Catenin Downregulation and AMPK Activation

pharmaceutics

Article Pyrvinium Treatment Confers Hepatic Metabolic Beneﬁts via β-catenin Downregulation and AMPK Activation

Shiwei Zhou 1,2,3,† , Obinna N. Obianom 2,†, Jiangsheng Huang 3, Dong Guo 2, Hong Yang 2, Qing Li 1,* and Yan Shu 1,2,*

1 Department of Clinical Pharmacology, Xiangya Hospital, Central South University, Changsha 410008, China; [email protected] 2 Department of Pharmaceutical Sciences, School of Pharmacy, University of Maryland, Baltimore, MD 21201, USA; [email protected] (O.N.O.); [email protected] (D.G.); [email protected] (H.Y.) 3 Department of Thyroid Surgery, The Second Xiangya Hospital, Central South University, Changsha 410011, China; [email protected] * Correspondence: [email protected] (Q.L.); [email protected] (Y.S.) † These authors contribute equally to the work.

Abstract: Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic disorders. Glucose production and lipid accumulation were analyzed to assess metabolic response to pyrvinium in hepatocytes. The expression of key proteins and genes were assessed by immunoblotting and RT-PCR. The in vivo efﬁcacy of pyrvinium against metabolic disorders was Citation: Zhou, S.; Obianom, O.N.; evaluated in the mice fed with a high fat diet (HFD). We found that pyrvinium inhibited glucose Huang, J.; Guo, D.; Yang, H.; Li, Q.; production and reduced lipogenesis by decreasing the expression of key genes in hepatocytes, which Shu, Y. Pyrvinium Treatment Confers were partially elicited by the downregulation of β-catenin through AXIN stabilization. Interestingly, Hepatic Metabolic Beneﬁts via the AMPK pathway also played a role in the action of pyrvinium, dependent on AXIN stabiliza- β-catenin Downregulation and tion but independent of β-catenin downregulation. In HFD-fed mice, pyrvinium treatment led AMPK Activation. Pharmaceutics 2021, to improvement in glucose tolerance, fatty liver disorder, and serum cholesterol levels along with 13, 330. https://doi.org/10.3390/ a reduced body weight gain. Our results show that small molecule stabilization of AXIN using pharmaceutics13030330 pyrvinium may lead to improved glucose and lipid metabolism, via β-catenin downregulation and

Academic Editors: Kishor M. Wasan AMPK activation. and Beom Soo Shin Keywords: pyrvinium; beta catenin; AMPK activation; gluconeogenesis; lipid metabolism Received: 7 January 2021 Accepted: 26 February 2021 Published: 4 March 2021 1. Introduction Publisher’s Note: MDPI stays neutral The liver has large metabolic plasticity and plays an important role in maintaining with regard to jurisdictional claims in body homeostasis of glucose and lipid metabolism. During starvation, the liver is the published maps and institutional afﬁl- primary source of energy and maintains blood glucose levels through gluconeogenesis. iations. In contrast, after a large energy intake, the liver suppresses the production of glucose, promotes the absorption of glucose, and enhances lipogenesis, thus maintaining normo- glycemia [1]. The hepatic dysfunction is a major reason accounting for the pathogenesis of metabolic disorders, such as nonalcoholic fatty liver disease (NAFLD), obesity, and type 2 Copyright: © 2021 by the authors. diabetes mellitus (T2DM) [2,3]. Licensee MDPI, Basel, Switzerland. The multifunctional armadillo repeats containing protein β-catenin is a critical effector This article is an open access article protein for multiple pathways, such as the Wnt/β-catenin and FOXO1 pathways, to cross distributed under the terms and talk in various physiological processes [4–6]. Metabolic syndrome, which is associated with conditions of the Creative Commons abnormalities in glucose and lipid metabolism, may arise from functional compromise in Attribution (CC BY) license (https:// β-catenin-associated signaling pathways [7–9]. For example, the genetic polymorphism creativecommons.org/licenses/by/ of TCF7L2, which encodes a crucial nuclear binding protein of β-catenin, has been well 4.0/).

Pharmaceutics 2021, 13, 330. https://doi.org/10.3390/pharmaceutics13030330 https://www.mdpi.com/journal/pharmaceutics Pharmaceutics 2021, 13, 330 2 of 17

shown to be an important risk factor for T2DM [10–12]. Tight regulation of β-catenin is maintained in the cytoplasm by a destruction complex containing kinases and scaffolding proteins that propagate its degradation. GSK3β and CK1α constitute the primary kinases that phosphorylate β-catenin, while AXIN and APC act to scaffold the proteins [13]. Upon β-catenin phosphorylation, β-TRCP is recruited to the destruction complex to propagate ubiquitination and proteasomal degradation [14]. Despite important progresses, there is still significant paucity of information on the mechanisms of how β-catenin, its regulators, or downstream effectors contribute to the development of metabolic complications. One approach to elucidate the role of β-catenin in glucose, lipid metabolism, and its therapeutic implication in metabolic complications is through the use of its small molecule modulators [15,16]. Only a few studies have explored this angle. For example, CX4945 has been shown a potent effect on insulin release by selectively inhibiting CK2 and reducing the protein expression of β-catenin. Although Rossi et al. did not reveal any significant effects of the compound on the expression of gluconeogenic genes or lipid accumulation in the liver upon treatment, they showed that CX4945 significantly improved glucose tolerance in the mice fed with a high fat diet (HFD) [17]. Here, we attempted to elucidate the role of β-catenin and its associated pathways in energy metabolism by using the small molecule pyrvinium, which was found to significantly decrease the cellular level of β-catenin [18,19]. Pyrvinium is an anthelmintic agent previously approved for the treatment of pinworm infections [20]. As a potent Wnt/β-catenin pathway inhibitor, pyrvinium has elicited anticancer and wound repair effects [19]. However, the efficacy of pyrvinium has not been explored in the treatment of metabolic disorders. In this work, we investigated the effect of pyrvinium on hepatic energy metabolism following its downregulation of β-catenin. Importantly, we also uncovered novel effects of pyrvinium on glucose and lipid metabolism via the activation of AMPK, a crucial cellular energy sensor, in addition to the downregulation of β-catenin.

2. Materials and Methods 2.1. Cell Culture The cell lines studied in the present study were obtained from the American Type Culture Collection (ATCC) and cultured according to the ATCC’s guidelines. For the growth of HEK293, HepG2, and Huh7 cells, the Dulbecco’s Modiﬁed Eagle’s Medium was supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (P/S) (Sigma, St. Louis, MO, USA). The cells were seeded 24 h prior to transfection and treatment. Transfection was carried out with speciﬁed transfection reagents in Opti-MEM Reduced Serum Media (ThermoFisher, Waltham, MA, USA).

2.2. Dual-luciferase Assa Cells were transfected with TCF/LEF-based reporter plasmid, TOPFlash, along with the plasmid for renilla luciferase as the internal control using Lipofectamine 2000 (Invitro- gen, Waltham, MA, USA). The M50 Super 8x TOPFlash was a gift from Dr. Randall Moon (Addgene plasmid # 12456). Treatment with the compounds was carried out 16 h after transfection for additional 24 h. The Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) was used to assess the luciferase activity on POLARstar Omega plate reader (BMC Labtech, Irvine, CA, USA).

2.3. Western Blot Analysis Cell lysates were prepared using NP-40 lysis buffer as previously described [16]. The lysate was centrifuged at 14,000× g for 15 min at 4 ◦C. Bicinchoninic acid (BCA) assay was used to normalize protein concentrations across the samples, and the proteins were resolved on a 7.5–12% SDS-PAGE gels. Western blot analysis was carried out with primary antibodies speciﬁc to the proteins of interest as followed: β-catenin (sc-133240, Santa Cruz Biotech, Dallas, TX, USA), AMPKα (#2603, Cell signaling, Danvers, MA, USA), phospho- AMPKα (#2535, Cell signaling, Danvers, MA, USA), β-actin (ab8227, Abcam, Cambridge, Pharmaceutics 2021, 13, 330 3 of 17

MA, USA), AXIN1 (#06-1049, Sigma, St. Louis, MO, USA). Chemiluminescence detection of proteins was carried out and images were captured using an Odyssey-Fc Imaging System (LI-COR Biosciences, Inc. Lincoln, NE, USA).

2.4. Quantitative Real-Time PCR Analysis Total RNA was extracted from the cells using TRIzol reagent (QIAGEN, Germantown, MD, USA) following the manufacturer’s instructions. The total RNA was reverse tran- scribed and real-time PCR were carried out with SYBR green master mix (Thermoﬁsher, Waltham, MA, USA) using speciﬁc primers as listed in Table1.

Table 1. Primers used for quantitative RT-PCR.

