Oncogenomics

Oncogene (2001) 20, 5067 ± 5074 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc

The pVHL-associated SCF ubiquitin ligase complex: Molecular genetic analysis of elongin B and C, Rbx1 and HIF-1a in renal cell carcinoma

Steven C Cli€ord1,3, Dewi Astuti1, Laura Hooper1, Patrick H Maxwell2, Peter J Ratcli€e2 and Eamonn R Maher*,2

1Section of Medical & Molecular Genetics, Division of Reproductive and Child Health, University of Birmingham, Birmingham, B15 2TT, UK; 2Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX3 7BN, UK

The VHL gene product (pVHL) forms a multimeric panels of CC-RCC and non-neoplastic samples using the complex with the elongin B and C, Cul2 and Rbx1 RFLPs generated by each variant did not reveal allelic proteins (VCBCR complex), which is homologous to the frequency di€erences between RCC patients and controls SCF family of ubiquitin ligase complexes. The VCBCR (P40.32 by chi-squared analysis). Nevertheless, the complex binds HIF-1a and HIF-2a, transcription factors signi®cance of these variations and their potential for critically involved in cellular responses to hypoxia, and modulation of HIF-1a function merits further investiga- targets them for ubiquitin-mediated proteolysis. Germline tion in both other tumour types and in non-neoplastic mutations in the VHL gene cause susceptibility to disease. Taken together with our previous Cul2 mutation haemangioblastomas, renal cell carcinoma (RCC), analysis these data suggest that development of sporadic phaeochromocytoma and other tumours. In addition and familial RCC is not commonly contributed to by somatic inactivation of the VHL gene occurs in most genetic events altering the destruction domain of HIF-1a, sporadic clear cell RCC (CC-RCC). However, the or components of the HIF-a destruction complex other absence of somatic VHL inactivation in 30 ± 40% of than VHL itself. Although (a) activation of HIF could CC-RCC implies the involvement of other gatekeeper occur through mutation of another region of HIF-a, and genes in CC-RCC development. We reasoned that in CC- (b) epigenetic silencing of elongin B/C, Cul2 or Rbx1 RCC without VHL inactivation, other pVHL-interacting cannot be excluded, these ®ndings suggest that pVHL proteins might be defective. To assess the role of elongin may represent the sole mutational target through which B/C, Rbx1 and HIF-1a in RCC tumorigenesis we (a) the VCBR complex is disrupted in CC-RCC. HIF mapped the genes to chromosomes 8q(cen) (elongin C), response is activated in CC-RCC tumorigenesis. Onco- 16p13.3 (elongin B) and 22q11.2 (Rbx1) by FISH, gene (2001) 20, 5067 ± 5074. monochromosomal somatic cell hybrid panel screening and in silico GenBank homology searching; (b) deter- Keywords: renal cell carcinoma; elongin B; elongin C; mined the genomic organisation of elongin C (by direct Rbx1; HIF-1a; VHL; genomic organization; chromo- sequencing of PAC clones), Rbx1 and elongin B (by somal localization; mutation GenBank homology searching); and (c) performed mutation analysis of exons comprising the coding regions of elongins B, C and Rbx1 and the oxygen-dependent Introduction degradation domain of HIF-1a by SSCP screening and direct sequencing in 35 sporadic clear cell RCC samples The isolation of rare familial cancer syndrome tumour without VHL gene inactivation and in 13 individuals with suppressor genes (TSG) has led frequently to the familial non-VHL clear cell RCC. No coding region identi®cation of critical gatekeeper genes for sporadic sequence variations were detected for the elongin B, cancers (Fearon, 1997). Prototypic examples are the elongin C or Rbx1 genes. Two amino acid substitutions APC TSG in familial polyposis coli and sporadic (Pro582Ser and Ala588Thr) were identi®ed in the colorectal cancers and the VHL TSG in von Hippel ± ONCOGENOMICS oxygen-dependent degradation/pVHL binding domain Lindau (VHL) disease and sporadic clear cell renal cell of HIF-1a, however neither substitution was observed carcinoma. Furthermore, elucidation of the function of exclusively in tumour samples. Association analysis in the TSG product may identify further candidate gatekeeper genes implicated in the same biochemical pathway. Thus the interaction of the APC, b-catenin *Correspondence: ER Maher, Division of Medical and Molecular and AXIN1 gene products provided the rationale for Genetics, Department of Paediatrics and Child Health, University of the subsequent identi®cation of somatic mutations in Birmingham Medical School, Edgbaston, Birmingham, B15 2TT, the b-catenin gene (Morin et al., 1997; Korinek et al., U.K.; E-mail: [email protected] 1997; Sparks et al., 1998) in colorectal cancers without 3 Current address: Cancer Research Unit, University of Newcastle, APC gene mutations and of AXIN1 gene mutations in Newcastle-upon-Tyne, NE2 4HH, UK. Received 11 December 2000; revised 23 January 2001; accepted 30 sporadic hepatocellular carcinomas without b-catenin January 2001 mutations (Satoh et al., 2000). Similarly, both patched pVHL-interacting proteins in RCC development SC Clifford et al 5068 and smoothened mutations occur in cutaneous basal oxygen-dependent domain of HIF-1a (Huang, 1998) cell carcinoma (Gailani et al., 1996; Wolter et al., 1997; which includes the core region sucient for interaction Xie et al., 1998). with pVHL (Cockman et al., 2000; Ohh et al., 2000; Renal cell