City University of New York (CUNY) CUNY Academic Works
Dissertations and Theses City College of New York
2017
A Phylogenetic and Environmental Analysis of Brazilian Placosoma Lizards
Kai A. Farje-Van Vlack CUNY City College
How does access to this work benefit ou?y Let us know!
More information about this work at: https://academicworks.cuny.edu/cc_etds_theses/707 Discover additional works at: https://academicworks.cuny.edu
This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] 1
2
3
4 A Phylogenetic and Environmental Analysis of Brazilian Placosoma Lizards
5
6
7
8
9
10
11
12 Kai A. Farje-Van Vlack
13
14
15
16 The City College of New York, 160 Convent Ave., New York, NY, 10031
17
18
19 Masters Dissertation Committee
20 Dr. Ana Carolina Carnaval
21 Dr. Amy Berkov
22 Dr. David J. Lohman
1
23 Abstract. Placosoma is a genus comprised of the Brazilian spectacled lizards P. champsonotus ,
24 P. cipoense , P. cordylinum , P. glabellum , and P. limaverdorum . While P. champsonotus , P.
25 cordylinum , and P. glabellum occupy the southern coast of Brazil, P. cipoense is found in the
26 montane grasslands north of that range, and P. limaverdorum was recently discovered in forest
27 isolates that persist within the semi-arid Caatinga. This study elucidates the ecological and
28 evolutionary relationships among these morphologically similar lizards. Using mitochondrial and
29 nuclear gene sequences, genus-wide phylogenies were inferred through Bayesian inference and a
30 species tree approach, and reconciled with geographical and climate data. I generated DNA
31 sequences for the nuclear markers DNAH3, PRLR, and SINCAIP, and the mitochondrial
32 markers ND4 and 16S for all species but P. limaverdorum (for which tissues are unavailable.
33 Results of the phylogenetic analyses were then compared to an environmental Principle
34 Component Analysis of the range of Placosoma to characterize differences in the environments
35 that each species occupies. Each sampled species of Placosoma was recovered as a monophyletic
36 clade, but discordance was observed between the species tree and non-coalescent-based Bayesian
37 trees. In the environmental PCA, P. champsonotus , P. cordylinum , and P. glabellum occupy
38 similar environmental spaces, while the geographically isolated P. cipoense and P. limaverdorum
39 are each similarly isolated in environmental space, albeit along different climatic variables. Both
40 phylogenetic and environmental analyses suggest that P. champsonotus and its sister species P.
41 glabellum may have diverged recently.
42 Keywords. Atlantic Forest, genetic structure, phylogeography, Placosoma , lizards
43
44
45
2
46 Introduction.
47 Identifying and understanding the processes that influence species distributions is of
48 paramount importance, particularly in threatened areas of the world with high rates of endemism.
49 As anthropogenic climate change progresses, endemics with restricted ranges - and the biomes
50 they occupy - may experience rates of extinction that exceed our ability to study them (Ferrier,
51 Pressey, & Barrett, 2000). Climate, in particular, is known to strongly determine species ranges
52 (Cracraft & Prum, 1988, Elith et al., 2006; Graham et al ., 2004). When tied to information about
53 phylogenetic relationships and divergence times, studies that map the distribution of narrow
54 endemics provide insight into conservation and biological discovery (Faith, 1992, Myers et al .,
55 2000). For instance, the similarity of the climatic tolerances of closely related lineages, or niche
56 conservatism, has been identified as a driver of allopatric speciation and concomitant rapid
57 diversification, explaining several of the patterns of lineage distribution in space (Kozak &
58 Weins, 2006). The assumption of pervasive niche conservatism among closely related taxa
59 across the tree of life underlie current standard analytical methods (Anderson, 2013; Peterson &
60 Nyari, 2008; Phillips & Dudík, 2008; Warren, Glor, & Turelli, 2008, and Wiens & Graham,
61 2005).
62 I verify the extent to which realized climatic niches differ across closely related species
63 of endemics in a species-rich biome while reconstructing the phylogeny of Placosoma , a genus
64 of Neotropical spectacled lizards. Of the five lizard species that comprise the genus Placosoma ,
65 three are found in the montane forests of eastern Brazil (Bérnils & Costa, 2012), particularly in
66 the southern Atlantic Forest (AF) domain (Carnaval et al., 2014), and two are endemic to high
67 elevation sites further north (Fig. 1). Placosoma glabellum inhabits low to high-altitude
68 rainforests along the Atlantic Coast of Brazil from Santa Catarina to Espírito Santo, P.
