyl- pyrocarbonate-treated water and stored at - 80 “C. The Primer design and DNA amplification.The degenerate primers concentration of RNA was determined spectrophoto- used in the amplification of R. palustris no. 7 recA internal metrically. The sequence of the oligonucleotide used as primer fragment were : P1, 5’-TT(TC) ATTGA(TC)GCIGA(AG)CA- for primer extension experiments is 5’-AGAGCGCCTTG- (TC)GC-3’; and P2, 5’-CCICCIGTIGTIGTTT(CT)IGG-3’ GATTTGTCC-3 ’. The primer hybridizes to nucleotides (see Fig. 1). Synthetic oligonucleotides used to generate + 679 to + 688 relative to the translational starting site. This deletions, mutations or probes for gel mobility shift experi- primer was end-labelled with [)J-’~~P]ATPand T4 poly- ments are listed in Table 2. Amplification reactions were nucleotide kinase. Primer extension analysis was carried out performed in a thermocycler for 30 cycles (1 min at 94 “C for as previously described (Inui et af., 1997).
Load more

Recommended publications
  • Proquest Dissertations
    Division of Mycobacterial Research National Institute for Medical Research, Mill Hill London RecA expression and DNA damage in mycobacteria Nicola A Thomas June 1998 A thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy in the Faculty of Science, University College of London. ProQuest Number: U642358 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest U642358 Published by ProQuest LLC(2015). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 A bstr a ct Bacterial responses to DNA damage are highly conserved. One system, the SOS response, involves the co-ordinately induced expression of over 20 unlinked genes. The RecA protein plays a central role in the regulation of this response via its interaction with a repressor protein, LexA. The recA gene of Mycobacterium tuberculosis has previously been cloned and sequenced (Davis et al, 1991) and a LexA homologue has recently been identified (Movahedzadeh, 1996). The intracellular lifestyle of pathogenic mycobacteria constantly exposes them to hostile agents such as hydrogen peroxide. Consequently, the response of mycobacteria to DNA damage is of great interest.
    [Show full text]
  • Non-Canonical Functions of the Bacterial Sos Response
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2019 Non-Canonical Functions Of The aB cterial Sos Response Amanda Samuels University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Microbiology Commons Recommended Citation Samuels, Amanda, "Non-Canonical Functions Of The aB cterial Sos Response" (2019). Publicly Accessible Penn Dissertations. 3253. https://repository.upenn.edu/edissertations/3253 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/3253 For more information, please contact [email protected]. Non-Canonical Functions Of The aB cterial Sos Response Abstract DNA damage is a pervasive environmental threat, as such, most bacteria encode a network of genes called the SOS response that is poised to combat genotoxic stress. In the absence of DNA damage, the SOS response is repressed by LexA, a repressor-protease. In the presence of DNA damage, LexA undergoes a self-cleavage reaction relieving repression of SOS-controlled effector genes that promote bacterial survival. However, depending on the bacterial species, the SOS response has an expanded role beyond DNA repair, regulating genes involved in mutagenesis, virulence, persistence, and inter-species competition. Despite a plethora of research describing the significant consequences of the SOS response, it remains unknown what physiologic environments induce and require the SOS response for bacterial survival. In Chapter 2, we utilize a commensal E. coli strain, MP1, and established that the SOS response is critical for sustained colonization of the murine gut. Significantly, in evaluating the origin of the genotoxic stress, we found that the SOS response was nonessential for successful colonization in the absence of the endogenous gut microbiome, suggesting that competing microbes might be the source of genotoxic stress.