carcinoma (RCC) is the most common Tanimoto et al., 2000). adult renal neoplasm and accounts for *2% of all adult human cancers. Most (*80%) of RCC are classi®ed as clear cell RCC (CC-RCC) (Thoenes et al., Results 1986). Investigations of the VHL TSG have provided critical insights into the pathogenesis of CC-RCC. Chromosomal localization of pVHL-interacting proteins Germline VHL TSG mutations are associated with a high (470%) lifetime risk of CC-RCC and up to 70% FISH and cytogenetic analysis of metaphase spreads of sporadic CC-RCC have VHL inactivation by loss, from normal lymphoblasts using P1 clone RPCI1 mutation or epigenetic silencing (Foster et al., 1994; 24815 as a probe localized the elongin C gene to the Gnarra et al., 1994; Herman et al., 1994; Cli€ord et al., centromeric region of the q-arm of chromosome 8 1998). However, the absence of somatic VHL gene (data not shown). BLAST homology searching of the inactivation in a signi®cant minority of CC-RCC and NCBI GenBank database (http://www.ncbi.nlm.nih.- the existence of familial non-VHL CC-RCC kindreds gov/) using the elongin B (Accession no. NM_007108) (Teh et al., 1997, Woodward et al., 2000) demonstrates and Rbx1 (Ac# AF140598) cDNA sequences revealed the existence of further CC-RCC genes. In view of the that the entire elongin B coding sequence was involvement of APC-associated proteins in colorectal represented by three non-overlapping 100% homo- cancer (Morin et al., 1997; Korinek et al., 1997; Sparks logous regions contained within two cosmid clones et al., 1998), genes which encode proteins implicated in (407D8 (Ac# AC005570) and 373C8 (Ac# AC004493)) pVHL function can be considered as candidate CC- mapping to chromosome 16 at band p13.3. The entire RCC genes. Rbx1 coding sequence was represented by ®ve non- The VHL gene product is likely to have multiple and overlapping 100% homologous regions contained tissue-speci®c functions (Kaelin and Maher, 1998 and within genomic clone 554C12 (Ac# A1080242) which references within). The ®nding that pVHL is required maps to chromosome 22 at band q11.2. Localization of for regulation of the HIF-1 transcriptional control the elongin B, C and Rbx1 genomic sequences to system demonstrated a central role in the cellular chromosomes 16, 8 and 22 respectively was con®rmed response to hypoxia (Maxwell et al., 1999). VHL forms independently by PCR-based screening of a mono- a complex with elongins B and C, Cul2 and the Ring- chromosomal somatic cell hybrid panel (data not H2 ®nger protein Rbx1 (VCBCR complex) which shown) obtained from the UK Human Genome shares sequence and structural similarities to the well- Mapping Project Resource Centre (Kelsell et al., characterised SCF (Skp-1-Cdc53/Cullin-F-box) class of 1995). HIF-1a has previously been mapped to 14q21- E3 ubiquitin ligase complexes. The VCBCR complex q24 (Semenza et al., 1996). binds the oxygen dependent destruction domain of HIFa subunits through the b-domain of pVHL, with Genomic structure of pVHL-interacting proteins pVHL acting as the recognition component of the E3 ubiquitin ligase complex mediating HIF-a destruction The genomic organization of the elongin C gene was (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et resolved by direct DNA sequencing of the RPCI1 al., 2000; Kamura et al., 2000). VHL TSG inactivation 24815 P1 clone using oligonucleotide primers based on consequently leads to stabilization of HIF-1a and HIF- the published cDNA sequence of the elongin C gene 2a and constitutive activation of a wide range of (Ac# L34587). Novel intronic sequences and intron/ hypoxia-inducible genes (Maxwell et al., 1999). exon boundaries were con®rmed by PCR ampli®cation Previously we initiated investigations of the role of of normal blood genomic DNA across each exon using pVHL-binding proteins in oncogenesis by assessing the oligonucleotide primer pairs based on the novel role of the Cul2 gene in the pathogenesis of RCC and intronic sequences followed by direct sequencing. This phaeochromocytoma (Cli€ord et al., 1999; Duerr et al., analysis revealed that the elongin C coding sequence 1999). Although Cul2 allele loss was detected in *25% (88_426 of L34587) is contained within three exons of of sporadic CC-RCC, no mutations were identi®ed. 54, 144 and 4212 bp in size (join 37_91, 92_235 and Similarly, no somatic pathogenic mutations, were 236_4444 of L34587). Elongin C exon sizes and detected in 26 phaeochromocytomas although one boundaries are summarized in Figure 1. sporadic tumour had a hemizygous gene deletion. Genomic structures of the elongin B and Rbx1 genes Nevertheless two Cul2 SNPs were found to be were determined by BLAST homology searching of the signi®cantly over-represented among phaeochromocy- NCBI GenBank database. The elongin B coding toma patients when compared to a control population. sequence (1_357 of the elongin B cDNA To further investigate the role of VHL binding proteins (NM_007108)) comprised three exons (join 3_138, in renal tumorigenesis we undertook to map, char- 139_244 and 242_4357). These exons showed 100% acterise and perform mutation analysis of the elongin homology to segments contained within genomic clones B, elongin C and Rbx1 genes. In addition we 407D8 and 373C8 (join 35163_35298 of AC005570 performed mutation analysis on exons encoding the with 1262_1367 and 4713_44825 of AC004493). The

