Instructions to RFLP Blind Test Application

UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PROGRAMA DE PÓ S-GRADUAÇ ÃO EM BIODIVERSIDADE E BIOLOGIA EVOLUTIVA

IDENTIFICAÇÃO MOLECULAR E AUTENTICIDADE DO PESCADO COMERCIALIZADO COMO LINGUADO NO RIO DE JANEIRO

DANIELA FERREIRA DOS SANTOS DE SOUZA

PÓ S-GRADUAÇ ÃO EM BIODIVERSIDADE E BIOLOGIA EVOLUTIVA

IDENTIFICAÇÃO MOLECULAR E AUTENTICIDADE DO PESCADO COMERCIALIZADO COMO LINGUADO NO RIO DE JANEIRO

Aluna: Daniela Ferreira dos Santos de Souza Orientador: Professor Antonio Mateo Solé-Cava

FEVEREIRO DE 2020

3 Ficha Catalográfica

Souza, Daniela Ferreira dos Santos Identificação molecular e autenticidade do pescado comercializado como linguado no Rio de Janeiro/ Daniela Ferreira dos Santos de Souza: Rio de Janeiro, 2020.

96 f.: il.

Orientador: Antonio Mateo Solé-Cava.

Dissertação (Mestrado em Biodiversidade e Biologia Evolutiva), Universidade Federal do Rio de Janeiro. Rio de Janeiro, 2020.

1. Biodiversidade 2. Genética marinha. I. Solé-Cava, Antonio Mateo. II. Universidade Federal do Rio de Janeiro.

4 Agradecimentos

Agradeço primeiramente a minha família, por me fazer quem sou e nunca desistir de me dar a chance de sonhar e realizar até mesmo os sonhos mais distantes, como esses. A minha mãe, por ser uma mulher forte, professora de escola pública que me ensinou e ensina todos os dias a fazer a mudança que queremos ser no mundo. Ao meu pai por me mostrar que nenhuma barreira é tão grande que não possa ser superada, e com jeito e muito trabalho muita coisa pode acontecer. Aos dois pelas noites não dormidas, as horas trabalhadas para sustentar meus estudos, aos conselhos nas horas difíceis, as rizadas nos melhores momentos e nos dias e noites na praia. A minha irmã por ser minha metade, me completando em absolutamente tudo, fiel escudeira, amiga, confidente, sempre me mostrando que sou mais capaz do que eu mesma possa pensar. Ao meu namorado, por ser tudo aquilo que eu preciso, mesmo quando eu não quero, me fazendo entender que meu limite esta muito além do que sempre espero. Por ser carinho e amor quando eu só sentia medo, por me mostrar que não preciso me sentir sozinha jamais. Ao meu avô, Maurício por me mostrar o amor a natureza, sua beleza e carácter fundamental em minha vida. Por ser meu porto seguro até mesmo agora que não está mais fisicamente entre nós. Por me ensinar a ser amor sempre e para todos independente do que o mundo possa me dar em troca. A minhas avós Dina e Tete por de maneiras diferentes a ser a mulher forte e independente que sou. Ao meu orientador Solé por todo o apoio incondicional, tanto profissional, emocional e amizade. Pelas horas não dormidas, e conselhos nos momentos mais importantes na minha vida, e pela oportunidade de aprender e conviver com uma pessoa incrível e um dos melhores pesquisadores do mundo. Obrigada por ser o melhor orientador e amigo que eu poderia sonhar professor. A todos os meus amigos em especial a Rafa, Jessica, Carine e a toda a Bandeja, por me apoiarem tanto na ciência quanto na vida, sem vocês eu não teria chegado até o final. A todos os meus professores, desde a escola municipal JK onde comecei minha vida escolar e aprendi muitos dos valores que carrego até hoje, ao Pedro II onde passei grande

5 parte da minha vida construindo meu ser consciente socialmente e politicamente sendo mais que uma escola, e por fim a UFRJ por toda a construção do ser pesquisadora uma das minhas maiores paixões. A todo o povo Brasileiro por apesar de tudo manter a garra e força e pelo trabalho possibilitar que eu e outros milhares de jovens alcançarem o sonho da faculdade pública de qualidade, que infelizmente não é para todos. A todos os jovens brasileiros em especial, que por não ter a oportunidade de ingressar no nível superior ou nem sequer a perspectiva, trabalham desde cedo e pagam com a própria força de trabalho para que nós estejamos aqui. Por fim, ao Mar, por seu encanto, beleza e força que me pegaram desde criança e pelo ímpeto que me da toda a vez que o vejo, sinto ou toco.

6 Resumo SOUZA, Daniela Ferreira dos Santos de. Identificação molecular e autenticidade do pescado comercializado como linguado no Rio de Janeiro. Rio de Janeiro, 2020. Dissertação (Mestrado em Biodiversidade e Biologia Evolutiva) – Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2020. No Brasil, os peixes legalmente comercializados como “Linguado” correspondem a espécies dos gêneros Syacium e Paralichthys, o que foi definido apenas em 2015 pela Instrução Normativa número 29 (IN 29). Entretanto, espécies de menor valor comercial conhecidas como panga, alabotes e solha, são frequentemente rotuladas ilegalmente como linguado, configurando substituições. Essa rotulagem incorreta pode gerar diversas consequências para os consumidores, que vão desde perdas econômicas até danos à saúde pública, devido a algumas dessas espécies possuírem alergênicos ou contaminantes. A identificação de quais espécies são utilizadas nessas substituições, bem como a etapa na cadeia de produção de alimentos onde elas ocorrem é fundamental no processo de erradicação de tal atividade ilegal. Uma vez que a identificação morfológica de pescado é frequentemente impossibilitada após seu processamento, o uso de técnicas moleculares vem se mostrando uma alternativa eficaz. Dentre estas, se destaca o sequenciamento, que apesar de ser uma técnica amplamente utilizada, possui um custo extremamente elevado, inviabilizam sua aplicação em grande escala em fiscalizações. Como alternativa, apresentam-se técnicas como a RFLP-PCR e PCR Multiplex, igualmente capazes de obter as identificações, com uma redução de tempo e custos. Sendo assim, essa dissertação teve como objetivos: (i) Estimar a taxa de substituição de Linguados no Rio de Janeiro e sua prevalência, ao longo da cadeia de comercialização de linguados; (ii) Verificar a funcionalidade do controle normativo (IN 29) sobre a flutuação nos casos de substituição de Linguado; e (iii) estabelecer e comparar métodos de autenticação com base em multiplex PCR, RFLP-PCR e sequenciamento, quanto à viabilidade, custo e eficiência. Para isso, amostras de files de diferentes etapas da cadeia de comercialização (feiras, supermercados, peixarias e restaurantes) foram sequenciadas para dois genes mitocondriais (Citocromo b e Citocromo Oxidase I) e utilizadas para determinar sua identidade por interrogação de bancos de dados genéticos por BLAST e reconstrução filogenética. Essa metodologia possibilitou a determinação de quais espécies são utilizadas como substitutas, em qual etapa da cadeia de produção essa atividade mais ocorre e a comparação das taxas de substituição antes e depois da IN 29, verificando sua efetividade. Ao mesmo tempo, foram desenvolvidas metodologias baseadas em RFLP- PCR e multiplex abrangendo todo o espectro de espécies determinado na primeira etapa de identificação. Através da comparação das metodologias desenvolvidas com o sequenciamento é possível determinar qual o método apresenta melhor aplicabilidade no processo de identificação em larga escala. A análise através de reconstrução filogenética se mostrou mais consistente do que a com similaridade com BLAST, detectando uma taxa de 52% de substituições fraudulentas, nas quais as espécies Pangasianodon hypophthalmus, Xystreurys spp., Micropogonias furnieri, Merluccius hubbsi, Lophius gastrophysus, Oreochromis niloticus e Cynoscion xanthulus foram rotuladas como linguado. Dentro da cadeia de comercialização de linguado, o mais alto índice de substituição foi encontrado em restaurantes, enquanto que em supermercados tal ocorrência foi a mais baixa. A prevalência de substituições em restaurantes demostra um alvo claro para ações de fiscalização de pescado visando sua coibição. Quanto ao cenário atual de substituições em relação ao período anterior a IN 29, apesar de um pequeno aumento geral de X% ter sido detectado, em pontos específicos como supermercados, foi possível observar a oposta, e esperada, queda (r%). O fato de uma mudança significativa ainda não ter ocorrido em toda a cadeia de produção, revela que tanto a descontinuidade espacial de fiscalizações, quanto o carácter lento de mudanças sociais podem impactar simultaneamente o cenário de substituições. Fiscalizações constantes e ao longo de toda a cadeia se tornam, portanto, fundamentais, o que só pode ser desenvolvido através de uma metodologia de identificação eficiente, acurada, e de baixo custo. Comparando as metodologias de identificação implementadas, com um custo de T reais, um tempo de obtenção de Y horas e uma eficiência de H%, a RFLP-PCR se mostrou a alternativa mais eficiente e adaptável à situação atual do controle normativo pesqueiro brasileiro. As substituições de rótulo de Linguado no brasil são complexas e multifatoriais, sendo portanto, os dados e tecnologias

7 desenvolvidas, uma fonte única de norteamento para políticas públicas nacionais no controle de fraudes pesqueiras. Abstract SOUZA, Daniela Ferreira dos Santos de. Molecular identification and authenticity of fish sold as sole in Rio de Janeiro. Rio de Janeiro, 2020. Dissertation (Master in Biodiversity and Evolutionary Biology) - Institute of Biology, Federal University of Rio de Janeiro, Rio de Janeiro, 2020.

In Brazil, the fish legally labeled and sold as “Flounder” correspond to species of the genera Syacium and Paralichthys, as defined in 2015 by Normative Instruction number 29 (IN 29). However, species of lower commercial value, such as Panga, Halibut and Plaice, are often illegally labeled and sold as sole, constituting illegal substitutions. Incorrect labeling can have several consequences for consumers, ranging from economic losses to damage to public health, due to some of these species having allergens or contaminants. The identification of which species are used in these substitutions, as well as their prevalence along the seafood chain is fundamental for the control of that practice. Since the morphological identification of fish is almost impossible after processing, the use of molecular techniques has been shown to be an effective alternative. Among these approaches, DNA sequencing has been the most popular and widely used, despide its high cost, making its application on a large scale in inspections unfeasible. As an alternative, PCR-based techniques are presented, such as PCR- RFLP and PCR Multiplex, which are capable of obtaining the same results with reduced cost. This dissertation had the following objectives: a) to estimate the rate of substitution and its prevalence, along the chain of commercialization of sole; b) to verify the real functionality of the normative control (IN 29); and c) to establish and compare authentication methods based on multiplex PCR, PCR/RFLP and sequencing, in terms of feasibility, cost and efficiency. For that, samples of filets from different stages of the commercialization chain (fairs, supermarkets, fishmongers and restaurants) were sequenced for two mitochondrial genes (Cytochrome b and Cytochrome Oxidase I) and used to determine their identity through BLAST interrogation of gene databases and phylogenetic reconstruction. That process enabled the determination of which species were used as substitutes -and in what proportion-, at which stage of the production chain this activity was prevalent, and the comparison of replacement rates before and after IN 29, verifying its effectiveness. At the same time, methodologies based on PCR RFLP and multiplex were developed covering the entire spectrum of species already determined in the first identification stage. By comparing the efficiency of the methodologies developed with that of the gold standard of DNA sequencing, it was possible to determine which method would have the best applicability in a large scale identification process. The analysis through phylogenetic reconstruction was more consistent than that done using BLAST similarity, detecting a 52% rate of fraudulent substitutions, in which the species Pangasianodon hypophthalmus, Xystreurys spp., Micropogonias furnieri, Merluccius hubbsi, Lophius gastrophysus, Oreochromis niloticus and Cynoscion xanthulus had been labeled as Flounder. Within the supply chain, the highest and lowest substitution rates occurred in restaurants and supermarkets, respectively, showing a clear target for enforcement actions. Although some differences were found in the substitution rate was detected before and after IN 29, it is correct to say that a significant change has not yet occurred effectively, showing the slow nature of social changes based on legislative changes. Comparing the methodologies, it was possible to identify that, although both worked effectively, PCR RFLP proved to be a more efficient and adaptable alternative to the current situation of the Brazilian fisheries regulatory control. Within such a scenario, the rapid and low-cost identification techniques developed would play a fundamental role in the effective process of reducing sole substitutions.

Lista de tabelas

Tabela 1. Metodologias baseadas em PCR na identificação de alguns grupos de pescado, referências bibliográficas : [1] Catanese et al., 2010; [2] Asensio et al., 2008; [3] Torres et al., 2013; [4] Anjali et al., 2019; [5] Pardo et al., 2004; [6] Xu et al., 2015; [7] Sivaraman et al., 2018; [8] Sotelo et al., 2000; [9] Céspedes et al., 2008; [10] Pappalardo et al., 2018; [11] Ferrito et al., 2019; [12] Hisieh et al., 2004 ...... Página 28

Tabela 2. BLAST and phylogenetic incongruences between genes identification...... Página 30

Tabela 3. Groups of samples according to phylogenetic identification on Cytochrome Oxidase I Maximum likelihood tree reconstruction (COI)...... Página 46-48

Tabela 4. Groups of samples according to phylogenetic identification on Cytochrome Oxidase I Maximum likelihood tree reconstruction (CytbI)...... Página 49-50

Tabela 5. Mislabeling rate compilation per country, continent and general world. Flatfishes group presents an independent analysis, as the target group of the present study...... Página 51-53

Tabela 6. Flatfishes substitute species proportion described at national and international literature...... Página 58-59

Tabela 7. Samples (N=45) used for the Multiplex and RFLP development and test...... Página 66

Tabela 8. Cytochrome oxidase taxon-specific oligonucleotides, their target groups, size of amplified fragment and synthesis direction...... Página 69

Tabela 9. Correlation between the Education level, study area, and both percent hits and answer sheets used...... Página 76

9 Lista de Figuras

Figura 1. Crescimento na produção pesqueira Nacional de 2010 e 2011, evidenciando o estado do Rio de Janeiro como um dos dez maiores produtores. Fonte dos dados: Boletim estatístico da pesca e Aquicultura, MPA, 2011...... Página 15

Figura 2. Etapas na cadeia de comercialização de Linguados, desde a pesca e importação, passando por feiras livres e peixarias, até os mais altos níveis de processamento, em supermercados e restaurantes...... Página 18

Figura 3. Espécies que podem ser legalmente comercializadas como Linguado no Brasil. Fonte: Instrução normativa número 29, 2015...... Página 22

Figura 4. Produtividade e preço de Linguado desde 1997 até 2017. Como um pescado de crescente interesse e valor de mercado sua produtividade busca alcançar números proporcionais a alta procura comercial...... Página 22

Figura 5. Espécies detectadas sendo substituídas por linguado no mercado brasileiro até o momento, bem como sua representatividade no número total de amostras substituídas (Carvalho et al., 2015 e 2017 e Staffen et al., 2017)...... Página 23

Figura 6. Pescados inteiros na fase de pré-processamento e seus respectivos produtos após nível médio de processamento. Na esquerda temos os pescados inteiros em duas colunas onde vemos as espécies substituídas (esquerda) e substitutas (direita) e seus respectivos filés no lado direito (pós processamento). Tal correlação é feita para evidenciar a perda de caracteres morfológicos após o processamento, que muitas vezes impossibilita a identificação morfológica, e a consequente diferenciação entre um pescado autêntico de um substituto...... Página 25

Figura 7. Metodologias baseadas em DNA, nesse caso mitocondrial, mais utilizadas em Identificação Molecular pesqueira. Sequenciamento de DNA e técnicas baseadas em PCR (PCR RFLP e PCR Multiplex). Fonte: Autoral e site Mitofish ...... Página 26

Figura 8. Mapa de distribuição das amostras de linguado coletadas na cidade do Rio de Janeiro. Somente os bairros coloridos foram amostrados, cobrindo uma boa parte da totalidade da região metropolitana carioca...... Página 29

Figura 9. Árvore filogenética dos genes COI e Cytb ...... Página 37

Figura 10. Cenário mundial de rotulagem incorreta de Linguados. …………………...... Página 39

Figura 11. Percentagem total de substituição e em cada uma das etapas da cadeia de comercialização e a distribuição das amostras de linguado fraudadas por espécies substitutas pleuronectiformes e não pleuronectiformes ...... Página 42

Figura 12. Relação entre incidência de substituições e a regulamentação de rotulagem (IN29). Tanto em relação a taxa de fraude (A) geral e dentro de cada etapa da cadeia de comercializacão quanto a quais espécies eram e são utilizadas(B) ...... Página 43

Figura 13. Distribuição ∆Substituição Normalizado, dentro das categorias da cadeia de comercialização (Peixaria, Feirinha e Restaurante) ...... Página 62

Figura 14. Primer annealing positions on the fragment of the Cytochrome oxidase I gene in the Multiplex assay...... Página 68

Figura 15. RFLP fragment patterns (in the left, the bands pattern; in the right, densitograms) of each target group. The peaks marked with an asterisk are the molecular size standards………...... Página 71

Figura 16. Correlation between amplicons and densitograms of two example samples of the same species to illustrate the identification fragments size even in lower concentration...... Página 72

Figura 17. Multiplex amplicons patterns in each target group, with expected and real amplicons sizes...... ……...... Página 73

Figura 18. Key for the identification of PCR RFLP banding patterns...... Página 74

Figura 19. Key to identification of PCR Multiplex Fragments...... Página 75

Figura 20. Test samples presence and absence patterns used in the Multiplex Blind test...... Página 78

Figura 21. Test samples patters and densitograms, that were used in the RFLP Blind test. .... ………...... Página 79 e 80

Figura 22. The file, READ-ME, with instructions for the application of the RFLP blind tests.. ………...... Página 81-84

Figura 23. Esquema 12ilustrativo da incongruência entre as Identidades da Amostra DA192, obtidas por BLAST e reconstrução filogenética. Tal divergência ilustra a necessidade da reconstrução filogenética na obtenção de uma identidade molecular acurada...... Página 86

Figura 24. Esquema ilustrativo dos Pescados que são encontrados em substituições de Linguado no Brasil, tanto na literatura prévia, quanto no presente trabalho, e suas proporções no senário de substituição nacional com ou sem os dados aqui apresentados...... Página 89

Figura 25. Fotos de coletas onde é evidente que muitos grupos pesqueiros são comercializados inteiros, enquanto todos os linguados são expostos ao consumidor de forma de 12files. No canto inferior esquerdo vemos o resto do pescado após o processamento e a direita o suposto produto de sua filetagem...... Página 90

12 Sumário I. Introdução expandida ...... 14 I.I Panorama geral pesqueiro e ocorrência de substituições ...... 14 I.II Fatores que podem ser influenciadores no panorama de substituições ...... 16 I.III Por trás das substituições: consequências e medidas legais inibitórias ...... 19 I.IV Caso dos pescados comercializados como linguado ...... 21 I.V Identificação como ferramenta autenticadora de pescados ...... 24 I.VI Visão geral Capítulos seguintes ...... 28 II. From fish-markets to restaurants: substitution prevalence along the flatfish commercialization chain in Brazil ...... 32 III. Sequencing-free, PCR based, approaches for the fast identification of flatfish species ...... 63 IV. Discussão ...... 84 V. Referências ...... 91

13 I. Introdução expandida

I.I Panorama geral pesqueiro e ocorrência de substituições Como um dos maiores e mais expressivos mercados alimentares, a pesca é uma atividade altamente produtiva, rentável e necessária para a população mundial. Com um consumo mundial per capita médio de 20,2Kg, o crescimento anual pesqueiro ultrapassou o populacional humano, chegando a exceder o crescimento de todos os animais terrestres juntos (FAO, 2018). A procura por produtos pesqueiros é justificada pela alta qualidade nutricional de sua carne aliada ao crescimento da preocupação geral da população e da mídia, em difundir uma alimentarão saudável como estilo de vida. Os produtos de origem pesqueira são uma enorme e valiosa fonte de diversos tipos de nutrientes, que possuem importância que vai desde a nutrição básica até a presença de nutrientes essenciais para mulheres grávidas, pessoas com deficiências nutricionais, na prevenção de doenças cardiovasculares e na saúde mental. (FAO, 2018). A nível mundial, a produção total de pescado previstos em 2030 é de aproximadamente 201 milhões de toneladas, das quais cerca de 1% correspondem à produção brasileira, o quarto maior produtor da américa Latina (FAO, 2018). Na indústria pesqueira brasileira o estado do Rio de Janeiro está entre um dos maiores produtores, responsável por 15% da produção nacional (MAPA, 2011; Figura 1). Essa produção está categorizada em grupos pesqueiros, que se inicia com a sardinha- verdadeira, com a maior produtividade, de 75.122 t, seguido da corvina, com 43.370 t e o grupo de “outros peixes”, com 40.168 t onde se encontram peixes como a pescada amarela, dourado, tainha, cação, linguado e robalo (MAPA, 2011). Os linguados, grupo alvo desta dissertação, são um dos pescados de maior valor tanto nacional como internacionalmente. São peixes apreciados pelo sabor de sua carne e pouca presença de espinhas, que os tornam peixes nobres tão procurados pelo consumidor. Tamanha procura por sua vez, tem alimentado um estado de sobre exploração nos estoques pesqueiros em geral. De 1970 até o ano de 2015, a porcentagem de estoques mundiais biologicamente sustentáveis de todos os peixes caiu de 90 para 66,9%, enquanto os níveis insustentáveis cresceram cerca de 10% no mesmo período (FAO, 2018).

Figura 1: Produção pesqueira Nacional em 2010 e 2011, evidenciando o estado do Rio de Janeiro como um dos dez maiores produtores. Imagem adaptada de: Boletim estatístico da pesca e Aquicultura, MAPA, 2011. Seguindo a lei da oferta e procura, juntamente com a diminuição dos estoques pesqueiros observou-se um aumento nos preços de venda de seus produtos, o que a longo prazo leva a ocorrência de substituições pesqueiras. Conhecidos como erros de rotulagem, as substituições representam os casos em que não há correspondência entre a espécie descrita no rótulo e aquela que de fato está sendo comercializada, podendo ter origem não intencional ou ilegal. Nos casos não intencionais, a substituição de pescados pode ocorrer por similaridade morfológica externa, um mesmo nome comum para espécies diferentes ou ainda uma única espécie possuindo diferente nomes comuns em diferentes regionalidades (Iglésias et al., 2010; Crego-Prieto et al., 2012). Porém, as motivações intencionais são responsáveis pela maior parte dos casos, onde, por ganhos monetários, tentativa de encobrir outra prática ilegal, como a comercialização de animal em risco de extinção, e outras razões, diversos pescados são substituídos de maneira premeditada (Do et al., 2019). A ocorrência de substituições intencionais tem sido documentada em todo o mundo, com uma imensa variedade de pescados como alvo (Guardone et al., 2017; Shehata et al., 2019; Willette & Cheng, 2018; Xiong et al., 2018) Pescados chineses conhecidos como Xue yu (um termo que pode significar bacalhau ou algum gadídeo), que chegam a custar 44 dólares o quilo, apresentam taxa de substituição que passa dos 57%, com mais de seis espécies sendo utilizadas como substitutas, incluindo algumas impróprias para consumo humano. As espécies do gênero Lagocephalus por exemplo, podem causar sérios danos neurológicos se consumidas em excesso (Xiong et al., 2018)

15 Restaurantes japoneses de Los Angeles tiveram seus pescados analisados e, segundo a lista da administração norteamericana de alimentos e drogas (Food and Drugs Administration, FDA), 47% do total amostras não correspondiam à descrição no rótulo. Caso analisadas separadamente, algumas espécies ainda apresentaram um índice de fraude superior a 77%, como no caso dos atuns e alabotes. Tal análise ocorreu por cinco anos, o que torna os dados descritos alarmantes, uma vez que medidas regulatórias, com o objetivo de coibir tais substituições, crescem cada dia mais, enquanto as substituições flutuam sem aparente queda substancial (Willette et al., 2017). Em restaurantes da cidade de Madri na Espanha, pescados do tipo bacalhau, merluza, e outros foram identificados, com uma taxa de substituição de 37%. Dos dezessete diferentes grupos de espécies analisados, cinco apresentaram uma taxa de 100% de erro de rotulagem, como no caso de uma espécie de garoupa (Epinephelus marginatus), ameaçada de extinção (Horreo et al., 2019). Taxa de substituição semelhante foi reportada em Buenos Aires onde, num total de 170 amostras, 22% representavam substituições de rotulagem, utilizando diversas espécies de peixes, como de tubarões, meros e bagres asiáticos, todos de valor inferior, se comparados com a espécie declarada no rótulo (Delpiani et al., 2020). Linguados europeus de diversas espécies são frequentemente alvo de erros de rotulagem, sendo substituídos por peixes de valor de mercado de até quatro vezes inferior, como no caso de uma família de bagres asiáticos (Pangasidae). O linguado comum europeu (Solea Solea) teve sua taxa de substituição apurada tanto em restaurantes quanto em grandes distribuidoras alemãs, com respectivamente cerca de 50 e 30 % de substituições encontradas (Kappel & Schoder, 2016). Outro linguado consumido na Europa, conhecido como língua (Lepidorhombus whiffiagonis), se mostrou um grande alvo de erros de rotulagem, ao ser substituído em 44% dos restaurantes espanhóis (Crego-Prieto et al., 2012). I.II Fatores que podem ser influenciadores no panorama de substituições Erros de rotulagem ocorrem não somente em diversos países por diversas motivações e em diversas taxas, mas também em diferentes locais da cadeia de produção pesqueira. Essas cadeias podem envolver um número considerável de intermediários entre o pescador artesanal ou industrial e o consumidor, assumindo uma complexidade que torna por vezes difícil de determinar onde uma substituição se originou (Figura 2). Atualmente, fatores com grande influência nas cadeias de produção de alimento, são a exportação e importação, que podem ocorrer com o pescado inteiro, com processamento primário ou ainda algum processamento da mais alta categoria como nos pescados enlatados (Iglésias et al., 2010; Crego-Prieto et al., 2012). Outro fator importante são as comercializações informais não registradas, que muitas vezes passam desapercebidas por possuir

16 pequena escala e serem mais baseadas em uma rede de confiança entre vendedor e cliente do que em leis e regulamentações. Entretanto, o maior fator que permeia a relação entre a cadeia de produção pesqueira e os casos de substituição são os níveis de processamento presentes em cada uma de suas etapas (Pardo et al., 2016; Koonse, 2016). Dentre os locais envolvidos em uma cadeia de produção pesqueira simplificada, se encontram feiras livres, peixarias, grandes e médias distribuidoras, supermercados e restaurantes (Figura 2). Com o objetivo de verificar a relação substituição/cadeia, amostras de diferentes pescados de restaurantes europeus e norte americanos, seus fornecedores e supermercados foram analisadas e foi observado um maior índice de substituição em restaurantes, superando 50% (Pardo et al., 2018; Kappel & Schröder, 2016; Shehata et al., 2019). Entretanto, a amplitude e profundidade de comprovação experimentais desses resultados ainda precisam ser ampliadas (Pardo et al., 2018). O conhecimento da funcionalidade e dinâmica das cadeias de produção pesqueiras assume, portanto, um papel fundamental na contenção dos casos de erros de rotulagem, uma vez que conhecendo onde há a maior incidência de casos, se identifica um alvo potencial de fiscalizações. Em uma cadeia tão complexa, uma noção ainda que básica, de qual ou quais etapas demandam uma maior atenção fiscalizadora pode representar a diferença entre uma mudança efetiva e o insucesso no controle de substituições (Leal et al., 2015; Iglésias et al., 2010; Crego-Prieto et al., 2012).