3
69 champsonotus is found from Santa Catarina to Rio de Janeiro, and P. cordylinum appears
70 restricted to the high-altitude areas of Rio de Janeiro state (Uzzell, 1959 and 1962). Placosoma
71 cipoense is found in the rockier montane grasslands of the relictual Atlantic Forest fragments
72 known as the “Brejos de Altitude” in Serra do Cipó in Minas Gerais (Cunha, 1966). Finally, P.
73 limaverdorum was recently described from an isolated high-altitude forest refugium at Ceará
74 (Borges-Nojosa et al., 2016; Fig. 1). Placosoma cipoense , known for only a handful of
75 specimens, is the only species in the genus that is considered endangered (Rodrigues, 2005).
76 The Brazilian coastal forests are a species rich, yet critically threatened environment. In
77 the Atlantic Forest domain, species turnover has been closely linked to regional climatic
78 conditions, and species occupying distinct climatic spaces of the forest seem to have responded
79 differently to past environmental shifts (Carnaval et al., 2014). Multiple species are co-
80 distributed along the lowlands and northern coastal region of the forest, many exhibiting signs of
81 population contractions under the cool conditions of the Last Glacial Maximum (LGM), and
82 post-LGM expansions (Carnaval et al., 2009, 2014). In contrast, phylogeographic studies and
83 environmental analyses indicate that the Southern Atlantic Forest and the highland sites further
84 north are populated by cold-associated species, which have experienced contractions in their
85 ranges after the LGM (Amaro, Rodrigues, Yassuda, and Carnaval, 2014; Batalha-Filho,
86 Cabanne, and Miyaki, 2012; Carnaval et al., 2014; Thomé et al ., 2010). This pattern of
87 historical range contraction, coupled with habitat threats from anthropogenic causes, make cold-
88 associated endemic species important targets for biodiversity conservation and prediction
89 (Morellato & Haddad, 2000). Placosoma lizards are one such group.
90 Here, I ask whether different species within this cold-associated genus further partition
91 the available climatic space and explore distinct environmental envelopes within the Southern
4
92 Atlantic Forest domain, or if, alternatively, they all share similar climatic niches and hence have
93 responded, and should be expected to respond, similarly to environmental shifts. To that end, I
94 reconstruct the phylogeny of Placosoma and assess the differences in the environmental spaces
95 occupied by its species. While morphological records exist for the species that comprise
96 Placosoma , no phylogenetic analyses exist and, consequently, evolutionary relationships have
97 not been inferred between species. Utilizing multilocus DNA sequence data from P. cipoense , P.
98 champsonotus , P. cordylinum , and P. glabellum (tissues of P. limaverdorum are not yet available
99 for sequencing), this study contributes to the biogeography of the Atlantic Forest by addressing
100 the following questions: (1) What are the evolutionary relationships among the species of
101 Placosoma , and (2) are Placosoma species structured in geographic and environmental space?
102 To answer these questions, I sample broadly and infer phylogenies using coalescent methods,
103 which have been useful in delimiting species in morphologically cryptic taxa (Blair et al ., 2014),
104 as well as Bayesian inference. Using climatic data from our collection sites and occurrence
105 points of Placosoma limaverdorum from Borges-Nojosa et al. (2016), I then compare the
106 climatic envelopes occupied by all five species of Placosoma .
107
108 Materials and Methods
109 DNA extraction, amplification, and sequencing
110 I sampled 30 Placosoma individuals of four species from the Brazilian States of Minas
111 Gerais, Rio de Janeiro, and São Paulo (Fig. 1, Appendix 1). Samples of Placosoma cipoense
112 were obtained from Serra do Cipó in Minas Gerais. Placosoma champsonotus, Placosoma
113 cordylinum, and Placosoma glabellum were obtained from various national parks in São Paulo
114 and Rio de Janeiro. A specimen of Colobodactylus taunayi (MTR 15549), a gymnophthalmid
5
115 lizard, was included as an outgroup given its basal position relative to Placosoma in a previous
116 phylogenetic study of the Gymnophthalmidae (Pellegrino, et al ., 2001). Collection sites were
117 either assigned geographic coordinates in the field using Global Positioning System equipment
118 or geo-referenced using collection notes. Tissues were obtained from the University of São Paulo
119 under the following collection codes: CTMZ (tissue collection of the Museu de Zoologia), LG
120 (cytogenetic laboratory at the University of São Paulo), MCL and MTR (herpetological
121 collection of Miguel Trefaut-Rodrigues), and MZUSP (specimen collection of the Museu de
122 Zoologia, Universidade de São Paulo).
6
A .
B .
