DOCSLIB.ORG

Metallothioneins and Zinc Dysregulation Contribute to Neurodevelopmental Damage in a Model of Perinatal Viral Infection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Metallothioneins and Zinc Dysregulation Contribute to Neurodevelopmental Damage in a Model of Perinatal Viral Infection RESEARCH ARTICLE Metallothioneins and Zinc Dysregulation Contribute to Neurodevelopmental Damage in a Model of Perinatal Viral Infection Brent L. Williams1,2; Kavitha Yaddanapudi1; Cassandra M. Kirk1; Arya Soman1; Mady Hornig1; W. Ian Lipkin1 1 Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, New York, NY. 2 Department of Microbiology and Molecular Genetics, University of California, Irvine. Corresponding author: Dr W. Ian Lipkin, Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 West 168th Street, Rm 1801, New York, NY 10032 (E-mail: [email protected]) Neonatal Borna disease (NBD) virus infection in the Lewis rat results in life-long viral cytes may also contribute to pathogenesis persistence and causes behavioral and neurodevelopmental abnormalities. A hallmark in NBD. Astrocytes are intimately associ- of the disorder is progressive loss of cerebellar Purkinje and dentate gyrus granule ated with neuronal synapses and regulate cells. Findings of increased brain metallothionein-I and -II (MT-I/-II) mRNA expression glutamate uptake/release and secretion of in cDNA microarray experiments led us to investigate MT isoforms and their relation- ship to brain zinc metabolism, cellular toxicity, and neurodevelopmental abnormalities soluble factors that promote neurogenesis, in this model. Real-time PCR con!rmed marked induction of MT-I/-II mRNA expression neuron survival, and neurite extension (1, in the brains of NBD rats (40.5-fold increase in cerebellum, p<0.0001; 6.8-fold increase 41, 54). Persistent BDV infection of pri- in hippocampus, p = 0.003; and 9.5-fold increase in striatum, p = 0.0012), whereas a mary feline cortical astrocytes results in in- trend toward decreased MT-III mRNA was found in hippocampus (1.25-fold decrease, hibition of glutamate uptake (3). p = 0.0841). Double label immuno"uorescence revealed prominent MT-I/-II expression "e role of zinc in normal brain matu- in astrocytes throughout the brain; MT-III protein was decreased in granule cell neu- ration and in disturbances of neurodevel- rons and increased in astrocytes, with di#erential subcellular distribution from cyto- plasmic to nuclear compartments in NBD rat hippocampus. Modi!ed Timm staining of opmental processes has only begun to be hippocampus revealed reduced zinc in mossy !ber projections to the hilus and CA3, examined. Although zinc homeostasis may accumulation of zinc in glial cells and degenerating granule cell somata, and robust play a regulatory role during neurotrans- mossy !ber sprouting into the inner molecular layer of the dentate gyrus. Zinc Trans- mission, it has been suggested that zinc may porter 3 (ZnT-3) mRNA expression was decreased in hippocampus (2.3-fold decrease, also contribute to neuronal injury in patho- p = 0.0065); staining for its correlate protein was reduced in hippocampal mossy !bers. logical contexts. High levels of zinc are toxic Furthermore, 2 molecules implicated in axonal path!nding and mossy !ber sprouting, to both neuronal and non-neuronal cells in the extracellular matrix glycoprotein, tenascin-R (TN-R), and the hyaluronan receptor CD44, were increased in NBD hippocampal neuropil. Abnormal zinc metabolism and vitro (13, 66) and neuronal zinc accumu- mechanisms of neuroplasticity may contribute to the pathogenesis of disease in this lation correlates with neurodegeneration model, raising more general implications for neurodevelopmental damage following in models of brain injury (20, 33, 55, 56). viral infections in early life. Nonetheless, zinc is indispensable for nor- mal brain development and is required for Brain Pathol 2006;16:1-14. the