    [Show full text]
  • Jiao Da Biochemistry-2
    DNA Damage and Repair Guo-Min Li (李国民 ）, Ph.D. Professor James Gardner Chair in Cancer Research University of Kentucky College of Medicine DNA Damage and Repair Contents • DNA damage • DNA damage response • DNA repair – Direct reversal – Base excision repair – Nucleotide excision repair – Translesion synthesis – Mismatch repair – Double strand break repair • Recombination repair • Non-homologous end joining – Inter strand cross-link repair Major DNA Lesions DNA lesions and structures that elicit DNA response reactions. Some of the base backbone lesions and noncanonical DNA structures that elicit DNA response reactions are shown. O6MeGua indicates O6- methyldeoxyguanosine, T<>T indicates a cyclobutane thymine dimer, and the cross-link shown is cisplatin G-G interstrand cross-link. Endogenous DNA Damage Deamination of cytosine to uracil can spontaneously occurs to creates a U·G mismatch. Depurination removes a base from DNA, blocking replication and transcription. Mismatch Derived from Normal DNA Metabolism 5’ 3’ DNA replication errors DNA recombination DNA Damage and Repair Contents • DNA damage • DNA damage response • DNA repair – Direct reversal – Base excision repair – Nucleotide excision repair – Translesion synthesis – Mismatch repair – Double strand break repair • Recombination repair • Non-homologous end joining – Inter strand cross-link repair Cellular Response to DNA Damage A contemporary view of the general outline of the DNA damage response signal-transduction pathway. Arrowheads represent activating events and perpendicular ends represent inhibitory events. Cell- cycle arrest is depicted with a stop sign, apoptosis with a tombstone. The DNA helix with an arrow represents damage-induced transcription, while the DNA helix with several oval-shaped subunits represents damage-induced repair. For the purpose of simplicity, the network of interacting pathways are depicted as a linear pathway consisting of signals, sensors, transducers and effectors.
    [Show full text]
  • Viewed Manually
    Cambray et al. Mobile DNA 2011, 2:6 http://www.mobilednajournal.com/content/2/1/6 RESEARCH Open Access Prevalence of SOS-mediated control of integron integrase expression as an adaptive trait of chromosomal and mobile integrons Guillaume Cambray1†, Neus Sanchez-Alberola2,3†, Susana Campoy2, Émilie Guerin4, Sandra Da Re4, Bruno González-Zorn5, Marie-Cécile Ploy4, Jordi Barbé3, Didier Mazel1* and Ivan Erill3* Abstract Background: Integrons are found in hundreds of environmental bacterial species, but are mainly known as the agents responsible for the capture and spread of antibiotic-resistance determinants between Gram-negative pathogens. The SOS response is a regulatory network under control of the repressor protein LexA targeted at addressing DNA damage, thus promoting genetic variation in times of stress. We recently reported a direct link between the SOS response and the expression of integron integrases in Vibrio cholerae and a plasmid-borne class 1 mobile integron. SOS regulation enhances cassette swapping and capture in stressful conditions, while freezing the integron in steady environments. We conducted a systematic study of available integron integrase promoter sequences to analyze the extent of this relationship across the Bacteria domain. Results: Our results showed that LexA controls the expression of a large fraction of integron integrases by binding to Escherichia coli-like LexA binding sites. In addition, the results provide experimental validation of LexA control of the integrase gene for another Vibrio chromosomal integron and for a multiresistance plasmid harboring two integrons. There was a significant correlation between lack of LexA control and predicted inactivation of integrase genes, even though experimental evidence also indicates that LexA regulation may be lost to enhance expression of integron cassettes.
    [Show full text]
  • Oxidative Stress Resistance in Deinococcus Radiodurans†