123 Fig. 1. Sampling sites for Placosoma in Brazil. (A) Type localities of Ceará’s Placosoma 124 limaverdorum (Borges-Nojosa et al., 2016) and (B) occurrence points of the other Placosoma 125 species. The extent of the Brazilian Atlantic Forest is shown in dark gray. 7
126 Standard salt extraction of DNA (Miller et al ., 1988) was performed on all samples. Gel
127 electrophoresis and spectrophotometry were used to verify extraction quality and concentration
128 values of DNA. Through Polymerase Chain Reactions (PCRs), genomic DNA was amplified for
129 the nuclear oncogene C-mos (CMOS; Saint et al., 1998), the nuclear genes dyneine axonemal
130 heavy chain 3 (DNAH3), the prolactin receptor (PRLR), and Synuclein Alpha interacting protein
131 (SINCAIP) gene, as well as for the mitochondrial genes NADH-dehydrogenase subunit 4 (ND4)
132 and 16S Ribosomal RNA gene (16S). In sequence, distilled H 2O, Flexy PCR buffer (Promega,
133 Madison, WI USA) MgCl 2, dNTPs, two marker-specific primers, and Taq polymerase were
134 mixed according to optimized protocols for each gene (Table 1). Protocols followed or were
135 adapted from Pellegrino et al ., (2001) for CMOS and ND4, Townsend et al . (2008) for DNAH3,
136 PRLR, and SINCAIP, and Palumbi and Benzi (1991) for 16S (for primer sequences, see Table
137 2). Samples ran in a thermocycler according to a marker-specific thermocycling profile. PCR
138 products were checked for amplification via gel electrophoresis, 5.0 µL of each successfully
139 amplified PCR product was incubated with 2.0 µL of Exonuclease I/Shrimp Alkaline
140 Phosphatase (Exo/Sap) solution, and a subsample was then sent to MacroGen (New York, NY)
141 for sequencing.
142
143
144
145
146
147
148
8
149 Table 1. Volume of PCR components used for gene specific protocols. Volumes given for a 150 single 0.5 μL volume of genomic DNA.
Distilled Flexi Forward Reverse Taq Marker MgCl 2 dNTP H2O Buffer Primer Primer Polymerase
CMOS 5.4372 μL 2.5 μL 1.5 μL 1 μL 0.5 μL 0.5 μL 0.0625 μL
DNAH3 6.6875 μL 2.5 μL 1 μL 0.25 μL 0.5 μL 0.5 μL 0.0625 μL
ND4 6.688 μL 2.5 μL 1 μL 0.25 μL 0.5 μL 0.5 μL 0.0625 μL
PRLR 6.1875 μL 2.5 μL 1 μL 0.25 μL 0.75 μL 0.75 μL 0.0625 μL
SINCAIP 5.6875 μL 2.5 μL 2 μL 0.25 μL 0.5 μL 0.5 μL 0.0625 μL
16S 6.6875 μL 2.5 μL 1 μL 0.25 μL 0.5 μL 0.5 μL 0.0625 μL
151
152
153
154
155 Table 2. List of primers used for the PCR protocol Target Gene Primer Name Primer Sequence (5’-3’) CMOS G73 (f) GCGGTAAAGCAGGTGAAGAAA CMOS G74 (r) TGAGCATCCAAAGTCTCCAATC DNAH3 DNAH3-F1 GGTAAAATGATAGAAGAYTACTG DNAH3 DNAH3-R6 CTKGAGTTRGAHACAATKATGCCAT ND4 ND4-fc CATTACTTTTACTTGGATTTGCACCA ND4 ND4-rc CACCTATGACTACCAAAAGCTCATGTAGAA PRLR PRLR-F1 GACARYGARGACCAGCAACTRATGCC PRLR PRLR-R3 GACYTTGTGRACTTCYACRTAATCCAT SINCAIP SINCAIP-F10 CGCCAGYTGYTGGGRAARGAWAT SINCAIP SINCAIP-R13 GGWGAYTTGAGDGCACTCTTRGGRCT 16S 16S-Ar (f) CGCCTGTTTAYCAAAAACAT 16S 16S-Br (r) CCGGTCTGAACTCAGATCACGT 156
9
157 Phylogenetic Analyses
158 Sequences were cleaned and aligned in Geneious version 6.1.6 (geneious.com, Kearse et al .,
159 2012). To generate phylogenies, I used both the *BEAST extension in BEAST (Drummond et
160 al ., 2012) and MrBayes (Huelsenbeck & Ronquist, 2001). All trees were visualized using
161 FigTree v.1.4.2. First, an alignment of the sequences of CMOS, DNAH3, ND4, PRLR,
162 SINCAIP, and 16S was analyzed under a coalescent framework in *BEAST, with parameters for
163 substitution rates and nucleotide frequency unlinked across partitions and trees linked across
164 mitochondrial genes. A 100-million generation chain was run with a 10% burn-in, and a
165 maximum clade credibility tree was produced in TreeAnnotator 1.8.2 (Drummond et al ., 2012).