Figura 2: Etapas na cadeia de comercialização de linguados, desde a pesca e importação (A), passando por feiras livres (B,C) e peixarias(D), até os mais altos níveis de processamento, em supermercados(E) e restaurantes (F). (A) Pescados sendo importados e/ou pescados em larga escala geralmente inteiros; (B) Diversos tipos de pescados inteiros sendo comercializados em feiras;(C) linguado exposto em feiras na forma de filé, diferentemente de outros pescados no mesmo local; (D) Filé de linguado em peixarias onde é possível encontrar sua comercialização como peixe inteiro; (E) Pescados mais processados expostos em supermercados, podendo inclusive estar congelado por longos períodos de tempo; (F) Pescado no mais alto nível de processamento, encontrado em restaurantes onde passam por processos como cozimento e fritura que não somente degradam as características morfológicas diagnósticas do filé mas também o seu material genético.

Outro fator frequentemente associado a erros de rotulagem é o preço atribuído ao pescado (Donlan & Luque, 2019; Kappel & Schrö der, 2016). Em uma análise de linguados coletados em restaurantes alemães, a média de preço de pescados autênticos foi de 27 euros, enquanto as substituições ocorriam em pescados que custavam em média 14 euros (Kappel & Schrö der, 2016), indicando uma correlação entre baixo custo e a ocorrência de substituições. Em um outro caso, abrangendo toda a cadeia de produção espanhola de merluzas, a mesma correlação preço/substituição foi encontrada com uma perda de em média 1,25 euros por quilo para os consumidores em 2013 (Muñoz-Colmenero et al., 2015). Tais relações não se mostram necessariamente homogêneas em todas as espécies analisadas em diferentes estudos. Algumas espécies de atum, por exemplo, apresentam alta relação entre substituições e preço, enquanto salmões quase não representaram perda ou ganho ao consumidor quando substituídos (Donlan & Luque, 2019).

I.III Por trás das substituições: consequências e medidas legais inibitórias Uma substituição pode ter diversas origens e fatores intrínsecos, porém, sejam estes quais forem, as possíveis consequências são as mesmas. A primeira e mais evidente é o dano monetário ao consumidor, quando uma espécie de alto valor comercial é substituída por uma de valor inferior. Não por acaso, tal consequência se destaca, uma vez que é também a mais recorrente, sendo citada na grande maioria dos relatos de caso (Fraser et al., 2018). Este é o caso de um bagre asiático conhecido como panga (Pangasianodon hypophthalmus, família Pangasiidae) , sendo constantemente utilizado em substituições de diversos pescados, dentre eles os Linguados (Delpiani et al., 2020). As substituições também podem representar uma ameaça para a saúde pública quando, sem ter conhecimento, um consumidor se alimenta de um pescado que contém substâncias nocivas à sua saúde. O panga e a tilápia do nilo (Oreochromis niloticus, família Cichlidae) são exemplos clássicos de tal questão , uma vez que por se tratarem de pescados de origem de cultivo, muitas vezes acumulam agrotóxicos, pesticidas e metais pesados quando em condições inapropriadas de criação (Chatterjee et al., 2015; Silva et al., 2019; Kulawik et al., 2016;). Outra vertente dos males a saúde pública é a existência de alergênicos naturais que algumas espécies de peixe possuem, como o peixe prego (Lepidocybium flavobrunneum; família Gempylidae) e espécies do gênero Lagocephalus(família Tetraodontinae) já citado anteriormente (Pardo et al., 2016). Além de tais consequências, os erros de rotulagem podem ainda levar ao agravamento do estágio de ameaça de extinção de algumas espécies, uma vez que possibilitam o encobrimento de sua comercialização sob outro rótulo (Horreo et al., 2019). Essa situação é comum com diversas espécies de serranídeos de venda proibida em diversos

19 países (como o mero, no Brasil), por estarem criticamente ameaçadas, segundo a lista vermelha da IUCN, mas que são comercializados sob nomes de outras espécies de venda permitida (Delpiani et al., 2020). Diversos países tomaram medidas legais buscando estabelecer um controle normativo na venda de pescados para a erradicação da prática de substituição. A principal delas tem sido a elaboração de listas correlacionando nomes comuns dos pescados a seus respectivos nomes científicos, que sempre deveriam ser utilizados em seus rótulos. Organizações internacionais como a União Europeia estabeleceram leis de rotulagem para pescados, onde cada rótulo deve conter informaç ões como identificação, origem do peixe e seu método de produç ão (Horreo et al., 2019). Conhecida como EU- 1379/2013, essa lei determina que cada país publique uma lista especificando até mesmo regionalidades referentes a nomes comuns utilizados em diferentes em partes de cada país (Horreo et al., 2019). A administração norte americana de alimentos e drogas (FDA) compilou uma versão online de uma enciclopédia regulatória de peixes (FDA, 2019) onde podemos encontrar uma listagem de nomes comuns relacionados a padrões de proteínas com focalização isoelétrica e dados de sequencias de DNA. Tal relação pode ser descrita como um primeiro passo no desenvolvimento de um processo de fiscalização, baseado na construção de uma biblioteca de dados genéticos que possibilitaria a autenticação de produtos pesqueiros em larga escala (Carvalho et al., 2011). Na Espanha, um Guia dos Principais Pescados, Moluscos e Crustáceos Comercializados na Comunidade de Madri, contém instruç ões de como diferenciar morfologicamente filés de pescado que são frequentemente substituídos e de seus substitutos, ainda que de forma limitada (Barbosa, 2015). Por outro lado, existem ainda países que estão em um longo e demorado processo de elaboração de tais listas e guias, como no caso da China e Argentina. Atualmente, esses países não possuem tal correlação entre rotulagem e conteúdo pesqueiro, logo, atividades de fiscalização são descritas como ineficazes e confusas, uma vez que não se tem um referencial legal (Xiong et al., 2018 ;Delpiani et al., 2020). O diferencial entre ter ou não sucesso no controle de fraude se inicia, portanto, no embasamento legal de políticas de rotulagem que possibilitem uma fiscalização efetiva e funcional. No Brasil, há quase uma década atrás, uma série de medidas legais e manuais de identificação para o consumidor têm sido desenvolvidos, com o objetivo de coibir a prática de substituições. Em 2015, o Ministério da Agricultura Pecuária e Abastecimento (MAPA) publicou a instrução normativa número 29 (IN 29) que determina, para as principais espécies de peixes de interesse comercial brasileiras, a correlação entre seus nomes comuns e respectivos nomes científicos a serem adotados nas rotulagens. Vista como uma ferramenta para o controle da indústria pesqueira, a IN29 possibilitou tanto um maior controle das empresas sobre a escolha de seus fornecedores, quanto introduziu o conceito de controle de compra pelos próprios consumidores, ainda que em nível raso. A partir desse

20 marco, quem compra um determinado pescado passou a ter o direito legal de exigir uma denominação específica em seu rótulo. Na lista da IN 29 estão presentes peixes como bagre, sardinha, caç ão, robalo, salmão, garoupa e linguado, que são comumente encontrados em feiras, peixarias e supermercado por todo o pais.́ Com esta lista estabelecida, o MAPA elaborou em 2016 um manual para a identificação morfológica de espécies de peixes, juntamente com custos que indicariam a ocorrência de substituições (MAPA, 2016). Tal material foi considerado uma referência didática, uma vez que demostra as diferenças morfológicas entre filés de peixes através de fotos e ilustrações, comparando as principais características de todos os pescados de interesse comercial brasileiros. No entanto, por ser extremante específico quanto à morfologia dos pescados já processados, o manual não pode ser amplamente utilizado em fiscalizações de larga escala. I.IV Caso dos pescados comercializados como linguado O peixe conhecido como “linguado” compreende espécies da ordem Pleuronectiformes, na qual se encontra a família Paralichthyidae, que contém 14 gêneros e cerca de 111 espécies (Nelson, 2016), a maioria marinha. Apresentam ampla distribuição em todos os oceanos, sendo sete gê neros com 18 espécies conhecidas no Brasil, das quais 17 ocorrem na costa do sudeste (Mendonç a & Araújo, 2002). Legalmente no Brasil, somente espécies do gênero Syacium (“linguado de areia”) e Paralichthys (“linguado”, “linguado preto”) podem ser comercializadas com o rotulo de linguado (MAPA, 2015) (Figura 3). Por ser um peixe de alto interesse popular e valor comercial, o linguado é alvo constante de substituições tanto no nível nacional como mundial (Bénard-Capelle et al., 2015; Naaum & Hanner, 2015; Kappel & Schrö der, 2016) (Figura 4). Segundo o MAPA, espécies de menor valor comercial, conhecidas como alabote dente curvo (Atheresthes stomias), panga (Pangasionodon hypophthalmus) e solha (Pleuronectes platessa) são frequentemente rotulados e comercializados como linguado no Brasil, o que constitui prática ilegal (MAPA, 2015) (Figura 5). Estas mesmas espécies foram documentadas em casos de fraude de linguado no Canadá, Alemanha, Espanha e Portugal, encontrando taxas de substituição entre 20 e 50% (Carvalho et al., 2015; Kappel & Schrö der, 2016; Naaum & Hanner, 2015; Pardo et al., 2018).

21 Ordem Pleuronectiformes

Família Paralicthyidae

Syacium Paralichthys

Figura 3: Espécies que podem ser legalmente comercializadas como linguado no Brasil. Fonte: MAPA, Instrução normativa número 29, 2015.

Figura 4: Produtividade e preço de linguado desde 1997 até 2017. Como um pescado de crescente interesse e valor de mercado, sua produtividade busca alcançar números proporcionais a alta procura comercial. Figura autoral, fonte dos dados: Fishstat, FAO, 2017.

22 Linguados foram substituídos por:

Alabote Dente Curvo Pescada Amarela Panga Corvina Merluza

30 % 10 % 20 % 30 % 10 %

Figura 5: Espécies descritas na literatura sendo substituídas por linguado no mercado brasileiro, bem como sua representatividade no número total de amostras substituídas. Figura autoral, fonte dos dados: Carvalho et al., 2015 e 2017 e Staffen et al., 2017. A organização não governamental OCEANA (https://oceana.org) realiza levantamentos anuais sobre o estado das substituições de pescado em todo o mundo, sendo no último ano os Estados Unidos o alvo da verificação. Dentre mais de 400 amostras de pescados analisadas, 21% foram consideradas substituições no território americano, com destaque para os linguados com a taxa de 22%, uma das maiores entre os grupos analisados (Warner et al., 2019) . Em 2012, o Brasil iniciou a importação, de um pescado chinês (o Alabote dente curvo: Atheresthes stomias) pertencente à mesma ordem dos linguados comercializados no país (Pleuronectiformes), porém com uma qualidade de sabor e nutritiva considerada inferior (MAPA, 2012). Sua livre comercialização com o rótulo de linguado no Brasil só teve considerável queda em 2015, quando através da IN 29 foi determinado que sua rotulagem correta seria “Alabote dente curvo” (Atheresthes stomias), ainda que em muitos casos continue sendo ilegalmente comercializado como linguado (Barbosa, 2015). Um dos peixes mais importados pelo Brasil, o Pangasianodon hypophthalmus (Panga), também é amplamente documentado em substituições de linguado no Brasil e em países como Espanha e México (Sarmiento-Camacho, 2018; Pardo et al., 2018). Em um trabalho de análise de pescados em cantinas europeias, cerca de 30% das amostras de linguado foram substituídas por Pangasianodon hypophthalmus (Panga), e outras espécies como Limanda aspera e Merluccius hubbsi (merluza) (Pardo et al., 2018). No Brasil, o panga também

23 é comercializado com o rótulo de dourado, pescada-amarela, tilápia e bagres amazônicos (MAPA, 2016) demostrando sua ampla utilização como substituto. Desde o ano de 2016, ocorre no Brasil a campanha intitulada “Operaç aõ Semana Santa”, onde auditores fiscais do MAPA coletam amostras de peixes nacionais e importados no Rio de Janeiro e em dezesseis estados brasileiros. Este programa de fiscalização nacional que ocorre uma vez ao ano tem como objetivo detectar e coibir erros de rotulagem pesqueira. Os resultados de 2020 demostraram que 11% dos peixes analisados pelos auditores eram fraudados, com substitutos como Panga e polaca do Alasca sendo rotulados como bacalhau e linguado. Segundo o MAPA, essa taxa é um forte indicativo de sucesso das fiscalizações, uma vez que em 2018 o índice de substituição foi de 21,4% (MAPA, 2019). I.V Identificação como ferramenta autenticadora de pescados Todos esses dados e levantamentos de taxas de substituição são realizados com base na identificação dos pescados, para comparação com o que consta no rótulo. A forma mais tradicional de identificação pesqueira se dá pela morfologia, onde características morfológicas externas ou internas são utilizadas como parâmetro de classificação e consequente obtenção de identidade. O linguado, como todo o pescado, possui caracteres morfológicos diagnósticos que o diferencia em relação aos demais pescados. O formato corporal é alongado antero-posteriormente e achatado dorso- ventralmente. As nadadeiras dorsal e caudal contíguas, possuem origem logo à frente do olho superior. Sua pele na face dorsal tem coloração variada entre castanho e marrom, podendo possuir regiões circulares mais escuras denominadas ocelos, já a face ventral não possui pigmentação, é esbranquiçada. A característica mais marcante do grupo é a migração occipital que ocasiona uma mudança morfológica onde ambos os olhos do animal se localizam de um dos lados do corpo (Figueiredo & Menezes, 2000; MAPA, 2016). Além disso, outros caracteres morfológicos, como número e formato de rastros branquiais, raios da nadadeira peitoral e tipo de escamas nas faces dorsal e ventral também auxiliam sua caracterização no nível de espécie (Figueiredo & Menezes, 2000) Como toda a metodologia, a identificação morfológica tem suas limitações, uma vez que todas essas características juntas possibilitam a identificação apenas de linguados inteiros, e em condições ideais, sem nenhum tipo de fragmentação ou desgaste. Além de também ser dependente de um taxonomista experiente no grupo pesqueiro específico, para uma identificação acurada e confiável. Em produtos processados para a comercialização, na maior parte das vezes tais caracteres são completamente eliminados, impossibilitando a identificação com base em morfologia (Figura 6). Até mesmo processamentos primários como a conhecida “limpeza” do pescado, filetagem ou postagem, já dificultariam o processo de identificação. Essa situação se agrava ao consideramos processos ainda mais modificadores como cozimento, fragmentação em porções e mistura em outros alimentos (Do et

24 al., 2019). Tendo em vista tal limitação, a identificação molecular vem se tornando uma alternativa viável e eficiente no processo de verificação da autenticidade de pescados, mesmo nos mais altos níveis de processamento (Anjali et al., 2019; Delpiani et al., 2020; Horreo et al., 2019; Pappalardo et al., 2018; Shehata et al., 2019, ; Sivaraman et al., 2018; ; Warner et al., 2019).

Pré-processamento Pós-processamento

Bacalhau do Atlântico Peixe Prego (Gadus morhua) (Lepidocybium flavobrunneum)

Garoupa Perca do nilo (Epinephelus spp.) (Lates niloticus)

Peixe espada Tubarão Mako (Trichiurus lepturus) ( Isurus oxyrinchus)

Linguado Panga (Paralichthys orbignianus) (Pangasianodon hypophthalmus)

Figura 6: Pescados inteiros na fase de pré-processamento e seus respectivos produtos após nível médio de processamento. Na esquerda temos os pescados inteiros em duas colunas onde vemos as espécies substituídas (esquerda) e substitutas (direita) e seus respectivos filés no lado direito (pós processamento). Tal correlação é feita para evidenciar a perda de caracteres morfológicos após o processamento, que muitas vezes impossibilita a identificação morfológica, e a consequente diferenciação entre um pescado autêntico de um substituto. Figura autoral adaptada de Stiles et al, 2011. Diversos protocolos foram descritos para a identificação molecular de peixes e seus produtos. Técnicas baseadas em sequências de DNA são especialmente indicadas nesses casos (por conta da maior estabilidade dessa molécula, que é menos danificada durante o processamento do pescado, além de possuir um alto nível de sensibilidade) se comparado com técnicas baseadas na análise de proteínas

25 e lipídios, usadas em alguns outros tipos de identificações moleculares (Mandal & Kumar, 2016; Sentandreu & Sentandreu, 2014; Kyrova et al., 2017). Dentre as metodologias baseadas em DNA, se destacam o sequenciamento (Fernandes et al., 2017; Carvalho et al., 2015; von der Heyden et al., 2010), a PCR multiplex (Ali et al., 2013; Catanese et al., 2010), e a o polimorfismo de comprimento de fragmento (PCR-RFLP)(Kyrova et al., 2017; Anjali et al., 2019; Pappalardo et al., 2018; Sivaraman et al., 2018) (Figura 7). Na tentativa de obter maior confiabilidade nos dados e ao mesmo tempo poder compara-los quanto a eficiência e confiabilidade, alguns autores combinam diversas metodologias nas análises das mesmas amostras (Kyrova et al., 2017). Na identificação de linguados na Espanha e Itália, ambas as técnicas de sequenciamento e PCR-RFLP, foram utilizadas, recuperando resultados de maneira congruente, comprovando a acurácia de ambos (Sotelo et al., 2001; Pappalardo et al., 2018).

o x

Figura 7: Metodologias baseadas em DNA, nesse caso mitocondrial, mais utilizadas em Identificação Molecular pesqueira. Sequenciamento de DNA e técnicas baseadas em PCR (PCR-RFLP e PCR Multiplex). Fonte: Autoral e site Mitofish . O sequenciamento de DNA é a técnica de identificação molecular mais utilizada atualmente, e muitas vezes considerada a mais acurada e, portanto, com um maior nível de confiabilidade que as ferramentas moleculares poderiam oferecer (Christiansen et al., 2018; Crego-Prieto et al., 2012; Delpiani et al., 2020; Do et al., 2019; Shehata et al., 2019). Dentre os genes utilizados os mitocondriais se destacam na identificação de pescados processados por possuírem cópias múltiplas, conservando uma maior quantidade de DNA mesmo após alta degradação (Do et al., 2019). Procurando um equilíbrio entre regiões conservadas para incluir toda a variedade de peixes, e a variabilidade para

26 diferencia-los do restante da diversidade, os genes Citocromo b (Cytb), Citocromo Oxidase I (COI), 12S rRNA e a região Dloop são descritos como as melhores opções descritas na literatura (Farias et al., 2001; Herbert et al., 2004; Griffiths et al., 2014; Ward et al., 2009). No entanto, por conta de seus extensos bancos de sequências acumulados na última década, somente os genes Cytb e COI são atualmente os mais utilizados na aplicação forense (Ward et al., 2009; Do et al., 2019 Shehata et al., 2019; Kappel & Schroder, 2016; Giusti et al., 2019). Tais genes são utilizados não só em uma ampla variedade de pescados mas também nas mais diversas regiões do mundo (Shehata et al., 2019; Delpiani et al., 2020; Do et al., 2019; Giusti et al., 2019; Pardo et al., 2015; Sarmiento-Camacho, 2018; Cawthorn et al., 2012; Pardo et al., 2018; Xiong et al., 2018; Pappalardo et al., 2018). Os métodos baseados em PCR são comparativamente menos utilizados em identificações pesqueiras, porém quando se trata de custos, aplicabilidade e velocidade ficam em destaque quando comparados ao sequenciamento (Sivaraman et al., 2018). A PCR Multiplex se baseia na amplificação de fragmentos de diferentes tamanhos, produzindo amplicons diagnósticos através de primers específicos que só amplificam seu respectivo grupo de interesse (Ali et al., 2013). A PCR RFLP por sua vez tem como princípio a fragmentação de um amplicon inicial em regiões específicas, distintas em cada grupo de interesse, que gera diversas combinações diagnósticas de fragmentos de diferentes tamanhos. Com ensaios específicos para cada grupo pesqueiro, tais metodologias possibilitam identificações rápidas, acuradas e de baixo custo (Ferrito et al., 2016). Na literatura já existem registros de seu desenvolvimento para grupos de espécies de bonito (Catanese et al., 2010); perca do Nilo (Asensio, 2008), garoupa (Anjali et al., 2019), atuns (Xu et al., 2015), meros (Sivaraman et al., 2018), linguados (Pappalardo et al., 2018) e tubarões (Shivji et al., 2012). Com relação ao grupo de garoupas por exemplo existem tanto ensaios RFLP quanto multiplex (Asensio et al., 2008; Torres et al.,2013; Anjali et al., 2019). A PCR multiplex, utilizou dois pares de primers para a identificação de 12 espécies, já o ensaio mais recente de RFLP utiliza duas enzimas de restrição para diferenciar seis espécies diferentes de garoupas (Asensio et al., 2008; Anjali et al., 2019). Nas espécies de linguado, entretanto, observaram-se até agora somente ensaios de PCR-RFLP. Inicialmente, em 2000 um ensaio com 3 enzimas foi capaz de identificar 3 grupos de linguados a nível de família (Sotelo et al., 2001), em 2008 3 diferentes enzimas possibilitaram então a diferenciação de três espécies (Céspedes et al., 2008) e por fim, dez anos mais tarde, quatro enzimas foram utilizadas para identificar sete espécies (Pappalardo et al., 2018) (Tabela 1).

Tabela 1: Metodologias baseadas em PCR na identificação de alguns grupos de pescado.

Referências bibliográficas : [1] Catanese et al., 2010; [2] Asensio et al., 2008; [3] Torres et al., 2013; [4] Anjali et al., 2019; [5] Pardo et al., 2004; [6] Xu et al., 2015; [7] Sivaraman et al., 2018; [8] Sotelo et al., 2001; [9] Céspedes et al., 2008; [10] Pappalardo et al., 2018; [11] Ferrito et al., 2019; [12] Hisieh et al., 2004; [13] Lin & Hwang, 2008. Tento em vista todo o panorama de altas taxas de substituições, com foco nos pescados comercializados como linguado, políticas públicas que visam sua detecção e coibição podem ser auxiliadas por diversas ferramentas moleculares. Nesse contexto, informações como quais espécies são utilizadas, em qual local da cadeia de produção são prevalentes as substituições e flutuações nas taxas de ocorrência em relação a leis de rotulagem, são de fundamental importância para a funcionalidade de medidas inibitórias. Em outras palavras, levantamentos de todos os dados que permeiam os casos se substituições são primordiais na promoção de uma mudança real de panorama. Porém, conhecer o universo das substituições é apenas o primeiro passo em direção a sua erradicação, sendo necessário o desenvolvimento de ferramentas moleculares de identificação rápidas, eficientes e de baixo custo que permitam fiscalizações em larga escala.

I.VI Visão geral dos Capítulos seguintes Nesta dissertação, serão apresentados dois capítulos em formato de artigos científicos, ambos em preparação para submissão na revista científica Food Control. O primeiro capítulo consiste na identificação dos pescados comercializados como “linguado” na Cidade do Rio de janeiro, sua prevalência ao longo da cadeia de comercialização e em relação a medidas legais de rotulagem. Além disso, o trabalho discute os fatores que possam estar inferindo na dinâmica das substituições, como flutuações no escopo de espécies utilizadas tanto em relação ao tempo, quanto ao local de origem, bem como a influência do preço na probabilidade de substituição. Para a amostragem, foram coletadas 248 amostras em todo a cidade, buscando a maior cobertura possível (Figura 8). Tais amostras foram coletadas de 2011 á 2019 (Tabela 2) por diversos membros do laboratório de Biodiversidade Molecular e colaboradores de outros laboratórios e de fora do meio acadêmico, sempre sobre orientações específicas visando impedir contaminações.

28 Peixaria Supermercado Feira Restaurante

Legenda Taquara Méier Praça da Bandeira Flamengo Barra da Tijuca Cachambi Estácio Botafogo Campo Grande Cascadura Engenho Novo Rio Comprido Copacabana Paciência Madureira Jacaré Rocha Ipanema Cidade de Deus Rocha Miranda Manguinho Catumbi Humaitá Anil Irajá Benfica Santa Teresa Jardim Botânico Jacarepaguá Vicente de Carvalho Grajaú Centro Leblon Legenda Freguesia Vila da Penha Vila Isabel Cidade Nova Lagoa Taquara Méier Praça da Bandeira Flamengo Gardênia Azul Olaria Maracanã Lapa Ilha do Governador Barra da Tijuca Cachambi Estácio Botafogo Praça Seca Bonsucesso Tijuca Gávea Campo Grande Cascadura Engenho Novo Rio Comprido Copacabana Curicica Del Castilho São Cristóvão Glória Paciência Madureira Jacaré Rocha Ipanema Cidade de Deus Rocha Miranda Manguinho Catumbi Humaitá Anil Irajá Benfica Santa Teresa Jardim Botânico Jacarepaguá Vicente de Carvalho Grajaú Centro Leblon Freguesia Vila da Penha Vila Isabel Cidade Nova Lagoa Gardênia Azul Olaria Maracanã Lapa Ilha do Governador Praça Seca Bonsucesso Tijuca Gávea Curicica Del Castilho São Cristóvão Glória

Figura 8: Mapa de distribuição das amostras de linguado coletadas na cidade do Rio de Janeiro. Somente os bairros coloridos foram amostrados, cobrindo 31% da totalidade da região metropolitana carioca entre 2011 e 2019.

29 Ano de coleta Total de Amostras Coletores

2011 9 Não identificado 2012 15 Procon; Biólogos LBDM e colaborações acadêmicas Dahuachem international economic and trada corp. [sic]; Costa Sul 2013 35 Pescados; Frescatto; Biólogo LBDM 2014 1 Biólogos LBDM 2015 5 Não identificado 2017 16 Biólogos LBDM; colaborações acadêmicas e não acadêmicas 2018 72 Biólogos LBDM; colaborações acadêmicas e não acadêmicas 2019 106 Biólogos LBDM; colaborações acadêmicas e não acadêmicas

Tabela 2: Correlação do total de amostras coletadas com suas respectivas datas e coletores.