    Downloaded from MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 2011, p. 133–191 Vol. 75, No. 1 1092-2172/11/$12.00 doi:10.1128/MMBR.00015-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved. Oxidative Stress Resistance in Deinococcus radiodurans† 1 1,2 Dea Slade * and Miroslav Radman http://mmbr.asm.org/ Universite´de Paris-Descartes, Faculte´deMe´decine, INSERM U1001, 156 Rue de Vaugirard, 75015 Paris, France,1 and Mediterranean Institute for Life Sciences, Mestrovicevo Setaliste bb, 21000 Split, Croatia2 INTRODUCTION .......................................................................................................................................................134 GENERAL PROPERTIES OF DEINOCOCCUS RADIODURANS.......................................................................134 Common Features of a “Strange” Bacterium.....................................................................................................134 Ecology of D. radiodurans.......................................................................................................................................135 D. radiodurans Physical Structure and Cell Division ........................................................................................135 Metabolic Configuration of D. radiodurans .........................................................................................................136 on March 25, 2015 by UNIVERSIDADE EST.PAULISTA JÚLIO DE Phylogeny of D. radiodurans ..................................................................................................................................140
    [Show full text]
  • Characterization of the Spontaneous SOS Response in Corynebacterium Glutamicum and Its Effect on the Lysogenic Prophage CGP3
    Characterization of the spontaneous SOS response in Corynebacterium glutamicum and its effect on the lysogenic prophage CGP3 Inaugural dissertation for the attainment of the title of doctor in the Faculty of Mathematics and Natural Sciences at the Heinrich-Heine-University Düsseldorf presented by Arun Nanda born in Düsseldorf Düsseldorf, December 2015 The thesis in hand has been performed at the Institute of Bio- and Geosciences IBG-1: Biotechnology, Forschungszentrum Jülich, from February 2011 until April 2014 under the supervision of Juniorprof. Dr. Julia Frunzke. Published with permission of the Faculty of Mathematics and Natural Sciences at Heinrich-Heine-University Düsseldorf Supervisor: Juniorprof. Dr. Julia Frunzke Institute of Bio- and Geosciences IBG-1: Biotechnology Forschungszentrum Jülich GmbH Co-supervisor: Prof. Dr. Joachim Ernst Institue of Molecular Mycology Heinrich-Heine-University Düsseldorf Date of oral examination: April 26th, 2016 Results described in this dissertation have been published in the following original publications: Nanda, A. M., Heyer, A., Krämer, C., Grünberger, A., Kohlheyer, D., & Frunzke, J. (2014). Analysis of SOS-Induced Spontaneous Prophage Induction in Corynebacterium glutamicum at the Single-Cell Level. Journal of Bacteriology, 196(1): 180–8. doi:10.1128/JB.01018-13 Nanda, A. M., Thormann, K., Frunzke, J. (2014) Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol 197(3): 410-9. doi: 10.1128/JB.02230-14 Arun M. Nanda and Julia Frunzke (2015). The Role of the SOS Response in CGP3 Induction of Corynebacterium glutamicum. Awaiting submission Results of further projects not discussed in this thesis have been published in: Grünberger, A., Probst, C., Helfrich, S., Nanda, A.
    [Show full text]
  • Dissecting the Reca-(In)Dependent Response to Mitomycin C in Mycobacterium Tuberculosis Using Transcriptional Profiling and Proteomics Analyses
    cells Article Dissecting the RecA-(In)dependent Response to Mitomycin C in Mycobacterium tuberculosis Using Transcriptional Profiling and Proteomics Analyses Anna Brzostek 1,*,† , Przemysław Płoci ´nski 1,2,† , Alina Minias 1 , Aneta Ciszewska 1, Filip G ˛asior 1 , Jakub Pawełczyk 1 , Bozena˙ Dziadek 3, Marcin Słomka 4 and Jarosław Dziadek 1,* 1 Institute of Medical Biology of the Polish Academy of Sciences, Lodowa 106, 93-232 Łód´z,Poland; [email protected] (P.P.); [email protected] (A.M.); [email protected] (A.C.); fi[email protected] (F.G.); [email protected] (J.P.) 2 Department of Immunology and Infectious Biology, Faculty of Biology and Environmental Protection, University of Łód´z,Banacha 12/16, 90-237 Łód´z,Poland 3 Department of Molecular Microbiology, Faculty of Biology and Environmental Protection, University of Łód´z, Banacha 12/16, 90-237 Łód´z,Poland; [email protected] 4 Biobank Lab, Department of Molecular Biophysics, Faculty of Biology and Environmental Protection, University of Łód´z,Pomorska 139, 90-235 Łód´z,Poland; [email protected] * Correspondence: [email protected] (A.B.); [email protected] (J.D.) † These authors equally contributed to this work. Abstract: Mycobacteria exploit at least two independent global systems in response to DNA damage: the LexA/RecA-dependent SOS response and the PafBC-regulated pathway. Intracellular pathogens, Citation: Brzostek, A.; Płoci´nski,P.; such as Mycobacterium tuberculosis, are exposed to oxidative and nitrosative stress during the course of Minias, A.; Ciszewska, A.; G ˛asior, F.; infection while residing inside host macrophages.