166 For comparison, I used the same alignment to generate a phylogeny in MrBayes and to
167 examine the contribution of the mitochondrial and nuclear markers to this Bayesian tree, I also
168 generated phylogenies in MrBayes using exclusively nuclear and exclusively mitochondrial
169 markers. These phylogenies were generated in MrBayes by applying appropriate models of
170 evolution to each gene partition, as determined by jModelTest (Darriba et al ., 2012; Table 3).
171 Choice of models of evolution was guided by the sample size corrected Akaike information
172 criterion (AICc). Each analysis utilized four Markov chains with lengths of 5,000,000
173 generations, a sample rate of 1/1000, and burn-in of 1,250 repetitions.
174
175
176
177
178
10
179 Table 3. Models of evolution used in phylogenetic analyses; HKY = Hasegawa, Kischino, and 180 Yano (1985), GTR = Generalized Time Reversible (Tavaré, 1986). Gamma (G) and the 181 proportion of invariant sites (I) parameters were included when appropriate. Gene CMOS DNAH3 ND4 PRLR SINCAIP 16S Model of HKY HKY+G HKY+I+G HKY HKY GTR+G Evolution 182
183 Characterization of occupied environmental spaces via Principle Component Analysis
184 To determine whether and to what extent the five Placosoma species differ in climate
185 space, I employed a Principal Component Analysis (PCA) of sampled sites, using the dismo
186 package in R. To this end, I combined locality data associated with collected vouchers with
187 information from weather-station-based bioclimatic variables, which describe local patterns of
188 temperature and precipitation, and which are freely available from the WorldClim database
189 (Hijmans et al., 2005). Specifically, I used the 30 arc-second resolution versions of the following
190 bioclim variables: BIO1: annual mean temperature, BIO2: mean diurnal range, BIO3:
191 isothermality, BIO4: temperature seasonality, BIO5: maximum temperature of warmest month,
192 BIO6: minimum temperature of coldest month, BIO7: temperature annual range, BIO8: mean
193 temperature of wettest quarter, BIO9: mean temperature of driest quarter, BIO10: mean
194 temperature of warmest quarter, BIO11: mean temperature of coldest quarter, BIO12: annual
195 precipitation, BIO13: precipitation of wettest month, BIO14: precipitation of driest month,
196 BIO15: precipitation seasonality, BIO16: precipitation of wettest quarter, BIO17: precipitation of
197 driest quarter, BIO18: precipitation of warmest quarter, BIO19: precipitation of coldest quarter.
198 To reflect known occurrences of members of the genus Placosoma, I use color-coded points to
199 represent individuals of each species, and present them over background points that were
200 randomly extracted from a radius of 200 km from each occurrence point.
201
11
202 Results.
203 Phylogenetic Analyses
204 A species tree generated through the *BEAST coalescent analysis, and using all markers,
205 recovers Placosoma as a monophyletic genus (outgroup species not shown); Placosoma cipoense
206 is inferred to be sister to P. cordylinum , with high posterior support (Fig. 2). The analysis also
207 recovers a sister relationship between P. glabellum and P. champsonotus – albeit with low
208 posterior probability (0.6673).
209
210 Fig. 2. Species tree generated via coalescent method using six genes and rooted with an 211 individual of Colobodactylus taunayi . Node labels indicate posterior probabilities and a scale of 212 genetic change is shown. 213
12
214 The topology of the Bayesian phylogeny, generated in MrBayes and with the same
215 markers, is nonetheless different from that of the species tree (Fig. 3). Although four main clades
216 are recognized within Placosoma , and despite the fact that all individuals of each named species
217 (P. champsonotus, P. cipoense, P. cordylinum, and P. glabellum ) are recovered as reciprocally
218 monophyletic clades with high support, the inferred relationship among species differs from that
219 provided by the coalescent method. Specifically, Placosoma cipoense is recovered as sister to all
220 other Placosoma in the Bayesian analysis.
221 Within the remaining Placosoma , P. cordylinum forms a clade which is sister to a clade
222 containing P. champsonotus and P. glabellum , rather poorly supported, and which splits into two
223 clades, one representing individuals obtained at the Estação Ecológica of Bananal (state of São
224 Paulo) and one representing those obtained from Teresópolis (state of Rio de Janeiro), with high
225 support throughout. The clade containing P. champsonotus and P. glabellum is composed of two
226 monophyletic groups, each of which contain all of the specimens of each species.