Utilizamos dois genes mitocondriais para as identificações: Citocromo b (Cytb) e citocromo Oxidase subunidade I (COI). As identidades de cada amostra foram obtidas através de busca nos Bancos de sequências NCBI e RENIMP, para que pudessem ser comparadas à identidade final obtida em reconstrução filogenética. Esperam-se encontrar incongruências entre as identidades por BLAST e reconstrução como consequência da não acurácia do banco de dados, logo, a construção da árvore se mostraria essencial, uma vez que não exclui os dados obtidos em BLAST apenas acrescentando novas relações a serem consideradas. Uma vez obtidas as identidades, espera-se que a taxa de fraude se mantenha em torno de 30%, a média nacional de pescados em geral (Staffen et al., 2017; Carvalho et al., 2015; Carvalho et al., 2017). Por apresentar um maior nível de processamento e consequente facilidade de mascarar as substituições, espera-se que os restaurantes sejem os locais mais passíveis de ocorrência de substituições. Baseado em um estudo de regulamentação de rotulagens espanhol, a taxa de fraude após a aplicação de uma medida inibitória deveria ser inferior a quaisquer outras que houvesse no período anterior. Portanto, após a IN 29, haveria um declínio nas taxas de substituições como um reflexo do esforço público em fiscalizações fazendo cumprir o que a legislação propõe. Outras questões como a biodiversidade taxonômica de espécies utilizadas como substitutas, seus percentuais de utilização e a relação com o preço também são abordadas. Entretanto, sem um padrão prévio acurado de comparação nacional, as perspectivas esperadas se tornam inviáveis, e nesse contexto o presente trabalho se mostra inovador. No segundo capítulo, com o levantamento geral de substituições e os grupos alvo em possíveis fiscalizações públicas, foi possível o desenvolvimento de ensaios rápidos e de baixo custo baseados em PCR (PCR-RFLP e PCR Multiplex). O capítulo descreve os aperfeiçoamentos e validações realizadas até o momento, entretanto até a fase de publicação mais testes deverão ser efetuados para que as técnicas sejam consideradas acuradas. Uma vez desenvolvidos, aperfeiçoados e validados tais

30 testes auxiliarão no processo de autenticação em larga escala, por órgãos públicos e privados que busquem uma alternativa ao já existente método de identificação que chega a custar quatro vezes mais que as baseadas em PCR. Porém, além de disponibiliza-las foi proposta uma comparação entre as metodologias desenvolvidas (PCR-RFLP e Multiplex) e aquela pré-estabelecida e reconhecida (Sequenciamento). Com tal correlação quanto a custo e eficiência, será possível inferir com maior grau de confiança, que as técnicas baseadas em PCR poderiam ser utilizadas em práticas forenses de autenticação de pescado, onde um alto gral de confiabilidade e custo-benefício são necessários.

31 II. From fish-markets to restaurants: substitution prevalence along the flatfish commercialization chain in Brazil

Souza, D.F.S., Weidy, R. F., Henning, F., Solé-Cava, A.M.

Abstract Over the last few years, molecular species identification has unveiled high levels of seafood mislabelling, which has generated public concern. The success of regulatory efforts depends on the accurate estimation of species substitution across multiple points in the supply chain. Flounder is among the most popular and highly valued seafood products marketed in Brazil. However, in large consumer markets such as Rio de Janeiro substitution rates are poorly known. In this study, we used mitochondrial sequencing to estimate the prevalence of mislabelling in the Brazilian flounder trade. Nearly 50% (128/260) of fish samples analysed were mislabelled and varied across the commercialisation chain. The prevalence of mislabelling was high in street markets (61%) and restaurants (82%), when compared to fishmongers (38%) and supermarkets (22%). The most common species used as substitute for flounders were Pangasianodon hypophthalmus (75%) and Xystreurys rasile (17%). The rate of mislabelling increased from 26% to 60% after labelling regulations introduced in 2015 restricted the number of species that were allowed to be sold as flounder. Substitute species products sold as flounders were usually lower-priced indicating an economic motivation for mislabelling. Our findings reinforce the need for updated and consistent labelling regulations and more stringent control of flounder sales in street markets and restaurants. Keywords: Flounder, Mislabelling, Seafood Fraud, DNA barcoding, Seafood traceability

1. Introduction Seafood has played a prominent role in human diet, particularly in the last decades, exceeding the consumption of all terrestrial animal foods combined, with world per capita fish consumption estimates rising above 20.5 kg a year in 2018 (FAO, 2020). Seafood products are commercialised in several forms and the complexity of their supply chain make their trade especially vulnerable to mislabelling (Kroetz et al., 2020). Several factors contribute to the prevalence of mislabelling, including deliberate fraud (Fraser et al., 2018) and non-intentional substitution, which may result from misidentification morphologically similar species or ambiguous common names in labelling legislation (Crego-Prieto et al., 2012; Muñoz-Colmenero et al., 2015). Regardless of the motivations, mislabelling is detrimental not only economically (i.e., leads to product devaluation and the decrease in fish stocks), but also to the health of consumers due to the possible presence of allergenic or contaminant agents in substitute replacement species (Kulawik et al., 2016). Additionally, mislabelling

32 can mask the illegal trade of endangered species and hamper stock management of overexploited fish species (Donlan and Luque, 2019; Kroetz et al., 2020). Official lists correlating common and scientific names of fisheries species and guidelines for the inspection of seafood products are maintained by different regulatory bodies and differ across geopolitical regions. For instance, the European Union Parliament has determined that labels should contain the scientific name of the species, its geographic origin, and production method (Carvalho et al., 2011; Kroetz et al., 2020). In the United States, the Food and Drug Administration (FDA) publishes an online regulatory fish encyclopaedia that lists the acceptable market names for each seafood species together with photographs of whole fish and their marketed product forms such as fillets (Yancy et al., 2008; FDA, 2018). Similarly, normative instruction number 29 (IN 29) determines which common names can be used for the 454 main commercial fishes sold in Brazil (MAPA, 2015). Under IN 29, the only species of fish that can be sold as flounder or sole (“linguado” in Portuguese) are those belonging to the genera Syacium and Paralichthys (family Paralichthyidae, order Pleuronectiformes). However, species of lower commercial value such as the basa/panga (Pangasianodon hypophthalmus) have been illegally used as substitutes for flounders in Brazil (Carvalho et al., 2017; Staffen et al., 2017). Other pleuronectiform fish like the arrow-tooth flounder (Atheresthes stomias), plaice (Pleuronectes platessa), and Pacific halibut (Hippoglossus stenolepis) are commercialised as flounder in some parts of the world but labelling them as flounder in Brazil is considered fraud. These same species have been used to replace flounder in Canada, Germany, Spain, and Portugal (Kappel and Schröder, 2016; Naaum and Hanner, 2016; Pardo et al., 2018). The incidence of mislabelling can vary along the seafood supply chain, making regulation logistically complex and vulnerable to fraud (Crego-Prieto et al., 2012). Studies comparing substitution rates among different sectors are still rare, but most indicate that the mislabelling rate increases along the supply chain (Kappel and Schröder, 2016; Pardo et al., 2018; Shehata et al., 2019). For example, a study in Canada found mislabelling rates of 17.6%, 27.3%, and 38.1% in importers, registered processers, and final retailers, respectively (Shehata et al., 2019). In order to control seafood mislabelling, substitution must be adequately detected and estimated. Morphological identification is the most traditional and simple method of determining the species of origin in fisheries products, but it is usually unsuitable after undergoing filleting, canning, and other processing procedures (Catanese et al., 2010). Molecular approaches circumvent those limitations, enabling identification even for high levels of processing (Christiansen et al., 2018; De Brito et al., 2015). The most commonly used genetic markers are mitochondrial sequences from the cytochrome b (Cytb) and cytochrome oxidase subunit I (COI) genes. Their use in fish species identification is widespread and well-established (Delpiani et al., 2020; Pappalardo et al., 2015; Pardo et al., 2018; Shehata et al., 2019).

33 Despite the increasing application of molecular techniques in recent years, finfish mislabelling reports in Brazil have been largely limited to a few groups such as elasmobranchs and sciaenids (Barbosa et al., 2020; Bunholi et al., 2018), while many other important groups are still poorly characterized. Mislabelling in Brazilian flounders has only been investigated in two studies with markedly different estimates (13% vs. 75%) owing to limited samples sizes (n = 4 and 23, respectively) (Carvalho et al., 2017; Staffen et al., 2017). Here, we use mitochondrial sequencing data from a large sample to estimate the prevalence of substitution in seafood labelled as “flounder” at multiple points in the supply chain, from street markets to restaurants, in Rio de Janeiro. We also compared the prevalence of mislabelling in samples collected before and after the fish labelling regulations came into force in Brazil. Our findings reveal a high prevalence of substitution and a stark variation in mislabelling rates across the supply chain. 2. Material and methods 2.1 Sample collection and DNA extraction Fish samples (n=260) were collected from street markets, fishmongers, supermarkets, and restaurants in Rio de Janeiro, Brazil between 2012 (pre-IN29 regulation, n=77) and 2020 (post-IN29 regulation, n=183) (Appendix A, Tables A1 and A2, Supplementary material). Tissues were kept in 96% ethanol and stored at −20 °C. DNA was purified from 20‒40 mg of tissue using a saline extraction protocol (Miller et al., 1988) and assessed using 1% agarose gel electrophoresis in 0.089 M Tris, 0.089 M Borate, 0.002 M EDTA buffer, pH 8.0. 2.2 Polymerase chain reaction (PCR) and sequencing Each PCR reaction consisted of 5‒10 ng of sample DNA, 2 µl of 5 X FIREPol® Master mix, 2.5 mM MgCl2 (Solis BioDyne, Tartu, Estonia), 0.25 µM of each primer, 200 µM dNTPs, 0.5 mg BSA, and nuclease-free water for a final volume of 10 µl. The primer pair L14735 (F) and H15149AD (R) (Sotelo et al., 2001) was used for Cytb amplifications, whereas primers FishF2_t1-F forward (F) and FishR2_t1 reverse (R) (Ivanova et al., 2007) were used for amplifying COI. The few samples that were ambiguously identified by COI and Cytb were additionally analysed using the ribosomal RNA 16S locus (16S rRNA) using the 16Sall_F (3’ ACCAAAAACAYCGCC 5’) and 16Sall_R (3’ TGTCCTGATCCAACATCG 5’) primers. PCR was performed with an initial denaturing step of 4 min at 94 °C, followed by 35 cycles at 93 °C for 30 s, 50 °C for 40 s, and 72 °C for 1 min and a final extension step of 7 min at 72 °C. PCR products were inspected using 2% agarose gel electrophoresis and purified enzymatically by incubating 5 µl of PCR product for 15 min at 37 °C in 6 µl of an aqueous solution containing 0.08 units of alkaline phosphatase (FastAP, Fermentas, Waltham, MA, USA) and 0.83 units of exonuclease I (Fermentas). Sequencing was performed using BigDye Terminator v3.1

34 Ready Mix kit (Applied Biosystems, Foster City, CA, USA) on a 3500 Genetic Analyzer (Applied Biosystems). 2.3 Sequence analysis and molecular identification Forward and reverse DNA sequences were assembled using Geneious Prime software version 2019.1.2 (Biomatters Ltd., Auckland, New Zealand). The sequences were used for species identification using two different approaches: similarity searches and phylogenetic analyses. In the similarity-based approach, a threshold of 98% similarity was used for species identification. Custom local BLASTn searches were conducted against a database containing all fish COI and Cytb sequences available at NCBI supplemented by an in-house sequence database. Phylogenetic identification was performed using an alignment approach including the sample sequences, representatives of possible species according to BLAST search, and the outgroup Scleropages formosus. Sequences were aligned using Clustal Omega (Sievers and Higgins, 2018) and manually curated using Geneious prime software version 2019.1.2. (Biomatters Ltd.). Phylogenetic reconstruction was performed using maximum likelihood as implemented in the IQ-Tree package (Minh et al., 2020) with the Kimura two-parameter (K2P) substitution model (Kimura, 1980) defined a priori as the most used and well-established model for forensic analysis of seafood products (Delpiani et al., 2020; Christiansen et al., 2018). 2.4 Mislabelling statistics To test and quantify possible financial implications of mislabelling cases, the normalized Δmislabel measure (NΔmislabel) was estimated for fish samples where individual price was recorded (n=97). The NΔmislabel was calculated using the equation (P label-P substitute)/(P label) (Donlan and Luque, 2019), where Plabel is the price of the putative fish and Psubstitute is the average price of the actual fish species identified genetically. Because the distributions of Plabel and Psubstitute were not homoscedastic, their means were compared using an unequal variance paired Student’s t test. The differences in mislabelling rates before and after implementation of labelling regulation IN29 and between supply chain stages were tested using the chi-square (Χ²) test. 3. Results and discussion 3.1 Species identification In total, 260 fish samples were analysed, all of which were successfully sequenced for at least one gene while 166 samples were sequenced for both genes, resulting in 189 COI and 237 Cytb sequences. Aligned sequences were 553 bp- and 335 bp-long for COI and Cytb, respectively (Fig. 1). Most sequences (93%) were at least 98% (2% cut-off threshold) similar to reference sequences in BLAST searches (NCBI+FishBol+ in-house sequence database). In 18 cases, however, the similarities did not meet that threshold (similarities as low as 86%), indicating that the species of origin was likely

35 missing from the sequence database. In contrast, phylogenetic analyses unambiguously identified all sequenced samples (Fig. 1). Six percent (n = 14) of all samples were ambiguously identified by Cytb and COI sequencing so that a third gene (16S) was sequenced to produce a final accurate identity (Appendix A, Table A2). In total, 15 species were found being sold as flounder: nine pleuronectiform and six non-pleuronectiform species (Fig. 4 and Appendix A, Tables A1 and A2).

36 Figure 1. Maximum-likelihood trees for market samples of flounder collected in this study and reference sequences from GenBank and in-house sequence database based on sequence alignments of COI and Cytb genes. (A) Maximum-likelihood tree based on a 335-bp alignment of the Cytb gene with 237 Cytb sequences from market samples of flounder and 14 sequences from reference samples. (B) Maximum-likelihood tree based on a 553-bp alignment of the COI gene with 189 COI sequences from market samples of flounder and 22 sequences from reference samples. Market samples were grouped by species to produce legible trees with the number of samples in each group shown in brackets. The identity of samples in each group is listed in Appendix B, Tables B1 and B2 in the Supplementary material. Bootstrap support values retrieved from 1,000 replicates and values < 98% are indicated at the nodes. The outgroup was Scleropages formosus (EU594545 for Cytb and JF946625 for COI). 3.2 Incidence of mislabelling Roughly half of all flounder samples (128 of 260, 49.2%) were mislabelled. Previous international seafood mislabelling studies reported similar (Willette et al., 2017) and contrasting (Christiansen et al., 2018; Delpiani et al., 2020) mislabelling rates depending on country and species analysed. Mislabelling is less common in Europe (22%), some regions of Oceania (15%), and South Africa (20%). In contrast, North and South America exhibit high mislabelling incidence, especially Brazil, where substitution rates can be as high as 46% for finfish products such as cod, croaker, tuna, and salmon (Appendix C, Table C1 in Supplementary material). The 49% mislabelling prevalence observed here is substantially higher than the reported average global seafood mislabelling rate of 27%, especially when compared to the global mislabelling rate of 18% reported for flounders (Figure 2 and Appendix C, Table C1 — Supplementary material). Similarly, high rates for flounders were also found in Spain and Malaysia, but the small sample sizes of those studies make them difficult to compare with ours (Appendix C, Table C1 — Supplementary material).

Figure 2. World qualitative flatfishes mislabelling scenario. Substitute species proportion on all flounder mislabelling cases reported in literature, with each bar representing the label descriptions and a single one characterizing the present study (for more details see Appendix C, Table C2 in Supplementary material). The striped catfish (Pangasianodon hypophthalmus), also known as panga or Asian catfish, accounted for over 75% of mislabelling cases (Fig. 2). The striped catfish is, indeed, one of the most common substitutes for more desirable, higher-priced seafood products worldwide (Calosso et al., 2020; Luque and Donlan, 2019; Minoudi et al., 2020), probably because of its low price and wide availability (Calegari et al., 2019). In fact, panga is the main substitute species among flatfishes, representing 14% of all cases worldwide (Fig. 2). Substitution of panga for valuable flatfish species

38 causes not only economic losses but may also lead to consumer health problems because of contamination by heavy metals and antibiotics (Luque and Donlan, 2019; Kulawik et al., 2016). The flatfish Xystreurys rasile (South American flounder) was the second most common fish used as a flounder substitute (17%). This is likely to represent a case of inadvertent mislabelling, since Xystreurys species are morphologically similar to the fish that are legally allowed to be labelled as Brazilian flounders. In fact, there is no report of fish in the genus Xystreurys being used as a flounder substitute, simply because the fish are labelled and sold as “fantail flounder” in countries where they are commercialised (Astarloa, 2002; Díaz de Astarloa and Fabré, 2001). Clearly, there is a need to include this genus in the “flatfish” label in future revisions of the Brazilian label legislation. The exclusion of Xystreurys and other Paralichthyidae species from the official list of acceptable market names is biologically unwarranted and creates confusion and overestimation of mislabelling cases. This is the first report of blackfin goosefish (Lophius gastrophysus), the unicorn leatherjacket filefish (Aluterus monocercos), and the Nile tilapia (Oreochromis niloticus) being sold as flounder substitutes, albeit at low frequencies. The use of blackfin goosefish as a substitute for flounder in Brazil may result from the recent export ban of this species to the European Union (EU) (Spautz, 2019). Other three substitutes recorded at low frequencies were the Argentine hake (Merluccius hubbsi), the Acoupa weakfish (Cynoscion acoupa), and the arrow-tooth flounder (Atheresthes stomias), all of which have been previously reported in flounder mislabelling cases in other countries (Pardo et al., 2018; Pardo and Jimenez, 2020; Staffen et al., 2017). The arrow-tooth flounder was widely traded in Brazil, where it was largely commercialised as flounder until 2015, but its use as a substitute has been drastically reduced since the introduction of the fish labelling legislation in late 2015 (Barbosa, 2016; Carvalho et al., 2015). 3.3 Mislabelling along the commercialisation chain Mislabelling was unevenly distributed along the supply chain and rates of mislabelling were higher in street markets and restaurants (Fig. 3). The complexity of seafood supply chains is often regarded as the main contributing factor to mislabelling, which appears to be cumulative throughout the supply chain (Crego-Prieto et al., 2012; Muñoz-Colmenero et al., 2017; Shehata et al., 2019). High mislabelling rates are often reported from restaurants, retailers, canteens, and sushi bars, which are the latest points of the supply chain where seafood products are more heavily processed (Christiansen et al., 2018; Helgoe et al., 2020; Kappel and Schröder, 2016; Shehata et al., 2019). The high substitution rate found in street markets in the current study would at first glance seem to be at odds with the assumed relationship between mislabelling and seafood processing level, since fish are usually sold in street markets at the lowest level of processing. However, unlike in European countries, for example, flounder is sold already filleted in the fish stalls of street markets in Brazil. That, combined with

39 insufficient on-site labelling inspection, explains the high mislabelling rates observed in street markets. A similar pattern is observed in Spain for the trade of tuna, megrim, and hake, which are sold in a more processed form (Cawthorn et al., 2015; Muñoz-Colmenero et al., 2016). Flounder substitutions varied across the supply chain not only in quantity but also in taxonomic diversity (Fig. 3). The highest number of substitute species was observed in restaurants, where six of the seven substitute species were detected (Fig. 3), likely reflecting fish species availability in the restaurant’s kitchen at the time of sale. Contrastingly, the low prevalence and species richness of substitute species found in supermarkets and fishmongers are probably due to more effective inspections at those stages in the supply chain.

40 A Total 50%

37% 9% 2% 0,25% 1% 0,25% 0,25% 50% 0,25%

B 2% 1% 1% 2% 4% 1% 1% 2% 2% 2% 2% 20% 24% 32%

72% 35%

78% 62%

39%

18%

Restaurant Fishmonger Street-market Supermarket 82% 38% 61% 22%

Pangasianodon hypophthalmus Atheresthes stomias Aluterus monocercos Lophius gastrophysus Merluccius hubbsi Xystreurys rasile Cynoscion acoupa Oreochromis niloticus Authentic Figure 3. Distribution of mislabelled flounder samples by pleuronectiform and non-pleuronectiform substitute species. Mislabelling prevalence and species proportions for (A) the entire supply chain and (B) each stage in the supply chain. Total mislabel ratios for both the entire supply chain and for each supply chain stage are shown alongside their respective labels (Total, Restaurant, Fishmonger, Street- market and Supermarket).

3.4 Effects of changes in labelling regulation Mislabelling rate doubled after the introduction of labelling regulation IN29 in late 2015 (Fig. 3; chi-square = 24.5; p < 7.4 × 10−7), which seems ironic considering it was intended to control

41 seafood fraud. However, this apparent contradiction is misleading and stems from the fact that before the IN29 regulation came into force any flatfish could be sold as flounder (Fig. 4). In fact, the only species analysed in this study that would have been considered mislabelled before the introduction of regulation IN29 in 2015 are those clearly identifiable as not being flatfish (e.g., panga or filefish). In contrast, a large proportion of samples (40%) collected before 2015 consisted of flatfish species (X. rasile, A. stomias, Limanda aspera, Lepidopsetta polyxystra, and Pleuronectes sp.) that would have been considered mislabelled based on the IN29 regulation introduced in that year (Fig. 4). The flatfish X. rasile is a clear example of a species that warrants inclusion in the fish labelling list to be marketed as flounder. The species is commonly found in the Brazilian coast, is not threatened, and by all means it is a flatfish. This single measure alone could reduce the mislabelling rate for flounder to roughly 47% (if considering samples collected after the introduction of IN29) or 40% (considering all samples) and would allow inspectors to concentrate on actual mislabelling cases.

42 Figure 4. Relationship between the incidence of mislabelling and labelling regulation. (A) Mislabelling incidence across the supply chain and before and after introduction of label regulation IN29. Number of cases is represented by the bar size. Total mislabel ratios for each category are shown as percentages next to their respective labels. (B) Substitute and accepted species before and after labelling regulation IN29. The positive effects of labelling regulation IN29 were clearly evident in supermarkets, where mislabelling rates decreased from 25% to 13% over five years, likely reflecting the more frequent and effective federal inspections at that stage of the supply chain. In Spain and Greece, it took approximately the same time for labelling regulation to produce a 10% decrease in substitution cases (Minoudi et al., 2020; Muñoz-Colmenero et al., 2015), in line with the overall seafood mislabelling rates in the EU, which declined from 23% to 7% between 2011 and 2015 (Warner et al., 2016). A surprising by-product of this investigation was the observation of a sharp (50%) decline in the numbers of Paralichthys patagonicus (Patagonian flounder) individuals sold in Brazil (Fig. 4B), likely resulting from overfishing and depletion of natural stocks, which has gone undetected because all Paralichthys species landed are treated as “linguado” (i.e., flounder), a general name that includes all flatfish species, for fishery statistics purposes. Moreover, the high prevalence of substitutes featuring on the market likely contributes to the overestimation of current stocks (Mariani et al., 2017), which makes it harder to identify depleting stocks directly affecting fisheries management as observed in the past for species like the red snapper (Lutjanus campechanus) and hake (Merluccius spp.) and leading to catastrophic consequences over time (Cawthorn et al., 2018; Garcia-Vazquez et al., 2012; Marko et al., 2004). According to a recent IUCN report, the current conservation status of P. patagonicus in Brazil, whose coastal waters host half of the global population of the species, is overexploitation (Riestra et al., 2020). 3.5 Price and flounder mislabelling Prices of substitute species were significantly lower than those of the species they were substituted for (the expected product, i.e., the species that appeared on the label) (N = 97; Student’s t = 10.79; p < 7.26× 10−20). This result indicates that flounder substitution was intentional and motivated by economic gain and, therefore, can be classified as seafood fraud. Normalized Δmislabel ratios indicate that consumer loss increases proportionally to processing level across the supply chain (street markets < fishmongers < restaurants, Appendix D, Table D1 in Supplementary material). In the very few mislabelling cases recorded in supermarkets, however, no significant difference was found between the average price of the species on the label (the expected product) and the actual species in the package, suggesting substitution was unintentional. The greatest economic losses (up to 80%) occurred when the lesser valued species P. hypophthalmus and C. acoupa were used as flounder

43 substitutes (Appendix D, Table D2 in Supplementary material). Sample prices are seldom reported in seafood substitution studies, hampering comparisons of mislabelling for profit (Luque and Donlan, 2019). For flatfishes, studies have mostly addressed the later stages of the supply chains. In European restaurants, for example, the mislabelled species sold as flounder fillets cost between 50% and 70% less than the prices charged on the menu (Deconinck et al., 2020; Kappel and Schröder, 2016). 4. Conclusions Our results show that roughly half of all fish sold as flounder in Rio de Janeiro are mislabelled, with over 75% of substitutions involving Pangasianodon hypophthalmus. Mislabelling was correlated directly with the level of processing and varied along the commercialization chain, reaching over 80% in restaurants. The relatively low rates observed in supermarkets are likely the result of federal inspections, which are more frequent and stringent than local inspections and have significantly improved compliance by large fish processing companies. There was an increase in the prevalence of substitution since 2015. However, much of it appears driven by the changes in labelling regulations, which inexplicably do not included X. rasile, a pleuronectiform, on the list of legal flounders, an oversight that is expect to be solved in updated versions of the list in the future. A positive correlation was found between price and mislabelling rate in the flounder trade, where consumers loss was directly related to processing level, with exception of supermarkets, where no correlation was found. The causes of mislabelling in the Brazilian flounder trade are complex and multifactorial but there is clearly the need for updating labelling regulations and improving inspections, particularly in street markets and restaurants.

CRediT author statement DSS: experimental design and work, data analyses, original draft preparation; WRC: experimental design and work, data analyses; FH: manuscript review and editing, data analyses and interpretation; AMSC: supervision, experimental design, data analyses, manuscript editing and review.

Acknowledgements We would like to thank Rafaela dos Santos Soares, Jessica Faria, Marcela Alvarenga Simões, Carine Belau, Gabriela Dias, Paulo Vianna, and Isabel Willmer for help during sampling and for providing comments that significantly improved the manuscript.

Funding

44 This work was supported by a National Council for Scientific and Technological Development (CNPq) productivity grant to AMSC and by Carlos Chagas Filho Foundation (FAPERJ) grants to AMSC (CNE and GARPA–RIO Programs) and FH (202.459/2017). DSS was funded by a graduate student fellowship from the Coordination for the Improvement of Higher Education Personnel (CAPES) through the post-graduate program in Biodiversity and Evolutionary Biology (PPGBBE) of the Federal University of Rio de Janeiro (UFRJ).

Supplementary Material Appendix A provides the collected samples list, of before (Table A1) and after (Table A2) the label regulation, and their correlation with collect date, type of product, supply chain category, collect location, the obtained identities by BLAST search and phylogenetic maximum likelihood trees and the categorization as mislabeled.