Human Genes Forward Reverse AXIN1 GACCTGGGGTATGAGCCTGA GGCTTATCCCATCTTGGTCATC CSNK1A1 AGTGGCAGTGAAGCTAGAATCT CGCCCAATACCCATTAGGAAGTT CTNNB1 CATCTACACAGTTTGATGCTGCT GCAGTTTTGTCAGTTCAGGGA PEPCK GTCAGCCTGATCACATCCACA CCGTCTTGCTTTCGATCCTG G6Pase CTACTACAGCAACACTTCCGTG GGTCGGCTTTATCTTTCCCTGA CYCD1 CAATGACCCCGCACGATTTC CATGGAGGGCGGATTGGAA IGFBP1 ACCTATGATGGCTCGAAGGC ATGGATGTCTCACACTGTCTGC ACAT2 GCGGACCATCATAGGTTCCTT ACTGGCTTGTCTAACAGGATTCT ACACA CTCTTGGCCTTTTCCCGGTC GCCAGACATGCTGGACCTTA FASN GCAAGCTGAAGGACCTGTCT AATCTGGGTTGATGCCTCCG PRKAA1 ACAGCCGAGAAGCAGAAACA GGGCCTGCATACAATCTTCCT Mouse G6Pase TGTTGCTGTAGTAGTCGGTGTCC CATCAATCTCCTCTGGGTGGC Pepck GCAGTGAGGAAGTTCGTGGA TACATGGTGCGGCCTTTCAT Acat2 AAACCCCGAGAAGGTCAACAT GCTGCCCACCTTTCAACAAT Acaca GTGGTACCTGGCTGCTAGTC GCCAGACATGCTGGATCTCAT Fasn AACCTCTCCCAGGTGTGTG AGAGACTGAACCGAAGGCAG

2.5. Gene Knockdown and Overexpression RNAi transfection was performed with Lipofectamine RNAimax (Thermoﬁsher, Waltham, MA, USA) for siRNAs. The pcDNA3 plasmid containing human beta-catenin cDNA was a gift from Dr. Eric Fearon (Addgene, Watertown, MA, USA plasmid #16828 and #19286), which was overexpressed using Lipofectamine 2000. Following 48 h of trans- fections, cells were treated with pyrvinium for additional 24–48 h unless otherwise stated. siRNA against AXIN1, CK1α, AMPKα1 were purchased from Sigma (sic001, NM_003502, NM_001892, NM_006251).

2.6. Glucose Production Assay Primary hepatocytes were isolated from the livers of C57BL/6J mice of 8–12 weeks old using a published method [21]. After 24 h of post-isolation, the cells were overlaid with Matri-gel. Cells were then treated with pyrvinium at the noted concentrations for 24 h. Glucose production was analyzed as described previously [22]. The cells were washed twice with PBS and starved with starving medium (containing DMEM without glucose, supplemented with HEPES, 40 ng/mL dexamethasone) for 4 h to deplete glucose reserve in the cells. Glucose production medium (bicarbonate-buffered saline medium containing 10 mM l-lactate, 1 mM pyruvate, and 0.3 µM glucagon) was added to the cells for an additional 4 h, after which the media was assayed for glucose content using a glucose determination kit (Sigma Aldrich, St. Louis, MO, USA). Pharmaceutics 2021, 13, 330 4 of 17

2.7. Nile Red Staining The staining method has been described previously [16,23]. Briefly, Huh7 cells were seeded on coverslips which had been coated with rat collagen I overnight. Then, the cells were treated with varying concentrations of pyrvinium. After 36 h, 200 µM sodium oleate was added with pyrvinium for another 16 h. After washing with PBS twice, the cells were fixed with 4% of paraformaldehyde for 30 min at 4 ◦C. Subsequently, cells were washed twice with PBS and stained with 1 µM of Nile red solution for 15 min. Cells were then washed twice with PBS and stained with DAPI solution for 5 min and washed twice again with PBS. The cells were imaged with a fluorescence microscope using 552/636 nm (excitation/emission) lamp settings and the images analyzed using ImageJ (Bethesda, MD, USA).

2.8. Animal Studies All animal experiments were approved by the University of Maryland at Baltimore Institutional Animal Care and Use Committee (IACUC #0617011). Six-week-old male C57BL/6J mice were purchased from the Jackson Laboratories and allowed to acclimate to our animal facility for a week prior to experiments. The mice were fed 45% high fat diet or normal chow diet for 5 weeks. Pyrvinium or vehicle (10% DMSO in saline) was intraperitoneally administered every two days. It was weekly dose escalated from 0.2 mg/kg to 0.5 mg/kg in both normal chow group and high fat diet group in a span of one month. Glucose tolerance tests were performed on the mice with 2 g/kg glucose following 6 h of fasting as described [24]. Liver tissues were excised from the mice and ﬁxed in 10% formalin. The samples were sent for embedding, and hematoxylin and eosin (H&E) staining at the University of Maryland School of Medicine Pathology Core Services. The serum samples were collected post mortem and sent for analysis by VRL-MARYLAND LLC.

2.9. Statistical Analysis Statistical analysis was carried out using GraphPad Prism. Data are presented as mean ± standard deviations and are representative of three independent experiments. Analysis was performed with Student t-test for two groups or analysis of variance (ANOVA) for more than two groups, with statistical signiﬁcance presented with p-value < 0.05.

3. Results 3.1. Pyrvinium Decreased Gluconeogenesis and Lipogenesis in Hepatocytes We first examined the effect of pyrvinium treatment on gluconeogenesis and lipogenesis in mouse primary hepatocytes and human hepatic Huh7 cells. The cytotoxicity by pyrvinium was assessed by CCK8 viability assays, and the results were used to choose a non-toxic concentration range for subsequent experiments (e.g., the IC50 of viability by pyrvinium in mouse primary hepatocytes was 904 nM). In a concentration-dependent manner, pyrvinium decreased glucose production in primary mouse hepatocytes (Figure1A). We conjectured that the effect of pyrvinium on glucose production might be the result of its effect on the gene expression related to glucose metabolism. Therefore, we assessed the mRNA expression of two key gluconeogenic genes G6Pase and Pepck in mouse primary hepatocytes (Figure1B) along with an immortalized human Huh7 cells (Figure1C). To determine the effect of pyrvinium on lipogenesis, we performed a Nile red staining assay in Huh7 cells. Pyrvinium could dose-dependently reduce lipid accumulation in Huh7 cells (Figure1D). Consistently, the expression of three important lipogenic genes, ACAT2, ACACA, and FASN, was reduced by pyrvinium treatment in Huh7 cells (Figure1E). Overall, these results indicate that pyrvinium treatment could decrease gluconeogenesis and lipogenesis in hepatocytes. Pharmaceutics 2021, 13, x FOR PEER REVIEW 5 of 18

Pharmaceutics 2021, 13, 330 5 of 17 1E). Overall, these results indicate that pyrvinium treatment could decrease gluconeogenesis and lipogenesis in hepatocytes.

. Figure 1. Pyrvinium decreased gluconeogenesis and lipogenesis in hepatocytes. (A) Inhibition of pyruvate-induced glucose Figureproduction 1. Pyrvinium in primary decreased mouse gluconeogenesis hepatocytes by pyrvinium.and lipogenesis Cells in were hepatocytes treated with. (A) pyrviniumInhibition of for pyruvate 24 h, then-induced fasted forglu- 4 h coseprior production to glucose in production primary mouse assay. hepatocytes (B) Inhibition by of pyrvinium. gluconeogenic Cells gene were expression treated with in mouse pyrvinium primary for hepatocytes24 h, then fasted incubated for 4 hwith prior pyrvinium to glucose 100 production nM for 24 h.assay. (C) Relative(B) Inhibition mRNA of expression gluconeogenic of gluconeogenic gene expression genes inPEPCK mouseand primaryG6Pase hepatocytesin Huh7 cells incubatedtreated with with pyrvinium pyrvinium for100 24 nM h infor the 24 mediumh. (C) Relative containing mRNA 1g/L expression glucose. of (D gluconeogenic) Representative genes images PEPCK of Nile and redG6Pase staining in Huh7for lipidscells treated in Huh7 with cells. pyrvinium The cells for were 24 h treatedin the medium with indicated containing concentrations 1g/L glucose. of (D pyrvinium) Representative for 36 images h and then of Nile together red stainingwith 200 forµ lipidsM oleate in Huh7 for 16 cells. h. The The scale cells bar were is 275 treatedµm (E )with Relative indicated mRNA concentrations expression of of lipogenic pyrvinium genes for ACAT236 h and, ACACA then , together with 200 μM oleate for 16 h. The scale bar is 275μm (E) Relative mRNA expression of lipogenic genes ACAT2, and FASN in Huh7 cells treated with pyrvinium for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three ACACA, and FASN in Huh7 cells treated with pyrvinium for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least independent studies. three independent studies. 3.2. Decrease of Gluconeogenesis and Lipogenesis by Pyrvinium Involved β-catenin 3.2.Downregulation Decrease of Gluconeogenesis and Lipogenesis by Pyrvinium Involved β-catenin DownregulationPyrvinium has been reported as a potent Wnt/β-catenin inhibitor, causing decreased cellularPyrvinium levels ofhasβ -cateninbeen reported [18,19]. as Here, a potent we first Wnt/β confirmed-catenin that inhibitor, pyrvinium causing had decreased this activity cellularin Huh7 levels cells. of β Pyrvinium-catenin [18 treatment,19]. Here, reduced we first theconfirmed level of thatβ-catenin pyrvinium but increased had this activ- that of ityAXIN1 in Huh7 in Huh7cells. Pyrvinium cells (Figure treatment2A), as has reduced been previously the level of reported β-catenin in HEK293 but increased cells [ 18that,19 ]. of Of AXIN1 note, the in Huh7 transcript cells levels (Figure of both2A), CTNNB1 as has been (encoding previouslyβ-catenin) reported and AXIN1in HEK293 genes cells were [18not,19] altered. Of note, upon the pyrvinium transcript treatmentlevels of both (data CTNNB1 not shown). (encoding As the proteinβ-catenin) level and of βAXIN1-catenin geneswas were changed, not wealtered also upon carried pyrvinium out TCF/LEF treatment reporter (data gene not assays shown). to examine As the Wnt/proteinβ-catenin level of signalingβ-catenin activitywas changed, in Huh7 we cells. also carried As expected, out TCF/LEF pyrvinium reporter treatment gene assays could to significantly examine Wnt/βreduce-catenin reporter signaling activity activity induced in byHuh7 the cells. ligand As protein expected, Wnt3a pyrvinium (Figure 2treatmentB). Interestingly, could significantlywith the treatment reduce reporter of LiCl, activi whichty increasesinduced by cellular the ligandβ-catenin protein levels Wnt3a and activates(Figure 2B). Wnt Interestingly,signaling activity with the by treatment inhibiting of GSK3 LiCl,β which, the inhibitory increases effectcellular by β pyrvinium-catenin levels did and not ac- exist tivates(Figure Wnt2B). signaling The data activity suggested by inhibiting that GSK3 GSK3β,β-mediated the inhibitory phosphorylation effect by ofpyrviniumβ-catenin did was notrequired exist (Figure for the 2B). effect The by data pyrvinium, suggested as has that been GSK3β previously-mediated reported phosphorylation [13]. Consistently, of β- cateninwhile was pyrvinium required treatment for the effect decreased by pyrvinium, the protein as expression has been previously of β-catenin, reported it lacked [13 this]. Consistently,ability in the while presence pyrvinium of LiCl treatment (Figure2C). decreased the protein expression of β-catenin, it lacked this ability in the presence of LiCl (Figure 2C). We next focused to determine whether β-catenin downregulation by pyrvinium contributed to its effects on gluconeogenesis and lipogenesis. Since CK1α activation and AXIN 1 stabilization were among those characterized upstream regulatory mechanisms for β-catenin downregulation [18,19], we investigated the effects of overexpressing