227 The clade containing individuals of P. glabellum is further split into two sister groups,
228 one of which contains all individuals obtained in the forests between Ubatuba and São Sebastião,
229 in the state of São Paulo, while the other is comprised of all individuals found to the west of that
230 range. This western clade also contains two sister groups which are segregated in geographic
231 space. One clade represents all individuals found west of Juquitiba, but is too poorly resolved to
232 be subdivided further. Its sister clade, including individuals from the forests between Juqitiba
233 and São Sebastião, is split into two clades; one of which represents individuals from a single
234 locality surrounding the Estação Biológica de Boracéia in Salesópolis.
13
235 236 Fig. 3. Phylogenetic tree of genus Placosoma generated via Bayesian inference using six genes 237 and rooted with an individual of Colobodactylus taunayi . Branch support values and a scale of 238 genetic change are shown. 239
240 The Bayesian inference tree based solely on sequences of the mitochondrial markers ND4
241 and 16S (Fig. 4), while still recovering each species as a monophyletic clade, differs from both
242 the species tree and the Bayesian phylogeny of all genes in its placement of P. cordylinum . P.
243 cordylinum is recovered neither as sister to P. cipoense (the case of the species tree), nor as sister
244 to the clade containing P. champsonotus and P. glabellum (observed in the Bayesian phylogeny).
245 Instead, it forms the basal branch of the phylogeny. The geographic structure within P.
246 cordylinum observed in the Bayesian phylogeny is preserved in the mitochondrial phylogeny.
247 In the mtDNA-only Bayesian inference tree, the sister group to P.cordylinum . which
248 contains all other species, is split into a clade representing the two specimens of P. cipoense and
249 a clade containing P. champsonotus and P. glabellum . The branch containing P. champsonotus
14
250 and P. glabellum is composed of two monophyletic groups, each of which contains all of the
251 specimens of each species.
252 The clade containing individuals of P. glabellum is split into two sister groups, one of
253 which contains all individuals collected in forests between the localities of Ubatuba and São
254 Sebastião, in the state of São Paulo, while the other is comprised of all individuals found to the
255 west of that range. This western clade also contains two sister groups, which are segregated in
256 geographic space. One clade represents all individuals found west of Juquitiba. Its sister clade,
257 including individuals from the forests between Juqitiba and São Sebastião, is split into two
258 clades; one containing individuals from a single locality surrounding the Estação Biológica de
259 Boracéia in Salesópolis.
260
261 262 Fig. 4. Phylogenetic tree of genus Placosoma generated via Bayesian inference using two 263 mitochondrial genes and rooted with an individual of Colobodactylus taunayi . Branch support 264 values and a scale of genetic change are shown. 265
15
266 In the Bayesian inference tree based solely on sequences of the nuclear markers CMOS,
267 DNAH3, PRLR SINCAIP (Fig. 5), monophyletic clades representing each named species are
268 recovered again. However, this phylogeny recovers the same structure as the Bayesian
269 phylogeny which used all analyzed genes with high support, placing P. cipoense as sister to a
270 clade containing all other species . Several well-supported splits are recovered within both P.
271 cordylinum and P. glabellum .
272
273 Fig. 5. Phylogenetic tree of genus Placosoma generated via Bayesian inference using four 274 nuclear genes and rooted with an individual of Colobodactylus taunayi . Branch support values 275 and a scale of genetic change are shown. 276 Environmental analysis 277
278 An environmental Principal Component Analysis identifies three niche spaces occupied
279 by Placosoma species (Fig. 6). The first, primarily located in the negative plane of PC1, contains
280 P. champsonotus , P. cordylinum , and P. glabellum – showing overlap between the climatic
16
281 niches of each. The second, located in the positive plane of PC1, is comprised of P.
282 limaverdorum . The third, located in the third quadrant, contains P. cipoense . In the
283 environmental principal component analysis, the following bioclimatic variables load primarily
284 in PC1: BIO4 (temperature seasonality) in the negative plane; BIO9 (mean temperature of driest
285 quarter), BIO11 (mean temperature of coldest quarter), and BIO15 (precipitation seasonality) in
286 the positive plane. In turn, variables BIO2 (mean diurnal range), BIO13 (precipitation of wettest
287 month), and BIO16 (precipitation of wettest quarter) load primarily in the negative plane of PC2
288 while BIO14 (precipitation of driest month) loads in the positive plane.
289 Fig. 6. Environmental PCA of Placosoma , based on occurrence data. PC1 primarily loads 290 Bioclim variables BIO4 (-), BIO9 (+), and BIO11 (+). PC2 primarily loads BIO2 (-), BIO13 (-), 291 BIO14 (+), and BIO16 (-). 292
293 Discussion
294 Environmental analysis shows that there is differentiation in the climatic spaces occupied
295 by some of the species of Placosoma , but not all. The three coastal species P. champsonotus , P.