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5069 Rbx1 coding sequence (7_333 of the Rbx1 cDNA DNA where available) RCC samples by PCR (AF140598)) comprised ®ve exons (join 2_84, ampli®cation and SSCP methods using the oligonu- 85_163, 164_234, 235_320 and 321_4508), show- cleotide primers described in Table 1. No evidence of ing 100% homology to segments contained within the sequence variation in the elongin C (exons 1 ± 3) or genomic clone 554C12 (join 22066_22148, Rbx1 (exons 1 ± 5) coding regions was found in any 24227_24305, 34719_34789, 38471_38556 and sample. 43148_443334 of AL080242). The genomic structure A complex conformer banding pattern was ob- of HIF-1a has previously been described (Iyer et al., served for exon 12 of HIF-1a on SSCP analysis. 1998). The sequence and boundaries of all exons PCR ampli®cation and direct DNA sequencing of analysed were con®rmed by PCR ampli®cation of samples giving rise to each conformer pattern normal genomic DNA using intronic primers spanning revealed three independent single-base substitutions: each exon, followed by direct DNA sequencing (see Firstly, a silent A/T substitution at nt1828. Secondly, Table 1; data not shown). All intron/exon boundaries a C/T substitution at nt1772 giving rise to a PRO/ followed the usual GT/AG rule (Shapiro and Sena- SER variation at codon 582 and causing a novel pathy, 1987). Hph1 restriction fragment length polymorphism (RFLP). These two changes were detected in both constitutional and tumour DNA samples, were not Analysis of DNA sequence variations in tumour-speci®c in any of the sporadic RCC samples pVHL-interacting proteins where matched constitutional DNA was available and Coding regions of the elongin B, elongin C and Rbx1 were therefore considered to be polymorphic changes. genes and HIF-1a sequences spanning the oxygen- A third single-base change (G/A substitution at dependent degradation/pVHL interaction domain (re- nt1790) giving rise to a ALA/THR variation at sidues 417 ± 698, exons 10 ± 12; Pugh et al., 1997; codon 588 and causing a novel Acil RFLP was Huang et al., 1998; Iyer et al., 1998; Cockman et al., detected in a single constitutional DNA sample from 2000; Ohh et al., 2000; Tanimoto et al., 2000), were an individual with inherited CC-RCC. Each of the screened for DNA sequence variations in our panel of substitutions causing novel RFLPs were con®rmed by familial and sporadic (including paired constitutional digestion with the appropriate restriction enzyme

Figure 1 Position and sequences of intron/exon boundaries surrounding the coding region of the human elongin C gene. Conserved splice donor and acceptor sites (AG/GT) are highlighted and the position of the ATG translation start site in exon 1 is shown in bold type. Positions shown are based on GenBank sequence L34587

Table 1 Oligonucleotide primers and PCR conditions used for ampli®cation of elongin B, elongin C, Rbx1 and HIF-1 exons