Pharmaceutics 2021, 13, x FOR PEER REVIEW 6 of 18

CTNNB1, and knocking down CSNK1A1 (encoding CK1α1) and AXIN1, respectively, in Huh7 cells (Figure 2D). Consistent with previous reports, knockdown of AXIN1 and CSNK1A1 led to increased protein levels of β-catenin and treatment with pyrvinium reversed this effect (Figure 2E). Moreover, overexpression of CTNNB1 and knockdown of CSNK1A1 and AXIN1 led to an increase in the expression of G6P, PEPCK, ACAT2, ACACA, and FASN. Treatment with pyrvinium significantly attenuated the increase (Fig- ure 2F–J). Overall, these results indicated that pyrvinium-induced decrease of gluconeo- Pharmaceutics 2021, 13, 330 genesis and lipogenesis in hepatocytes was at least partially through the downregulation6 of 17 of β-catenin level, likely via AXIN 1 stabilization.

FigureFigure 2. 2. RoleRole of of ββ-catenin-catenin downregulation downregulation in in the the effects effects of of pyrvinium pyrvinium on on gluconeogenesis gluconeogenesis and and lipogenesis lipogenesis.. (A (A) )Protein Protein expressionexpression of of AXIN1 AXIN1 and and ββ-catenin-catenin in in Huh7 Huh7 cells cells treated treated with with the the indicated indicated concentrations concentrations of of pyrvinium pyrvinium for for 24 24 h. h. (B (B) )Dual Dual luciferaseluciferase reporter reporter a assayssay showing thethe effectseffects by by pyrvinium pyrvinium on on Wnt Wnt signaling signaling pathway pathway activity activity in Huh7in Huh7 cells cells co-treated co-treated with LiCl (GSK3β inhibitor) or WNT3a-conditioned medium. The cells were transfected with TCF/LEF reporter plasmids for 16 h and treated with pyrvinium along with LiCl or WNT3a for additional 24 h. (C) Protein expression of β-catenin in Huh7 cells treated with 100 nM pyrvinium in the presence or absence of LiCl (25 mM) for 24 h. (D) Relative mRNA expression in Huh7 cells transfected with wild type β-catenin, or small interfering RNA (siRNA) against AXIN1 and CSNK1A1; transfection was carried out with 500 ng plasmids or 5 pmol siRNA for 48 h. (E) Protein levels of β-catenin in Huh7 cells transfected with siRNA AXIN1 and CSNK1A1.(F–J) Relative mRNA expression of gluconeogenic genes G6Pase (F), PEPCK (G) and lipogenic genes ACAT2 (H), ACACA (I), and FASN (J) in Huh7 cells with or without β-catenin overexpression, knockdown of AXIN1 and CSNK1A1, respectively, followed by treatment with 50 nM pyrvinium for 24 h. Refer to Figure2 for cell culture conditions. * p < 0.05; ** p < 0.01, *** p < 0.001. Data are representative of at least three independent studies. Pharmaceutics 2021, 13, 330 7 of 17

We next focused to determine whether β-catenin downregulation by pyrvinium contributed to its effects on gluconeogenesis and lipogenesis. Since CK1α activation and AXIN 1 stabilization were among those characterized upstream regulatory mechanisms for β-catenin downregulation [18,19], we investigated the effects of overexpressing CTNNB1, and knocking down CSNK1A1 (encoding CK1α1) and AXIN1, respectively, in Huh7 cells (Figure2D). Consistent with previous reports, knockdown of AXIN1 and CSNK1A1 led to increased protein levels of β-catenin and treatment with pyrvinium reversed this effect (Figure2E). Moreover, overexpression of CTNNB1 and knockdown of CSNK1A1 and AXIN1 led to an increase in the expression of G6P, PEPCK, ACAT2, ACACA, and FASN. Treatment with pyrvinium signiﬁcantly attenuated the increase (Figure2F–J). Overall, these results indicated that pyrvinium-induced decrease of gluconeogenesis and lipogenesis in hepatocytes was at least partially through the downregulation of β-catenin level, likely via AXIN 1 stabilization.

3.3. Effects of Pyrvinium on Gluconeogenesis and Lipogenesis Were Affected by β-catenin Mutation We also compared the effects of pyrvinium treatment on gluconeogenic and lipogenic gene expression in HepG2, another human hepatic cell line, with those in Huh7 cells. Interestingly, the effects by pyrvinium on the expression of G6P, PEPCK, ACAT2, ACACA, and FASN were significantly less in HepG2 cells as compared to Huh7 cells (Figure3A–E). HepG2 cells predominantly express a β-catenin mutant lacking the phosphorylation sites for CK1α and GSK3β (Figure3F) [ 25]. After β-catenin has been transferred from cytoplasm into the nucleus, it can bind to different transcriptional factors such as LEF/TCF1 and FOXO1, leading to downstream gene expression accordingly [26,27]. We examined the expression of β-catenin/TCF target gene CCND1 (encoding CycD1) and β-catenin/FOXO1 target gene IGFBP1 following pyrvinium treatment in Huh7 and HepG2 cells. Whereas the expression of both genes in Huh7 cells was significantly reduced, pyrvinium treatment did not have any significant effect on their expression in HepG2 cells (Figure3G–H), suggesting requirement of a fully functional β-catenin in conferring the pharmacological activities of pyrvinium. Of note, we also tested ICG-001, a β-catenin/CBP/TCF inhibitor. While the expression of CCND1 was significantly reduced by ICG-001 as expected, the expression of G6P, PEPCK, ACAT2, ACACA, and FASN were either not affected or even moderately increased (Figure3I), suggesting that inhibition of the canonical Wnt/ β-catenin/CBP/TCF1 pathway was not the underlying mechanism for pyrvinium to decrease gluconeogenesis and lipogenesis. Overall, however, these results further confirmed a role of intact β-catenin in the decrease of gluconeogenesis and lipogenesis by pyrvinium.

3.4. Pyrvinium Treatment Led to the Activation of AMPK, a Master Regulator of Cellular Metabolism As shown in the above comparison between Huh7 and HepG2 cells, β-catenin downregulation could not fully explain the decrease of gluconeogenesis and lipogenesis by pyrvinium. Pyrvinium treatment can stabilize the levels of AXIN, thereby reducing β- catenin levels [18,19]. AXIN has been previously reported to play a key role in glucose and lipid metabolism by facilitating AMPK activation, i.e., phosphorylation at the Thr172 of AMPKα unit, via AXIN-AMPK-LKB1 complexation [28]. Therefore, we hypothesized that pyrvinium might also cause AMPK activation, which also contributed to the decreased gluconeogenesis and lipogenesis as well. To test this hypothesis, we first confirmed that AXIN1 overexpression led to increased AMPKα phosphorylation at Thr172 in Huh7 cells (Figure4A). As expected, the phosphorylation of Thr172 was also significantly increased by pyrvinium treatment (Figure4B). Next, we studied whether loss of AMPK function affected pyrvinium’s effects on gluconeogenic and lipogenic gene expression. We used siRNA to knock down PRKAA1 (encoding AMPKα1) expression in Huh7 cells (Figure4C,D). We also employed mouse embryonic fibroblasts (MEF) cell lines that harbored double knockout of AMPKα1/2 (DKO) (Figure5A). While the transit knockdown of PRKAA1 led to an increase in the expression of G6P, PEPCK, ACAT2, ACACA, and FASN, the permanent deletion of Pharmaceutics 2021, 13, 330 8 of 17

AMPK resulted in only upregulation of Pepck, Acat2, and Acc1 but those of G6p and Fasn. Pharmaceutics 2021, 13, x FOR PEERHowever, REVIEW in both cases, loss of AMPK expression significantly attenuated the8 of 18 effects of

pyrvinium on the expression of G6Pase, Pepck, Acat2, Acaca, and Fasn (Figure4E,F and Figure5B–F).