Appendix B. Souza et al. From fish-markets to restaurants: substitution prevalence along the flatfish commercialization chain in Brazil

Table B1. Groups of samples according to phylogenetic identification on Cytochrome Oxidase I Maximum likelihood tree reconstruction (COI)

Gene COI

Number of N=9 N=62 N=4 N=6 N=4 N=10 N=3 N=6 N=26 N=24 N=4 N=12 N=2 Samples Group Group15 Group10 Group 14 Group 1 Group 2 Group 9 Group 6 Group 13 Group 7 Group 8 Group 12 Group 4 Group 3

Species

Xystreurys

orbignianus patagonicus patagonicus

Paralichthys Paralichthys Paralichthys

Pleuronectes

Limanda aspera

hypophthalmus hypophthalmus

Pangasionodon Pangasionodon

quadrituberculatus

Atheresthes stomias

Paralichthys isoceles Paralichthys isoceles

Lophius gastrophysus

Lepidopsetta polyxystra

DA054 DA004 DA082 RF13C036 RF11C006 DA213 DA008 DA148 DA038 DA016 DA075 DA005 RF12A026

DA076 DA006 DA185 RF13C037 RF13B051 LING01 DA009 DA152 DA087 DA019 RF12A063 DA024 RF12A027

DA079 DA007 DA189 RF13C039 RF13B052 RF12A020 DA010 DA233 DA093 DA020 RF13A050 DA025

DA112 DA011 DA195 RF13C040 RF13B053 RF12A021 DA240 DA105 DA029 RF13B011 DA026

DA131 DA012 RF13C041 RF12A022 RF14A001 DA110 DA042 DA044

DA146 DA013 RF13C042 RF12A023 RF14A002 DA122 DA060 DA073

DA163 DA014 RF12A024 DA172 DA070 DA186

Samples by Group DA235 DA017 RF12A025 DA180 DA099 RF13A056

DA241 DA027 RF13C013 DA184 DA123 RF13A064

DA032 RF13C014 DA188 DA133 RF13B010

DA041 DA204 DA134 RF13B013

DA043 DA205 DA135 SOL12

45 DA048 DA218 DA137

DA050 DA222 DA169

DA052 DA224 DA178

DA053 RF12A049 DA187

DA056 RF13A048 DA191

DA058 RF13B014 DA192

DA061 RF13C006 DA198

DA064 RF13C007 DA200

DA067 RF13C008 RF12A050

DA080 RF13C009 RF12A064

DA081 RF13C010 RF13B027

DA084 RNP002 SOL01

DA085 LING02

DA089 LING03

DA090

DA094

DA100

DA108

DA109

DA111

DA139

DA140

DA144

DA154

DA155

DA157

DA158

DA168

DA173

DA182

DA196

DA197

DA202

DA206

DA211

DA216

DA226

DA229

DA232

DA242

RF11A05 9

46 RF11C00 4 RF11C00 5 RF13A06 2 RF13B00 6 RF13B00 7 RF13B00 8 RF13B00 9 SOL06

47 Table B2. Groups of samples according to phylogenetic identification on Cytochrome b Maximum likelihood tree reconstruction (Cytb)

Gene Cytb

Number os Samples N= 62 N=25 N=6 N=4 N=10 N=24 N=3 N=26 N=48 N=12 N=2

Group Group 10 Group 11 Group 1 Group 2 Gropu 9 Gropu 8 Group 6 Group 7 Group 5 Group 4 Group 3

Species

polyxystra

brasiliensis

orbignianus

Paralichthys Paralichthys Paralichthys

Pleuronectes patagonicus/ Lepidopsetta

hypophthalmus hypophthalmus

Pangasionodon Pangasionodon

Limanda aspera

Xystrery liolepis

quadrituberculatus

Atheresthes stomias

Paralichthys isoceles Paralichthys isoceles

DA004 DA023 RF13C037 RF11C006 DA213 DA016 DA008 DA038 DA001 DA005 RF12A026

DA006 DA063 RF13C039 RF13B051 LING01 DA019 DA009 DA087 DA002 DA024 RF12A027

DA007 DA072 RF13C040 RF13B052 RF12A020 DA020 DA010 DA093 DA003 DA025

DA011 DA083 RF13C041 RF13B053 RF12A021 DA029 DA105 DA018 DA026

DA012 DA088 RF13C042 RF12A022 DA042 DA110 DA021 DA044

DA013 DA102 RF12A023 DA060 DA122 DA022 DA073

DA014 DA107 RF12A024 DA070 DA172 DA036 DA186

DA017 DA132 RF12A025 DA099 DA180 DA045 RF13A056

DA027 DA141 RF13C013 DA123 DA184 DA051 RF13A064

DA032 DA150 RF13C014 DA133 DA188 DA055 RF13B010

DA041 DA151 DA134 DA204 DA059 RF13B013

DA043 DA159 DA135 DA205 DA062 SOL12

DA048 DA164 DA137 DA218 DA066

DA050 DA177 DA169 DA222 DA069

DA052 DA207 DA178 DA224 DA071

Group

DA053 DA236 DA187 LING02 DA074

DA056 RF11A006 DA191 LING03 DA078

Samples by DA058 RF11A055 DA192 RF12A049 DA086

DA061 RF11A056 DA198 RF13A048 DA097

DA064 RF11A057 DA200 RF13B014 DA098

DA067 RF11A058 RF12A050 RF13C006 DA129

DA080 RF11A060 RF12A064 RF13C007 DA130

DA081 RF12A004 RF13B027 RF13C008 DA143

DA084 RF13A002 SOL01 RF13C009 DA145

DA085 RF13A006 RF13C010 DA147

DA089 RNP002 DA149

DA090 DA156

DA094 DA175

DA100 DA179

DA108 DA181

DA109 DA183

DA111 DA190

48 DA139 DA193

DA140 DA208

DA144 DA215

DA154 DA217

DA155 DA219

DA157 DA220

DA158 DA221

DA168 DA223

DA173 DA225

DA182 DA227

DA196 DA228

DA197 LING04

DA202 RF12A005

DA206 RF12A006

DA211 RF12A034

DA216 RF14A004

DA226

DA229

DA232

DA242

RF11A059

RF11C004

RF11C005

RF13A062

RF13B006

RF13B007

RF13B008

RF13B009

SOL06

SOL11

49 Appendix C. Souza et al. From fish-markets to restaurants: substitution prevalence along the flatfish commercialization chain in Brazil Table C3. Mislabeling rate compilation per country, continent and general world. Flatfishes group presents an independent analysis, as the target group of the present study. Number of Mislabeling Analyzed Number of Geographic area Year frauds per Reference rate taxon samples region Different regions 43,0% Flatfishes 2008 30 13 Espiñera et al., 2008 on World Pappalardo et al., 2015; Acutis et 23,0% Italy Flatfishes 2014-2018 166 38 al., 2019; Nicolé et al., 2012; Pappalardo et al., 2018 47,0% Spain Flatfishes 2015-2016 68 31,96 Pardo & Jimenez, 2020 Rehbein et al., 2012; Kappel & 23,0% Germany Flatfishes 2009-2016 124 28,52 Scroder, 2016 28,3% Greece Flatfishes 2015-2018 46 13,018 Minoudi et al., 2020 Flounder and 24,4% USA 2018 90 21,96 Warner et al., 2019 Halibuts

24,4% Canada Flounders 2018 45 10,98 Hu et al., 2018 Staffen et al., 2017; Carvalho et al., 25,0% Brazilian Flounders 2017 27 6,75 2017 Flatfishes Brazil, present 50,0% Flounders 2012-2020 248 124 Souza et al., 2020 study 0,0% Russia Flounders 2015 8 0 Nedunoori et al., 2017

10,0% China Flounders 2016 10 1 But et al., 2019

40,0% Malaysia Flatfishes 2018 7 2,8 Ho et al.,2020 Mariani et al., 2015; Deconinck et 9,0% Europe Flatfishes 2015-2020 174 15,66 al., 2020; Pardo et al., 2018 Different regions 9,7% Flatfishes 2019 1000 97 Luque & donlan, 2019 of World Sole and 8% France 2015 12 1 Bénard-Capelle et al., 2015 halibut Flatfishes weighted 20,0% World Flatfishes 2008-2020 2055 405,648 average Guardone et al., 2017; Giusti et al., 2019;Di pinto et al., 2016;Barbuto Commercially et al., 2010; Nicole et al., 16,0% Italy important 2011-2019 902 144,32 ̀ 2012;Pappalardo et al., 2014; Fishes Ferrito et al., 2019; Acutis et al., 2019 Commercially 31,0% Belgium important 2018 280 86,8 Chistinansen et al., 2018 Fishes 34,0% Spain media 2012-2019 2293 779,62 Horreo et al., 2019; Munoz- Commercially Colmenero et al., 2016; Crego- important Prieto et al., 2012; Gordoa et al., Fishes 2017; Muñoz et al., 2015; Helgoe et al., 2020; Pardo & Jimenez, 2020

34,0% Germany Flatfishes 2009, 2016 124 42,16 Rehbein et al., 2012; Kappel &

Scroder, 2016 13,0% Greece Commercially 2015-2018 285 37,05 Minoudi et al., 2020

Europe important Fishes 28,0% United Kingdom 2012- 2018 378 105,84 Huxley-Jonse et al., 2012; Commercially Cawthorn et al., 2018; Griffiths et important al., 2014 Fishes 84,0% Turkey Alaskan 2012 50 42 Keskin & Atar, 2012 pollock

4,0% France Bluefin and 2015 371 14,84 Bénard-Capelle et al., 2015 yellowfin tuna, cod, sole and seabream 10,0% Europe 2015-2020 1984 198,4 Mariani et al., 2015; Pardo et al., Commercially 2018; Deconinck et al., 2020; important Fishes

European Commercially 6667 1451,03 weighted 22,0% Europe important 2009-2020 average Fishes

Willet et al., 2017; Abelson & Daley, 2011; Abelson & Daley, 2012; Warner, 2011; Warner et al., Commercially 2012b; Warner et al., 2012c; 31,0% USA important 2011-2019 3785 1173,35 Warner et al., 2012a; Cline, 2012; Fishes Warner et al., 2013; Cawthorn et al., 2018;Warner et al., 2019; Qin

th America

r et al., 2020; Liou et al., 2020

Commercially Hanner et al., 2011; Naaum et al., 40,0% Canada important 2011-2019 1044 417,6 2016; Cawthorn et al., 2018; Hu et Fishes al., 2018; Shehata et al., 2019

North 33,0% North America 2011-2019 4829 1590,95 Commercially America important weighted Fishes average Ardura et al., 2010; Carvalho et al., 2011; De Brito et al., 2015; Commercially Carvalho et al., 2015; Carvalho et

46,0% Brazil important 2010-2019 734 338 al., 2017; Staffen et al., 2017; Fishes Barbosa et al., 2020; Veneza et al., 2018; Calegari et al. 2019 7,0% Chile Crab-meat 2012 114 8 Haye et al.,2012

Commercially 18,0% Mexico important 2018 134 24,12 Sarmiento et al., 2018 Fishes Commercially Buenos Aires,

South Americaand Central 21,3% important 2019 172 36,7048 Delphiani et al., 2019 Argentine Fishes Turks & Caicos 82,0% Grouper 2017-2018 38 31,16 Calosso et al., 2020 Islands, Caribe South and Commercially central South and Central 37,0% important 2010-2019 1192 437,9848 America America Seafood weighted average Commercially Cawthorn et al., 2018; Ho et 23,0% Singapore important 2018 137 31,51 al.,2020 Fishes Commercially Kannuchamy et al., 2015; Wilwet 22,0% India important 2015-2018 152 33,44 et al., 2018 Seafood Commercially Xiong et al., 2016; But et al., 2019; 45,0% China media important 2016-2019 216 97,2 Xiong et al., 2020 Fishes Commercially 11,0% Iran important 2013 27 2,97 Changizi et al., 2013 Fishes Commercially 14,0% Philippines important 2013 19 2,66 Maralit et al., 2013 Fishes

Asia Commercially 23,0% Russia important 2015 22 5,06 Nedunoori et al., 2017 Fishes Commercially 16,0% Malaysia important 2015 62 9,92 Chin et al., 2016 Fishes Commercially 22,0% Taiwan important 2018 355 77,9935 Xing et al., 2020 Fishes Commercially 5,0% Qatar important 2019 82 4,1 Chen et al., 2019 Fishes Commercially 21,4% South Korea important 2019 172 36,808 Do et al., 2019 Fishes Asia Commercially weighted 24,0% Asia important 2013-2019 1244 301,6615 average Fishes 16,0% Australia Lutjanidae 2018 5 0,8 Cawthorn et al., 2018 Oceania 8,0% New Zealand Lutjanidae 2018 1 0,08 Cawthorn et al., 2018 Oceania weighted 15,0% Oceania Lutjanidae 2018 6 0,88 average

51 World General 27,0% World Fisheries 2008-2020 13938 3782,5063 weighted average

References:

Abelson, J., Daley, B., 2011. On the menu, but not on yout plate, the Boston Globe. Retrieved from: http://www.bostonglobe.com/business/2011/10/22/menu-but-not-on-your- plate/NDbXGXdPR6O37mXRSVPGIL/story.html. Abelson, J., Daley, B., 2012. Re-testing Mislabeled Fish, Boston Globe. Retrieved from: http://www.bostonglobe.com/Page/Boston/2011- 2020/WebGraphics/Business/BostonGlobe.com/2012/11/fish/fish.xml. Acutis, P.L., Cambiotti, V., Riina, M.V., Meistro, S., Maurella, C., Massaro, M., Stacchini, P., Gili, S., Malandra, R., Pezzolato, M., Caramelli, M., Bozzetta, E., 2019. Detection of fish species substitution frauds in Italy: A targeted National Monitoring Plan. Food Control 101, 151–155. https://doi.org/10.1016/j.foodcont.2019.02.020 Ardura A, Pola IG, Ginuino I, Gomes V, Garcia-Vazquez E., 2010. Application of barcoding to Amazonian commercial fish labelling. Food Res. Int. 43, 1549–1552. doi: 10.1016/j.foodres.2010.03.016. Barbosa, A.J., Sampaio, I., da Silva, E.M., Alcântara, J.V.L., Santos, S., 2020. Molecular authentication by DNA barcoding and multiplex PCR assay reveals mislabeling and commercial fraud of the Acoupa weakfish (Cynoscion acoupa), an economically important sciaenid marketed in Brazil. Food Control 117, 107351. https://doi.org/10.1016/j.foodcont.2020.107351 Barbuto, M., Galimberti, A., Ferri, E., Labra, M., Malandra, R., Galli, P., Casiraghi, M., 2010. DNA barcoding reveals fraudulent substitutions in shark seafood products: The Italian case of “palombo” (Mustelus spp.). Food Res. Int. 43, 376–381. https://doi.org/10.1016/j.foodres.2009.10.009 Bénard-Capelle, J., Guillonneau, V., Nouvian, C., Fournier, N., Loët, K. Le, Dettai, A., 2015. Fish mislabelling in France: Substitution rates and retail types. PeerJ 2015, 1–21. https://doi.org/10.7717/peerj.714 But, G.W.C., Wu, H.Y., Shaw, P.C., 2019. Identification of fish species of sushi products in Hong Kong. Food Control 98, 164–173. https://doi.org/10.1016/j.foodcont.2018.11.008 Calegari, B.B., Reis, R.E., Alho, C.S., 2019. DNA barcode identification of shark fillet reveals fraudulent commerce in Brazil. J. Can. Soc. Forensic Sci. 52, 95–100. https://doi.org/10.1080/00085030.2019.1581692 Calosso, M.C., Claydon, J.A.B., Mariani, S., Cawthorn, D.M., 2020. Global footprint of mislabelled seafood on a small island nation. Biol. Conserv. 245, 108557. https://doi.org/10.1016/j.biocon.2020.108557 Carvalho, D.C., Guedes, D., da Gloria Trindade, M., Coelho, R.M.S., de Lima Araujo, P.H., 2017. Nationwide Brazilian governmental forensic programme reveals seafood mislabelling trends and rates using DNA barcoding. Fish. Res. 191, 30–35. https://doi.org/10.1016/j.fishres.2017.02.021 Carvalho, D.C., Neto, D.A.P., Brasil, B.S.A.F., Oliveira, D.A.A., 2011. DNA barcoding unveils a high rate of mislabeling in a commercial freshwater catfish from Brazil. Mitochondrial DNA 22, 97– 105. https://doi.org/10.3109/19401736.2011.588219 Carvalho, D.C., Palhares, R.M., Drummond, M.G., Frigo, T.B., 2015. DNA Barcoding identification of commercialized seafood in South Brazil: A governmental regulatory forensic program. Food Control 50, 784–788. https://doi.org/10.1016/j.foodcont.2014.10.025 Cawthorn, D.M., Baillie, C., Mariani, S., 2018. Generic names and mislabeling conceal high species diversity in global fisheries markets. Conserv. Lett. 11, 1–12. https://doi.org/10.1111/conl.12573

52 Changizi, R., Farahmand, H., Soltani, M., Asareh, R., Ghiasvand, Z., 2013. Species identification reveals mislabeling of important fish products in Iran by DNA barcoding. Iran. J. Fish. Sci. 12, 758– 765. Chen, K.-C., Zakaria, D., Altarawneh, H., Andrews, G.N., Ganesan, G.S., John, K.M., Khan, S., Ladumor, H., 2019. DNA barcoding of fish species reveals low rate of package mislabeling in Qatar. Genome 62, 69–76. https://doi.org/10.1139/gen-2018-0101 Chin, T.C., Adibah, A.B., Danial Hariz, Z.A., Siti Azizah, M.N., 2016. Detection of mislabelled seafood products in Malaysia by DNA barcoding: Improving transparency in food market. Food Control 64, 247–256. https://doi.org/10.1016/j.foodcont.2015.11.042 Christiansen, H., Fournier, N., Hellemans, B., Volckaert, F.A.M., 2018. Seafood substitution and mislabeling in Brussels’ restaurants and canteens. Food Control 85, 66–75. https://doi.org/10.1016/j.foodcont.2017.09.005 Cline, E., 2012. Marketplace substitution of Atlantic salmon for Pacific salmon in Washington State detected by DNA barcoding. Food Res. Int. 45, 388–393. https://doi.org/10.1016/j.foodres.2011.10.043 Crego-Prieto, V., Campo, D., Perez, J., Martinez, J.L., Garcia-Vazquez, E., Roca, A., 2012. Inaccurate labelling detected at landings and markets: The case of European megrims. Fish. Res. 129–130, 106–109. https://doi.org/10.1016/j.fishres.2012.06.017 De Brito, M.A., Schneider, H., Sampaio, I., Santos, S., 2015. DNA barcoding reveals high substitution rate and mislabeling in croaker fillets (Sciaenidae) marketed in Brazil: The case of “pescada branca” (Cynoscion leiarchus and Plagioscion squamosissimus). Food Res. Int. 70, 40–46. https://doi.org/10.1016/j.foodres.2015.01.031 Deconinck, D., Volckaert, F.A.M., Hostens, K., Panicz, R., Eljasik, P., Faria, M., Monteiro, C.S., Robbens, J., Derycke, S., 2020. A high-quality genetic reference database for European commercial fishes reveals substitution fraud of processed Atlantic cod (Gadus morhua) and common sole (Solea solea) at different steps in the Belgian supply chain. Food Chem. Toxicol. 111417. https://doi.org/10.1016/j.fct.2020.111417 Delpiani, G., Delpiani, S.M., Deli Antoni, M.Y., Covatti Ale, M., Fischer, L., Lucifora, L.O., Díaz de Astarloa, J.M., 2020. Are we sure we eat what we buy? Fish mislabelling in Buenos Aires province, the largest sea food market in Argentina. Fish. Res. 221, 105373. https://doi.org/10.1016/j.fishres.2019.105373 Di Pinto, A., Mottola, A., Marchetti, P., Bottaro, M., Terio, V., Bozzo, G., Bonerba, E., Ceci, E., Tantillo, G., 2016. Packaged frozen fishery products: Species identification, mislabeling occurrence and legislative implications. Food Chem. 194, 279–283. https://doi.org/10.1016/j.foodchem.2015.07.135 Do, T.D., Choi, T.J., Kim, J. il, An, H.E., Park, Y.J., Karagozlu, M.Z., Kim, C.B., 2019. Assessment of marine fish mislabeling in South Korea’s markets by DNA barcoding. Food Control 100, 53–57. https://doi.org/10.1016/j.foodcont.2019.01.002 Espiñeira, M., Ginzález-Lavín, N., Vieites, J.M., Santaclara, F,J., 2008. Development of a Method for the Genetic Identification of Flatfish Species on the Basis of Mitochondrial DNA Sequences. Food Chem. 56, 8954-8961. Ferrito, V., Raffa, A., Rossitto, L., Federico, C., Saccone, S., Pappalardo, A.M., 2019. Swordfish or shark slice? A rapid response by CoiBar–RFLP. Foods 8. https://doi.org/10.3390/foods8110537 Giusti, A., Tinacci, L., Sotelo, C.G., Acutis, P.L., Ielasi, N., Armani, A., 2019. Authentication of ready-to-eat anchovy products sold on the Italian market by BLAST analysis of a highly informative cytochrome b gene fragment. Food Control 97, 50–57. https://doi.org/10.1016/j.foodcont.2018.10.018 Gordoa, A., Carreras, G., Sanz, N., Viñas, J., 2017. Tuna species substitution in the Spanish commercial chain: A knock-on effect. PLoS One 12, 1–15. https://doi.org/10.1371/journal.pone.0170809

53 Griffiths, A.M., Sotelo, C.G., Mendes, R., Pérez-Martín, R.I., Schröder, U., Shorten, M., Silva, H.A., Verrez-Bagnis, V., Mariani, S., 2014. Current methods for seafood authenticity testing in Europe: Is there a need for harmonisation? Food Control 45, 95–100. https://doi.org/10.1016/j.foodcont.2014.04.020 Guardone, L., Tinacci, L., Costanzo, F., Azzarelli, D., D’Amico, P., Tasselli, G., Magni, A., Guidi, A., Nucera, D., Armani, A., 2017. DNA barcoding as a tool for detecting mislabeling of fishery products imported from third countries: An official survey conducted at the Border Inspection Post of Livorno-Pisa (Italy). Food Control 80, 204–216. https://doi.org/10.1016/j.foodcont.2017.03.056 Hanner, R., Becker, S., Ivanova, N. V., Steinke, D., 2011. FISH-BOL and seafood identification: Geographically dispersed case studies reveal systemic market substitution across Canada. Mitochondrial DNA 22, 106–122. https://doi.org/10.3109/19401736.2011.588217 Hayes, K.A., Cowie, R.H., Thiengo, S.C., Strong, E.E., 2012. Comparing apples with apples : clarifying the identities of two highly invasive Neotropical Ampullariidae ( Caenogastropoda ) 723– 753. https://doi.org/10.1111/j.1096-3642.2012.00867.x Helgoe, J., Oswald, K.J., Quattro, J.M., 2020. A comprehensive analysis of the mislabeling of Atlantic cod (Gadus morhua) products in Spain. Fish. Res. 222, 105400. https://doi.org/10.1016/j.fishres.2019.105400 Ho, J.K.I., Puniamoorthy, J., Srivathsan, A., Meier, R., 2020. MinION sequencing of seafood in Singapore reveals creatively labelled flatfishes, confused roe, pig DNA in squid balls, and phantom crustaceans. Food Control 112, 107144. https://doi.org/10.1016/j.foodcont.2020.107144 Horreo, J.L., Fitze, P.S., Jiménez-Valverde, A., Noriega, J.A., Pelaez, M.L., 2019. Amplification of 16S rDNA reveals important fish mislabeling in Madrid restaurants. Food Control 96, 146–150. https://doi.org/10.1016/j.foodcont.2018.09.020 Hu, Y., Huang, S.Y., Hanner, R., Levin, J., Lu, X., 2018. Study of fish products in Metro Vancouver using DNA barcoding methods reveals fraudulent labeling. Food Control 94, 38–47. https://doi.org/10.1016/j.foodcont.2018.06.023 Huxley, P., Evans, S., Madge, S., Webber, M., Burchardt, T., McDaid, D., Knapp, M., 2012. Social Inclusion Measure. Health Technol. Assess. (Rockv). 16, 1–248. Kappel, K., Schröder, U., 2016. Substitution of high-priced fish with low-priced species: Adulteration of common sole in German restaurants. Food Control 59, 478–486. https://doi.org/10.1016/j.foodcont.2015.06.024 Keskin, E., Atar, H.H., 2012. Molecular identification of fish species from surimi-based products labeled as Alaskan pollock. J. Appl. Ichthyol. 28, 811–814. https://doi.org/10.1111/j.1439- 0426.2012.02031.x Liou, P., Banda, A., Isaacs, R.B., Hellberg, R.S., 2020. Labeling compliance and species authentication of fish fillets sold at grocery stores in Southern California. Food Control 112, 107137. https://doi.org/10.1016/j.foodcont.2020.107137 Luque, G.M., Donlan, C.J., 2019. The characterization of seafood mislabeling: A global meta- analysis. Biol. Conserv. 236, 556–570. https://doi.org/10.1016/j.biocon.2019.04.006 Maralit, B.A., Aguila, R.D., Ventolero, M.F.H., Perez, S.K.L., Willette, D.A., Santos, M.D., 2013. Detection of mislabeled commercial fishery by-products in the Philippines using DNA barcodes and its implications to food traceability and safety. Food Control 33, 119–125. https://doi.org/10.1016/j.foodcont.2013.02.018 Mariani, S., Griffiths, A.M., Velasco, A., Kappel, K., Jerome, M., Perez-Martin, R.I., Schroder, U., Verrez-Bagnis, V., Silva, H., Vandamme, S.G., Boufana, B., Mendes, R., Shorten, M., Smith, C., Hankard, E., Hook, S.A., Weymer, A.S., Gunning, D., Sotelo, C.G., 2015. Low mislabeling rates indicate marked improvements in European seafood market operations. Front. Ecol. Environ. 13, 536–540. https://doi.org/10.1890/150119 Minoudi, S., Karaiskou, N., Avgeris, M., Gkagkavouzis, K., Tarantili, P., Triantafyllidou, D., Palilis, L., Avramopoulou, V., Tsikliras, A., Barmperis, K., Triantafyllidis, A., 2020. Seafood mislabeling in