    [Show full text]
  • DNA Base Excision Repair: Mutation Induction and Novel Functions
    DNA Base Excision Repair: Mutation Induction and Novel Functions by Izaskun Muruzábal-Lecumberri Thesis submitted in fulfillment of the requirements for the degree of PHILOSOPHIAE DOCTOR (PhD) Faculty of Science and Technology Department for Mathematics and Natural Sciences Centre for Organelle Research (CORE) 2015 University of Stavanger N-4036 Stavanger NORWAY www.uis.no © 2015 Izaskun Muruzábal-Lecumberri ISBN: 978-82-7644-608-1 ISSN: 1890-1387 PhD thesis no. 258 Abstract DNA is susceptible to chemical modifications corrupting its cellular information processing function, necessitating correction of such modifications. Cells are formed mostly by water – giving rise to hydrolytic reactions – and aerobic metabolism is a source of reactive oxygen species (ROS) – causing oxidation. Deamination of cytosine to uracil is an example of the former and oxidation of thymine to 5-formyluracil (f5U) is an example of the latter. In order to avoid the incorporation of wrong nucleosides into DNA, f5U must be eliminated and substituted by the correct base. The main mechanism for the repair of f5U is the base excision repair (BER) pathway, in which specific glycosylases recognize the damage and excise it from its ribose residue. Several glycosylases have been found to be involved in the repair of f5U in Escherichia coli, where 3-methyladenine DNA glycosylase II (AlkA) may be the most important. However, here we present evidence to indicate that the nucleotide excision repair protein UvrA is also involved in the repair of f5U, although the mechanism has yet to be elucidated. Interestingly, we have found that the AlkA glycosylase, in addition to alleviating is also able to promote mutation induction by 5-formyldeoxyuridine in E.
    [Show full text]
  • THE SOS RESPONSE: Recent Insights Into Umudc-Dependent Mutagenesis and DNA Damage Tolerance
    P1: FQP September 29, 2000 12:36 Annual Reviews AR116-17 Annu. Rev. Genet. 2000. 34:479–97 Copyright c 2000 by Annual Reviews. All rights reserved THE SOS RESPONSE: Recent Insights into umuDC-Dependent Mutagenesis and DNA Damage Tolerance Mark D Sutton, Bradley T Smith, Veronica G Godoy, and Graham C Walker Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139; e-mail: [email protected] ■ Abstract Be they prokaryotic or eukaryotic, organisms are exposed to a multitude of deoxyribonucleic acid (DNA) damaging agents ranging from ultraviolet (UV) light to fungal metabolites, like Aflatoxin B1. Furthermore, DNA damaging agents, such as reactive oxygen species, can be produced by cells themselves as metabolic byproducts and intermediates. Together, these agents pose a constant threat to an organism’s genome. As a result, organisms have evolved a number of vitally important mechanisms to repair DNA damage in a high fidelity manner. They have also evolved systems (cell cycle checkpoints) that delay the resumption of the cell cycle after DNA damage to allow more time for these accurate processes to occur. If a cell cannot repair DNA damage accurately, a mutagenic event may occur. Most bacteria, including Escherichia coli, have evolved a coordinated response to these challenges to the integrity of their genomes. In E. coli, this inducible system is termed the SOS response, and it controls both accurate and potentially mutagenic DNA repair functions [reviewed comprehensively in (25) and also in (78, 94)]. Re- cent advances have focused attention on the umuD+C+-dependent, translesion DNA synthesis (TLS) process that is responsible for SOS mutagenesis (70, 86).
    [Show full text]
  • Mutation Repair Prin
    Peter Pristas BNK1 Mutations and DNA repair Peter Pristas BNK1 2003 The Central Dogma of Molecular Biology The DNA molecule is a single biopolymer in the cell which is repaired All other uncorrectly synthetised biopolymers (RNA, proteins) are degraded There are some 100 enzymes participating in the DNA repair in human cell Peter Pristas BNK1 2003 Mutation n Change in the nucleotide sequence of the genome. Sequence changes are localized, i.e., change from an A to G, deletion of a base pair, addition of three base pairs, etc. n By altering the DNA sequence, a modification of the instructions for a gene product may result, thus affecting the function of that gene. n Occurrence through spontaneous means, without