Figure 3. Comparison of pyrvinium effects on gene expression between Huh7 and HepG2 cells. (A–E) Relative mRNA expressionFigure 3. of Comparison gluconeogenic of pyrvinium genes G6Pase effects( Aon), genePEPCK expression(B) and between lipogenic Huh7 genes andACAT2 HepG2 (cellsC), .ACACA (A–E) Relative(D), and mRNAFASN (E) in HepG2expression and Huh7 of gluconeogenic cells treated genes with G6Pase 50 nM ( pyrviniumA), PEPCK ( forB) and 48 hlipogenic in the medium genes ACAT2 containing (C), ACACA 1g/L ( glucoseD), and FASN (A,B) ( orE) in normal mediumHepG2 containing and Huh7 200cellsµ treatedM oleate with (C 50–E nM). ( Fpyrvinium) Differential for 48 protein h in the expression medium containing of β-catenin 1g/L formsglucose in (A Huh7,B) or in and normal HepG2 cells. (G) Relativemedium containing mRNA expression 200 μM oleate of Wnt (C–E target). (F) Differential gene CCND1 protein(encoding expression Cyclin of β-ca D1)tenin and forms (H )inβ Huh7-catenin/FOXO1 and HepG2 cells. target gene (G) Relative mRNA expression of Wnt target gene CCND1 (encoding Cyclin D1) and (H) β-catenin/FOXO1 target gene IGFBP1IGFBP1in Huh7 in Huh7 and and HepG2 HepG2 cells cells treated treated with pyrvinium100 pyrvinium100 nM nM for for 24 h. 24 (I h.) Relative (I) Relative mRNA mRNA expression expression of glucon ofeogenic gluconeogenic and lipogenic genes and Wnt target gene CCND 1 in Huh7 cells treated with 5 µM ICG-001 for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three independent experiments.

Pharmaceutics 2021, 13, x FOR PEER REVIEW 10 of 18

Pharmaceutics 2021, 13, 330 9 of 17 Pharmaceutics 2021, 13, x FOR PEER REVIEW 10 of 18

Figure 4. Role of AMPK activation in the effects of pyrvinium on gluconeogenesis and lipogenesis in Huh7 cells. (A) Effect ofFigure AXIN1 4. Roleoverexpression of AMPK activation on AMPK in pho thesphorylation effects of pyrvinium in Huh7on cells. gluconeogenesis The cells were and transiently lipogenesis overexpressed in Huh7 cells. with (A )the Effect p3

plasmidof AXIN1 containing overexpression AXIN1 on gene. AMPK (B) phosphorylationEffect of pyrvinium in Huh7 treatment cells. Theon AMPK cells were phosphorylation transiently overexpressed in Huh7 cells. with The the cells p3 wereplasmidFigure treated 4. containing Role with of AMPKvarying AXIN1 activation concentrations gene. (B )in Effect the effects of pyrvinium of pyrvinium treatmentfor 24 on h. gluconeogenesis( onC) AMPKThe gene phosphorylation expression and lipogenesis of inPRKAA1 Huh7 in Huh7 cells. (encoding cells. The cells ( AAMPK) Effect were alphatreatedof AXIN1 1) with in overexpression Huh7 varying cells concentrations transfected on AMPK of with pho pyrvinium siRNAsphorylation againstfor 24 in h. PRKAA1Huh7 (C) The cells. gene. (D The) expression Protein cells were expression of transientlyPRKAA1 of(encoding phosphorylated overexpressed AMPK with alpha and the total 1) inp3 AMPKαplasmid in containing Huh7 cell AXIN1transfected gene. with (B) siRNAEffect of against pyrvinium PRKAA1 treatment. (E,F) Relativeon AMPK mRNA phosphorylation expression of in gluconeogenic Huh7 cells. The genes cells Huh7 cells transfected with siRNA against PRKAA1.(D) Protein expression of phosphorylated and total AMPKα in Huh7 (PEPCKwere treated, G6Pase with; (E )varying and lipogenic concentrations genes (ACAT2 of pyrvinium, ACACA for and 24 FASNh. (C) ;The (F) withgene orexpression without knockdownof PRKAA1 (encodingof PRKAA1 AMPK, fol- cell transfected with siRNA against PRKAA1.(E,F) Relative mRNA expression of gluconeogenic genes (PEPCK, G6Pase;(E) lowedalpha by 1) treatment in Huh7 cellswith transfected50 nM pyrvinium with siRNA for 24 againsth. * p < PRKAA10.05; ** p. < ( D0.01.) Protein Data are expression representative of phosphorylated of at least three and inde- total pendentandAMPKα lipogenic experiments. in Huh7 genes cell (ACAT2 transfected, ACACA withand siRNAFASN against;(F) with PRKAA1 or without. (E,F knockdown) Relative mRNA of PRKAA1 expression, followed of gluconeogenic by treatment genes with 50(PEPCK nM pyrvinium, G6Pase; for(E) 24and h. lipogenic * p < 0.05; genes ** p < ( 0.01.ACAT2 Data, ACACA are representative and FASN; of(F at) with least or three without independent knockdown experiments. of PRKAA1, followed by treatment with 50 nM pyrvinium for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three independent experiments.

Figure 5. Effect of AMPK deletion on gluconeogenic and lipogenic gene expression in mouse embryonic ﬁbroblasts (MEF) cells. (A) Protein expression of phosphorylated and total AMPK in AMPKα1/α2 wild-type (WT) and double knockout Figure(DKO) 5. MEF Effect cells. of AMPK (B–F) deletion Relative on mRNA gluconeogenic expression and of lipogenic gluconeogenic gene expression genes G6Pase in mouse(B), Pepck embryonic(C) and fibroblasts lipogenic (MEF genes) cellsAcat2. (A(D) ),ProteinAcaca (expressionE), Fasn (F )of in phosphorylated AMPKα1/α2 WT and and total DKO AMPK MEF in cells AMPKα1/α2 treated without wild-type and (WT) with a 100nMnd double pyrvinium knockout for

24 h. Control: WT MEF cells without pyrvinium treatment. * p < 0.05; ** p < 0.01. Data are representative of at least three Figure 5. Effect of AMPK deletion on gluconeogenic and lipogenic gene expression in mouse embryonic fibroblasts (MEF) independent experiments. cells. (A) Protein expression of phosphorylated and total AMPK in AMPKα1/α2 wild-type (WT) and double knockout

Pharmaceutics 2021, 13, 330 10 of 17

We examined the relationship between β-catenin downregulation and AMPK activation in pyrvinium treatment with additional cell lines. First, we compared the protein expression of β-catenin and AMPK in L-cells versus L-Wnt3a cells, which have an increased level of β-catenin (Figure6A). The increase in protein levels of β-catenin did not affect AMPK phosphorylation at Thr172. We then assessed the role of β-catenin to AMPK activation by culturing HEK293 cells with Wnt3a-conditioned medium. As reported previously [29], Wnt3a-conditioned medium increased the cellular level of β-catenin protein. However, AMPK phosphorylation at Thr172 was not affected (Figure6B). Pyrvinium treatment still decreased the cellular level of β-catenin and increased those of AXIN1 and phosphorylated AMPK in the HEK293 cells cultured with Wnt3a-conditioned medium. Pharmaceutics 2021, 13, x FOR PEER REVIEW 11 of 18 Lastly, we assessed the role of AMPK in the downregulation of β-catenin by pyrvinium. In both AMPK WT and DKO MEFs, an apparent decrease of β-catenin levels was observed after pyrvinium treatment (Figure6C), suggesting that the downregulation of β-catenin by (DKO) MEF cells. (B–F) Relativepyrvinium mRNA wasexpression independent of gluconeogenic of its effect genes on G6Pase AMPK (B activation.), Pepck (C) and Notably, lipogenic the genes basal Acat2 protein (D), Acaca (E), Fasn (F) in levelAMPKα1/α2 of β-catenin WT and was DKO decreased MEF cells in treated the DKO without MEFs. and with The reason100nM pyrvinium might be for that 24 AMPK h. Control: WT MEF cells withoutcould pyrvinium phosphorylate treatment. and * stabilizep < 0.05; **β -catenin,p < 0.01. Data therefore are representative its deletion of might at least cause threeβ inde--catenin pendent experiments. proteins more prone to degradation via the destruction complex [30]. Overall, these results indicated that pyrvinium was able to activate AMPK via AXIN 1 stabilization and reduce gluconeogenesis and lipogenesis independent of its inhibitory effect on the level of β-catenin.