54 Greek market using DNA barcoding. Food Control 113, 107213. https://doi.org/10.1016/j.foodcont.2020.107213 Muñoz-Colmenero, M., Blanco, O., Arias, V., Martinez, J.L., Garcia-Vazquez, E., 2016. L’authentification ADN des produits halieutiques révèle un mauvais étiquetage associé au traitement des fruits de mer. Fisheries 41, 128–138. https://doi.org/10.1080/03632415.2015.1132706 Muñoz-Colmenero, M., Klett-Mingo, M., Díaz, E., Blanco, O., Martínez, J.L., Garcia-Vazquez, E., 2015. Evolution of hake mislabeling niches in commercial markets. Food Control 54, 267–274. https://doi.org/10.1016/j.foodcont.2015.02.006 Naaum, A.M., Hanner, R., 2016. Community engagement in seafood identification using DNA barcoding reveals market substitution in Canadian seafood. DNA Barcodes 3, 74–79. https://doi.org/10.1515/dna-2015-0009 Nagalakshmi, K., Annam, P.K., Venkateshwarlu, G., Pathakota, G.B., Lakra, W.S., 2016. Mislabeling in Indian seafood: An investigation using DNA barcoding. Food Control 59, 196–200. https://doi.org/10.1016/j.foodcont.2015.05.018 Nedunoori, A., Turanov, S. V., Kartavtsev, Y.P., 2017. Fish product mislabeling identified in the Russian far east using DNA barcoding. Gene Reports 8, 144–149. https://doi.org/10.1016/j.genrep.2017.07.006 Nedunoori, A., Turanov, S. V., Kartavtsev, Y.P., 2017. Fish product mislabeling identified in the Russian far east using DNA barcoding. Gene Reports 8, 144–149. https://doi.org/10.1016/j.genrep.2017.07.006 Nicolè, S., Negrisolo, E., Eccher, G., Mantovani, R., Patarnello, T., Erickson, D.L., Kress, W.J., Barcaccia, G., 2012. DNA barcoding as a reliable method for the authentication of commercial seafood products. Food Technol. Biotechnol. 50, 387–398. Pappalardo, A.M., Federico, C., Saccone, S., Ferrito, V., 2018. Differential flatfish species detection by COIBar-RFLP in processed seafood products. Eur. Food Res. Technol. 244, 2191–2201. https://doi.org/10.1007/s00217-018-3129-x Pappalardo, A.M., Ferrito, V., 2015. DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets. Fish. Res. 164, 153–158. https://doi.org/10.1016/j.fishres.2014.11.004 Pappalardo, A.M., Ferrito, V., 2015. DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets. Fish. Res. 164, 153–158. https://doi.org/10.1016/j.fishres.2014.11.004 Pardo, M.Á., Jiménez, E., 2020. DNA barcoding revealing seafood mislabeling in food services from Spain. J. Food Compos. Anal. 91. https://doi.org/10.1016/j.jfca.2020.103521 Pardo, M.Á., Jiménez, E., Viðarsson, J.R., Ólafsson, K., Ólafsdóttir, G., Daníelsdóttir, A.K., Pérez- Villareal, B., 2018. DNA barcoding revealing mislabeling of seafood in European mass caterings. Food Control 92, 7–16. Qin, J., Vasefi, F., Hellberg, R.S., Akhbardeh, A., Isaacs, R.B., Yilmaz, A.G., Hwang, C., Baek, I., Schmidt, W.F., Kim, M.S., 2020. Detection of fish fillet substitution and mislabeling using multimode hyperspectral imaging techniques. Food Control 114. https://doi.org/10.1016/j.foodcont.2020.107234 Rehbein, H., Oliveira, A.C.M., 2012. Alaskan flatfishes on the German market: Part 1: Identification by DNA and protein analytical methods. Eur. Food Res. Technol. 234, 245–251. https://doi.org/10.1007/s00217-011-1629-z Sarmiento-Camacho, S., Valdez-Moreno, M., Adamowicz, S., 2018. DNA barcode identification of commercial fish sold in Mexican markets. Genome 61, 457–466. https://doi.org/10.1139/gen-2017- 0222 Shehata, H.R., Bourque, D., Steinke, D., Chen, S., Hanner, R., 2019. Survey of mislabelling across finfish supply chain reveals mislabelling both outside and within Canada. Food Res. Int. 121, 723– 729. https://doi.org/10.1016/j.foodres.2018.12.047

55 Staffen, C.F., Staffen, M.D., Becker, M.L., Löfgren, S.E., Muniz, Y.C.N., de Freitas, R.H.A., Marrero, A.R., 2017. DNA barcoding reveals the mislabeling of fish in a popular tourist destination in Brazil. PeerJ 2017, 1–13. https://doi.org/10.7717/peerj.4006 Veneza, I., Silva, R., Freitas, L., Silva, S., Martins, K., Sampaio, I., Schneider, H., Gomes, G., 2018. Molecular authentication of pargo fillets Lutjanus purpureus (perciformes: Lutjanidae) by DNA barcoding reveals commercial fraud. Neotrop. Ichthyol. 16, 1–6. https://doi.org/10.1590/1982-0224- 20170068 Warner K, Timme W, Lowell B, Hirshfield, M., 2012b. Widespread seafood fraud found in L.A. Oceana. From: http://oceana.org/en/news-media/publications/reports/Widespread-seafood-fraud- foud-in-los-angeles. Warner K, Timme W, Lowell B, Hirshfield, M., 2012c. Widespread seafood fraud found in New York city. Oceana. From: http://oceana.org/en/news-media/publications/reports/Widespread- seafood-fraud-foud-in-new-york-city. Warner K, Timme W, Lowell B, Stiles, M., 2012a. Persistent Seafood Fraud in South Florida. Oceana. From: http://oceana.org/en/news-media/publications/reports/persistent-seafood-fraud-in- south-florida. Warner, K., 2011. Seafood Fraud Found in Boston-Area Supermarkets. From: http://oceana.org/en/news-media/publications/reports/seafood-fraud-in-boston-area-supermarkets. Warner, K., Timme, W., Lowell, B., Hirshfield, M., 2013. Oceana study reveals seafood fraud nationwide. Oceana 1–69. Warner, K.A., Lowell, B., Timme, W., Shaftel, E., Hanner, R.H., 2019. Seafood sleuthing: How citizen science contributed to the largest market study of seafood mislabeling in the U.S. and informed policy. Mar. Policy 99, 304–311. https://doi.org/10.1016/j.marpol.2018.10.035 Willette, D.A., Simmonds, S.E., Cheng, S.H., Esteves, S., Kane, T.L., Nuetzel, H., Pilaud, N., Rachmawati, R., Barber, P.H., 2017. Using DNA barcoding to track seafood mislabeling in Los Angeles restaurants. Conserv. Biol. 31, 1076–1085. https://doi.org/10.1111/cobi.12888 Wilwet, L., Jeyasekaran, G., Shakila, R.J., Sivaraman, B., Padmavathy, P., 2018. A single enzyme PCR-RFLP protocol targeting 16S rRNA/tRNAval region to authenticate four commercially important shrimp species in India. Food Chem. 239, 369–376. https://doi.org/10.1016/j.foodchem.2017.06.132 Xiong, X., Guardone, L., Cornax, M.J., Tinacci, L., Guidi, A., Gianfaldoni, D., Armani, A., 2016. DNA barcoding reveals substitution of Sable fi sh ( Anoplopoma fi mbria ) with Patagonian and Antarctic Tooth fi sh ( Dissostichus eleginoides and Dissostichus mawsoni ) in online market in China : How mislabeling opens door to IUU fi shing. Food Control 70, 380–391. https://doi.org/10.1016/j.foodcont.2016.06.010 Xiong, Xiong, Yuan, F., Huang, M., Xiong, Xiaohui, 2020. Exploring the possible reasons for fish fraud in China based on results from monitoring sardine products sold on Chinese markets using DNA barcoding and real time PCR. Food Addit. Contam. - Part A Chem. Anal. Control. Expo. Risk Assess. 37, 193–204. https://doi.org/10.1080/19440049.2019.1694709 Xiong, Xiong, Yuan, F., Huang, M., Xiong, Xiaohui, 2020. Exploring the possible reasons for fish fraud in China based on results from monitoring sardine products sold on Chinese markets using DNA barcoding and real time PCR. Food Addit. Contam. - Part A Chem. Anal. Control. Expo. Risk Assess. 37, 193–204. https://doi.org/10.1080/19440049.2019.1694709

Table C2. Flatfishes substitute species proportion described at national and international literature. Number of Label name Substitute specie Reference occurrences

Paralichthys dentatus Paralichthys patagonicus 1 Warner et al., 2019

Paralichthys dentatus Paralichthys lethostigma 3 Warner et al., 2019

Paralichthys dentatus Lepidopsetta polyxystra 1 Warner et al., 2019

Paralichthys dentatus Pleuronectes quadrituberculatus 1 Warner et al., 2019

Paralichthys dentatus Psettodes erumei 1 Warner et al., 2019

Limanda aspera Lepidopsetta polyxystra 22 Rehbein et al., 2012, Minoudi et al., 2020

Limanda aspera Isopsetta isolepis 2 Rehbein et al., 2012

Limanda aspera Hippoglossoides sp. 2 Rehbein et al., 2012, Minoudi et al., 2020

Limanda aspera Pangasius hypophthalmus 1 Minoudi et al., 2020

Flounder, sole, halibut Reinhardtius hippoglossoides 4 Nedunoori et al., 2017

Flounder, sole, halibut Pangasius hypophthalmus 5 Kappel & Scroder, 2016

Flounder, sole, halibut P. sanitwongsei 5 Kappel & Scroder, 2016

Flounder, sole, halibut C. senegalensis 4 Kappel & Scroder, 2016

Flounder, sole, halibut S. lusitanica 2 Kappel & Scroder, 2016

Flounder, sole, halibut Glyptocephalus stelleri 1 Nedunoori et al., 2017

Flounder, sole, halibut G. stelleri 3 Nedunoori et al., 2017

Flounder, sole, halibut Limanda aspera 2 Nedunoori et al., 2017

Flounder, sole, halibut Pleuronectes quadrituberculatus 1 Nedunoori et al., 2017

Flounder, sole, halibut Isopisthus parvipinnis 1 Staffen et al., 2017

Flounder, sole, halibut Micropogonias furnieri 2 Staffen et al., 2017

Flounder, sole, halibut Paralichthys patagonicus 2 Staffen et al., 2017

Flounder, sole, halibut Cynoscion guatucupa 2 Staffen et al., 2017

Flounder, sole, halibut Pangasionodon sp. 1 Carvalho et al., 2017

Flounder, sole, halibut Atheresthes stomias 2 Carvalho et al., 2017

Flounder, sole, halibut Seriola quinqueradiata 1 But et al., 2019

Flounder, sole, halibut Pangasius hypophthalmus 2 Pardo & Jimenez, 2020

Flounder, sole, halibut Gadus morhua 1 Pardo & Jimenez, 2020

Flounder, sole, halibut Atheresthes stomias 1 Pardo & Jimenez, 2020

Flounder, sole, halibut Synaptura lusitanica 1 Pardo & Jimenez, 2020

Flounder, sole, halibut Cynoglossus canariensis 1 Pardo & Jimenez, 2020

Flounder, sole, halibut Pangasius hypophthalmus 1 Hu et al., 2018

Flounder, sole, halibut Lepidopsetta polyxystra 2 Hu et al., 2018

Flounder, sole, halibut Microstomus kitt 2 Deconinck et al., 2020

Flounder, sole, halibut Pangasius hypophthalmus 1 Deconinck et al., 2020

Flounder, sole, halibut Solea senefalensis 2 Deconinck et al., 2020

Flounder, sole, halibut Limanda aspera 8 Deconinck et al., 2020

Flounder, sole, halibut Lepidopsetta polyxystra 1 Deconinck et al., 2020

Flounder, sole, halibut Cynoglossus spp. 2 Deconinck et al., 2020

57 Flounder, sole, halibut Merluccius hubbsi 1 Pardo et al., 2018

Flounder, sole, halibut Limanda aspera 1 Pardo et al., 2018

Flounder, sole, halibut Pangasius hypophthalmus 1 Pardo et al., 2018

Lepidorhombus boscii Lepidorhombus whiffagonis 1 Acutis et al., 2019

Solea solea Microchirus azevia 1 Espiñera et al., 2008

Solea solea Solea senegalensis 2 Espiñera et al., 2008

Solea solea Arnoglossus laterna 5 Pappalardo et al., 2015

Solea solea Pleuronectes platessa 1 Minoudi et al., 2020

Pleuronectes platessa Platichthys flesus 1 Espiñera et al., 2008

Pleuronectes platessa Hippoglossoides platessoides 3 Espiñera et al., 2008

Pleuronectes platessa Hippoglossoides dubius 1 Espiñera et al., 2008

Pleuronectes platessa Limanda aspera 1 Minoudi et al., 2020

Pleuronectes platessa Pangasius hypophthalmus 2 Pappalardo et al., 2015

Pleuronectes platessa Platichthys flesus 6 Pappalardo et al., 2015

Pleuronectes platessa Limanda limanda 2 Pappalardo et al., 2015

Hippoglossus hipoglossus Lepidorhombus boscii 2 Espiñera et al., 2008

Hippoglossus hippoglossus Pangasius hypophthalmus 1 Minoudi et al., 2020

Hippoglossus stenolepis Paralichthys californicus 4 Warner et al., 2019

Hippoglossus stenolepis Hippoglossus hippoglossus 15 Warner et al., 2019

Hippoglossus stenolepis Reinhardtius hippoglossoides 1 Warner et al., 2019

Hippoglossus stenolepis Reinhardtius hippoglossoides 2 Hu et al., 2018

Hippoglossus stenolepis Pangasius hypophthalmus 2 Hu et al., 2018

Hippoglossus hippoglossus Hippoglossus stenolepis 1 Hu et al., 2018

Hippoglossus stenolepis Melanogrammus aeglefinus 1 Hu et al., 2018

Hippoglossus stenolepis Hippoglossus stenolepis 1 Hu et al., 2018

Hippoglossus sp Atherethes stomias 2 Ho et al.,2020 Reinhardtius Pleuronectes platessa 1 Espiñera et al., 2008 hippoglossoides

Limanda ferruginea Platichthys flesus 1 Espiñera et al., 2008

Microstomus kitt Microstomus pacificus 1 Espiñera et al., 2008

Paralichtys isosceles Paralichtys patagonicus 1 Acutis et al., 2019

Solea vulgaris Solea senegalensis 2 Acutis et al., 2019

Solea senegalensis Solea vulgaris 1 Acutis et al., 2019

Arnoglassus laterna Lepidorhombus boscii 1 Acutis et al., 2019

Dicologoglossa cuneata Pegusa cadenati 1 Acutis et al., 2019

Flounder, sole, halibut Cynoglossus senegalensis 1 Bénard-Capelle et al.,2015

References:

Acutis, P.L., Cambiotti, V., Riina, M.V., Meistro, S., Maurella, C., Massaro, M., Stacchini, P., Gili, S., Malandra, R., Pezzolato, M., Caramelli, M., Bozzetta, E., 2019. Detection of fish species substitution frauds in Italy: A targeted National Monitoring Plan. Food Control 101, 151–155. https://doi.org/10.1016/j.foodcont.2019.02.020

58 Bénard-Capelle, J., Guillonneau, V., Nouvian, C., Fournier, N., Loët, K. Le, Dettai, A., 2015. Fish mislabelling in France: Substitution rates and retail types. PeerJ 2015, 1–21. https://doi.org/10.7717/peerj.714 But, G.W.C., Wu, H.Y., Shaw, P.C., 2019. Identification of fish species of sushi products in Hong Kong. Food Control 98, 164–173. https://doi.org/10.1016/j.foodcont.2018.11.008 Carvalho, D.C., Guedes, D., da Gloria Trindade, M., Coelho, R.M.S., de Lima Araujo, P.H., 2017. Nationwide Brazilian governmental forensic programme reveals seafood mislabelling trends and rates using DNA barcoding. Fish. Res. 191, 30–35. https://doi.org/10.1016/j.fishres.2017.02.021 Deconinck, D., Volckaert, F.A.M., Hostens, K., Panicz, R., Eljasik, P., Faria, M., Monteiro, C.S., Robbens, J., Derycke, S., 2020. A high-quality genetic reference database for European commercial fishes reveals substitution fraud of processed Atlantic cod (Gadus morhua) and common sole (Solea solea) at different steps in the Belgian supply chain. Food Chem. Toxicol. 111417. https://doi.org/10.1016/j.fct.2020.111417 Espiñeira, M., Ginzález-Lavín, N., Vieites, J.M., Santaclara, F,J., 2008. Development of a Method for the Genetic Identification of Flatfish Species on the Basis of Mitochondrial DNA Sequences. Food Chem. 56, 8954-8961. Ho, J.K.I., Puniamoorthy, J., Srivathsan, A., Meier, R., 2020. MinION sequencing of seafood in Singapore reveals creatively labelled flatfishes, confused roe, pig DNA in squid balls, and phantom crustaceans. Food Control 112, 107144. https://doi.org/10.1016/j.foodcont.2020.107144 Hu, Y., Huang, S.Y., Hanner, R., Levin, J., Lu, X., 2018. Study of fish products in Metro Vancouver using DNA barcoding methods reveals fraudulent labeling. Food Control 94, 38–47. https://doi.org/10.1016/j.foodcont.2018.06.023 Kappel, K., Schröder, U., 2016. Substitution of high-priced fish with low-priced species: Adulteration of common sole in German restaurants. Food Control 59, 478–486. https://doi.org/10.1016/j.foodcont.2015.06.024 Luque, G.M., Donlan, C.J., 2019. The characterization of seafood mislabeling: A global meta- analysis. Biol. Conserv. 236, 556–570. https://doi.org/10.1016/j.biocon.2019.04.006 Mariani, S., Griffiths, A.M., Velasco, A., Kappel, K., Jerome, M., Perez-Martin, R.I., Schroder, U., Verrez-Bagnis, V., Silva, H., Vandamme, S.G., Boufana, B., Mendes, R., Shorten, M., Smith, C., Hankard, E., Hook, S.A., Weymer, A.S., Gunning, D., Sotelo, C.G., 2015. Low mislabeling rates indicate marked improvements in European seafood market operations. Front. Ecol. Environ. 13, 536–540. https://doi.org/10.1890/150119 Minoudi, S., Karaiskou, N., Avgeris, M., Gkagkavouzis, K., Tarantili, P., Triantafyllidou, D., Palilis, L., Avramopoulou, V., Tsikliras, A., Barmperis, K., Triantafyllidis, A., 2020. Seafood mislabeling in Greek market using DNA barcoding. Food Control 113, 107213. https://doi.org/10.1016/j.foodcont.2020.107213 Nedunoori, A., Turanov, S. V., Kartavtsev, Y.P., 2017. Fish product mislabeling identified in the Russian far east using DNA barcoding. Gene Reports 8, 144–149. https://doi.org/10.1016/j.genrep.2017.07.006 Nicolè, S., Negrisolo, E., Eccher, G., Mantovani, R., Patarnello, T., Erickson, D.L., Kress, W.J., Barcaccia, G., 2012. DNA barcoding as a reliable method for the authentication of commercial seafood products. Food Technol. Biotechnol. 50, 387–398. Pappalardo, A.M., Federico, C., Saccone, S., Ferrito, V., 2018. Differential flatfish species detection by COIBar-RFLP in processed seafood products. Eur. Food Res. Technol. 244, 2191–2201. https://doi.org/10.1007/s00217-018-3129-x Pappalardo, A.M., Ferrito, V., 2015. DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets. Fish. Res. 164, 153–158. https://doi.org/10.1016/j.fishres.2014.11.004 Pardo, M.Á., Jiménez, E., 2020. DNA barcoding revealing seafood mislabeling in food services from Spain. J. Food Compos. Anal. 91. https://doi.org/10.1016/j.jfca.2020.103521

59 Pardo, M.Á., Jiménez, E., Viðarsson, J.R., Ólafsson, K., Ólafsdóttir, G., Daníelsdóttir, A.K., Pérez- Villareal, B., 2018. DNA barcoding revealing mislabeling of seafood in European mass caterings. Food Control 92, 7–16. Rehbein, H., Oliveira, A.C.M., 2012. Alaskan flatfishes on the German market: Part 1: Identification by DNA and protein analytical methods. Eur. Food Res. Technol. 234, 245–251. https://doi.org/10.1007/s00217-011-1629-z Staffen, C.F., Staffen, M.D., Becker, M.L., Löfgren, S.E., Muniz, Y.C.N., de Freitas, R.H.A., Marrero, A.R., 2017. DNA barcoding reveals the mislabeling of fish in a popular tourist destination in Brazil. PeerJ 2017, 1–13. https://doi.org/10.7717/peerj.4006 Warner, K.A., Lowell, B., Timme, W., Shaftel, E., Hanner, R.H., 2019. Seafood sleuthing: How citizen science contributed to the largest market study of seafood mislabeling in the U.S. and informed policy. Mar. Policy 99, 304–311. https://doi.org/10.1016/j.marpol.2018.10.035

60 Appendix D. Souza et al. From fish-markets to restaurants: substitution prevalence along the flatfish commercialization chain in Brazil

Figure D1. Normalized ∆Mislabeling percentual distribution, inside the supply chain categories (Fishmonger, Street market and Restaurant). Figure D2. Normalized ∆Mislabeling percentual distribution in each substitute species.

90%

u t 80%

e 70%

i 60%

a l 50%

a 40%

d 30%

i l 20%

o 10%

N 0% Fismonger Street market Restaurant

90%

t 80%

c r 70%

n 60%

l 50%

m 40%

30%

l 20%

o 10%

N 0% Oreochromis Pangasianodon Lophius Atheresthes Xystreurys niloticus hypophthalmus gastrophysus stomias rasile

61 III. Sequencing-free, PCR based, approaches for the fast identification of flatfish species

Souza, D.F.S., Solé-Cava, A.M.

Abstract Flounders are a diverse and high-valued seafood. Because of that, levels of substitution of flounder for other, lower value, species, has been estimated to be as high as 52%, which calls for labeling regulations. In Brazil, only species of the genera Syacium and Paralichthys can be labeled as flounder. The implementation of that regulation, however, is hindered when fish is sold as filets, which is the most common type of presentation of flounders in the markets. The most commonly used method to overcome that limitation is DNA sequencing of mitochondrial genes, but it can be expensive to run and requires sophisticated molecular laboratory facilities. Here we compare DNA sequencing with two other, faster and cheaper approaches: Restriction fragment length polymorphism (RFLP) of PCR products and multiplex PCR. For the A RFLP assay, we used digestions with a single enzyme of PCR products of the Cytochrome B gene (Cytb). For the Multiplex approach, we developed a 16 primers multiplex system using the Cytochrome oxidase subunit I gene (COI). Those methodologies were used to identify 14 target groups in the flounder trade (Paralichthys (P. brasiliensis, P. orbignianus, P. isosceles, P. patagonicus) and Syacium (S. microrum, S. papillosum) Pangasionodon hypophthalmus; Bothus robinsi; Citharycthys spp.; Limanda aspera; Atheresthes stomias; Pleuronectes spp., and Lepidopsetta polyxystra; Etropus spp.). The performance of both methods was evaluated through a blind-test, using dichotomous keys aid the identification of the banding patterns. The RFLP approach produced the best results, with hit rates of 95% and a cost of U$2,50/sample. The application of sequencing-free methods will help the inspection system, because it will allow a more widespread use in developing countries. Introduction Fishes of the order Pleuronectiformes include many flatfish species of high commercial interest, such as sole, flounder and halibut (Pappalardo et al., 2018). Although flatfish account for only 1.6% of all word trade of fish products (FAO, 2018) they include some of the most valued fish in the world. Therefore, it is expected that other, cheaper, fish may be sold under the name of flounders. This represents a problem not only because of the misleading of consumers, but also because it hinders the conservation of natural fish stocks and affects public health (when flatfish are replaced, e.g., by other, allergenic or contaminated species) (FAO, 2019). Fish mislabeling has been responsible, for example, for outbursts of intoxication in China (Xu et al., 2015), USA (Warner et al., 2015) and Italy (Ferrito et al., 2019).

62 Fish mislabeling is harder to control morphologically when fish is sold processed in the form of filets, slices and steaks (Muñoz-Colmenero et al., 2015). Thus, molecular tools, particularly DNA sequencing (FINS or Forensically Informative Nucleotide Sequencing; Bartllet & Davidson, 1992) have become the norm in controlling processed sea food mislabeling (Christiansen, 2018; Crego – Prieto, 2018; Delpiani, 2019; Do, 2019; Shehata, 2019). For example, in a recent FINS study of Brazilian flounders, a substitution rate of 52% was found (Souza et al., 2020). The most common FINS approach for fish identification has been the use of Cytochrome Oxidase I sequences (the so-called “DNA barcodes”; Heber et al., 2003; Ardura et al., 2013). Also, other sequencing independent methodologies have been used, like ELISA, multiplex and real time PCR, restriction fragment length polymorphism of PCR- amplified DNA (PCR/RFLP) and amplified fragment length polymorphisms (AFLP) (Sumathi et al., 2015; Torres et al., 2013; Chen et al. 2017; Asensio et al., 2008; Anjali et al., 2019; Fernandes et al., 2017; Ali et al, 2013, 2014). Among these, PCR/RFLP and multiplex PCR (Anjali et al., 2019; Ali, 2013) have been considered as the most suitable methods for sequencing-free seafood authentication, facilitating the work of inspection agencies (Sivaraman et al., 2018). The first use of PCR/RFLP for seafood identification was in 2000 (Wolf et al., 2000), and, after that, the technique has been extensively used in a variety of fish species (Aranishi et al., 2005; Sivaraman et al., 2018; Ferrito et al., 2019; Anjali et al., 2019; Ferrito et al., 2016; Xu et al., 2015; Anjali et al., 2019). Multiplex assays were developed latter, for the discrimination between groupers, wreckfish and tilapia (Asensio, 2008) or bonito species (Lin & Hwang, 2008). Regarding flatfishes specifically, the common sole (Solea solea) was the target group in an Italian RFLP assay (Pappalardo et al., 2018), where 7 flounder species could be identified by 4 enzymes in separated assays. The aim of this work was to implement and compare PCR/RFLP and multiplex techniques to help governmental bodies to identify, more quickly and without the need of sequencing facilities, samples sold as flounder in Brazil. We tested the methodology using the fourteen species of fish found to be sold as “flounder” in a previous study (Souza et al., 2020).

Material and methods Fourteen species were analyzed, including the 6 species that can be sold under the name of “flounder” according to Brazilian legislation (IN29; MAPA,2015), namely species of the genera Paralichthys (P. brasiliensis, P. orbignianus, P. isosceles, P. patagonicus) and Syacium (S. microrum, S. papillosum). Additionally, we analyzed samples of the fish most commonly sold as “flounder” in Brazil (Souza et al., 2020): Pangasionodon hypophthalmus; Bothus robinsi; Citharycthys macrops, C. spilopterus; Limanda aspera; Atheresthes stomias; Pleuronectes platessa, P. quadrituberculatus, Etropus spp., and

63 Lepidopsetta polyxystra. To make our methodology more broadly useful, we tried to make our systems genus specific, allowing them to be applied to other geographical areas.

Collection of samples and DNA extraction Samples of each species were collected under varying degrees of processing, to provide a diversity of levels of tissue conservation (Table 1). Tissues were stored in 96 % Ethanol at -20 ºC until DNA extraction, which was performed using a salting-out method (Miller et al., 1988). Quality of the DNA extracts was checked on an 1% agarose gel.

PCR, Sequencing and data analysis All samples were sequenced to obtain standards with which to compare the identifications obtained through PCR/RFLP and multiplex assays. Portions of the Cytochrome b (Cytb) and Cytochrome oxidase I (COI) genes were amplified by PCR in each sample as follows. A 10 µl reaction was prepared using 2.5 ml of 5 X FIREPol® Master mix with dNTPs (Solis BioDyne, Tartu, Estonia), 0.25 µM of each forward and reverse primer, 0.5 mg BSA and 0.5µl of sample DNA (approx. 10 ng) in 7 µl of nuclease free water. The primers Fish_ling_F (Forward) and Fish_ling_R (Reverse) were used to amplify the COI gene (Ward et al. (2009) e Ivanova et al. (2007)), while the primers L14735 (F) and H15149AD (R) were used to amplify the Cytb gene (Sotelo et al.,2001). Thermal amplification consisted of a denaturing step of 4 minutes at 94 °C, followed by 35 cycles at 93 ° for 30 seconds, 50 °C for 40 seconds and 72 °C for 1 minute; and a final extension step for 7 minutes at 72 °C. A 2% agarose gel electrophoresis was used to verify the amplification quality. Five microliters of each PCR product were purified by digestion at 37 °C for 15 minutes with 0.83 units of Exonuclease I and 0.08 units of Shrimp Alkaline Phosphatase in 0.25 µl of nuclease free water. Sequencing of the purified PCR products was performed in both reading directions using BigDye Terminator v3.1 Cycle Sequencing chemistry, in an ABI3500 sequencer, according to the manufacturers’ protocol (Applied BioSystems).