17
296 cordylinum , and P. glabellum form a single large cluster which falls primarily in the second
297 quadrant of the environmental PCA, representing the colder and more seasonal environments
298 within the range of Placosoma. The montane species P. cipoense occupies a niche that lies
299 slightly below the most negative PC2 value of the coastal cluster, indicating that P. cipoense
300 occurs in environments with a large degree of temperature seasonality but with less variable
301 seasonal precipitation. Placosoma limaverdorum , the species of Placosoma most geographically
302 isolated from its congeners, is similarly isolated in environmental space in the less seasonal and
303 hotter environments of northern Brazil. The closely related P. glabellum and P. champsonotus
304 largely share their environmental envelopes, suggesting a trend of higher niche similarity with
305 phylogenetic relatedness: niche conservatism seems evident among the more closely related
306 species.
307 The phylogenic analyses reflect species delimitations most recently proposed for the
308 genus Placosoma , particularly regarding P. champsonotus and P. cordylinum . Originally
309 classified as two subspecies of P. cordylinum by Uzzell (1959), P. cordylinum cordylinum and P.
310 cordylinum champsonotus were recently elevated to species level based on their morphological
311 differences and sympatry (Zaher et al., 2011). Our findings validate that taxonomic revision with
312 molecular evidence. Each species is recovered as a monophyletic clade in the Bayesian analysis.
313 Moreover, P. champsonotus and P. glabellum are recovered as sister clades in all phylogenies -
314 although with moderately poor support in the species tree. The degree of overlap observed in the
315 environmental niches and ranges of these two species (Fig. 6), and the high support of the sister
316 relationship in the majority of analyses, support the view that the divergence between P.
317 glabellum and P. champsonotus is recent.
18
318 Trees generated via strict Bayesian inference and the species tree generated by a
319 coalescent process mostly differed in their phylogenetic placement of P. cipoense. While the
320 *BEAST tree recovered P. cipoense as sister to P. cordylinum , the mitochondrial Bayesian tree
321 recovers it as sister to the ( P. glabellum , P. champsonotus) clade with low support, and the
322 Bayesian trees with all genes, as well as only nuclear genes, recover it as basal and sister to the
323 rest of the genus with high support. Providing support to the *BEAST inference, the
324 environmental PCA indicates that the climatic niche of P.cordylinum extends closer to the niche
325 of P. cipoense, in the negative plane of PC2, than to that of any other species. Because *BEAST
326 inference incorporates the process of gene coalescence, effectively incorporating historical signal
327 in the mitochondrial and nuclear genes, I argue that the species tree generated for Placosoma
328 may be a better approximation of the true phylogeny of this genus (Heled & Drummond, 2011).
329 Inclusion of genetic samples from P. limaverdorum may improve the resolution of the species
330 tree of Placosoma , and further inform our view of the evolutionary history of this genus.
331
332 Literature Cited
333 Amaro, R. C., Rodrigues, M. T., Yonenaga-Yassuda, Y., & Carnaval, A. C. (2012).
334 Demographic processes in the montane Atlantic rainforest: molecular and cytogenetic evidence
335 from the endemic frog Proceratophrys boiei . Molecular Phylogenetics and Evolution , 62 (3),
336 880-888.
337 Anderson, R. P. (2013). A framework for using niche models to estimate impacts of climate
338 change on species distributions. Annals of the New York Academy of Sciences , 1297 (1), 8-28.
19
339 Bérnils, R. S., & Costa, H. C. (2010). Brazilian reptiles–List of species. Sociedade Brasileira de
340 Herpetologia http://www. sbherpetologia. org. br/checklist/repteis. htm (último acesso em
341 05/05/2010) .
342 Blair, C., Mendez de la Cruz, F. R., Law, C., & Murphy R. W. (2014). Molecular phylogenetics
343 and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus ) throughout the
344 Mexican tropical dry forest. Molecular Phylogenetics and Evolution . 84 , 254-265.
345 Borges-Nojosa, D. M., Caramaschi, U., & Rodrigues, M. T. (2016). A new species of lizard
346 Placosoma Tschudi, 1847 (Squamata: Gymnophthalmidae) from the relictual forest mountains of
347 the State of Ceará, Brazil. Zootaxa , 4169 (1), 160-170.
348 Carnaval, A.C., Hickerson, M.J., Haddad C.F.B., Rodrigues, M. T., & Moritz, C. (2009).
349 Stability predicts genetic diversity in the Brazilian Atlantic Forest hotspot. Science . 323 , 785–
350 789.