Figure 6. Pyrvinium effect on β-catenin level was independent of its effect on AMPK phosphorylation. (A) β-catenin and AMPKFigure phosphorylation 6. Pyrvinium effe inctL-cells on β-catenin and L-Wnt3a level was cells independent cultured for of 24 its h. effect (B) Effect on AMPK of β-catenin phosphorylation upregulation. (A on) β- pyrvinium-catenin and AMPK phosphorylation in L-cells and L-Wnt3a cells cultured for 24 h. (B) Effect of β-catenin upregulation on pyrvinium- induced AMPK activation in HEK293 cells. The cells were cultured with and without WNT3a-conditioned medium and induced AMPK activation in HEK293 cells. The cells were cultured with and without WNT3a-conditioned medium and further treated with 100 nM pyrvinium for 24 h. (C) Protein expression of β-catenin in AMPKα1/α2 WT and DKO MEF further treated with 100 nM pyrvinium for 24 h. (C) Protein expression of β-catenin in AMPKα1/α2 WT and DKO MEF cells treated with and without 100 nM pyrvinium for 24 h. Data are representative of at least three independent experiments. cells treated with and without 100 nM pyrvinium for 24 h. Data are representative of at least three independent experiments. 3.5. Efficacy of Pyrvinium in Treatment of High Fat Diet-Induced Metabolic Disorders in Mice 3.5. EfficacyThe effect of Pyrvinium of pyrvinium in Treatment on energy of metabolismHigh Fat Diet was-Induced further Metabolic assessed Disorders using ain mouse Mice model of metabolic disorders induced by a high fat diet (HFD). Four groups of mice The effect of pyrvinium on energy metabolism was further assessed using a mouse were used, two groups fed normal chow diet (NCD) and the other two fed HFD. Due to model of metabolic disorders induced by a high fat diet (HFD). Four groups of mice were the extremely low bioavailability of pyrvinium [31], the mice received the drug through used, two groups fed normal chow diet (NCD) and the other two fed HFD. Due to the intraperitoneal injection. The results showed that one month of pyrvinium treatment extremely low bioavailability of pyrvinium [31], the mice received the drug through in- significantly improved glucose tolerance in HFD-fed mice, but not in the mice fed with traperitoneal injection. The results showed that one month of pyrvinium treatment signif- NCD (Figure7A). The treatment of pyrvinium was also observed to suppress body weight icantly improved glucose tolerance in HFD-fed mice, but not in the mice fed with NCD gain in HFD-fed mice while having minimal effect in NCD-fed mice (Figure7B). HFD feeding(Figure led7A). to The excessive treatment hepatic of pyrvinium lipid accumulation was also observed and steatosis. to suppress We examined body weight the liver gain histologyin HFD-fed of mice the mice. while There having was minimal significant effect accumulation in NCD-fed mice of lipids (Figure in the7B).liver HFD of feeding mice led to excessive hepatic lipid accumulation and steatosis. We examined the liver histology of the mice. There was significant accumulation of lipids in the liver of mice fed HFD compared to NCD. Upon treatment with pyrvinium, the HFD-induced lipid accumulation was remarkably reduced (Figure 7C). We also analyzed serum biochemical level related to metabolism (Figure 7D). Pyrvinium treatment significantly decreased serum cholesterol in both HFD-and NCD-fed mice. However, there was no significant effect by pyrvinium treatment on the level of triglycerides in either group (data not shown).

Pharmaceutics 2021, 13, 330 11 of 17

fed HFD compared to NCD. Upon treatment with pyrvinium, the HFD-induced lipid Pharmaceutics 2021, 13, x FORaccumulation PEER REVIEW was remarkably reduced (Figure7C). We also analyzed serum biochemical 12 of 18

level related to metabolism (Figure7D). Pyrvinium treatment signiﬁcantly decreased serum cholesterol in both HFD-and NCD-fed mice. However, there was no signiﬁcant effect by pyrvinium treatment on the level of triglycerides in either group (data not shown).

Figure 7. In vivo efficacy of pyrvinium in treatment of metabolic disorders in mice. (A) Glucose tolerance test in high fat diet (HFD)Figure and normal 7. In vivo chow efficacy diet (NCD)-fed of pyrvinium mice in treated treatment with of and metabolic without disorders pyrvinium. in mice. C57BL/6J (A) Glucose mice (n tolerance = 5 per group) test in high fat were treateddiet with (HFD) pyrvinium and normal for 1chow month diet and (NCD) fasted-fed for mice 6 h prior treated to intraperitonealwith and without injection pyrvinium. of 1g/kg C57BL/6J glucose mice for glucose(n = 5 per group) tolerance test.were Thetreated dose with of pyrvinium pyrvinium was for gradually1 month and escalated fasted for from 6 h 0.2 prior mg/kg to intraperitoneal to 0.5 mg/kg ininjection a span of of 1g/kg one month. glucose (B for) glucose tolerance test. The dose of pyrvinium was gradually escalated from 0.2 mg/kg to 0.5 mg/kg in a span of one month. (B) Body weight monitoring of the mice. Injection arrow indicates the start of pyrvinium administration. (C) Haematoxylin and Body weight monitoring of the mice. Injection arrow indicates the start of pyrvinium administration. (C) Haematoxylin eosin staining of liver tissues (20X image, scale bar is 400µm). (D) Effect of pyrvinium on serum cholesterol levels. Serum and eosin staining of liver tissues (20X image, scale bar is 400μm). (D) Effect of pyrvinium on serum cholesterol levels. was collectedSerum postmortem. was collected Data postmortem. are presented Data as meanare presented± SD. * pas< mean 0.05, **± SD.p < 0.01.* p < 0.05, ** p < 0.01. 4. Discussion 4. Discussion The function of β-catenin has been explored quite extensively by using genetic animal The function of β-catenin has been explored quite extensively by using genetic ani- models [2,32]. To date, however, the findings are inconclusive as to whether modulation of mal models [2,32]. To date, however, the findings are inconclusive as to whether modula- β-catenin levels would lead to metabolic benefits in treatment of metabolic diseases. Thus, tion of β-catenin levels would lead to metabolic benefits in treatment of metabolic dis- we sought to use the small molecule pyrvinium to conduct this proof-of-concept study in eases. Thus, we sought to use the small molecule pyrvinium to conduct this proof-of-con- exploration of potential metabolic effects via β-catenin downregulation. Our results show cept study in exploration of potential metabolic effects via β-catenin downregulation. Our that pyrvinium treatment confers therapeutic benefits on the metabolism of glucose and results show that pyrvinium treatment confers therapeutic benefits on the metabolism of lipids in treatment of metabolic disorders through β-catenin downregulation as well as the unexpectedglucose AMPK and activation. lipids in treatment of metabolic disorders through β-catenin downregulation β-cateninas well plays as the an unexpected important role AMPK in regulation activation. of hepatic glucose and lipid metabolism. It has been reportedβ-catenin that plays fatty an acid important treatment ro willle in leadregulation to β-catenin of hepatic accumulation glucose and in hepa-lipid metabo- tocytes, whichlism. It enhances has been lipogenesis, reported that eventually fatty acid causing treatment steatohepatitis will lead to [β33-catenin]. Consistently, accumulation in under a highhepatocytes, fat diet, which hepatocyte-specific enhances lipogenesis,β-catenin eventually transgenic causing (TG) mice steatohepatitis showed appar- [33]. Consist- ent steatosis,ently, as under well asa high rapid fat obesity diet, hepatocyte and systemic-specific insulin β-catenin resistance transgenic in comparison (TG) mice to showed wild-typeapparent mice. In steatosis, contrast, as genetic well as deletion rapid obesity of hepatic andβ systemic-catenin ininsulin mice hasresistance been shown in comparison to causeto resistance wild-type to mice.HFD-induced In contrast, metabolic genetic disorders deletion [ of2, 27 hepatic,32]. In β- thesecatenin studies, in mice the has been expressionshown of key to gluconeogenic cause resistance and to lipogenic HFD-induced genes metabolic in the liver disorders was downregulated [2,27,32]. In in these the studies, liver-specificthe expressionβ-catenin nullof key mice gluconeogenic compared to and their lipogenic control genes littermates in the [ 32liver,34 ].was However, downregulated in the liver-specific β-catenin null mice compared to their control littermates [32,34]. How- ever, silencing of β-catenin has also been reported to exacerbate liver injury [35]. As β- catenin and its associated signaling pathways are physiological critical, their permanent genetic deletion may lead to certain compounding pathological changes in animals. A reversible pharmacological approach may be appropriate in assessment of the therapeutic

Pharmaceutics 2021, 13, 330 12 of 17

silencing of β-catenin has also been reported to exacerbate liver injury [35]. As β-catenin and its associated signaling pathways are physiological critical, their permanent genetic deletion may lead to certain compounding pathological changes in animals. A reversible pharmacological approach may be appropriate in assessment of the therapeutic potential of β-catenin downregulation. We reproduced the desirable results following β-catenin downregulation in mouse primary hepatocytes and human Huh7 cells treated with pyrvinium. Pyrvinium treatment decreased the expression of gluconeogenic and lipogenic genes in a concentration-dependent manner. The same experimental methods were used in our previous studies to assess the metabolic efficacy of metformin and a pyrvinium analog [16,22]. It seems that pyrvinium has appreciable metabolic benefits, and it is worthwhile to explore the potential of this old drug and its analogs in treatment of metabolic diseases. Nevertheless, the detail mechanism accounting for β-catenin downregulation upon pryvinium treatment remains unclear. In our study, pyrvninium treatment did not affect the transcript level of CTNNB1 gene. Lee’s group has reported that pyrvinium could bind allosterically and activate CK1α, thereby increasing phosphorylation and subsequent degradation of β-catenin [18]. However, this has been challenged by Venerando et al. who reported that pyrvinium was not a CK1α activator [36]. Instead, their findings indicated that pyrvinium inhibited the phosphorylation of AKT and hence increased GSK3β activity, eventually increasing the degradation of β-catenin. Very recently, in collaboration with Lee’s group, Shen et al. reported that pyrvinium could directly stimulate the kinase activity of purified, recombinant CK1αS, a splice variant of CK1α in vitro [37]. Interestingly, as observed in the present study, Lee’s group also reported that pyrvinium increases cellular AXIN levels [18,19]. Like other small molecule AXIN stabilizers, pyrvinium may thus reduce beta-catenin level (or increase its degradation) simply via the increase/stabilization of the level of AXIN protein that provides the scaffold for β-catenin, its kinases GSK3β and CK1α in the formation of β-catenin destruction complex [38,39]. The activities of GSK3β and CK1α may or may not be necessarily changed by pyrvinium treatment. However, the exact role of these proteins including AKT, GSK3β, and CK1α in the action of pyrvinium should be defined in future studies. The signaling pathway downstream to β-catenin also remains to be illustrated. β- catenin is an important protein involved in multiple signaling pathways. For example, it can collaborate with the transcriptional factor TCF7L2 to enhance the expression of canonical Wnt target genes. It can also bind with the transcriptional factor FOXO1 to promote certain gene expression [26,27,40]. The role of Wnt/β-catenin/TCF7L2 in hepatic metabolism remains debated. There is evidence supporting that an activated canonical Wnt/β-catenin signaling pathway could actually repress hepatic steatosis and reduce hepatic lipid accumulation [41–44]. In contrast, IP et al. have demonstrated that insulin could stimulate β-catenin S675 phosphorylation and TCF7L2 expression, which leads to Wnt signaling activation and subsequently inhibition of hepatic gluconeogenesis [45]. By using the β-catenin/CBP/TCF inhibitor ICG-001, our results suggested that inhibition of the canonical Wnt/β-catenin/TCF7L2 pathway was not the underlying mechanism for pyrvinium to decrease gluconeogenesis and lipogenesis. On the other hand, the role of FOXO1, which is another important nuclear binding partner of β-catenin, in hepatic energy metabolism and metabolic disorders such as non-alcoholic fatty liver disease (NAFLD) and T2D, has been well documented [46,47]. Liu et al. has reported that under the stimulation by glucagon, more β-catenin would bind to FOXO1 and promote hepatic gluconeogenesis [27], suggesting that inhibition of FOXO1 pathway may confer metabolic benefits. FOXO1 expression has been reported to negatively influence NAFLD progress [46,48,49]. G6Pase and PEPCK can be transcriptionally regulated by FOXO1 [50]. The association of FOXO1 with β-catenin was reported to lead to the upregulation of both G6P and PEPCK, and subsequently an increase in glucose production [27]. In our studies, we found that pyrvinium treatment led to downregulation of FOXO1 signaling, as reflected by the decreased expression of the target gene IGFBP1. However, future studies are needed to demonstrate if FOXO1 mediates the effects of pyrvinium on gluconeogenesis and lipogenesis via β-catenin downregulation. Pharmaceutics 2021, 13, 330 13 of 17