Sequence analysis and molecular identification Assembly of the forward and reverse DNA sequences into contigs was obtained using Geneious software v.11.1.5. The consensus sequences were manually edited, followed by a BLAST query of reference sequences on the NCBI (1) and RENIMP (2) databases. A threshold of 97% similarity was used to define putative positive identification hits. The sequences of the three most similar species (highest hits in the BLAST searches), were kept for subsequent phylogenetic analyses. The DNA sequences of each sample, together with the three highest hits on the BLAST search, were used for

64 phylogenetic reconstruction using the maximum likelihood algorithm, in the IQ-Tree program (NGUYEN et al., 2015), to obtain the FINS identity. The K2P (Kimura, 1980) model was chosen for those analyses. Once sequences of all species had been confirmed both morphologically and by FINS, they were used as the basis of the RFLP and Multiplex development (Table 1). (1) National Center for Biotechnology Information (2) Rede Nacional de Identificação Molecular do Pescado – National Molecular Fish Identification Network

DNA Sample name Species Collection site Use as sample test concentration Multiplex BA11 Etropus spp. 27.18 RENIMP RFLP SOL11 Pangasianodon hypopthalmus 57.94 Street fair Multiplex AI62 Syacium spp. 50.78 RENIMP Multiplex AI67 Bothus robinsi 22.17 RENIMP Multiplex Multiplex AL37 Citharycthys macrops 50.08 RENIMP RFLP RF13B027 Xyastreurys spp. 70 Street fair Multiplex Multiplex RF13C037 Limanda aspera 56.39 Supermarket RFLP RF13C013 Atheresthes stomias 38.25 Supermarket Multiplex Multiplex RF13B053 Pleuronectes spp. 30.84 Supermarket RFLP Multiplex AL05 Paralichthys orbignianus 51.07 RENIMP RFLP AH27 Paralichthys isoceles 45.42 RENIMP Multiplex RF13A065 Paralichthys brasiliensis 43.97 Fishmonger Multiplex RF13C010 Paralichthys patagonicus 40.10 Supermarket Multiplex RF12A026 Lepidosetta polyxystra 126 Supermarket Multiplex AK74 Paralichthys isoceles 12.45 RENIMP RFLP RF13A048 Paralichthys patagonicus 42.30 Fishmonger RFLP AC47 Paralichthys patagonicus 9.55 RENIMP RFLP AC51 Paralichthys brasiliensis 6.76 RENIMP RFLP AK86 Paralichthys orbignianus 35.56 Fishmonger RFLP AJ62 Citharycthys spilopterus 36.40 RENIMP RFLP LING01 Atheresthes stomias 57.9 Supermarket RFLP SOL01 Xystreurys 127.35 Fishmonger RFLP DA011 Pangasianodon hypopthalmus 95.66 Market-places RFLP

DA004 Pangasianodon hypopthalmus 6.78 Street fair RFLP BA12 Etropus crossutus 18.19 RENIMP RFLP BA13 Etropus microstomus 64.33 RENIMP RFLP AH93 Syacium spp. 89.50 RENIMP RFLP AI61 Syacium spp. 33.12 RENIMP RFLP AI68 Bothus robinsi 57.56 RENIMP RFLP Multiplex AI66 Bothus robinsi 107.64 RENIMP RFLP RF12A026 Lepidosetta polyxystra 112.95 Supermarket Multiplex Multiplex DA024 Paralichthys isoceles 25.86 Restaurant RFLP SOL12 Paralichthys isoceles 84.26 Fishmonger Multiplex Multiplex DA008 Paralichthys orbignianus 36.56 Restaurant RFLP LING06 Atherestes stomias 117.37 Supermarket Multiplex Multiplex RF12A064 Xystreurys 31.35 RENIMP RFLP Multiplex RF13A062 Pangasianodon hypopthalmus 27.91 Supermarket RFLP Multiplex AL38 Syacium spp. 63.00 RENIMP RFLP Multiplex RF12A024 Atheresthes stomias 10.97 Street fair RFLP Multiplex RF12A025 Atheresthes stomias 12.6 Fishmonger RFLP Multiplex RF12A016 Paralichthys isoceles 22.57 Supermarket RFLP Multiplex RF13A056 Paralichthys isoceles 21.37 Fishmonger RFLP RF13B053 Pleuronectes spp. 30.84 Street fair RFLP RF12A027 Lepidosetta polyxystra 70.00 Supermarket RFLP Multiplex AL39 Syacium spp. 63.00 RENIMP RFLP Table 1: Samples (N=45) used for the Multiplex and RFLP development and test.

RFLP PCR Development Target gene and Enzyme choice Initially, sequences of several mitochondrial genes were aligned, and polymorphic sites were used to search each alignment for species- and genus- specific restriction sites. The RFLP patterns were verified through in-silico digestion using Geneious software (Geneious Inc.), in relation to suitability of restriction patterns to gel electrophoresis detection and locus-specific primer design. The best result was obtained when observing the RFLP patterns of Cytochrome b gene sequences (Cytb) treated with the MseI enzyme.

PCR and Restriction reaction Once the best combination of gene and restriction enzyme was established, we proceeded to test and optimize the methodology. A fragment of about 470 bp base pairs (bp) of the Cytb gene was amplified by PCR using the fish universal oligonucleotides, L14735 (Forward) and H15149AD (Reverse; Sotelo et al., 2001), using the same PCR protocol described above. A 2% agarose gel electrophoresis was used to verify the amplification success. Ten microlites of PCR product was, then, digested overnight at 37 °C with 0.2 units of Anza ™ 64SaqAl 10U/ µl (MseI Invitrogen) in 0.4 µl of buffer (Anza ™ 10x Buffer) and 0.4 µl of ultrapure water. The restriction fragments were visualized using 2.5% agarose gel electrophoresis. We also used a QiaXcel high resolution automatic capillary gel electrophoresis apparatus (Qiagen) to analyse the RFLP patterns according to the manufacturer’s instruction.

Band template construction To estimate levels of intraspecific variation that could interfere with the PCR/RFLP identification protocol, at least ten individuals of each species were analyzed. When polymorphism was detected, more individuals were analyzed, to establish the range of variation within each species. A dichotomous key, based on species- or genus- specific banding patterns, including densitometric band patterns produced on the QiaXcel sytem was produced, to facilitate the identification of unknown samples in the blind tests.

Multiplex pcr Development

66 Target gene Similarly to the procedure for the RFLP analyses, we scanned the aligned sequences of all mitogenomes available on GenBank for the target species using the Geneious program, to choose the most suitable primer sets. Primers were designed so that their first two 3’ nucleotides corresponded to a taxon-specific sequence in different parts of the sequence, producing amplicons with different sizes (Figure 1). The gene that proved to be most suitable for that analysis was CO1, for which we could design 15 oligonucleotides that would produce diagnostic amplicons for each interest group (Table 2). Beside the species-specific primers, we also used universal teleostean primers for the analyses (FishF2_t1-F and FishR2_t1-R Ward et al., 2009 and Ivanova et al., 2007).

600 Pb (external)

394 Pb (Xyst_F) 302 Pb (Sya_F) 256 Pb (Lim_F) 224 Pb (Hipo_F) 220 Pb (Athe_F) 187 Pb (Bot_F) 178 Pb (Etrop_F) 130 Pb (Para3_F) 120 Pb (Citha_F)

Citocrome Oxidase subunity I

325 Pb (Pleu_Rl)

462 Pb (Pang_R)

482 Pb (Lepi_Rl)

Figure 1. Primer annealing positions on the fragment of the Cytochrome oxidase I gene in the Multiplex assay.

Amplification PrimerName Oligonucleotides primers sequence Expected Size of amplicon Target group Gene direction FishF2_t1-F TTCGACTAATCATAAAGATATCGGCA 600 F Fishes (External) COI FishR2_t1-R ACTTCAGGGTGACCGAAGAATCAGAA 600 R Fishes (External) COI AtheCOI_F TGCTGGGGCATCAGTTGATCTTACG 220 F Atheresthes stomias COI HipoCOI_F CCCTCCTTTCTCCTCCTCT 224 F Hippoglossus spp. COI LepiCOI_R GACAGCAGTTACTATGTACCAA 482 R Lepidoseptta polyxystra COI LimCOI_F ATGTACCAAATTCCACTATTCGTG 256 F Limanda aspera COI PleuCOI_R GGGAACAGGGTGAACCGTATA 325 R Pleuronectes spp. COI BotCOI_F CCTTGCAGGTATCTCGTCG 187 F Bothus spp. COI EtroCOI_F GAACTTGGTCCACGCAGGT 178 F Etropus spp. COI PangCOI_R CCAGCAATTTCAATATCAAACACCTT 462 R Pangassionodon hyppopthalmus COI ParaCOI_R YAGCAACCTAACCCATCCT 117 F Paralichthys spp. COI newSya_COI_F CCTATTCATGTGTAGAAGG 302 F Syacium spp. COI newCitha_COI_F CTCCGTCACAATGTACCAAATC 120 F Citharycthys spp. COI newXyst_COI_F ACTTATCCCCCTAATAATCGGAGCT 394 F Xystreurys rasile COI Para3_COI_F TMACHATRTACCAAATYCCG 130 F Paralichthys spp. COI

67 Table 2: Cytochrome oxidase taxon-specific oligonucleotides, their target groups, size of amplified fragment and synthesis direction.

Optimization of the PCR Multiplex protocol Initially, each group specific primer was tested together with external, universal primers, in triplex reactions, to test the primer amplification in all target species. The PCR reactions had 10 µl of final volume, containing 0.25 µM of each primer, 0.5 µl (approx 20 ng) of sample DNA, 2µl of 5 X FIREPol® Master mix that contained 200 µM of dNTPs (Solis BioDyne, Tartu, Estonia) and 7 µl of nuclease free water. Thermocycling conditions started with a denaturation step of 4 minutes at 94 °C, followed by 35 cycles of denaturing at 93 ° for 30 seconds, annealing at 50 °C for 40 seconds, and extension at 72 °C for 1 minute, followed by a final extension stage for 7 minutes at 72 °C. The PCR results were visualized by 2.5% agarose gel electrophoresis. After that initial test, each assay went through an optimization step, where annealing temperature, MgCl2 concentration and extension time were adjusted.

PCR Multiplex development Once each group-specific primer was adjusted, we started adding other primers in progressively larger multiplex sets. The primers that failed to produce a diagnostic pattern in the multiplex assay, possibly because of negative interactions with other primers, were subjected to tetraplex tests, to identify which oligos were interfering with each other. Once those primers were identified, primer concentration adjustment were made, until each interest group presented a diagnostic pattern in the complete multiplex reaction. Final Multiplex PCR conditions were 0.25 µM of primers FishF2_t1-F, FishR2_t1-R, LepiCOI_R, PleuCOI_R, PangCOI_R, newCitha_COI_F, newXyst_COI_F, ParaCOI_R, newSya_COI_F; 0.35 µM of primers AtheCOI_F, EtroCOI_F, BotCOI_F, newSya_COI_F; 0.20 µM of primer Para3_COI_F and 0.10 µM of primer LimCOI_F. The best thermocycling conditions were obtained with a denaturation step of 4 minutes at 94 °C, followed by 35 cycles of denaturing at 93 ° for 30 seconds, annealing at 55 °C for 40 seconds, and extension at 72 °C for 50 seconds, followed by a final extension stage for 7 minutes at 72 °C.

Band template construction Once the multiplex conditions were established, more samples of each group were tested to detect possible polymorphisms within each group, that could be attributed to SNPs in the annealing sites. No group displayed such polymorphisms; therefore, the system was considered ready for testing.

Blind tests (RFLP and Multiplex) To validate both approaches, we asked volunteers to identify unknown samples using a dichotomous key and photos of the expected RFLP (N = 19 persons), or multiplex-PCR (N = 7 persons) patterns. Volunteers included scientists and non-scientists (Table 3), and the person who applied the test was also unaware of the true identity of each sample (configuring a blind test; MacCoun & Perlmutter, 2015). A total of 26 samples were analyzed by cytochrome b sequencing, of which 25 were tested by RFLP/PCR and 15 were tested by Multiplex PCR. The individual analyses were, then, separated and labels were scrambled before giving them to the volunteers, who should independently and on different occasions identify the samples using each technique. Each RFLP test was composed of a Readme text with instructions (anex), an answer sheet with the RFLP patterns per group with the correlation between amplicons and densitograms to PCR RFLP (Figure 2), an answer sheet with presence and absence of bands to PCR Multiplex (Figure 4) and dichotomous keys for the identification based on the answer sheets of both approaches (Figure 5 and 6).

RESULTS AND DISCUSSION

PCR RFLP Diagnostic RFLP patterns were found for all the 14 taxonomic groups. In some cases, like in Paralichthys isosceles and Paralichthys orbignianus, polymorphism was observed, with two diagnostics patterns each. Similar instances of polymorphism have been reported in other species and were explained as the result of intraspecific genetic variation (Ferrito et al., 2019). The method was reliable even for samples with very low DNA concentrations (Figure 3). Many PCR/RFLP fish identification systems have been described in the last decade (Anjali et al., 2019; Pardo et al., 2004; Xu et al., 2015; Sivaraman et al., 2018; Sotelo et al., 2000; Céspedes et al., 2008; Pappalardo et al., 2018). To our knowledge, only one flounder PCR/RFLP assay has been published to date, which was able to discriminate between three European flounder species using the COI gene (Pappalardo et al., 2018). Also, no other paper has reported an identification of a number of fish taxa as large as this one using a single restriction enzyme. The simplicity of this approach for flounder identification keeps the application price lower than others for the identification of fish products, which often require the use of 2-4 enzymes (Anjali et al., 2019; Pardo et al., 2004; Xu et al., 2015; Sivaraman et al., 2018; Sotelo et al., 2000; Céspedes et al., 2008; Pappalardo et al., 2018).

69 Paralichthys isoceles Paralichthys isoceles Paralichthys patagonicus/brasiliensis Paralichthys orbignianus

Paralichthys orbignianus Lim anda aspera Citharycthys spilopterus Citharycthys m acrops

Atheresthes stom ias Xystreurys spp. Pangasianodon hypophthalm us Etropus crossutus

Syacium spp. Bothus robinsi Pleuronectes spp. Lepidopsetta polixystra

Figure 2: RFLP fragment patterns (in the left, the bands pattern; in the right, densitograms) of each target group. The peaks marked with an asterisk are the molecular size standards.

Figure 3: Correlation between amplicons and densitograms of two example samples of the same species to illustrate the identification fragments size even in lower concentration.

MULTIPLEX PCR

70 A template sheet with 14 diagnostic patterns was developed (Figure 4). Ideally, in a multiplex PCR, a single amplicon should be observed for each interest group to differentiate it from the others. However, in some cases we observed the presence of unspecific bands, shared or not by different groups. This could be considered a problem for the development of diagnostic patterns, but it did not interfere with the identification because the specific bands were still present. In fact, the non-specific bands actually helped the identification, because sometimes they helped distinguish species whose diagnostic bands had similar sizes. In most cases, the amplicon size difference between groups was close to 50 base pairs (bp), which allowed a considering differentiation in 2% agarose (Catanese et al., 2010, Asensio et al., 2008). That differentiation was even clearer with a Quiaxel system (Qiagen inc) because of its higher resolution. However even without the Quiaxel system the patterns were easy to distinguish using a 3% agarose gel. Multiplex assays have been successfully used for the identification of 4 species of cooked bonito (10 primers), four shark species (5 primers) and five swordfish and billfish species (5 primers) (Lin & Hwang, 2008; Abercrombie et al., 2005; Hsieh et al., 2004). However, this is the first time when a multiplex assay is presented to simultaneously discriminate among 14 fish species (using 15 primers). In fact, the technical difficulties in developing multiplex systems for such wide range of organisms increase exponentially with the number of groups to be discriminated, because of complex interactions between primers sets and the need to find PCR conditions that are suitable to the whole group. The key factor in obtaining a higher chance of success, in this case, was the balance between primer concentration in the final reaction.

Figure 4: Multiplex amplicons patterns in each target group, with expected and real amplicons sizes.

Identification keys Aiming to improve both approaches success rate, we developed dichotomous key (Figure 5 and 6), which facilitated the identification both in terms of speed and consistency. There is no literature report of this kind of answer sheet, perhaps because most papers include only between 3 and 10 interest groups, which makes the identification process less complex (Xu et al., 2015; Pappalardo et al., 2018; Ferrito et al., 2016; Anjali et al., 2019). The tendency on identifications processes has been the replacement of simpler methodologies, such as Multiplex and RFLP, by direct sequencing of PCR products, because of its highest accuracy. However, sequencing of PCR fragments is still too expensive to be applied in large-scale control programs, where low cost and speed are essential characteristics. The approaches described here, particularly in relation to the implementation of dichotomous keys based on banding patterns, may facilitate their application in large scale identifications processes.

72 KEY TO IDENTIFICATION OF PCR RFLP AMPLICONS

1. Has an amplicon of 150 (140-150) bp. 2 Does not have an amplicon of 150 (140-150) bp. 3

2. Has an amplicon between 175 - 200 bp 4 Does not have an amplicon between 175 – 200 bp 5

3. Has 1-2 amplicons between 200 and 560 bp. 6 Does not have an amplicon between 200 and 560 bp. 7

4. Has only the previous amplicons Paralicthys brasiliensis or patagonicus Besides the previous amplicons, Paralicthys brasiliensis or patagonicus has only 3 amplicons between 25-50 bp. Besides the previous amplicons, has amplicons above 50 bp. 8

5. Has 2 amplicons between 60 – 100 bp. 9 Has 3 amplicons between 60 – 100 bp. Citharycthys macrops

6. Has amplicons between 75 – 100 bp. 10 Does not have amplicons between 75 – 100 bp. 14 Has 2 amplicons between 175 – 200 bp. 11

7. Has 1 amplicon between 175 – 500 bp Paralichthys isoceles Has only an amplicon of approximately 25-50 pb. Bothus robinsi Has 2 amplicons between 175 – 500 bp. 13

8. Does not have an amplicon of approximately 500-700 bp. 12 Has an amplicon of approximately 500-700 bp. Etropus microstomus and 2 amplicons between 25-50 bp.

9. Has 3 amplicons between 25 – 50 bp. Paralichthys isoceles Does not have 3 amplicons between 25 – 50 Pb. 13

10. Has an amplicon between 75- 100 bp. Closer of 100 bp. Pangasianodon hypophthalmus Has an amplicon between 75-100, closer to 75 bp. Etropus crossutus

11. The amplicons of approximately 175-200 bp. are almost indiscernible Lepidopsetta polyxystra The amplicons of approximately 175-200 bp. are separated Limanda aspera by a distance of an amplicon

12. Does not have an amplicon of approximately 100 (90-110) bp. Paralichthys orbignianus Has an amplicon of approximately 100 (90-110) bp. Citharycthys spilopterus

13. Has 1 amplicon above 160 bp. Atheresthes stomias Does not have 1 amplicon above 160 bp Xystreurys rasile

14. Has 1 amplicon between 100-130 bp. Syacium spp. Has 1 amplicon between 25-50 bp. Pleuronectes platessa Figure 5: Key for the identification of PCR RFLP banding patterns

73 KEY TO IDENTIFICATION OF PCR MULTIPLEX AMPLICONS

1. Has an amplicon of 600 bp. 2 Does not have an amplicon of 600 bp. 3

2. Has an amplicon between 400 – 500 bp. 4 Does not have an amplicon between 400 – 500 bp Paralichthys brasiliensis/ patagonicus

3. Has an amplicon between 400-500 bp. 5 Does not have an amplicon between 400 – 500 bp 6

4. Has an amplicon of 200 bp. and hasn’t an amplicon of 300 bp. Citharycthys spp. Has an amplicon of 300 bp and may Has an amplicon of 200 bp. Bothus robinsi Has an amplicon of 220-250 bp. Lepidopsetta polyxystra

5. Has only an amplicon of de 500 bp. Pangasianodon hypophthalmus Has only an amplicon of de 450 bp. Xystreurys spp. Has an amplicon of 400 bp. Limanda aspera

6. Has an amplicon between 100-200 bp. 8 Does not have an amplicon between 100 – 200 bp 9

7. Has an amplicon of 200 bp. and other of 350 bp. Paralichthys orbignianus Has an amplicon of 100 bp. and other of 320 bp. Pleuronectes spp.

8. Has an amplicon of 235 bp. and other of 325 bp. Etropus crossutus Has an amplicon of 382 bp. Syacium spp. Has an amplicon of 300 bp. Athesthes stomias Has an amplicon of 350 bp. Paralichthys isoceles

Figure 6: key to identification of PCR Multiplex Fragments

Comparison of the PCR based approaches

The blind test revealed that 85% (22 in 26 tests) of the samples could be identified correctly using the PCR/RFLP approach, and 71% (11 in 15 tests) in the multiplex approach. We found significant variation among answers that was correlated to being or not part of the scientific community (Table 3). Error rates in persons of the scientific community were much lower (5% in RFLP and 20% in multiplex), which could be related to a familiarization with dichotomous keys and identification of banding patterns. There was also a significant variation among species in relation to failure rates, that varied from 37% (RFLP) for Limanda aspera to zero in Pangasianodon hypophthalmus. In the blind tests the PCR RFLP had higher success identification rates when compared to Multiplex. According to the participants, the RFLP answer sheet by densitograms may be the explanation of this difference, since that format enabled the visualization of the exact size of bands. The similar patterns

74 observed between many species in the PCR Multiplex results also may be a factor for their lower success rates, because some amplicons had similar sizes which would not be a problem if higher resolution densitograms had been used. The RFLP PCR banding patterns, in fact, had a higher variability and complexity than the multiplex ones which, in theory, would make the identification process harder than in the multiplex system. However, the result observed indicate that low variability in species patterns may difficult species identification. There are no reports of comparation of those sequencing-free PCR based techniques for fish identification. The papers on grouper species, for example, used both the methodologies, but the multiplex assay was able to identify only 2 species and the RFLP 6 (Anjali et al., 2019; Asensio, 2008). Many other multiplex studies also present a smaller number of target groups than RFLP based ones. This can be attributed to the complexity of elaborating a simultaneous assay with a large number of primers. However, once developed and improved, the Multiplex may become a method of choice, because of its lower cost and faster identification, in one only reaction. Clearly the multiplex method still needs some improving, and it may become more effective using higher resolution systems, like the QiaXcel used for the RFLP analyses.

Hit percentual Answer sheet Hit percentual Answer sheet Education level Study area RFLP used Multiplex used

Higher level Biologica sciences 100% All available - Patterns and All available Higher level Biologica sciences 100% densitograms 80% Higher level Arts 65% All available - Higher level Law 77% All avaiable - Higher level Biologica sciences 96% Identification Key - Medium level - 89% All available 80% Bands pattern Higher level Biologica sciences 92% Identification Key - Higher level International Relations 77% All avaiable - Higher level International Relations 61% All avaiable - Higher level Biologica sciences 81% 81% - Higher level Advertisement 61% All avaiable - Higher level Biologica sciences 89% All avaiable 74% All available Higher level Arquiteture 89% All available All available Identification Key Higher level Biological sciences - 87% All available Higher level Law 74% All available Higher level Biological sciences 92% All available - Higher level Biological sciences 92% All available - Higher level Biological sciences 92% All available All available Higher level Biological sciences 92% Identification Key - Higher level Biological sciences 92% Identification Key - Higher level Biological sciences 67% All available Higher level Biological sciences 92% Identification Key - Table 3: Correlation between the Education level, study area, and both percent hits and answer sheets used.

75 Both sequencing-free methods were very robust to variation in DNA quality. In other words, both did not seem to be affected by the type of processing, allowing the identification of raw, frozen, cooked and deep-fried samples. Multiplex PCR has the advantage of being quicker to perform, while RFLP PCR is more easily expandable, in relation to the inclusion of new target groups (Li et al., 2019; Rasmussen & Morrissey, 2008; Ali et al., 2013). Based on the results obtained here, and the blind tests performed, we believe that the most reliable current approach is RFLP.

Sequencing-free approaches for fish fraud control Currently, the gold standard for forensic analysis of seafood is DNA sequencing (also called the Forensically Informative Nucleotide Sequencing – FINS for short - approach), usually of mitochondrial DNA genes, mostly because of its simplicity, high accuracy and reproducibility. Indeed, in seafood forensic identification the error rates must be as small as possible, because of the huge and direct consequences of forensic identification, that may be result in legal social and individual consequences. In Brazil, the only method used by public and private inspections institutions for seafood fraud identification has been the FINS approach (Carvalho et al., 2015, Carvalho et al., 2017). One important drawback of this methodology, however, is its cost, which may limit its application in larger scales. For example, the only regular large-scale seafood authenticity inspections performed by the Government occur only once a year in Brazil (just before of holy-Friday, where traditionally the population consume large amounts of fish, and when fish-fraud may be more frequent, although this hypothesis has not been tested so far). In countries where resources for sea-food control are limited, using only FINS can mean reducing the frequency or the geographic coverage of inspections. It is at this point that the sequencing-free based techniques (RFLP and Multiplex) can make a difference. In the flounder assay methods developed here, identifications could be performed at half reagent costs than using FINS. In the case studied, with one-step RFLP, and 15 primers multiplex, costs per sample (post-DNA extraction, and considering a batch of 200 samples) were U$ 6.5 for FINS, U$ 2.50 for PCR-RFLP and U$ 2 for multiplex PCR. The fastest approach was multiplex PCR (turnaround time, after DNA extraction, of about 4 hours), and the slowest was FINS (at least 2 days).

CONCLUSION The PCR/RFLP and Multiplex approaches can be performed in basic molecular labs, without the need for sequencing facilities, and are faster and cheaper than FINS. We believe that the sequencing-free approaches developed here will help to expand fraud detection capability, particularly away from the big centers. This means that the methods will help control fraud more regularly in Brazil and in other developing countries. Thanks to the European inspection system, seafood fraud has been decreasing,

76 going from almost 25% before 2011 to 15% in 2014 (OCEANA, Warner et al., 2016). The application of sequencing-free methods, like the one described here, will help achieve similar goals in countries with lower resources for seafood commerce control.

SUPLEMENTARY MATERIAL

1 2 3 4 5 6 7 8

600 500 400 300 200 100 9 10 11 12 13 14 15

600 500 400 600 300 500 400 600 300 200 500 400 200 300 100 200 100 100

Annex I: Test samples presence and absence patterns used in the Multiplex Blind test.