Exon Forward Primer (5' to 3') Reverse Primer (5' to 3') Product (bp) Ann (8C) MgCl2 (mM) Accession Elongin C 1 CCAAGGACATTAAATAACAG CCAGTTTCTACTAGTTAAAACAC 175 50 2.5 ± 2 CCAAACCTGTTTAGTTTTAG AAAAACATCCATCAAACATTA 270 49 1.5 ± 3 CAGCCAATAACATACATAATTC TGCATACAGGCAACATGCTATA 323 55 1.5 ± Elongin B 1 CCGCCCCCAGGACGTGTTCC TACATCGCGGACAGCGTAGG 224 61 2.5 AC005570 2 TCCTCTGACTTCCCGTGTAG CTCCCTGATGACCTTCTTTG 274 57 1.5 AC004493 3 TGCTGCTTCCTCCACAGATG CTCTTTTATTGGGGGAAATG 165 55 2.0 AC004493 RBX-1 1 TCGGACGACAGACCGTGTGT GGAACGCCCTGAAATGAAAC 215 59 3.0 AL080242 2 GCCAAAGAGATGATAACTGC CTCGTGTGAAGAAGAAAATC 266 51 1.5 AL080242 3 TGCTCCCAAGGTCCAGTGAT AGCAAAGCAGGAAAAGTGGA 177 54 2.5 AL080242 4 CTACCCTGTGGGACCTGTT CCTGAGGCAAGTCAAAAAG 212 52 2.5 AL080242 5 AAGCAGGTTTTATGTCTCAA GTTCCATCCAATTTGTAATT 169 47 2.5 AL080242 HIF-1a 10A GACTCTGTCTTGGGTAAAAA ACTCTGGATTTGGTTCTAAT 272 51 1.5 AF050123 10B TGAAACGCCAAAGCCACTTC CTTGAATGCTAAAATCTGAAAG 223 51 1.5 AF050123 11 AGCTTCTTCAGGAAATAGTA ACAGCAAATACATGAGTTTT 282 46 1.5 AF050124 12A GCCATTGTAAAAACTCATGT ACGGTCTTTTGTCACTGTTT 270 51 1.5 AF050124 12B CCAGCAGACTCAAATACAAG CTATCACATACATTTATCTC 352 50 1.5 AF050124

Primers for PCR ampli®cation of each exon are shown together with the GenBank sequence (accession number) on which they are based. PCR conditions (annealing temperatures: Ann (8C) and ®nal magnesium chloride concentrations, MgCl2 (mM)), product lengths are also shown

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5070 (data not shown). Sequence variations are sum- Discussion marised in Table 2, and example SSCP and sequencing analyses from the variant exons are We have mapped the genes for three pVHL-associated shown in Figure 2. proteins, elongin C, elongin B and Rbx1, to the To assess whether the ALA588THR variation in pericentromic region of chromosome 8, 16p13.3 and HIF-1a was either disease-associated or disease-speci- 22q11.2 respectively and determined their genomic ®c, two further panels of constitutional DNA samples organisation. In addition to any role in hereditary from renal patients with non-neoplastic disease and non-VHL and sporadic RCC development these genes una€ected relatives (n=100) and from individuals provide candidates genes for the development of receiving genetic screening for non-neoplastic disorders tumours displaying genetic alterations at these loci. (n=44) were screened using the Acil RFLP. In For instance, 8q loss of heterozygosity (LOH) has been addition, the panels were assessed for the Hph1 RFLP reported in bladder and prostate carcinoma (Knowles at nt1772 to facilitate association mapping. The et al., 1993; Perinchery et al., 1999), 16p13.3 LOH in ALA588THR variation was detected in 4/144 of the anaplastic thyroid carcinoma and papillary carcinoma individuals in these panels, indicating that this change of the breast (Kadota et al., 2000; Lininger et al., 1998) represents a rare polymorphism not speci®c to and LOH at 22q11.2 in a number of tumour types individuals with RCC. Furthermore, presence or including head and neck carcinoma and rhabdoid absence of a given allelotype at either RFLP was not tumours (Poli-Frederico et al., 2000; Scho®eld et al., speci®cally associated with CC-RCC development 1996). This report of the elongin C, elongin B and (P40.32 by chi-squared analysis). Allelotype frequen- Rbx1 genomic organizations will facilitate studies to cies for all HIF-1a sequence variations are summarized assess their role in the development of these tumour in Table 2. types. Direct DNA sequencing of elongin B exon 3 PCR We did not identify somatic mutations in elongins B products identi®ed a further sequence variation in and C or Rbx1 genes in 35 CC-RCC without VHL addition to those detected by SSCP analysis. This gene mutations. From these results, it seems unlikely represented a single base insertion polymorphism that these genes are frequently mutated in CC-RCC (insG) +2 bases 3' of the termination codon (see with a VHL-independent mechanism of tumorigenesis. Figure 2). Forty-six per cent (6/13) of the samples Some tumour suppressor genes may be inactivated analysed were polymorphic for this variation, which frequently by epigenetic silencing but rarely by was not speci®c to tumour samples (see Table 2). mutations (Dammann et al., 2000) so we cannot Furthermore, multiple ESTs representing each variant exclude the possibility that Elongin B and C and were identi®ed by BLAST homology searching of the Rbx1 genes are methylated frequently RCC tumorigen- NCBI GenBank EST database. Taken together these esis. Nevertheless, the observation that, to date, cancer- ®ndings are indicative of a polymorphic variation. No associated mutations only occur in VHL would be sequence variations were detected in the remainder of compatible with a model where each protein has either the elongin B coding reqion (exons, 1, 2) or the specialized functions within the VCBCR complex, but remainder of the oxygen-dependent degradation do- some components are involved in similar complexes main of HIF-1a (exons 10, 11). controlling other pathways. In this model, Cul2 and