The effects of pyrvinium treatment on the expression of gluconeogenic and lipogenic genes were moderate in HepG2 cells. Consistently, the effects by pyrvinium on the expression of Wnt and FOXO1 target genes were lost in HepG2 cells, which carry a somatic mutation in the CTNNB1 gene lacking of exons 3–4 [25]. Both GSK3β and CK1α phosphorylate the N-terminal region of β-catenin on serine 45, threonine 41, serine 37 and serine 33 [13], all of which fall in the deleted region of the truncated β-catenin in HepG2 cells. The β-catenin mutation might account for the decreased effects of pyrvinium on the studied gene expression in HepG2 cells. The findings in HepG2 cells have further supported a role of functional β-catenin in conferring the effects of pyrvinium on hepatic glucose and lipid metabolism. Meanwhile, the remaining effects of pyrvinium on gluconeogenic and lipogenic gene expression in HepG2 cells suggested that other mechanism, in addition to β-catenin downregulation, was involved in the pharmacological action of pyrvinium on hepatic mechanism. AXIN stabilization may be critical to the pharmacological mechanism of pyrvinium in regulation of hepatic metabolism. Altering cellular AXIN protein levels has metabolic consequences. For instance, following its deletion in vitro and in vivo, there are defects in glucose and lipid metabolism resulting from deactivation of AMPK, a master protein regulator of energy metabolism [28,51]. The deletion of AXIN leads to fatty liver as a result of profound increase in the expression of lipogenic genes in mice [52]. Consistently, we observed that gluconeogenic and lipogenic gene expression was upregulated in the cells of AXIN knockdown and pyrvinium treatment alleviated this effect. Furthermore, both AXIN overexpression and pyrvinium treatment led to an increased activation of AMPK in the present study. As the impact by AMPK activation on gluconeogenesis and lipogenesis are well understood [53,54], our results therefore indicate that the metabolic effects of pyrvinium can be explained by both β-catenin downregulation and AMPK activation following AXIN stabilization. AXIN has been reported to provide a scaffold for AMPK and its kinase LKB1, enhancing AMPK activation [28]. Moreover, AXIN expression has been reported to suppress mitochondrial ATP production in HeLa cells [55], and a decreased cellular energy charge due to mitochondria suppression is well associated with an increased AMPK activity. Pyrvinium has been reported to suppress mitochondrial respiration [56]. Although it is likely that the suppression of mitochondrial respiration by pyrvinium may result from its effect of AXIN stabilization, it remains unclear as to whether AXIN stabilization by pyrvinium could fully account for its effects of mitochondria suppression as well as AMPK activation. The signaling pathway of AMPK activation by pyrvinium also remains to be detailed. Among AMPK activation-induced metabolic benefits are decreased de novo lipogenesis, increased fatty acid oxidation, and reduced reactive oxygen species (ROS) generation, via phosphorylation of key downstream enzymes such as acetyl-CoA carboxylase (ACC), 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGR), glycerol-3-phosphate acyl- transferases (GPAT), the lipogenic transcription factor SREBP-1c, and the antioxidant transcription factor NRF2 [54,57]. It will be important to examine if pyrvinium treatment af- fects the activities of these molecules downstream to AMPK in the future. Moreover, while our data indicated that AMPK activation by pyrvinium was independent of its effect of β-catenin downregulation, it seemed that the level of AMPK could affect that of β-catenin. AMPK has been reported to phosphorylate and stabilize β-catenin [30]. AMPK is also involved in many cellular functions by inhibiting mTORC1 pathway, which was reported to be activated by Wnt via inhibiting GSK3β without involving β-catenin-dependent transcription [58]. It will be interesting to examine whether mTORC1 signaling pathway is involved in pyrvinium effects on hepatic metabolism in future studies. Lastly, to fully explain the metabolic benefits of pyrvinium, we would like to point out that the direct target of pyrvinium needs to be discovered. Although its metabolic benefits could be well explained by β-catenin downregulation and AMPK activation via AXIN stabilization, the contribution from other mechanisms such as a direct effect on the activities of key gluconeogenic and lipogenic enzymes cannot be excluded without the target information. Pharmaceutics 2021, 13, 330 14 of 17

In the present study, the transcript level of AXIN1 gene was not affected by pyrvinium treatment in hepatocytes. We have synthesized a variety of pyrvinium analogs [16,59]. Currently, our research focuses on the identification of a direct target that accounts for the effect of AXIN stabilization by pyrvinium and its analogs. Given the observed metabolic effects of pyrvinium in vitro resulting from β-catenin downregulation and AMPK activation, we further evaluate its potential as a pharmacological strategy to treat metabolic disorders. Our studies in HFD-fed mice indicated that pyrvinium treatment led to improvement in glucose tolerance and a corresponding decrease in HFD-induced body weight gain. The data are consistent with various genetic studies showing that deactivation of the β-catenin leads to decrease in body weight gain of mice [2,27]. The improved glucose tolerance we observed agrees with an increased insulin sensitivity in the mice. Pyrvinium treatment also alleviated HFD-induced fatty liver, which was in line with its in vitro effects on gene expression pertinent to energy metabolism. The animal results have provided further evidence as to its overall benefits in the treatment of metabolic related disorders. However, the animal model used in the present study was limited as the exposure to HFD was relatively short. While we had observed the metabolic benefits of pyrvinium in mice in this proof-of-concept study, it will be important to characterize the pharmacological effects in the hepatic disorder models of more clinical relevance in the future. In addition, application of pyrvinium as a therapeutic agent is limited. Pyrvinium has an extremely low bioavailability [31]. In addition, it causes toxicity in animals with a narrow therapeutic window after systemic exposure [60]. In the present study, an intraperitoneal dose escalated from 0.2 mg/kg to 0.5 mg/kg was used, which was within the range that has been previously employed in the breast cancer xenograft model in mice [60]. The dose was expected to cause a systemic concentration that was higher than pyrvinium’s minimal in vitro efficacy on AXIN stabilization. However, it might be not far away from the in vitro IC50 in viability assays in hepatocytes. Using the chemical structure of pyrvinium as a template, we have synthesized and tested novel classes of analogs of which a lead compound has showed metabolic benefits against HFD- induced metabolic disorders [16,59]. With the mechanistic understanding of pyrvinium action in hepatic metabolism in the present study, we are aiming to develop pyrvinium analogs with better physicochemical, pharmacokinetic, and toxicological properties to explore their potential efficacy against various pathophysiological changes associated with hepatic metabolic disorders, including lipid accumulation, insulin resistance, glucose overproduction, and inflammation. In conclusion, our findings that small molecule downregulation of β-catenin may confer metabolic benefits is a significant step to resolving certain inconsistencies in previously reported genetic studies. Pyrvinium may increase AXIN levels, subsequently decrease β-catenin level and simultaneously activate AMPK to affect glucose and lipid metabolism as well as perhaps other nutrient metabolism in the liver. Further studies are needed to characterize detail molecular mechanisms underlying the metabolic effects of pyrvinium and to develop its desirable analogs that are useful in treatment of metabolic disorders.