77 6 5 2 2 5 6 2 2 1 4 2 3 2 2 2 2 1 4 2 3 2 2 2 2 0 9 7 8 2 1 1 1 0 9 2 8 7 1 1 1

6 5 1 4 3 3 1 4 1 1 1 1 . p p s

s y r u e r t s y X 6 5 1 4 4 3 3 1 1 1 1

2 0 9 1 1 1 1 2 0 1 9 1 1 1 8 8 7 6 5

8 8 5 6

p p

0 9 4 3 4 1 2 3 2 1 4

AnnexTestII:samples patters and densitograms, that were used in the RFLPBlind test.

78 6 5 2

5 6 2 2 1 4 2 3 2 2 2 2 1 4 2 3 2 2 2 2 0 9 7 8 2 1 1 1 0 9 2 8 7 1 1

1 Annex II: TestII:Annex samples pattersand densitograms, thatwereused in the RFLP Blind test.

5 1 4 3 3 1 4 1 1 1 1 . p p s

s y r u e r t s y X

6 5 1 4 4 3 3 1 1 1 1 1

79 2 0 9 1 1 1 1 2 0 1 9 1 1 1 8 8 7 6 5

8 8 5 6

p p

0 9 4 3 4 1 2 3 2 1 4 Annex III: The file, READ-ME, with instructions for the application of the RFLP blind tests. Instructions to RFLP blind test Application

Introduction

Fish is currently the most consumed animal protein worldwide, and research aimed at improving the quality of its production and distribution is more and more frequent. The following test is part of a master's thesis that has as its central theme the identification of fish marketed as “Flounder” in Rio de Janeiro. By identifying the species of the fish, we can establish whether fraud is occurring, how often and with what species, thus helping the entire investigation process by fish inspection bodies. The RFLP test is a method based on breaking the DNA molecule into a specific part, generating several fragments of different sizes in each species, enabling its identification. Imagine the DNA molecule as a colored ribbon with a different color combination for each species. If these ribbons are cut only in red, each species can be identified by the different sizes of the generated pieces.

Your participation will be essential for us to verify the effectiveness of the methodology by employing people from different types of training. The test is blind, meaning you shouldn't talk or ask anybody any questions. You should take the test (ie, identify the 26 samples from files 3, filling out spreadsheet 5, without any help. Thanks in advance for your collaboration: it will be very useful for us to improve a methodology that will be socially important for the control marketing of fish in Brazil. You are receiving 5 files:

File 1: Band Patterns and Peak Template

File 2: Dichotomous Key

File 3: Application of the test

File 4: Excel spreadsheet for answers to IDs

File 5: Questionnaire on the use of templates

File 1 contains templates that can be used for identification. They show how to identify each species using RFLP standards, based on two types of data: a) photo of the gel and the intensity of the peaks of the same individuals. To facilitate identification, we also present a dichotomous key (file 2). File 4 shows the samples that you must identify. You must note your conclusion about which species corresponds to each sample in the Excel file (file 5), in the position corresponding to its identification number. Finally, we would like to hear from you about the difficulties you had with these

80 identifications, what kind of data (band or peak pattern) was most useful, or any other comments you want to make.

To read the type 1 template, see that each column (marked in yellow rectangle in the figure below) corresponds to a sample or species. Each band (black lines horizontally) corresponds to a DNA fragment of the individual. The left column indicates the sizes of the fragments, ignore the red bands: they are internal standards of the technique that should not be used.

e u

s s s l

a u u a

s s r s

n n h

p s t

e e .

b a t

l l s

a a i

o u

i i t .

p a

h i

e e / r t y

n n p p s

c c s c m p x

p i

s l

g g o p n

o o u s

a o

i i l i

i t s

s s c s o

i i i p s

b b b s

o e

s p

r r

s s o a

s r t

s y

o o r

h m

y y o c a

M e

s y M

s s

u s e

h h g

u s

P y h n i t

h P

t t

y y

t u n

a t e c

u e

h o

h h t s r

h h c

t h o s

t d

c c t t

e t r a

a c y

i i

y p

l l r o

r o

h h

y o u

r S

y o

e m

a a c c r

a n

t e i

i i B

r r s l

l l X d

a L

h a i

y t i

a a P

a a t

i E p

r r

P P t A

i e

t C

a a

P P

i n

r P

To read the type 2 template, see that each line (marked in red rectangle in the figure below) corresponds to a sample or species. In this case, what you see are peaks, which correspond to the intensity of the bands of each fragment of DNA. The peaks corresponding to the largest bands (which are at the top in template 1) are to the right in template 2. Note also that the most intense bands in template 1 correspond to the highest peaks in template 2.

Paralichthys isoceles Paralichthys isoceles Paralichthys patag onicus/brasiliensis Paralichthys orb ig nianus

Paralichthys orbignianus Lim an da a sp era C itharycthys spilopterus C itharycthys m acrops

Atheresthes stom ias Xystreurys spp. Pang asian odon hyp ophthalm us Etropus cro ssutus

Syacium spp. B oth us robinsi Pleuro nectes spp. Lepidopsetta polixystra

You can identify the samples directly by comparing the band and peak patterns of each sample with the images in the types 1 and 2 templates (File1). However, if you prefer, you can also use a decision

81 key (also known as a “dichotomous key”), in which you follow a path based on the answers to each question. It is a legal way to guide your decision when identifying samples. The key is shown below:

82 LET'S PRACTICE: See the first individual on the gel below and its corresponding peaks

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

It has two red bands, one size 1000 (above) and one size 25 (below). As we said, they are the quality control standards of the gel, and should not be used in identification. The other bands observed, in this case, are one of approximately 550 and the other between 25 and 50 (weak). This can be confirmed by looking at the peak intensity (peak template, file 2, useful to see the weaker bands as well). Now look at templates 1 and 2, and try to see which species have these same peaks (accept some small variations, as each gel can be slightly different from the others. What matters is the set - or pattern - of peaks). You will see that the closest pattern is that of Pleuronectes platessa. If you prefer to use the dichotomous key, the path will be: Does not have a band of 150…...... 3

3- It has 1-2 bands of 200 to 200 Pb… ...... 6

6- There are no bands between 75 - 100 Pb ...... 14

14- It has 1 band between 25-50 bp ...... Pleuronectes platessa

Ready!

Now you should go to the Excel spreadsheet and put a cross, indicating individual 1 as Pleuronectes platessa.

83 IV. Discussão

No total de amostras analisadas, 52% do pescado comercializado como linguado no município do Rio de Janeiro se mostrou ser de fato substitutos ilegais. O peixe mais utilizado em tais erros de rotulagem foi Pangasionodon hypophthalmus, seguida de Xystreurys rasile representando respectivamente 75 e 17% das amostras substituídas. Dentro da cadeia de produção de linguado, os restaurantes e supermercados representam os extremos maior e menor em percentual de substituições com diferenças drásticas também na composição taxonômica. Considerando o total de amostras, nenhuma correlação pode ser encontrada entre preço e substituições, dentro de cada etapa da cadeia de substituição, entretanto os resultados foram diferentes. Em peixarias e restaurantes a média de preço de amostras autenticas é maior do que a das substituídas, indicando uma correlação entre substituições e preço baixo em tais categorias. Já em feiras, observou-se o oposto, a média de preço de amostras autênticas é menor que a das substituídas o que por sua vez indica uma relação entre preço alto e substituições na categoria. Em relação a Instrução normativa número 29, um padrão se repete, onde a amostragem total não reflete alguns padrões encontrados dentro de cada categoria de cadeia de produção. Ao observarmos a porcentagem total de substituições nos períodos anterior e posterior á regulamentação, um aparente aumento é observado. Entretanto, em supermercados, onde a amostragem permitiu uma comparação com suporte estatístico, a esperada queda nos casos de substituição pôde então ser visualizada. Diversos fatores podem causar essa discrepância entre o aumento ou diminuição da taxa de substituição, observados em cada uma das categorias, desde o N amostral até a eficiência das medidas de fiscalização que de fato é distinta dentro da cadeia de produção. Uma vez identificadas as espécies mais utilizadas em substituições de linguado, a prevalência na cadeia de produção bem como a relação entre as substituições, regulamentação e fiscalizações, é possível estabelecer metodologias de baixo custo e tempo. Tais metodologias de identificação mais eficientes possibilitariam, portanto, a fiscalização mais eficiente em todas as etapas da cadeia de comercialização e por fim a coibição da prática de substituições. Tal finalidade traria consequências que impactariam no manejo e conservação dos Linguados brasileiros. Os marcadores moleculares utilizados no trabalho (COI e Cytb) se mostraram eficientes na identificação de espécies de pescado comercializadas como linguado. A identidade inicial obtida por sequenciamento através da ferramenta BLAST muitas vezes apresentou diferenças em relação àquela obtida pela análise filogenética. Tal diferença foi maior com sequencias do gene Cytb do que do COI. Isso provavelmente reflete a menor abrangência, para peixes brasileiros, de sequências de citocromo b em relação ao COI devido ao banco de dados da Fish Barcode of Life Initiative (FISH-BOL). Tal iniciativa foi a principal responsável pela cobertura de COI para 25% de todos os peixes conhecidos,

84 enquanto Cytb, com uma taxa de crescimento mais lenta apresenta 15% de cobertura taxonômica. Sempre que houve discordância entre as abordagens BLAST e filogenia, optamos pela identificação pela posição nas árvores filogenéticas, pois o posicionamento reflete de maneira mais adequada a taxonomia e é menos sujeito a problemas de amostragem no banco de dados. Na análise por BLAST, a sequência identificada será aquela mais semelhante a aquelas presentes no banco de dados, mesmo quando a espécie alvo não está presente ali. Na análise filogenética, o posicionamento na árvore em relação às espécies mais próximas indica se o indivíduo pertence ou não ao grupo, pelas relações de parafilia que ocorrem quando a espécie está ausente no banco de dados. Tais casos se repetiram com 20 amostras, como por exemplo DA192 que, através da identificação por BLAST baseada em sequencias de COI foi identificada como Paralichthys isoceles com 99% de similaridade, enquanto na

árvore filogenética a identidade obtida foi Xystreurys rasile (Figura 9). O uso do BLAST, por outro 6

lado, se justifica ao indicar que espécies mais próximas devem ser selecionadas para a análise /

6 filogenética, e permitir uma atribuição de probabilidade de exclusão, quando concordante com o 9

1 /

1 8

0 resultado da análise filogenética. 8

8 1

. /

4 9

/ 9

Identidade por BLAST Identidade por árvore Filogenética .

D R D D D D D D

D D

A F A A A A A A A A

0 1

0 1 0 0 1 1 1 2

n o

S S

M G

5 6 7 7 3 4 3

y y

4 3 6 9 1 6 5

0 e

a a

P X

G P

0 r

s g

c c

a y

1 p

i i

u u

D D D D

O G

G L

m m

L r

A A A A

p s

r r

r m

1 1 1 0

p g

h (

(

r N

7 8 9 8 8

a u

1 i

h H

t u

N h

(

n u

5 5 9 2

p n

(

u (

(

i t

p s

)

c d

G D P D D

6 e

s (

)

(

2 s

) r

A A A

(

)

P i

(

i 5

2 1 2

(

)

l a )

(

y r

( t

3 5 4

(

G i

(

p s

1 s

o 7

3 c 2 0

)

t =

(

)

t h =

)

1 l

)

P t

r 1

)

(

u a

3 l

) b

p ( )

(

( e

)

N t

s H

u K

)

a )

(

l 9

n P

N 1

E 0

(

)

(

)

9 s

)

i 0

2 a

)

G =

2 t

)

5 5

)

( 9

6 |

U e

)

(

5 3

8 8

)

(

( N

(

G 6

( 0

)

= U

)

E (

1 F

N 6

7 K

5 M

7 Y

)

| G

3 R

Figura 9: Esquema representativo da incongruência entre as Identidades da2 Amostra DA192, obtidas

5 por BLAST e reconstrução filogenética. Tal divergência ilustra a necessidade da reconstrução filogenética na obtenção de uma identidade molecular acurada.

Apesar da limitação clara no uso exclusivo do BLAST, em diversos trabalhos de identificação molecular essa é a única ferramenta utilizada para a determinação de identidade, o que poderia gerar uma série de erros que venham a afetar a confiabilidade dos dados (Do et al., 2019; Shehata et al., 2019; Horreo et al., 2019). A taxa de divergência entre as identificações por ambas as ferramentas consequentemente se reflete nas taxas de substituições encontradas, com respectivamente 63 e 52%

85 por similaridade e reconstrução filogenética (Becker et al., 2011). Em outras palavras, utilizar somente a identidade por similaridade inflaciona as taxas de substituição encontradas. Considerando toda a diversidade de pescados, a taxa de 50% de substituições observada está dentro da média mundial, enquanto que dentro do grupo de linguados, o percentual de substituição que observamos foi superior à faixa de valores mundial, que se mantem entre 20 e 50% (Naaum & Hanner, 2015, Kappel & Schrö der, 2016, Carvalho et al., 2015; Pardo et al., 2018). Do total de 8 (Figura 10) espécies utilizadas como substitutas, a maior taxa de ocorrência foi de Pangasionodon hypophthalmus, que obteve destaque sendo responsável por 61% dos casos. Conhecido popularmente como Panga, esse bagre asiático é amplamente documentado em casos de substituição de linguado e outros pescados por todo o mundo. Acredita-se que tamanha ocorrência seja devida a sua disponibilidade constante e baixo custo. Por ser de origem de cultivo, a substituição de espécies por panga pode representar uma ameaça à saúde pública, por poder conter agrotóxicos ou pesticidas (Triantafyllidis et al., 2010; Chatterjee et al., 2015; Ebo et al., 2010; Srivastava et al., 2014). O segundo pescado mais utilizado nas substituições, Xystreuris rasile, apresenta um panorama distinto, onde sua utilização não se justifica monetariamente, já que possui preço de mercado semelhante ao linguado (Fabre & Diaź de Astarloa, 2001; Diaź de Astarloa, 2002), ou seja, é mais provável que a substituição não seja intencional ou fraudulenta, representando apenas um erro de rotulagem. O restante das espécies encontradas, em baixa proporção, podem representar tendências futuras no cenário de substituições, refletindo ao mesmo tempo o caráter oportunista da atividade.

86 Linguados foram substituídos por:

Alabote Dente Curvo Pescada Amarela Panga Corvina M erluza 30 % 10 % 20 % 30 % 10 %

21% 10% 6715 % 0% 1 %

3% 12% 3117 %% 1%

Tam boriu Linguado PePsceadixae b rpanocraco Tilápia (Xystraurys spp.)

Figura 10: Pescados que são encontrados em substituições de Linguado no Brasil, tanto na literatura prévia, quanto no presente trabalho, e suas proporções no senário de substituição nacional com ou sem os dados aqui apresentados.

Através do levantamento inicial do espectro de espécies utilizadas em substituições, foi possível o desenvolvimento de testes de identificação rápidos e de baixo custo, visando sua aplicabilidade em larga escala. Fiscalizações no nível nacional, como a conhecida “Operação Semana Santa”, ocorrem apenas uma vez ao ano e sempre em datas pré-estabelecidas e conhecidas por quem trabalha com comercialização pesqueira (MAPA, 2019). De acordo com tais dados, as substituições de pescado teriam reduzido em mais de 10% em relação ao ano anterior, porém é difícil determinar se isso não é

87 apenas um artefato de tal investigação concentrada em apenas uma operação pontual ao ano (MAPA, 2019). Logo, para que se tenha uma ideia real do panorama de substituições, são necessárias ferramentas moleculares que possibilitem sua realização em diversas ocasiões ao ano. Com tal propósito, as metodologias baseadas em PCR-RFLP e Multiplex foram desenvolvidas e se mostraram eficientes, para identificar as espécies levantadas anteriormente. Em comparação com o sequenciamento, a metodologia de PCR-RFLP mostrou uma maior aplicabilidade na utilização forênsica pesqueira de larga escala, uma vez que possui custo reduzido e acurácia semelhante ao sequenciamento, com uma maior eficiência por apresentar tempo de execução e custo de até duas vezes menor. Até o momento, a única metodologia aplicada a fiscalização pesqueira no Brasil é o sequenciamento, o que explica sua baixa ocorrência devido ao elevado custo de tal metodologia no mercado nacional (Carvalho et al., 2017). Porém, com a possível aplicação de metodologias PCR- RFLP, tal panorama poderá se modificar e a coibição das substituições poderia ser alçada em menos tempo, com uma melhor eficiência. A informação sobre o local de prevalência das substituições é importante para que as fiscalizações de rotulagem possam focar onde elas são mais comuns, ou seja, saber onde há um maior número de ocorrências é ter o poder de agir através de medidas inibitivas onde de fato se concentra o problema. Dentro da cadeia de produção de linguados, os restaurantes e feiras se destacaram por serem responsáveis respectivamente por 82% e 61% dos casos de substituição, panorama este já descrito na literatura para outros grupos de pescados como merluzas (Muñoz-Colmenero et al., 2016). Entretanto tal distribuição nas taxas de erro de rotulagem não é comum, estando a concentração de substituições nos níveis mais altos de processamento como restaurantes e cantinas, na maioria dos casos (Shehata et al., 2019; Crego-Prieto et al., 2012; Kappel & Schoder, 2016; Muñoz-Colmenero et al., 2015). O padrão prevalente de substituições nas extremidades da cadeia de produção não pode ser totalmente explicado pelo aumento no nível de complexidade na maioria das espécies de peixes, uma vez que em feiras os pescados se encontram em um dos níveis mais basais de processamento. No entanto, a comercialização dos linguados em feiras é diferente da maioria das outras espécies de peixes, pois raramente são vendidos na forma de peixes inteiros. Consequentemente, a taxa de substituição na base da cadeia em linguados não precisa ser diferente daquela em outros níveis, pois todos, como consequência do nível alto de processamento, acabam sendo sujeitos ao mesmo tipo de substituição (Figura 11).

Figura 11: Fotos de coletas onde é evidente que muitos grupos pesqueiros são comercializados inteiros, enquanto todos os linguados são expostos ao consumidor de forma de filés. No canto inferior esquerdo vemos o resto do pescado após o processamento e a direita o suposto produto de sua filetagem. Em relação ao período anterior à IN 29, a taxa de substituição de linguados aparenta ter aumentado, com foco no crescimento da utilização de Pangasianodon hypophthalmus, uma vez que este foi o principal pescado utilizado. Entretanto, considerando somente os supermercados, onde nossa amostragem foi substancial (já que o número de amostras coletadas nos períodos pré e pós IN 29, é o mais próximo de igualdade dentre as categorias), observamos que as substituições diminuíram. Outro fator que pode ter contribuído para o aparente aumento nos casos de fraude é justamente a ausência de fiscalizações constantes, uma vez que a regulamentação sem a fiscalização se mostra ineficiente. Logo, mais uma vez a aplicação de técnicas de identificação rápidas e de baixo custo fariam a diferença na análise de substituições. Ao analisarmos também a diversidade de espécies utilizadas nas substituições em relação IN 29, observamos um aumento na diversidade após o período de validação da regulamentação o que, segundo o único estudo comparativo na literatura, pode ser explicado pelo aumento na globalização do mercado de pescados (Mansfield, 2003; Muñoz-Colmenero et al., 2015). Tal globalização teria possibilitado um maior acesso a pescados de baixo custo importados de outros

89 países e sua consequente utilização em substituições o que, antes de 2015, não seria uma realidade no Brasil. Diversos casos de investigação de autenticidade pesqueira tentam estabelecer uma relação entre o preço cobrado pelo produto e a probabilidade de que o mesmo tenha sido substituído (Ardura et al., 2010; Bénard-capelle et al., 2015; Cawthorn & Hoffman 2017; Munoz-Colmenero et al., 2016; Wang & Hsieh 2016; Gordoa et al., 2017; Xiong et al., 2016; Donlan & Luque, 2019). Em uma meta análise considerando diversos estudos anteriores, não foi encontrada no geral uma relação entre preço e substituições (Donlan & Luque, 2019). Isso foi semelhante ao observado no caso dos linguados brasileiros, onde a média de preço entre um pescado substituto e um linguado legítimo é a mesma. Tal panorama indica que não há a correlação entre uma maior probabilidade de um pescado comercializado como linguado ser substituído e seu preço de venda. Entretanto, ao analisarmos o preço através da comparação par-a-par do preço de cada individuo com o da espécie substituta, foi possível observar que em amostras de restaurantes se encontra uma diferença entre 12 e 14 dólares. Isso fundamentalmente significa que, em restaurantes, a diferença entre o preço cobrado e o preço que o peixe de fato custa é maior e, portanto, o dano monetário ao consumidor também é mais acentuado. Na contramão dos restaurantes se encontram os supermercados, onde os pescados substituídos se concentrem baixas diferenças de valores negativos, num máximo de sete dólares, podendo indicar uma substituição não intencional. Todos os resultados e debates na literatura nos levam a crer que a problemática das substituições de linguados é uma questão em emergência, apesar de grande esforço em direção ao seu controle. A necessidade de trabalhos de levantamento e desenvolvimento de metodologias moleculares de identificação se mostram essenciais em tal panorama, visando criar ferramentas de fiscalização e controle efetivo de substituições. Esse levantamento base também não pode ser interpretado como um evento único, uma vez que o espectro de espécies utilizadas em substituições é extremamente fluido. Portanto, são necessárias revisões constantes, sempre visando o aperfeiçoamento das técnicas de identificação e inclusão de novas espécies quando necessário. Com metodologias atualizadas, eficientes e fiscalizações constantes o controle de autenticação de rotulagem poderá observar uma diminuição real nas taxas de substituição e não apenas artefatos, ou dados insuficientes para conclusões claras. Esta dissertação visa, portanto, contribuir para isso, tanto pela estimativa que apresentei sobre a prevalência das substituições como pelas metodologias que desenvolvemos para permitir, pelo custo reduzido em reagentes e tempo que permitirá um acompanhamento mais frequente da comercialização dos linguados no Brasil.

90 V. Referências

Abercrombie, D. L., Clarke, S. C. & Shivji, M. S. (2005). Global-scale genetic identification of hammerhead sharks: Application to assessment of the international fin trade and law enforcement. Conserv. Genet. 6, 775–788.

Ali, M. E., Razzak, M. A. & Hamid, S. B. A. (2014). Multiplex PCR in Species Authentication: Probability and Prospects—A Review. Food Anal. Methods 7, 1933–1949.

Almerón-Souza, F., Sperb C., Castilho C. L., Figueiredo P. I. C. C., Gonç alves, L. T., Machado R., Oliveira L. R., Valiati V. H., Fagundes, N. J. R. (2018). Molecular identification of shark meat from local markets in Southern Brazil based on DNA barcoding: Evidence for mislabeling and trade of endangered species. Front. Genet. 9, 1–12.

Anjali, K. M., Mandala, A., Gunalanb, B., Rubana, L., Anandajothia, E., Thineshsanthara, D., Manojkumara, T.G., Kandan, S. (2019). Identification of six grouper species under the genus Epinephelus (Bloch, 1793) from Indian waters using PCR-RFLP of cytochrome c oxidase I (COI) gene fragment. Food Control 101, 39–44.

Ardura A., Planes S., Garcia-Vazquez E. (2013). Applications of DNA barcoding to fish landings: authentication and diversity assessment. Zookeys 365, 49–65.

Armani, A., Castigliego, L., Tinacc, L., Gandini, G., Gianfaldoni., D., Guidi, G. (2012).A rapid PCR- RFLP method for the identification of Lophius species. Eur. Food Res. Technol. 235, 253–263.

Asensio, G. L. (2007). PCR-based methods for fish and fishery products authentication. Trends Food Sci. Technol. 18, 558–566. Asensio, G. L. (2008). Application of multiplex PCR for the identification of grouper meals in the restaurant industry. Food Control 19, 1096–1099.

Astarloa, J. M. D. de, Munroe, T. A., Béarez, P., Gonzalez-Castro, M. & Castellini, D. L. (2018). External morphology, postcranial and appendicular osteology of three southwestern Atlantic flatfishes (Paralichthys, Paralichthyidae), and comparisons with other congeneric species. Neotrop. Ichthyol. 16, 1–21.

Barbosa, M.J. (2015). Fraudaç ão na comercializaç ão do pescado. Acta Fish. Aquat. Res., 3(2): 89-99. Barone, R. S. C., Lorenz, E. K., Sonoda, D. Y. & Cyrino, J. E. P. (2017). Fish and fishery products trade in Brazil, 2005 to 2015: A review of available data and trends. Sci. Agric. 74, 417–424.

Bartllet S.E. & Davidson W.S. (1992). FINS (forensically informative nucleotide sequencing): a procedure for identifying the animal origin of biological specimens. Biotechniques 12, 408-411.

Becker, S., Hanner, R., & Steinke, D. (2011). Five years of FISH-BOL: Brief status report. Mitochondrial DNA 22, 3–9.

Bénard-capelle J, Guillonneau V, Nouvian C, Fournier N, LE loë t K, Dettai A. (2015) Fish mislabelling in France: substitution rates and retail types. Peer Journal, 2: e 714.

Bernatchez, L., Wellenreuther, M., Araneda, C., Ashton, D. T., Barth,J. M. M., Beacham, T. D., Maes, G. E., Martinsohn, J. T., Miller, K. M., Naish,K. A., Ovenden,J. R., Primmer, C. R., Suk, H. Y.,

91 Therkildsen, N. O., Withler, R. E. (2017). Harnessing the Power of Genomics to Secure the Future of Seafood. Trends Ecol. Evol. 32, 665–680.

Boletim Estatístico da Pesca e Aquicultura. REPÚBLICA FEDERATIVA DO BRASIL Presidenta Dilma Vana Rousseff. Bol. Estatístico Da Pesca E Aquicultura 2011 1–60 (2011) doi:10.1007/s12032- 011-9855-6.

Borgo, R., Souty-Grosset, C., Bouchon, D. & Gomot, L. (1996). An Hypothesis Paper PCR-RFLP Analysis of Mitochondrial DNA for Identification of Snail Meat Species INTRODUCTION. J. Food Sci. 61, 1–4.

Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Manual de inspeç ão para identificaç ão de espécies de peixes e valores indicativos de substituiç ões em produtos da pesca e aquicultura / Secretaria de Defesa Agropecuária. – Brasiliá : MAPA, 2016.188 p.

Brito, M. A. de, de Brito, M. A., Schneider, H., Sampaio, I., & Santos, S. (2015). DNA barcoding reveals high substitution rate and mislabeling in croaker fillets (Sciaenidae) marketed in Brazil: The case of “pescada branca” (Cynoscion leiarchus and Plagioscion squamosissimus). In Food Research International 70, 40–46.

But, G. W. C., Wu, H. Y. & Shaw, P. C. (2019). Identification of fish species of sushi products in Hong Kong. Food Control 98, 164–173.

Calegari, B. B., Reis, R. E. & Alho, C. S. (2019). DNA barcode identification of shark fillet reveals fraudulent commerce in Brazil. J. Can. Soc. Forensic Sci. 52, 95–100.

Carvalho D. C., Oliveira D. A.A., Pompeu P. S., Leal C. G., Oliveira C., Hanner R. (2011). Deep barcode divergence in Brazilian freshwater fishes—the case of the Sa ̃o Francisco river basin. Mitochondrial DNA 22, 97–105.

Carvalho, D. C., Guedes, D., da Gloria Trindade, M., Coelho, R. M. S. & de Lima Araujo, P. H. (2017). Nationwide Brazilian governmental forensic programme reveals seafood mislabelling trends and rates using DNA barcoding. Fish. Res. 191, 30–35.