Table 2 Summary of HIF-1a and elongin B sequence variations Allelotype frequencies Sequence variation Sporadic Familial Normal Association Gene Exon Position Nucleotide Protein RFLP Allelotype RCC CC-RCC panels (chi-squared)

HIF-1a 12 nt1772 C/T PRO 582 SER Hph1 C/C 30 (86%) 12 (92%) 110 (77%) P=0.45 C/T 5 (14%) 1 (8%) 27 (19%) T/T 0 0 6 (4%) Total 35 (100%) 13 (100%) 143 (100%) HIF-1a 12 nt1790 G/A ALA 588 THR Aci1 G/G 35 (100%) 12 (92%) 140 (97%) P=0.32 G/A 0 1 (8%) 4 (3%) A/A 0 0 0 Total 35 (100%) 13 (100%) 144 (100%) HIF-1a 12 nt1828 A/T ± ± A/A 33 (94%) 12 (92%) ± A/T 2 (6%) 1 (8%) ± T/T 0 0 ± Total 35 (100%) 13 (100%) ± Elongin B 3 nt357 (+2) insG ± ± insG7/insG7 4 (36%) 2 (66%) ± insG7/insG+ 6 (55%) 0 ± insG+/insG+ 1 (9%) 1 (33%) ± Total 11 (100%) 3 (100%) ±

Allelotype frequencies in our panels of sporadic RCC, familial RCC and control groups are shown for each polymorphic variant. Also shown are results of allelotype association (chi-squared) analyses between RCC and control (normal) groups for the two HIF-1a protein sequence polymorphisms

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5071

Figure 2 Identi®cation of sequence variations. (a) Exon 12 of the HIF-1 a gene ± examples of each di€erent conformer banding pattern detected are shown (A ± G) together with electropherograms of con®rmatory direct DNA sequence analysis showing the corresponding sequence variations. (b) Exon 3 of the elongin B gene ± example electropherograms of sequence variations detected by direct DNA sequence analysis are shown. All sequence variations detected are summarized in Table 2

Rbx1 would interact to recruit and activate ubiquity by development and cellular physiology. The HIF-1 E2 ubiquitin-conjugating enzymes. Elongins B and C transcription factor activates transcription of genes would link the recognition component to the Cul2/ whose products increase O2 delivery (including ery- Rbx1 module (Kamura et al., 2000) while the pVHL thropoietin and angiogenic growth factors), metabolic itself would act as a recognition component by binding adaptation (glucose transporters, glycolytic enxymes) speci®c target proteins. In a manner analagous to the or cell survival (IGF2) and plays a critical role in the F-box protein in SCF complexes, pVHL would normal cellular response to hypoxia (Semenza, 2000). determine substrate speci®city while the rest of the HIF activation is implicated in many physiological VCBCR complex proteins constitute a generic unit and pathological processes. Gene targeting experi- which utilizes other recognition components to target ments have established that HIF-1 is required for other protein substrates. In support of this concept, embryonic development, and that HIF status in¯u- more than 20 Elongin BC-binding proteins have now ences susceptibility to hypoxia-induced pulmonary been identi®ed and one such protein, SOCS-1 hypertension. HIF activation is particularly relevant (suppressor of cytokine signalling) binds the haemato- to cancer biology, with experimental studies indicating poietic-speci®c guanine nucleotide exchange factor Vav major e€ects on gene expression and angiogenesis, and for ubiquitin mediated proteolysis (De Sepulveda et al., evidence of activation in the majority of human 2000). Such an arrangement would predict that cancers studied. HIF activation has also been mutations would occur in the speci®c substrate described recently in cardiac ischaemia. Although recognition components and not in the multifunctional other mechanisms contribute, the dominant mode of CBCR components which might be implicated in a regulation of HIF is through oxygen-dependent wide variety of other cellular processes. Based on the degradation of the a subunits, a process which pVHL model, F-box like proteins that target oncogenic requires pVHL. The oxygen dependent degradation substrates for degradation may provide candidate domain (ODDD) of HIF-1a has been mapped to tumour suppressor genes for further investigation. amino acids 401 ± 603, and includes more than one The ability to sense and adapt to variations in sub-sequence which confers oxygen-dependent instabil- oxygen concentration is fundamental to normal ity (Huang et al., 1998). The region includes a