Author Contributions: Y.S. and Q.L. conceived the idea. S.Z. and O.N.O. performed the experiments and wrote the manuscript. S.Z., O.N.O., D.G., H.Y., and J.H. carried out analysis and/or edited the manuscript. All authors have read and agreed to the published version of the manuscript. Funding: The present study received support from the National Science and Technology Major Project of China on Novel Drug Discovery and Development (2019ZX09201-002-006) and the National Key R & D Program of China (2019YFE0190500). D.G. is a CERSI Scholar supported by the US Food and Drug Administration (FDA) under grant 2U01FD005946. Institutional Review Board Statement: All animal experiments were approved by the University of Maryland at Baltimore Institutional Animal Care and Use Committee (IACUC #0617011). Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Pharmaceutics 2021, 13, 330 15 of 17

Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References 1. Owen, O.E.; Reichard, G.A., Jr.; Patel, M.S.; Boden, G. Energy metabolism in feasting and fasting. Adv. Exp. Med. Biol. 1979, 111, 169–188. [CrossRef] 2. Behari, J.; Li, H.; Liu, S.; Stefanovic-Racic, M.; Alonso, L.; O’Donnell, C.P.; Shiva, S.; Singamsetty, S.; Watanabe, Y.; Singh, V.P.; et al. beta-catenin links hepatic metabolic zonation with lipid metabolism and diet-induced obesity in mice. Am. J. Pathol. 2014, 184, 3284–3298. [CrossRef] 3. Paschos, P.; Paletas, K. Non alcoholic fatty liver disease and metabolic syndrome. Hippokratia 2009, 13, 9–19. 4. Komiya, Y.; Habas, R. Wnt signal transduction pathways. Organogenesis 2008, 4, 68–75. [CrossRef][PubMed] 5. Essers, M.A.; de Vries-Smits, L.M.; Barker, N.; Polderman, P.E.; Burgering, B.M.; Korswagen, H.C. Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 2005, 308, 1181–1184. [CrossRef] 6. Morris, S.L.; Huang, S. Crosstalk of the Wnt/beta-catenin pathway with other pathways in cancer cells. Genes Dis. 2016, 3, 41–47. [CrossRef][PubMed] 7. Clevers, H.; Nusse, R. Wnt/beta-catenin signaling and disease. Cell 2012, 149, 1192–1205. [CrossRef] 8. Guo, Y.F.; Xiong, D.H.; Shen, H.; Zhao, L.J.; Xiao, P.; Guo, Y.; Wang, W.; Yang, T.L.; Recker, R.R.; Deng, H.W. Polymorphisms of the low-density lipoprotein receptor-related protein 5 (LRP5) gene are associated with obesity phenotypes in a large family-based association study. J. Med. Genet. 2006, 43, 798–803. [CrossRef] 9. Yi, F.; Sun, J.; Lim, G.E.; Fantus, I.G.; Brubaker, P.L.; Jin, T. Cross talk between the insulin and Wnt signaling pathways: Evidence from intestinal endocrine L cells. Endocrinology 2008, 149, 2341–2351. [CrossRef] 10. Zhang, C.; Qi, L.; Hunter, D.J.; Meigs, J.B.; Manson, J.E.; van Dam, R.M.; Hu, F.B. Variant of transcription factor 7-like 2 (TCF7L2) gene and the risk of type 2 diabetes in large cohorts of U.S. women and men. Diabetes 2006, 55, 2645–2648. [CrossRef] 11. Cauchi, S.; Meyre, D.; Dina, C.; Choquet, H.; Samson, C.; Gallina, S.; Balkau, B.; Charpentier, G.; Pattou, F.; Stetsyuk, V.; et al. Transcription factor TCF7L2 genetic study in the French population: Expression in human beta-cells and adipose tissue and strong association with type 2 diabetes. Diabetes 2006, 55, 2903–2908. [CrossRef] 12. Grant, S.F.; Thorleifsson, G.; Reynisdottir, I.; Benediktsson, R.; Manolescu, A.; Sainz, J.; Helgason, A.; Stefansson, H.; Emilsson, V.; Helgadottir, A.; et al. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat. Genet. 2006, 38, 320–323. [CrossRef][PubMed] 13. Liu, C.; Li, Y.; Semenov, M.; Han, C.; Baeg, G.H.; Tan, Y.; Zhang, Z.; Lin, X.; He, X. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 2002, 108, 837–847. [CrossRef] 14. Aberle, H.; Bauer, A.; Stappert, J.; Kispert, A.; Kemler, R. Beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 1997, 16, 3797–3804. [CrossRef] 15. Chen, J.; Li, J.; Miao, Z.; Xu, X.; Liu, C.F. XAV939, a small molecular inhibitor, provides neuroprotective effects on oligodentrocytes. J. Neurosci. Res. 2014, 92, 1252–1258. [CrossRef][PubMed] 16. Obianom, O.N.; Ai, Y.; Li, Y.; Yang, W.; Guo, D.; Yang, H.; Sakamuru, S.; Xia, M.; Xue, F.; Shu, Y. Triazole-Based Inhibitors of the Wnt/beta-Catenin Signaling Pathway Improve Glucose and Lipid Metabolisms in Diet-Induced Obese Mice. J. Med. Chem. 2019, 62, 727–741. [CrossRef] 17. Rossi, M.; Ruiz de Azua, I.; Barella, L.F.; Sakamoto, W.; Zhu, L.; Cui, Y.; Lu, H.; Rebholz, H.; Matschinsky, F.M.; Doliba, N.M.; et al. CK2 acts as a potent negative regulator of receptor-mediated insulin release in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2015, 112, E6818–E6824. [CrossRef][PubMed] 18. Thorne, C.A.; Hanson, A.J.; Schneider, J.; Tahinci, E.; Orton, D.; Cselenyi, C.S.; Jernigan, K.K.; Meyers, K.C.; Hang, B.I.; Waterson, A.G.; et al. Small-molecule inhibition of Wnt signaling through activation of casein kinase 1alpha. Nat. Chem. Biol. 2010, 6, 829–836. [CrossRef] 19. Saraswati, S.; Alfaro, M.P.; Thorne, C.A.; Atkinson, J.; Lee, E.; Young, P.P. Pyrvinium, a potent small molecule Wnt inhibitor, promotes wound repair and post-MI cardiac remodeling. PLoS ONE 2010, 5, e15521. [CrossRef][PubMed] 20. Sudigbia, I.; Notokarsono, S.; Darmawan, S.; Tjoen, L.W. Single-dose treatment of oxyuriasis with pyrvinium pamoate (Vanquin). Paediatr. Indones 1970, 10, 125–130. 21. Li, W.C.; Ralphs, K.L.; Tosh, D. Isolation and culture of adult mouse hepatocytes. Methods Mol. Biol. 2010, 633, 185–196. [CrossRef] [PubMed] 22. Shu, Y.; Sheardown, S.A.; Brown, C.; Owen, R.P.; Zhang, S.; Castro, R.A.; Ianculescu, A.G.; Yue, L.; Lo, J.C.; Burchard, E.G.; et al. Effect of genetic variation in the organic cation transporter 1 (OCT1) on metformin action. J. Clin. Investig. 2007, 117, 1422–1431. [CrossRef][PubMed] 23. Greenspan, P.; Mayer, E.P.; Fowler, S.D. Nile red: A selective ﬂuorescent stain for intracellular lipid droplets. J. Cell Biol. 1985, 100, 965–973. [CrossRef][PubMed] 24. Ayala, J.E.; Samuel, V.T.; Morton, G.J.; Obici, S.; Croniger, C.M.; Shulman, G.I.; Wasserman, D.H.; McGuinness, O.P.; Consor- tium, N.I.H.M.M.P.C. Standard operating procedures for describing and performing metabolic tests of glucose homeostasis in mice. Dis. Model. Mech. 2010, 3, 525–534. [CrossRef] Pharmaceutics 2021, 13, 330 16 of 17