351 Carnaval, A. C., Waltari, E., Rodrigues, M. T., Rosauer, D., VanDerWal, J., Damasceno, R.,
352 Prates, I., Strangas, M., Spanos, Z., Rivera, D., Pie, M. P., Firkowski, C. R., Bornschein, M. R.,
353 Ribeiro, L. F., & Moritz, C. (2014). Prediction of phylogeographic endemism in an
354 environmentally complex biome. Proceedings of the Royal Society B . (Vol. 281, No. 1792, p.
355 20141461)
356 Cracraft, J. & Prum, R. O. (1988). Patterns and processes of diversification – speciation and
357 historical congruence in some Neotropical birds. Evolution . 42 , 603–620.
20
358 Cunha, O. R. D. (1966). Sobre uma nova espécie de lagarto do estado de Minas Gerais
359 Placosoma cipoense sp. n.(Lacertilia, Teiidae).
360 Darriba D., Taboada G. L., Doallo R, & Posada D. (2012). jModelTest 2: more models, new
361 heuristics and parallel computing. Nature Methods . 9(8), 772.
362 Drummond A. J., Suchard M. A., Xie D., & Rambaut A. (2012). Bayesian phylogenetics with
363 BEAUti and the BEAST 1.7 Molecular Biology and Evolution. 29 , 1969-1973
364 Elith, J., Graham, C. H., Anderson R. P., Dudik, M., Ferrier, S., Guison, A., Hijmans, R. J.,
365 Huettman, F., Leathwick, J. R., Lehmann, A., Li, J., Lohmann, L. G., Loiselle, B. A., Manion,
366 G., Moritz, C., Nakamura, M., Nakazawa, Y., Overton, J. McC., Peterson, A. T., Phillips, S. J.,
367 Richardson, K., Scachetti-Pereira, R., Schapire, R. E., Soberón, J., Williams, S., Wisz, M. S., &
368 Zimmerman, N. E. (2006). Novel methods improve prediction of species’ distributions from
369 occurrence data. Ecography , 29 (2), 129-151.
370 Faith, D. P. (1992). Conservation evaluation and phylogenetic diversity. Biological
371 Conservation , 61 (1), 1-10.
372 Ferrier, S., Pressey, R. L., Barrett, T. W. (2000). A new predictor of the irreplaceability of areas
373 for achieving a conservation goal, its application to real-world planning, and a research agenda
374 for further refinement. Biological Conservation , 93 , 303–325.
375 Graham, C. H., Ron, S. R., Santos, J. C., Schneider, C. J., & Moritz, C. (2004). Integrating
376 phylogenetics and environmental niche models to explore speciation mechanisms in dendrobatid
377 frogs. Evolution . 58 (8), 1781-1793.
21
378 Hasegawa M., Kishino H., & Yano T. (1985). Dating of human-ape splitting by a molecular
379 clock of mitochondrial DNA. Journal of Molecular Evolution . 22 (2), 160–174.
380 Heled, J. & Drummond, A. J. (2011). Bayesian inference of species trees from multilocus data.
381 Molecular Biology and Evolution . 27 (3), 570-580.
382 Hijmans, R. J., Cameron, S. E., Parra, J. L., Jones, P. G. & Jarvis, A. (2005). Very high
383 resolution interpolated climate surfaces for global land areas. International Journal of
384 Climatology . 25 , 1965-1978.
385 Huelsenbeck, J. P. & Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogeny.
386 Bioinformatics . 17, 754-755.
387 Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S.,
388 Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., & Drummond, A.
389 (2012). Geneious Basic: an integrated and extendable desktop software platform for the
390 organization and analysis of sequence data. Bioinformatics . 28 (12), 1647- 1649.
391 Kozak, K. H., & Wiens, J. (2006). Does niche conservatism promote speciation? A case study in
392 North American salamanders. Evolution . 60 (12), 2604-2621.
393 Miller S., Dykes D., & Polesky H. (1988). A simple salting out procedure for extracting DNA
394 from human nucleated cells. Nucleic Acids Research , 16 , 1135–1141.
395 Morellato, L. P. C., & Haddad, C. F. (2000). Introduction: the Brazilian Atlantic forest
396 Biotropica . 32 (4), 786-792.
22
397 Myers, N., Mittermeier, R. A., Mittermeier, C. G., Da Fonseca, G. A., & Kent, J. (2000).
398 Biodiversity hotspots for conservation priorities. Nature . 403 (6772), 853-858.
399 Palumbi, S. R., & Benzie, J. (1991). Large mitochondrial DNA differences between
400 morphologically similar penaeid shrimp. Molecular Marine Biology and Biotechnology , 1(1),
401 27-34.