a known cause; or may be induced, use of chemical or physical agents that alter DNA sequences. n May be reversible with a back mutation to the original form. Peter Pristas BNK1 2003 Segregationof heteroduplex DNA during replication Mutations usually become apparent only after cell division yielding one wildtypeand one mutant cell. Peter Pristas BNK1 2003 Type of mutations A. point mutations n transitions n transversions A pyrimidine is changed to another A pyrimidine is changed to a purine, pyrimidine, or a purine to another or a purine to a pyrimidine. purine. Peter Pristas BNK1 2003 Type of mutations B. structural mutations n 1.1. deletionsdeletions == lossloss ofof sequencesequence n 2.2. inversionsinversions == reversalreversal ofof orientationorientation n 3.3. translocattranslocatiionsons == displacementdisplacement n 4.4. duplidupliccationsations
    [Show full text]
  • Establishment and Maintenance of 35S Rrna Gene Chromatin States in Saccharomyces Cerevisiae
    Establishment and maintenance of 35S rRNA gene chromatin states in Saccharomyces cerevisiae DISSERTATION ZUR ERLANGUNG DES DOKTORGRADES DER NATURWISSENSCHAFTEN (DR. RER. NAT.) DER FAKULTÄT FÜR BIOLOGIE UND VORKLINISCHE MEDIZIN DER UNIVERSITÄT REGENSBURG vorgelegt von Manuel Wittner aus Ingolstadt im Februar 2012 Das Promotionsgesuch wurde eingereicht am: 07. Februar 2012 Die Arbeit wurde angeleitet von: PD Dr. Joachim Griesenbeck Prüfungsausschuss: Vorsitzender: Prof. Dr. Herbert Tschochner 1. Prüfer: PD Dr. Joachim Griesenbeck 2. Prüfer: Prof. Dr. Michael Rehli 3. Prüfer: Prof. Dr. Wolfgang Seufert Die vorliegende Arbeit wurde in der Zeit von Dezember 2008 bis Februar 2012 am Lehrstuhl Biochemie III des Institutes für Biochemie, Genetik und Mikrobiologie der Naturwissenschaftlichen Fakultät III der Universität Regensburg unter Anleitung von PD Dr. Joachim Griesenbeck im Labor von Prof. Dr. Herbert Tschochner angefertigt. Ich erkläre hiermit, dass ich diese Arbeit selbst verfasst und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Diese Arbeit war bisher noch nicht Bestandteil eines Prüfungsverfahrens. Andere Promotionsversuche wurden nicht unternommen. Manuel Wittner Regensburg, 07. Februar 2012 Table of Contents Table of Contents 1 Summary...................................................................................................................1 2 Introduction ..............................................................................................................3 2.1 Eukaryotic chromatin structure..............................................................................3
    [Show full text]
  • Juliana Brandstetter Vilar
    0 JULIANA BRANDSTETTER VILAR MECANISMOS DE REPARO DE DNA ENVOLVIDOS COM LESÕES INDUZIDAS POR AGENTE ALQUILANTE (NIMUSTINA) EM CÉLULAS HUMANAS E SUA ASSOCIAÇÃO COM A RESISTÊNCIA DE GLIOMAS Tese apresentada ao Programa de Pós- Graduação em Microbiologia do Instituto de Ciências Biomédicas da Universidade de São Paulo, para obtenção do Tìtulo de Doutor em Ciências. São Paulo 2014 1 JULIANA BRANDSTETTER VILAR MECANISMOS DE REPARO DE DNA ENVOLVIDOS COM LESÕES INDUZIDAS POR AGENTE ALQUILANTE (NIMUSTINA) EM CÉLULAS HUMANAS E SUA ASSOCIAÇÃO COM A RESISTÊNCIA DE GLIOMAS Tese apresentada ao Programa de Pós-Graduação em Microbiologia do Instituto de Ciências Biomédicas da Universidade de São Paulo, para obtenção do Tìtulo de Doutor em Ciências. Área de concentração: Microbiologia Orientador: Dr. Carlos Frederico Martins Menck Versão original São Paulo 2014 2 Colic ença. Eu peço licença para ocupar esta página com uma homenagem, ainda que tardia. Eu preciso der 3 um pouco de justiça à luz daqueles que por aqui pousarem seus olhos, ou além... Poderia alguém querer negligentemente passar adiante... Mas desaconselho. Para 4 5 6 Esta tese é o resultado de muitos experimentos e de incontáveis experiências. Ao final de cada linha, poder-se-ia desenrolar um novelo. Desenrolo-o. Desfio-o pelo avesso, como quem mostra o reflexo do espelho. Antes de ser uma tese, esta era um projeto e, antes de sê-lo, era um sonho. Sonhado de forma modesta e imprecisa por sua autora, pela autora da autora, e pela autora desta: No centro do mundo, interior de Goiás, uma mulher chamada Maria, costureira, analfabeta, talvez por não reconhecer qualquer letra dava valor à palavra; e esta lição ensinou aos seus filhos e netos.
    [Show full text]