25. De La Coste, A.; Romagnolo, B.; Billuart, P.; Renard, C.A.; Buendia, M.A.; Soubrane, O.; Fabre, M.; Chelly, J.; Beldjord, C.; Kahn, A.; et al. Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc. Natl. Acad. Sci. USA 1998, 95, 8847–8851. [CrossRef] 26. MacDonald, B.T.; Tamai, K.; He, X. Wnt/beta-catenin signaling: Components, mechanisms, and diseases. Dev. Cell 2009, 17, 9–26. [CrossRef] 27. Liu, H.; Fergusson, M.M.; Wu, J.J.; Rovira, I.I.; Liu, J.; Gavrilova, O.; Lu, T.; Bao, J.; Han, D.; Sack, M.N. Wnt signaling regulates hepatic metabolism. Sci. Signal. 2011, 4, ra6. [CrossRef] 28. Zhang, Y.L.; Guo, H.; Zhang, C.S.; Lin, S.Y.; Yin, Z.; Peng, Y.; Luo, H.; Shi, Y.; Lian, G.; Zhang, C.; et al. AMP as a low-energy charge signal autonomously initiates assembly of AXIN-AMPK-LKB1 complex for AMPK activation. Cell Metab. 2013, 18, 546–555. [CrossRef][PubMed] 29. Schinzari, V.; Timperi, E.; Pecora, G.; Palmucci, F.; Gallerano, D.; Grimaldi, A.; Covino, D.A.; Guglielmo, N.; Melandro, F.; Manzi, E.; et al. Wnt3a/beta-Catenin Signaling Conditions Differentiation of Partially Exhausted T-effector Cells in Human Cancers. Cancer Immunol Res. 2018, 6, 941–952. [CrossRef] 30. Zhao, J.; Yue, W.; Zhu, M.J.; Sreejayan, N.; Du, M. AMP-activated protein kinase (AMPK) cross-talks with canonical Wnt signaling via phosphorylation of beta-catenin at Ser 552. Biochem. Biophys. Res. Commun. 2010, 395, 146–151. [CrossRef] 31. Smith, T.C.; Kinkel, A.W.; Gryczko, C.M.; Goulet, J.R. Absorption of pyrvinium pamoate. Clin. Pharmacol. Ther. 1976, 19, 802–806. [CrossRef] 32. Elghazi, L.; Gould, A.P.; Weiss, A.J.; Barker, D.J.; Callaghan, J.; Opland, D.; Myers, M.; Cras-Meneur, C.; Bernal-Mizrachi, E. Importance of beta-Catenin in glucose and energy homeostasis. Sci. Rep. 2012, 2, 693. [CrossRef] 33. Gu, X.; Sun, R.; Chen, L.; Chu, S.; Doll, M.A.; Li, X.; Feng, W.; Siskind, L.; McClain, C.J.; Deng, Z. Neutral ceramidase mediates nonalcoholic steatohepatitis by regulating monounsaturated fatty acids and gut IgA(+) B cells. Hepatology 2020.[CrossRef] [PubMed] 34. Boj, S.F.; van Es, J.H.; Huch, M.; Li, V.S.; Jose, A.; Hatzis, P.; Mokry, M.; Haegebarth, A.; van den Born, M.; Chambon, P.; et al. Diabetes risk gene and Wnt effector Tcf7l2/TCF4 controls hepatic response to perinatal and adult metabolic demand. Cell 2012, 151, 1595–1607. [CrossRef][PubMed] 35. Zhou, D.; Lezmi, S.; Wang, H.; Davis, J.; Banz, W.; Chen, H. Fat accumulation in the liver of obese rats is alleviated by soy protein isolate through beta-catenin signaling. Obesity (Silver Spring) 2014, 22, 151–158. [CrossRef] 36. Venerando, A.; Girardi, C.; Ruzzene, M.; Pinna, L.A. Pyrvinium pamoate does not activate protein kinase CK1, but promotes Akt/PKB down-regulation and GSK3 activation. Biochem. J. 2013, 452, 131–137. [CrossRef] 37. Shen, C.; Li, B.; Astudillo, L.; Deutscher, M.P.; Cobb, M.H.; Capobianco, A.J.; Lee, E.; Robbins, D.J. The CK1alpha Activator Pyrvinium Enhances the Catalytic Efficiency (kcat/Km) of CK1alpha. Biochemistry 2019, 58, 5102–5106. [CrossRef][PubMed] 38. Huang, S.M.; Mishina, Y.M.; Liu, S.; Cheung, A.; Stegmeier, F.; Michaud, G.A.; Charlat, O.; Wiellette, E.; Zhang, Y.; Wiess- ner, S.; et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 2009, 461, 614–620. [CrossRef] 39. Cha, P.H.; Cho, Y.H.; Lee, S.K.; Lee, J.; Jeong, W.J.; Moon, B.S.; Yun, J.H.; Yang, J.S.; Choi, S.; Yoon, J.; et al. Small-molecule binding of the axin RGS domain promotes beta-catenin and Ras degradation. Nat. Chem. Biol. 2016, 12, 593–600. [CrossRef] 40. Monga, S.P. Beta-Catenin Signaling and Roles in Liver Homeostasis, Injury, and Tumorigenesis. Gastroenterology 2015, 148, 1294–1310. [CrossRef][PubMed] 41. Lee, D.H.; Park, M.H.; Hwang, C.J.; Kim, Y.; Hwang, D.Y.; Han, S.B.; Hong, J.T. Parkin deficiency prevents chronic ethanol-induced hepatic lipid accumulation through beta-catenin accumulation. Cell Commun. Signal. 2019, 17, 104. [CrossRef][PubMed] 42. Yao, Y.; Sun, S.; Wang, J.; Fei, F.; Dong, Z.; Ke, A.W.; He, R.; Wang, L.; Zhang, L.; Ji, M.B.; et al. Canonical Wnt Signaling Remodels Lipid Metabolism in Zebrafish Hepatocytes following Ras Oncogenic Insult. Cancer Res. 2018, 78, 5548–5560. [CrossRef] 43. Tian, L.; Shao, W.; Ip, W.; Song, Z.; Badakhshi, Y.; Jin, T. The developmental Wnt signaling pathway effector beta-catenin/TCF mediates hepatic functions of the sex hormone estradiol in regulating lipid metabolism. PLoS Biol. 2019, 17, e3000444. [CrossRef] 44. Seo, M.H.; Lee, J.; Hong, S.W.; Rhee, E.J.; Park, S.E.; Park, C.Y.; Oh, K.W.; Park, S.W.; Lee, W.Y. Exendin-4 Inhibits Hepatic Lipogenesis by Increasing beta-Catenin Signaling. PLoS ONE 2016, 11, e0166913. [CrossRef] 45. Ip, W.; Shao, W.; Chiang, Y.T.; Jin, T. The Wnt signaling pathway effector TCF7L2 is upregulated by insulin and represses hepatic gluconeogenesis. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E1166–E1176. [CrossRef] 46. Matsumoto, M.; Han, S.; Kitamura, T.; Accili, D. Dual role of transcription factor FoxO1 in controlling hepatic insulin sensitivity and lipid metabolism. J. Clin. Investig. 2006, 116, 2464–2472. [CrossRef] 47. Li, Y.; Ma, Z.; Jiang, S.; Hu, W.; Li, T.; Di, S.; Wang, D.; Yang, Y. A global perspective on FOXO1 in lipid metabolism and lipid-related diseases. Prog. Lipid Res. 2017, 66, 42–49. [CrossRef][PubMed] 48. Xiao, J.; Liong, E.C.; Ching, Y.P.; Chang, R.C.; Fung, M.L.; Xu, A.M.; So, K.F.; Tipoe, G.L. Lycium barbarum polysaccharides protect rat liver from non-alcoholic steatohepatitis-induced injury. Nutr. Diabetes 2013, 3, e81. [CrossRef] 49. Xiao, J.; Ho, C.T.; Liong, E.C.; Nanji, A.A.; Leung, T.M.; Lau, T.Y.; Fung, M.L.; Tipoe, G.L. Epigallocatechin gallate attenuates fibrosis, oxidative stress, and inflammation in non-alcoholic fatty liver disease rat model through TGF/SMAD, PI3 K/Akt/FoxO1, and NF-kappa B pathways. Eur. J. Nutr. 2014, 53, 187–199. [CrossRef] 50. Nakae, J.; Kitamura, T.; Silver, D.L.; Accili, D. The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. J. Clin. Investig. 2001, 108, 1359–1367. [CrossRef][PubMed] Pharmaceutics 2021, 13, 330 17 of 17

51. Jing, M.; Cheruvu, V.K.; Ismail-Beigi, F. Stimulation of glucose transport in response to activation of distinct AMPK signaling pathways. Am. J. Physiol. Cell Physiol. 2008, 295, C1071–C1082. [CrossRef] 52. Pyun, D.H.; Kim, T.J.; Kim, M.J.; Hong, S.A.; Abd El-Aty, A.M.; Jeong, J.H.; Jung, T.W. Endogenous metabolite, kynurenic acid, attenuates nonalcoholic fatty liver disease via AMPK/autophagy- and AMPK/ORP150-mediated signaling. J. Cell Physiol. 2020. [CrossRef] 53. Zhou, G.; Myers, R.; Li, Y.; Chen, Y.; Shen, X.; Fenyk-Melody, J.; Wu, M.; Ventre, J.; Doebber, T.; Fujii, N.; et al. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Investig. 2001, 108, 1167–1174. [CrossRef] 54. Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [CrossRef] 55. Shin, J.H.; Kim, H.W.; Rhyu, I.J.; Kee, S.H. Axin is expressed in mitochondria and suppresses mitochondrial ATP synthesis in HeLa cells. Exp. Cell Res. 2016, 340, 12–21. [CrossRef] 56. Teguh, S.C.; Klonis, N.; Duffy, S.; Lucantoni, L.; Avery, V.M.; Hutton, C.A.; Baell, J.B.; Tilley, L. Novel conjugated quinoline-indoles compromise Plasmodium falciparum mitochondrial function and show promising antimalarial activity. J. Med. Chem. 2013, 56, 6200–6215. [CrossRef] 57. Joo, M.S.; Kim, W.D.; Lee, K.Y.; Kim, J.H.; Koo, J.H.; Kim, S.G. AMPK Facilitates Nuclear Accumulation of Nrf2 by Phosphorylating at Serine 550. Mol. Cell Biol. 2016, 36, 1931–1942. [CrossRef][PubMed] 58. Inoki, K.; Ouyang, H.; Zhu, T.; Lindvall, C.; Wang, Y.; Zhang, X.; Yang, Q.; Bennett, C.; Harada, Y.; Stankunas, K.; et al. TSC2 integrates Wnt and energy signals via a coordinated phosphorylation by AMPK and GSK3 to regulate cell growth. Cell 2006, 126, 955–968. [CrossRef][PubMed] 59. Yang, W.; Li, Y.; Ai, Y.; Obianom, O.N.; Guo, D.; Yang, H.; Sakamuru, S.; Xia, M.; Shu, Y.; Xue, F. Pyrazole-4-Carboxamide (YW2065): A Therapeutic Candidate for Colorectal Cancer via Dual Activities of Wnt/beta-Catenin Signaling Inhibition and AMP-Activated Protein Kinase (AMPK) Activation. J. Med. Chem. 2019, 62, 11151–11164. [CrossRef][PubMed] 60. Xu, W.; Lacerda, L.; Debeb, B.G.; Atkinson, R.L.; Solley, T.N.; Li, L.; Orton, D.; McMurray, J.S.; Hang, B.I.; Lee, E.; et al. The antihelmintic drug pyrvinium pamoate targets aggressive breast cancer. PLoS ONE 2013, 8, e71508. [CrossRef]