402 Pellegrino K., Rodrigues M. T., Yonenaga-Yassuda Y., & Sites, Jr, A. (2001). A molecular
403 perspective on the evolution of microteiid lizards (Squamata, Gymnophthalmidae), and a new
404 classification for the family. Biological Journal of the Linnean Society . 74 , 315-338.
405 Peterson, A. T., & Nyari, A. S. (2008). Ecological niche conservatism and Pleistocene refugia in
406 the thrush-liker mourner, Schiffornis sp. in the Neotropics. Evolution , 62 (1), 173-183.
407 Phillips, S. J., & Dudík, M. (2008). Modeling of species distributions with Maxent: new
408 extensions and a comprehensive evaluation. Ecography , 31 (2), 161-175.
409 Rodrigues, M. T., (2005). The conservation of Brazilian reptiles: challenges for a megadiverse
410 country. Conservation Biology, 19 (3), 659-664.
411 Saint, K. M., Austin, C. C., Donnellan, S. C., & Hutchinson, M. N. (1998). C-mos, a nuclear
412 marker useful for squamate phylogenetic analysis. Molecular phylogenetics and evolution , 10 (2),
413 259-263.
414 Tavaré S. (1986). Some probabilistic and statistical problems in the analysis of DNA sequences.
415 Lectures on Mathematics in the Life Sciences (American Mathematical Society) 17 , 57–86.
23
416 Thomé, M. T. C., Zamudio, K. R., Giovanelli, J. G., Haddad, C. F., Baldissera, F. A., &
417 Alexandrino, J. (2010). Phylogeography of endemic toads and post-Pliocene persistence of the
418 Brazilian Atlantic Forest. Molecular phylogenetics and evolution , 55 (3), 1018-1031.
419 Townsend, T. M., Alegre, R. E., Kelley, S. T., Wiens, J. J., & Reeder, T. W. (2008). Rapid
420 development of multiple nuclear loci for phylogenetic analysis using genomic resources: an
421 example from squamate reptiles. Molecular Phylogenetics and Evolution , 47 (1), 129-142.
422 Uzzell, T. M. Jr. (1959). Teiid lizards of the genus Placosoma . Museum of Zoology, University
423 of Michigan.
424 Uzzell, T. M. Jr. (1962) Additional notes on teiid lizards of the genus Placosoma . Copeia, 4,
425 833–835.
426 Warren, D. L., Glor, R. E., & Turelli, M. (2008). Environmental niche equivalency versus
427 conservatism: quantitative approaches to niche evolution. Evolution . 62 (11), 2868-2883.
428 Wiens, J. J., & Graham, C. H. (2005). Niche conservatism: integrating evolution, ecology, and
429 conservation biology. Annual Review of Ecology, Evolution, and Systematics . 519-539.
430 Zaher, H., Barbo, F. E., Martínez, P. S., Nogueira, C., Rodrigues, M. T., & Sawaya, R. J. (2011).
431 Répteis do Estado de São Paulo: conhecimento atual e perspectivas. Biota Neotropica , 67-81.
432
433
434
435
24
436 Appendix 1. Specimens used.
437 The following collection codes are used for specimens in this study:
Species Location Collection Code
Placosoma champsonotus Parque Estadual de Jacupiranga (Núcleo CTMZ 03574 Caverna do Diabo-eldorado Paulista)
Placosoma champsonotus Estação Biológica de Boracéia LG 734
Placosoma cipoense Parque Nacional Serra do Cipó MTR 20324, MTR 20362
Placosoma cordylinum : Estação Ecológica do Bananal CTMZ03208, CTMZ 03322B
Placosoma cordylinum : Teresópolis MTR 936146, MTR 936144, MTR 936147 MZUSP 89960, MZUSP 89961, MZUSP 89944 Placosoma glabellum Cananéia MZUSP 3527
Placosoma glabellum Caraguatatuba CTMZ 03558
Placosoma glabellum Parque Estadual de Jacupiranga (Núcleo CTMZ 03594, Caverna do Diabo-eldorado Paulista) CTMZ 03596
Placosoma glabellum Juquitiba MZUSP 95434
Placosoma glabellum Guaratuba MTR 946152
Placosoma glabellum Boiçucanga in São Sebastião MTR 946309
Placosoma glabellum Iguape MTR 946967
25
Placosoma glabellum Ubatuba LG 1005, MTR 89980, LG 1381
Placosoma glabellum Pilar do Sul MZUSP 8979
Placosoma glabellum Ilha Comprida LG 1782
Placosoma glabellum Caucaia do Alto LG2136
Placosoma glabellum Iporanga LG 2157
Placosoma glabellum Estação Biológica de Boracéia MCL 220, MCL 225, MTR 10367 Placsoma glabellum Caucaia do Alto MTR 09435
438
26