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5072 sequence centred around 549 ± 582 which represents a PCR amplification of pVHL-interacting protein exons transferable ODDD (Pugh et al., 1997) and is sucient for pVHL binding (Cockman et al., 2000; Based on the sequences de®ned, intronic PCR primer pairs Ohh et al., 2000; Tanimoto et al., 2000). We lying 430 bp external to each intron/exon boundary were hypothesized that RCC without VHL gene inactiva- designed to amplify across each exon using the Oligo4 primer design package (see Table 1). Using these primers, exons were tion might result from somatic missense mutations in PCR ampli®ed using standard conditions. Brie¯y, reactions the ODDD/VBD which would prevent binding to comprised: GeneAmp 106PCR bu€er (500 mM potassium pVHL and result in increased HIF-1a expression. chloride, 100 mM Tris-HCl (pH 8.3); Perkin Elmer), 3 ml; Although we did not identify somatic mutations, we dNTP stock containing 2.5 mM dA,C,T,GTP (Pharmacia), did detect two novel missense variants at codons 582 2.4 ml; 50 mM magnesium chloride (to required ®nal con- and 588. Both these variants were detected in the centration); 20 mM forward primer stock, 0.8 ml; 20 mM germline of patients with familial or sporadic RCC reverse primer stock, 0.8 ml; 5 U/ml Amplitaq (Perkin Elmer), but were also present in control patients with non- 0.08 ml; 50 ng/ml genomic DNA template, 2 ml; sterile distilled neoplastic disease. We cannot exclude the possibility water to 30 ml (®nal volume). Reactions were overlayed with that either variant might modify tumour susceptibility mineral oil (30 ml) before thermal cycling (958C for 5 min followed by 40 cycles of 958C, 30 s; x8C, 30 s; 728C, 30 s and or progression, and the e€ects of the naturally a ®nal extension at 728C for 5 min). A control reaction occurring PRO582SER and ALA588THR variants substituting sterile distilled water for the genomic template on HIF-1 expression in hypoxic and normoxic was included in each batch of reactions to control against conditions have not been investigated. Furthermore, contamination of the reactions by exogenous DNA sources. these variants represent candidate genetic modi®ers for Primers, PCR product size, annealing temperatures (x) and the many human diseases associated with disturbed O2 ®nal MgCl2 concentrations for the ampli®cation of each exon homeostatis such as cardiovascular and respiratory are summarized in Table 1. disease and the angiogenic responses in ischaemia and tumorigenesis and merit further investigation in this respect (Semenza, 2000). Direct DNA sequencing of PCR products PCR products were sequenced using the d-rhodamine sequencing kit protocol and the ABI 377 DNA sequencer (both Applied Biosystems). Individual exons were ®rst PCR Materials and methods ampli®ed as described above. PCR products were puri®ed by agarose gel electrophoresis using the QiaQuick gel extraction Patients and samples kit (Qiagen) according to manufacturer's instructions and eluted in 15 ml sterile distilled water. Five ml of elutant was Thirty-®ve sporadic primary RCC samples were analysed seeded into a 10 ml (®nal volume) d-rhodamine sequencing (comprising paired tumour and normal blood DNA samples reaction, which was set up and cycled according to from 24 patients and tumour-only DNA samples from a manufacturer's instructions, before separation and analysis further 11 patients). Histopathological classi®cation was on the ABI 377 DNA sequencer. available for 20 tumours all of which were CC-RCC (Thoenes et al., 1986). Additionally, constitutional DNA was analysed from 13 a€ected individuals with familial CC- RCC. All samples have previously been assessed for VHL Detection of DNA sequence variations by single strand gene mutation and methylation status and screened for Cul2 conformation polymorphism (SSCP) analysis mutation and have no evidence of inactivation or mutation of SSCP methods (Orita et al., 1989) were used to detect either gene (Foster et al., 1994; Cli€ord et al., 1998, 1999; changes in the exonic DNA sequences, and were performed Woodward et al., 2000). Constitutional DNA samples from as previously described (Crossey et al., 1994). Brie¯y, for each renal patients with non-neoplastic disease (n=100) and from exon under analysis, standard (see above) 30 ml PCR individuals receiving genetic screening for non-neoplastic reactions were performed for all samples and water controls, disorders (n=44) were also employed. and 10 ml of each completed reaction added to an equal volume of formamide loading bu€er (98% formamide, P1 (PAC) artificial chromosome isolation, fluorescence in situ 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol hybridization (FISH) analysis and direct DNA sequencing of blue), before denaturing by heating at 958C for 5 min and snap chilling on ice. Samples were then loaded onto a PAC clones 20620 cm vertical 8% polyacrylamide gel containing 5% PAC maintenance and DNA isolation was as described glycerol and 0.56TBE bu€er, and electrophoresed in a 108C previously (Cli€ord et al., 1999). A PAC clone containing cold cabinet overnight at 2 Watts in 0.56TBE bu€er. Gels elongin C sequences (clone 24815) was isolated from the were then removed from the apparatus and DNA bands RPCI1 library (Ioannou and de Jong, 1996; supplied by the visualized by silver staining as follows: (i) ®xation in 10% UK HGMP Resource Centre) by PCR-based screening using ethanol for 5 min; (ii) oxidation in 1% nitric acid for 10 min; the primers AGGTTCGCTACACTAACAGC (forward) and (iii) water rinse for 2 min; (iv) staining in 0.006 M silver TCGCAGCCATCAGCAGTTC (reverse) based on the nitrate for 15 min; (v) water rinse for 2 min; (vi) DNA band elongin C cDNA sequence (GenBank accession no. development in freshly prepared 0.28 M sodium carbonate/ L34587). Direct DNA sequencing of the PAC clone and 0.019% formalin until desired image intensity was achieved; FISH-based analysis of elongin C chromosomal localization (vii) ®xation in 10% acetic acid for at least 5 min. Gels were using the clone 24815 P1 as a probe were performed as then dried under heat and vacuum onto Whatman 3MM described previously (Cli€ord et al., 1999). paper for viewing and storage.