Carvalho, D. C., Neto, D. A. P., Brasil, B. S. A. F. & Oliveira, D. A. A. (2011). DNA barcoding unveils a high rate of mislabeling in a commercial freshwater catfish from Brazil. Mitochondrial DNA 22, 97– 105.

Carvalho, D. C., Palhares, R. M., Drummond, M. G. & Frigo, T. B. (2015). DNA Barcoding identification of commercialized seafood in South Brazil: A governmental regulatory forensic program. Food Control 50, 784–788.

Carvalho, D. C., Palhares, R. M., Drummond, M. G. & Gadanho, M. (2017).Food metagenomics: Next generation sequencing identifies species mixtures and mislabeling within highly processed cod products. Food Control 80, 183–186.

Catanese, G., Manchado, M., Fernández-Trujillo, A. & Infante, C. (2010) A multiplex-PCR assay for the authentication of mackerels of the genus Scomber in processed fish products. Food Chem. 122, 319–326.

92 Cawthorn, D. M., Baillie, C. & Mariani, S. (2018). Generic names and mislabeling conceal high species diversity in global fisheries markets. Conserv. Lett. 11, 1–12.

Cawthorn, D. M., Duncan, J., Kastern, C., Francis, J. & Hoffman, L. C. (2015). Fish species substitution and misnaming in South Africa: An economic, safety and sustainability conundrum revisited. Food Chem. 185, 165–181.

Cawthorn, D. M., Steinman, H. A. & Witthuhn, R. C. (2012). Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa. Gene 491, 40–48.

Cawthorn, D.M., Duncan, J., Kastern, C., Francis, J., & Hoffman, L. C. (2015). Fish species substitution and misnaming in South Africa: An economic, safety and sustainability conundrum revisited. Food Chemistry 185, 165-181.

Céspedes, A., Garcia,́ T., Carrera, E., González, I., Sanz,B., Hernández, P. E., Martin,́ R. (2008).Identification of Flatfish Species Using Polymerase Chain Reaction (PCR) Amplification and Restriction Analysis of the Cytochrome b Gene. J. Food Sci. 63, 206–209.

Chatterjee, N. S., Banerjee, K., Utture, S., Kamble, N., Rao, B. M., Panda, S. K., & Mathew, S. (2016). Assessment of polyaromatic hydrocarbons and pesticide residues in domestic and imported pangasius (Pangasianodon hypophthalmus) fish in India. Journal of the Science of Food and Agriculture, 96(7), 2373–2377. https://doi.org/10.1002/jsfa.7352

Chen, C.-H., Hsieh, C.-H., & Hwang, D.-F. (2013). PCR-RFLP analysis using capillary electrophoresis for species identification of Cyprinidae-related products. In Food Control (Vol. 33, Issue 2, pp. 477–483).

Chen, S., Peng, X., Lin, S. & Xu, Q. (2018). Identification of Plectropomus leopardus, Promicrops lanceolatus and Cromileptes altivelis using species-specific TaqMan real-time PCR. Food Control 84, 408–412.

Christiansen, H., Fournier, N., Hellemans, B. & Volckaert, F. A. M. (2018). Seafood substitution and mislabeling in Brussels’ restaurants and canteens. Food Control 85, 66–75.

Crego-Prieto, V., Campo, D., Perez, J., Martinez, J.L., Garcia-Vazquez, E., Roca, A.(2012) Inaccurate labelling detected at landings and markets: the case of European megrims, Fish. Res. 129, 106–109.

De Astarloa, J. M. D. & Munroe, T. A. (1998). Systematics, distribution and ecology of commercially important paralichthyid flounders occurring in Argentinean-Uruguayan waters (Paralichthys, Paralichthyidae): an overview. J. Sea Res. 39, 1–9.

De Brito, M. A., Schneider, H., Sampaio, I. & Santos, S. (2015). DNA barcoding reveals high substitution rate and mislabeling in croaker fillets (Sciaenidae) marketed in Brazil: The case of ‘pescada branca’ (Cynoscion leiarchus and Plagioscion squamosissimus). Food Res. Int. 70, 40–46.

Delpiani, G., Delpiania, S.M., Deli Antonib, M.Y., Covatti Aleb, M., Fischerb, L., Luciforac, L.O., Diaź de Astarloa, J.M. (2020). Are we sure we eat what we buy? Fish mislabelling in Buenos Aires province, the largest sea food market in Argentina. Fish. Res. 221, 105373.

93 Di Pinto, A. et al. Mottola, A., Marchetti, P., Bottaro, M., Terio, V., Bozzo, G., Bonerba, E., Ceci, E., Tantillo, G. (2016). Packaged frozen fishery products: Species identification, mislabeling occurrence and legislative implications. Food Chem. 194, 279–283.

Diaź de Astarloa, J. M. (2002). A review of the flatfish fisheries of the south Atlantic Ocean. Revista de Biologiá Marina y Oceanografiá 37, 113–125.

Do, T. D., Choi, T. J., Kim, J. I., An, H. E., Park, Y. J., Karagozlu, M. Z., Kim, C. B. (2019). Assessment of marine fish mislabeling in South Korea’s markets by DNA barcoding. Food Control 100, 53–57.

Donlan, C. J. & Luque, M. G. (2019). Exploring the causes of seafood fraud: A meta-analysis on mislabeling and price. Marine Policy 100, 258-264.

E. Cline, Marketplace substitution of Atlantic salmon for Pacific salmon in Ebo, D.G., Kuehn, A., Bridts, C.H., Hilger, C., Hentges, F., Stevens, W.J.(2010). Monosen- sitivity to Pangasius and Tilapia caused by allergens other than parvalbumin. J. Investig. Allergol. Clin. Immunol. 20, 84–88.

Espiñeira, M., N. Gonzalez-Lavín, J. M. Vieites, and F. J. Santalcara. (2008). Authentication of anglerfish species (Lophius spp.) by means of polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) and forensically informative nucleotide sequencing (FINS) methodologies. Journal of Agricultural and Food Chemistry 56, 10594–10599.

EUMOFA, EU. (2015). Control plan coordinated at European Union level to assess the prevalence on the market of white fish mislabelled with regard to its declared species. http:// ec.europa.eu/food/safety/official_controls/food_fraud/fish_substitution_en.

Fabre ́, N. N. & Diaź de Astarloa, J. M. (2001). Distributional patterns and abundance of paralichthyid flounders in the south-west Atlantic (Pleuronectiformes: Paralichthyidae). Thalassas 17, 45–55.

FAO. 2018. The State of World Fisheries and Aquaculture 2018 - Meeting the sustainable development goals. Rome. Licence: CC BY-NC-SA 3.0 IGO.

FDA (2019). Site acessado em 11 de fevereiro de 2020 < https://www.fda.gov/food/seafood guidance-documents-regulatory-information/fda-seafood-list-updates-2019>

Ferrantelli, V., Giangrosso, G., Cicero, A., Naccari, C., Macaluso, A., Galvano, F., & Naccari, F. (2012). Evaluation of mercury levels in Pangasius and Cod fillets traded in Sicily (Italy). Food Additives & Contaminants 29, 1046e1051.

Ferrito V, Bertolino V, Pappalardo AM (2016) White fish authentication by COI/RFLP: toward a common strategy for the rapid identification of species in convenience seafood. Food Control 70:130– 137

Ferrito, V., Raffa, A., Rossitto, L., Federico, C., Saccone, S., Pappalardo, A. M. (2019). Swordfish or shark slice? A rapid response by CoiBar–RFLP. Foods 8, 537.

94 FISH-BOL. Journal of Fish Biology, 74, 329–356. (2012) Forensics and CITES caviar trade regulation, PLoS One 7, 40907.

Ghovvati, S., Nassiri, M. R., Mirhoseini, S. Z., Moussavi, A. H. & Javadmanesh, A. (2009). Fraud identification in industrial meat products by multiplex PCR assay. Food Control 20, 696–699.

Giusti, A., Tinacci, L., Sotelo, C. G., Acutis, P. L., Ielasi, N., Armani, A. (2019). Authentication of ready-to-eat anchovy products sold on the Italian market by BLAST analysis of a highly informative cytochrome b gene fragment. Food Control 97, 50–57.

Gordoa, A., Carreras, G., Sanz, N., Viñas, J. (2017). Tuna species substitution in the Spanish commercial chain: a knock-on effect, PLoS One 12,0170809. Griffiths, A. M., Sotelo, C. G., Mendes, R., Martin, P., Schro€der, U., et al. (2014). Current methods for seafood authenticity testing in Europe: Is there a need for harmonisation? Food Control 45, 95- 100.

Griffiths, A. M., Sotelo, C. G., Mendes, R., Martin, R. I. P., Schrö derd, U., Shortene, M., Silvac,H. A., Verrez-Bagnisf, V., Mariania, S.(2014).Current methods for seafood authenticity testing in Europe: Is there a need for harmonisation? Food Control 45, 95–100.

Guardone, L., Tinacci, L., Costanzo, F., Azzarelli, D., D'Amico, P., Tasselli, G., Magni, A., Guidi, A., Nucera, D., Armani, A. (2017). DNA barcoding as a tool for detecting mislabeling of fishery products imported from third countries: An official survey conducted at the Border Inspection Post of Livorno-Pisa (Italy). Food Control 80, 204–216.

Haynes, E., Jimenez, E., Pardo, M. A. & Helyar, S. J. (2019).The future of NGS (Next Generation Sequencing) analysis in testing food authenticity. Food Control 101, 134–143.

Hebert PD, Cywinska A, Ball SL, deWaard JR. (2003). Biological identifications through DNA barcodes. Proceedings Biological sciences. 270, 313–21.

Herrero, B., J. M. Vieites, and M. Espiñeira. (2011). Duplex real-time PCR for authentication of anglerfish species. European Food Research and Technology 233, 817–823.

Horreo, J. L., Fitze, P. S., Jiménez-Valverde, A., Noriega, J. A. & Pelaez, M. L. (2019). Amplification of 16S rDNA reveals important fish mislabeling in Madrid restaurants. Food Control 96, 146–150.

Hsieh, H. S., Chai, T., Cheng, C., Hsieh, Y. W., Hwang, D. F. (2004). Application of DNA Technique for Identifying the Species of Different. J. Food Sci. 69. https://eu.oceana.org/sites/default/files/euo/OCEANA_fish_label_english.pdf Hu, Y., Huang, S. Y., Hanner, R., Levin, J. & Lu, X. (2018). Study of fish products in Metro Vancouver using DNA barcoding methods reveals fraudulent labeling. Food Control 94, 38–47.

Iglesias, S.P., Toulhoat, L., Sellos, D.Y. (2010) Taxonomic confusion and market mislabeling of threatened skates: important consequences for their conservation status. Aquat. Conserv., Mar. Freshw. Ecosyst. 20, 319–333.

95 Fraser, J. Seafood industry lagging in traceability efforts, Seafood source (2018),

Kappel, K. & Schröder, U. (2016). Substitution of high-priced fish with low-priced species: Adulteration of common sole in German restaurants. Food Control 59, 478–486.

Karimi, R., Fitzgerald, T. P. & Fisher, N. S. (2012). A quantitative synthesis of mercury in commercial seafood and implications for exposure in the United States. Environ. Health Perspect. 120, 1512–1519.

Kim, J. H., Park, J. Y., Jung, J. W., Kim, M. J., Lee, W. S., An, C. M., Kang, J. H., Hwang, S. Y. (2011). Species identification of filefishes (Monacanthidae) using DNA microarray in Korean marketplace. Biochip J. 5, 229–235.

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111–120.

Koonse, B. (2016). A summary of the United States Food and Drug Administrations' food safety program for imported seafood; one country's approach. Foods 5, 2.

Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35, 1547–1549.

Leal, M. C., Pimentel, T., Ricardo, F., Rosa, R. & Calado, R. (2015).Seafood traceability: Current needs, available tools, and biotechnological challenges for origin certification. Trends Biotechnol. 33, 331–336.

Leray, M., Knowlton, N., Ho, S. L., Nguyen, B. N. & Machida, R. J. (2019). GenBank is a reliable resource for 21st century biodiversity research. Proc. Natl. Acad. Sci. U. S. A. 116, 22651–22656.

Lin, W. F. & Hwang, D. F. (2008). A multiplex PCR assay for species identification of raw and cooked bonito. Food Control 19, 879–885.

Link, J. S., Griffis, R. B., & Busch, D. S. (2015). NOAA Fisheries climate science strategy.

Logan. (2015). Too cheap to be true: Seafood fraud in Brussels. Oceana.

Luque, G. M. & Donlan, C. J. (2019). The characterization of seafood mislabeling: A global meta- analysis. Biological Conservation 236, 556–570.

Mabragaña, E., de Astarloa, J. M. D., Hanner, R., Zhang, J. & Castro, M. (2011). DNA barcoding identifies argentine fishes from marine and brackish waters. PLoS One 6, 1–12.

Mandal, A., & Kumar, J. (2016). DNA-based methods to reveal seafood fraud. Marine Products Export Development Authority (MPEDA)37–43 August 2016.

MAPA – Ministry of Agriculture, Livestock and Food Supply (2015). Instrucão Normativa no29, de 23 de setembro de 2015.

96 MAPA (2016). Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Manual de inspeç ão para identificaç ão de espécies de peixes e valores indicativos de substituiç ões em produtos da pesca e aquicultura / Secretaria de Defesa Agropecuária. – Brasília : MAPA, 2016. 188 p.

MAPA (2005). Ministério da Agricultura, Pecuária e Abastecimento, Instruç ão Normativa No 29, de 2015

Mariani, S., Cawthorn, D. M. & Hanner, R. (2017). Mislabeling Seafood Does Not Promote Sustainability: A Comment on Stawitz et al. (2016). Conserv. Lett. 10, 781–782.

Mariani, S., Griffiths, A. M., Velasco, A., Kappel, K., Jérôme, M., Perez-Martin, R. I., Schröder, U., Verrez-Bagnis, V., Silva, H., Vandamme, S. G., Boufana, B., Mendes, R., Shorten, M., Smith, C., Hankard, E., Hook, S. A., Weymer, A. S., Gunning, D., & Sotelo, C. G. (2015). Low mislabeling rates indicate marked improvements in European seafood market operations. Frontiers in Ecology and the Environment 13, 536–540.

Martinez I., James D., Lore aĺ H. (2005). Application of modern analytical techniques to ensure seafood safety and authenticity. FAO Fisheries Technical Paper. Rome: Food and Agriculture Organization of United Nations.

Mendonça, P. & Araújo, F. G. (2002). Composição das populações de linguados (Osteichthyes, Pleuronectiformes) da Baía de Sepetiba, Rio de Janeiro, Brasil. Rev. Bras. Zool. 19, 339–347.

MPA(2011). BOLETIM ESTATÍSTICO DA PESCA E AQUICULTURA.

Figueiredo & Menezes (2000). Manual de peixes marinhos do sudeste do Brasil. VI. Teleostei (5)

Meyer, R., Hog Felein, C., Lug Thy, J., Candrian, U. (1995). Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identi"ca- tion in food. Journal Association of Oficial Analytical Chemists, 78, 1542-1551.

Momigliano, P., Jokinen, H., Calboli, F., Aro, E. & Merilä, J. (2019). Cryptic temporal changes in stock composition explain the decline of a flounder (Platichthys spp.) assemblage. Evol. Appl. 12, 549–559.

Muñoz-Colmenero, M., Blanco, O., Arias, V., Martinez, J. L. & Garcia-Vazquez, E. (2016). DNA Authentication of Fish Products Reveals Mislabeling Associated with Seafood Processing. Fisheries 41, 128–138.

Muñoz-Colmenero, M., Klett-Mingo, M., Diaz,́ E., Blanco, O., Martinez,́ J. M., Garcia-Vazquez, E. (2015). Evolution of hake mislabeling niches in commercial markets. Food Control 54, 267–274.

Naaum, A. M., & Hanner, R. (2015). Community engagement in seafood identification using DNA barcoding reveals market substitution in Canadian seafood. In DNA Barcodes, 3, Issue 1.

Naaum, A. M., Warner, K., Mariani, S., Hanner, R. H. & Carolin, C. D. (2016). Seafood Mislabeling Incidence and Impacts. Seafood Authenticity and Traceability: A DNA-based Pespective. Elsevier Inc.

97 Nagalakshmi, K., Annam, P. K., Venkateshwarlu, G., Pathakota, G. B. & Lakra, W. S. (2016). Mislabeling in Indian seafood: An investigation using DNA barcoding. Food Control 59, 196–200.

Nair, R. J. & Gopalakrishnan, A. (2014). A review on the fisheries, taxonomy, and status of the flatfishes in tropical waters. Rev. Fish. Sci. Aquac. 22, 175–183.

Nedunoori, A., Turanov, S. V., & Kartavtsev, Y. P. (2017). Fish product mislabeling identified in the Russian far east using DNA barcoding. In Gene Reports 8, 144–149

Nelson, J. S. (1994). Fishes of the World. Wiley.

OCEANA, 2011. Stiles, M. L., Lahr, H., Lahey, W., Bethel, D. & Seaver, B. (2011) Bait and Switc : how seafood fraud hurts our oceans, our wallets and our health. Oceana.

Oceana, Lenin, J. (2018). Seafood Fraud and Mislabeling Across Canada.

Olsson, D., Marquez, A., Tellechea, J. S., Carvalho, P. H., Pereira, A. N., Norbis, W. (2019). Genetic and morphometric analyzes of Paralichthys species confirm the presence of P. brasiliensis in the Uruguayan waters. Neotrop. Biodivers. 5, 30–35.

Pappalardo, A. M., & Ferrito, V. (2015). A COIBar-RFLP strategy for the rapid detection of Engraulis encrasicolus in processed anchovy products. Food Control, 57, 385–392.

Pappalardo, A. M., & Ferrito, V. (2015). DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets. Fisheries Research, 164, 153–158.

Pappalardo, A. M., Federico, C., Saccone, S. & Ferrito, V. (2018). Differential flatfish species detection by COIBar-RFLP in processed seafood products. Eur. Food Res. Technol. 244, 2191–2201.

Pardo, M. A. & Pérez-Villareal, B. (2004). Identification of commercial canned tuna species by restriction site analysis of mitochondrial DNA products obtained by nested primer PCR. Food Chem. 86, 143–150.

Pardo, M. Á., Jiménez, E., & Pérez-Villarreal, B. (2016). Misdescription incidents in seafood sector. Food Control, 62, 277–283.

Pardo, M. Á., Jimenez, E., Viðarsson, J. R., Olafsson, K., Olafsdottir, G., Daníelsdottir, A. K., Perez- Villareal, B. (2018). DNA barcoding revealing mislabeling of seafood in European mass caterings. Food Control 92, 7–16. Pardo, M. Á., Jiménez, E., Viðarsson, J. R., Ólafsson, K., Ólafsdóttir, G., Daníelsdóttir, A. K., & Pérez- Villareal, B. (2018). DNA barcoding revealing mislabeling of seafood in European mass caterings. Food Control, 92, 7–16.

Pardo, M.Á ., Jiménez, E., & Pérez-Villarreal, B. (2016). Misdescription incidents in seafood sector. Food Control, 62(Complete), 277–283.

Pauly, D., & Zeller, D. (2016). Catch reconstructions reveal that global marine fisheries catches are higher than reported and declining. Nature Communications, 7, 10244.

98 Pollack, S. J., Kawalek, M. D., Williams-Hill, D. M., & Hellberg, R. S. (2018). Evaluation of DNA barcoding methodologies for the identification of fish species in cooked products. Food Control, 84, 297–304.

MAPA (2019) (http://www.agricultura.gov.br/noticias/onze-por-cento-de-amostras-de-pescados- coletadas-em-operacao-do-mapa-apresentaram inconformidades) Acessado em 20 de janeiro de 2020.

Porter, T. M. & Hajibabaei, M. (2018). Over 2.5 million COI sequences in GenBank and growing. PLoS One 13, 1–16.

Sarmiento-Camacho, S., Valdez-Moreno, M. & Adamowicz, S. (2018). DNA barcode identification of commercial fish sold in Mexican markets. Genome 61, 457–466.

Shehata, H. R., Bourque, D., Steinke, D., Chen, S. & Hanner, R. (2019). Survey of mislabelling across finfish supply chain reveals mislabelling both outside and within Canada. Food Res. Int. 121, 723– 729.

Shen Y-Y, Chen X, Murphy RW (2013). Assessing DNA Barcoding as a Tool for Species Identification and Data Quality Control. PLoS ONE 8, 57125.

Sivaraman, B., Jeyasekaran, G., Shakila, R. J., Alamelu, V., Wilwet, L., Aanand, S., Sukumar, D. (2018). PCR-RFLP for authentication of different species of processed snappers using mitochondrial D-loop region by single enzyme. Food Control 90, 58–65.

Srivastava, S.C., Verma, P., Verma, A.K., Singh, A. K. (2014). Assessment for possible metal contamination and human health risk of Pangasianodon hypophthalmus (Sauvage, 1878) farming, India. Int. J. Fish. Aquat. Stud. 1, 176–181.

Staffen, C. F., Becker, M. L., Lö fgren, S. E., Muniz, I. C. N., De Freitas, R. H. A., Marrero, A. R. (2017). DNA barcoding reveals the mislabeling of fish in a popular tourist destination in Brazil. PeerJ 2017, 1–13. Staffen, C. F., Staffen, M. D., Becker, M. L., Löfgren, S. E., Muniz, Y. C. N., de Freitas, R. H. A., & Marrero, A. R. (2017). DNA barcoding reveals the mislabeling of fish in a popular tourist destination in Brazil. PeerJ, 5, e4006. https://doi.org/10.7717/peerj.4006

Stawitz, C. C., Siple, M. C., Munsch, S. H. & Lee, Q. (2017). Financial and Ecological Implications of Global Seafood Mislabeling. Conserv. Lett. 10, 681–689.

Valentini, P., Galimberti, A., Mezzasalma, V., De Mattia, F., Casiraghi, M., Labra, M., Pompa, P. P. (2017). DNA Barcoding Meets Nanotechnology: Development of a Universal Colorimetric Test for Food Authentication. Angew. Chemie - Int. Ed. 56, 8094–8098

Van Ruth, S. M., Luning, P. A., Silvis, I. C. J., Yang, Y. & Huisman, W. (2018). Differences in fraud vulnerability in various food supply chains and their tiers. Food Control 84, 375–381.

Veneza, I., Silva, R., Freitas, L., Silva, S., Martins, K., Sampaio, I., Schneider., H., Gomes, G. (2018). Molecular authentication of pargo fillets Lutjanus purpureus (perciformes: Lutjanidae) by DNA barcoding reveals commercial fraud. Neotrop. Ichthyol. 16, 1–6.

Ward, R. D., Hanner, R., & Hebert, P. D. (2019). The campaign to DNA barcode all fishes,

99 Warner, K. A., Lowell, B., Timme, W., Shaftel, E. & Hanner, R. H. Seafood sleuthing: How citizen science contributed to the largest market study of seafood mislabeling in the U.S. and informed policy. Mar. Policy 99, 304–311.

Warner, K. A., Lowella, B., Timmeb, W., Shaftelc, E., Hannerd, R. H. (2019). Seafood sleuthing: How citizen science contributed to the largest market T study of seafood mislabeling in the U.S. and informed policy. Marine Policy 99, 304–311.

Warner, K., Lowell, B., Geren, S. & Talmage, S. (2016). Deceptive Dishes : Seafood Swaps Found Worldwide Table of Contents. Oceana 1–21.

Warner, K., Mustain, P., Lowell, B., Geren, S., & Talmage, S. (2016). Deceptive dishes: seafood swaps found worldwide. Oceana, 1–21.

Warner, K., Mustain, P., Lowell, B., Green, S., Talmage, ST. (2016). Deceptive Dishes: seafood Swaps Found Worldwide, Oceana, Washington DC.

Warner, K., Roberts, W., Mustain, P., Lowell, B., Swain, M. (2016).Deceptive Dishes: Seafood Swaps Founds Worldwide Appendix. OCEANA.

Washington State detected by DNA barcoding, Food Res. Int. 45 (1) (2012)

Willette, D. A. & Cheng, S. H. (2018). Delivering on seafood traceability under the new U.S. import monitoring program. Ambio 47, 25–30.

Willette, D. A., Simmonds, S. E., Cheng, S. H., Esteves, S., Kane, T. L., Nuetzel, H., Pilaud, N., Rachmawati, R., & Barber, P. H. (2017). Using DNA barcoding to track seafood mislabeling in Los Angeles restaurants. Conservation Biology: The Journal of the Society for Conservation Biology, 31(5), 1076–1085.

Wilwet, L., Jeyasekaran, G., Shakila, R. J., Sivaraman, B. & Padmavathy, P. (2018). A single enzyme PCR-RFLP protocol targeting 16S rRNA/tRNAval region to authenticate four commercially important shrimp species in India. Food Chem. 239, 369–376.

Wolf, C., Burgener, M., Hübner, P. & Lüthy, J. (2000). PCR-RFLP analysis of mitochondrial DNA: Differentiation of fish species. LWT - Food Sci. Technol. 33, 144–150.

Wollenberg, K. C., Veith, M., Noonan, B. P. & Lotters, S. (2006). Polymorphism Veruss Species Richness-Systematics of Large Dendrobates from the Eastern Guianan Sheild (Amphibia: Dendrobatidae). Copeia 2006, 623–629.

Xiong, X., D’Amico, P., Guardone, L., Castigliego, L., Guidi, A., Gianfaldoni, D., & Armani, A. (2016). The uncertainty of seafood labeling in China: A case study on Cod, Salmon and Tuna. Marine Policy, 68, 123–135.

Xiong, X., Guardone, L., Cornax, M.J., Tinacci, L., Guidi, A, Gianfaldoni, D., Armani, A. (2016).DNA barcoding reveals substitution of Sablefish (Anoplopoma fimbria) with Patagonian and Antarctic Toothfish (Dissostichus eleginoides and Dissostichus mawsoni) in online market in China: how mislabeling opens door to IUU fishing, Food Control 70, 380–391.

100 Xiong, X., Yao, L., Ying, X., Lu, L., Guardone, L., Armani, A, Guidi, A., Xiong, X. (2018). Multiple fish species identified from China’s roasted Xue Yu fillet products using DNA and mini-DNA barcoding: Implications on human health and marine sustainability. Food Control 88, 123–130.

Xu, K., Feng, J., Ma, X., Wang, X., Zhou, D., Dai, Z. (2016). Identification of tuna species (Thunnini tribe) by PCR-RFLP analysis of mitochondrial DNA fragments. Food Agric. Immunol. 27, 301–313.

Yancy, H. F., Zemlak, T. S., Mason, J., Washington, J. D., Tenge, B. J., Nguyen, N. L. T., Barnett, J. D., Savary, W. E., Hill, W. E., Moore, M. M., Fry, F. S., Randolph, S. C., Rogers, P. L., Hebert, P. D. N. (2008). Potential use of DNA barcodes in regulatory science: Applications of the regulatory fish encyclopedia. J. Food Prot. 71, 210–217.

101