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5073 Centre (Kelsell et al., 1995). Panel DNAs and appropriate Allelotyping using HIF-1a restriction fragment length controls were screened by PCR ampli®cation as described polymorphisms (RFLPs) elsewhere using primers to Rbx1 exon 2, elongin C exon 3 All samples were allelotyped for the RFLPs identi®ed in exon and elongin B exon 1 (see Table 1). PCR products were 12 of HIF-1a. Brie¯y, samples and water controls were PCR resolved by agarose gel electrophoresis and visualized by ampli®ed as described. Following ampli®cation, PCR staining with ethidium bromide using standard techniques. products were restriction digested by addition of 2 ml restriction enzyme (Hph1 or Aci1, 10 U/ml), 4 ml106appro- priate reaction bu€er (all New England Biolabs), 4 ml water and incubation at 378C for 24 h. Samples were then resolved by agarose gel elecrophoresis and visualized by staining with ethidium bromide using standard techniques. Acknowledgements We thank the Medical Research Council, Cancer Research Monochromosomal somatic cell hybrid panel screening Campaign (CRC) and the VHL Alliance for ®nancial A monochromosomal somatic cell hybrid panel was obtained support. We are grateful to Dr PC Harris, Mayo Clinic for from the UK Human Genome Mapping Project Resource providing DNA samples.

References

Cli€ord SC, Prowse AH, A€ara NA, Buys CH and Maher Kaelin Jr WG and Maher ER. (1998). Trends Genet., 14, ER. (1998). Genes Chrom. Cancer, 22, 200 ± 209. 423 ± 426. Cli€ord SC, Walsh S, Hewson K, Green EK, Brinke A, Kamura T, Sato S, Iwai K, Czyzyk-Krzeska M, Conaway Green PM, Gianelli F, Eng C and Maher ER. (1999). RC and Conaway JW. (2000). Proc.Natl.Acad.Sci.USA, Genes Chrom. Cancer, 26, 20 ± 28. 97, 10430 ± 10435. Cockman ME, Masson N, Mole DR, Jaakkola P, Chang Kelsell DP, Rooke L, Warne D, Bouzyk M, Cullin L, Cox S, GW, Cli€ord SC, Maher ER, Pugh CW, Ratcli€e PJ and West L, Povey S and Spurr NK. (1995). Ann. Hum. Genet., Maxwell PH. (2000). J. Biol. Chem., 275, 25733 ± 25741. 59, 233 ± 241. Crossey PA, Richards FM, Foster K, Green JS, Prowse A, Knowles MA, Shaw ME and Proctor AJ. (1993). Oncogene, Latif F, Lerman MI, Zbar B, A€ara NA, Ferguson-Smith 8, 1357 ± 1364. MA et al. (1994). Hum. Mol. Genet., 3, 1303 ± 1308. Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Dammann R, Li C, Yoon JH, Chin PL, Bates S and Pfeifer Kinzler KW, Vogelstein B and Clevers H. (1997). Science, GP. (2000). Nat. Genet., 25, 315 ± 319. 275, 1784 ± 1787. De Sepulveda P, Ilangumaran S and Rottapel R. (2000). J. LiningerRA,ParkWS,ManYG,PhamT,MacGroganG, Biol. Chem., 275, 14005 ± 14008. Zhuang Z and Tavassoli FA. (1998). Hum. Pathol., 29, Duerr EM, Gimm O, Neuberg DS, Kum JB, Cli€ord SC, 1113 ± 1118. Toledo SP, Maher ER, Dahia PL and Eng C. (1999). J. Maxwell PH, Wiesener MS, Chang GW, Cli€ord SC, Vaux Clin. Endocrinol. Metab., 84, 3207 ± 3211. EC, Cockman ME, Wyko€ CC, Pugh CW, Maher ER and Fearon ER. (1997). Science, 278, 1043 ± 1050. Ratcli€e PJ. (1999). Nature, 399, 271 ± 275. Foster K, Crossey PA, Cairns P, Hetherington JW, Richards Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, FM, Jones MH, Bentley E, A€ara NA, Ferguson-Smith Vogelstein B and Kinzler KW. (1997). Science, 275, 1787 ± MA and Maher ER. (1994). Br. J. Cancer, 69, 230 ± 234. 1790. Gailani MR, Stahlebackdahl M, Le€ell DJ, Glynn M, Ohh M, Park CW, Ivan M, Ho€man MA, Kim TY, Huang Zaphiropoulos PG, Pressman C, Unden AB, Dean M, LE, Pavletich N, Chau V and Kaelin WG. (2000). Nat. Brash DE, Bale AE and Toftgard R. (1996). Nat. Genet., Cell. Biol., 2, 423 ± 427. 14, 78 ± 81. Orita M, Iwahana H, Kanazawa H, Hayashi K and Sekiya T. GnarraJR,ToryK,WengY,SchmidtL,WeiMH,LiH, (1989). Proc. Natl. Acad. Sci. USA, 86, 2766 ± 2770. Latif F, Liu S, Chen F, Duh FM et al. (1994). Nat. Genet., Perinchery G, Bukurov N, Nakajima K, Chang J, Hooda M, 7, 85 ± 90. Oh BR and Dahiya R. (1999). Int. J. Oncol., 14, 495 ± 500. HermanJG,LatifF,WengY,LermanMI,ZbarB,LiuS, Poli-Frederico RC, Bergamo NA, Reis PP, Kowalski LP, SamidD,DuanDS,GnarraJR,LinehanWMet al. Zielenska M, Squire JA and Rogatto SR. (2000). Head (1994). Proc. Natl. Acad. Sci. USA, 91, 9700 ± 9704. Neck, 22, 585 ± 590. Huang LE, Gu J, Schau M and Bunn HF. (1998). Proc. Natl. Pugh CW, O'Rourke JF, Nagao M, Gleadle JM and Ratcli€e Acad. Sci. USA, 95, 7987 ± 7992. PJ. (1997). J. Biol. Chem., 272, 11205 ± 11214. Ioannou PA and de Jong PJ. (1996). Construction of Satoh S, Daigo Y, Furukawa Y, Kato T, Miwa N, Nishiwaki bacterial arti®cial chromosome libraries using the mod- T,KawasoeT,IshiguroH,FujitaM,TokinoT,SasakiY, i®ed P1 (PAC) system. In Dracopoli et al.(ed.)Current Imaoka S, Murata M, Shimano T, Yamaoka Y and Protocols in Human Genetics, Unit 5.15. New York: John Nakamura Y. (2000). Nat. Genet., 24, 245 ± 250. Wiley and Sons. Scho®eld DE, Beckwith JB and Sklar J. (1996). Genes Chrom. Iyer NV, Leung SW and Semenza GL. (1998). Genomics, 52, Cancer, 15, 10 ± 17. 159 ± 165. Semenza GL, Rue EA, Iyer NV, Pang MG and Kearns WG. Kadota M, Tamaki Y, Sakita I, Komoike Y, Miyazaki M, (1996). Genomics, 34, 437 ± 439. Ooka M, Masuda N, Fujiwara Y, Ohnishi T, Tomita N, Semenza GL. (2000). Genes Dev., 14, 1983 ± 1991. Sekimoto M, Ohue M, Ikeda T, Kobayashi T, Horii A and Shapiro MB and Senapathy P. (1987). Nuc. Acids Res., 15, Monden M. (2000). Onco. Rep., 7, 529 ± 533. 7155 ± 7175.

Oncogene pVHL-interacting proteins in RCC development SC Clifford et al 5074 Sparks AB, Morin PJ, Vogelstein B and Kinzler KW. (1998). Wolter M, Reifenberger J, Sommer C, Ruzicka T and Cancer Res., 58, 1130 ± 1134. Reifenberger G. (1997). Cancer Res., 57, 2581 ± 2585. Tanimoto K, Makino Y, Pereira T and Poellinger L. (2000). Woodward ER, Cli€ord SC, Astuti D, A€ara NA and Maher EMBO J., 19, 4298 ± 4309. ER. (2000). J. Med. Genet., 37, 348 ± 353. The BT, Giraud S, Sari NF, Hii SI, Bergerat JP, Larsson C, Xie JW, Murone M, Luoh SM, Ryan A, Gu QM, Zhang CH, Limacher JM and Nicol D. (1997). Lancet, 349, 848 ± 849. Bonifas JM, Lam CW, Hynes M, Goddard A, Rosenthal Thoenes W, Storkel S and Rumpelt HJ. (1986). Path. Res. A, Epstein EH and de Sauvage FJ. (1998). Nature, 391, Prac., 181, 125 ± 143. 90 ± 92.

Oncogene