function of over 200 enzymes and pro- teins (59). Zinc is abundant in the normal INTRODUCTION of specific neuronal subsets are unknown. brain and gradually increases during early Borna disease virus (BDV) is a neuro- Damage is proposed to result from virus- postnatal development (neonatal growth tropic RNA virus that infects a wide variety mediated obstruction of cellular prolifera- spurt), with high concentrations in the of warm-blooded animals. Lewis rats ex- tion, differentiation, or survival pathways. cerebellum of neonates and in the hippo- perimentally infected as adults have menin- NBD is associated with altered brain levels campus of adult rats (49). "e majority of goencephalitis and a progressive movement of transcripts encoding cytokines (IL-1C, brain zinc is associated with metalloprotein disorder; infected neonates do not mount a IL-6, TNF-B, and TGF-C1); neurotrophic complexes. "e remaining zinc (approxi- cellular immune response to infection, yet factors (brain-derived neurotrophic factor mately 10%) is localized at synaptic vesicles have microglial activation, proinflammato- [BDNF], nerve growth factor [NGF], and in a subset of glutamatergic neurons (19). ry cytokine gene expression, cerebellar and neurotrophin-3 [NT-3]); neurotransmitters Particularly high concentrations of zinc are hippocampal dysgenesis, and disturbances and receptors (serotonin, dopamine); and found in hippocampal granule cell mossy of learning, mood and behavior (neonatal apoptosis-related products (Fas, caspase- fibers, where zinc is released along with glu- Borna disease, NBD) (6). Although BDV 1, and Bcl-x) (6, 25). Decreased levels of tamate during synaptic transmission and is noncytolytic, neuronal apoptosis is ob- 2 presynaptic proteins involved in synaptic may serve as an endogenous neuromodula- served in cerebellum and hippocampus in plasticity, synaptophysin and GAP-43, are tor of NMDA, AMPA, and GABA receptors NBD (25, 62). However, the cellular and observed in regions of neuronal loss (22). and the glial glutamate transporter, EAAT1 molecular mechanisms responsible for loss Functional disturbances of infected astro- (13, 60). Homeostatic controls over zinc Metallothioneins and Zinc Dysregulation in a Model of Perinatal Viral Infection—Williams et al 1 Gene (Accession #) Primer Pairs (5’–3’) [ Reaction Concentration] and probe Amplicon (bp) LTI, Gaithersburg, Md) before applying to For: AGGGCTGTGTCTGCAAAGGT [100nm] the prewarmed microarray in a humidified MT-I/ -II (J00750) Rev: CAAGACTCTGAGTTGGTCCGG [100nm] 110 hybridization chamber. After hybridization FAM-ACGTGCTGTGCCTGAAGTGACGAAC-TAMRA at 53°C for 18 hours, slides were washed for 15 minutes each in 2 × SSC/0.2% SDS For: TACAGTCTCTCGCGGCTGCT [100nm] at 42°C, 2 × SSC at room temperature, MT-III (BC058453) Rev: GCAGCTCTTCTTGCAGTTCGT [100nm] 130 0.2 × SSC at room temperature, and then FAM-CCTGTCCTACTGGTGGTTCCTGCACCT-TAMRA dried by centrifugation. "e hybridized For: AAGCCCCAGTACAAGGTGGC [300nm] cDNA was fluorescence-labeled during ZnT-3 (AY538655) Rev: ACCTTCCATGAGGACGAGGA [300nm] 110 an additional hybridization with the Cy3- FAM-CAGCACCTTCCTCTTCTCTATCTGCGCC-TAMRA 3DNA and Cy5-3DNA capture reagents For: GGACCAGGCAGAGCCAGAG [300nm] in SDS-hybridization buffer for 3 hours ZnT-1 (U17133) Rev: GGACGTGCAGAAACACTCCTC [300nm] 145 at 62°C, followed by sequential washes for FAM-AATGGGAATCTCATCCAGGAGTCAGACAGTC-TAMRA 15 minutes each in 2 × SSC/0.2%SDS at For: ATTCGGGGAAACCTCAACACC [300nm] 65°C, and 2 × SSC and 0.2 × SSC at room PBGD (X06827) Rev: CTGACCCACAGCATACATGCAT [300nm] 157 temperature. Fluorescence-labeled slides FAM-GCAAGATCTGGCCCACCCGGTT-TAMRA were dried by centrifugation and scanned with a GenePix 4000B scanner (Axon In- Table 1. Real-time PCR: rat gene-speci!c, primer and probe combinations. Accession numbers are given for sequence used to design primer and probe sets using Primer Express software. The !nal concentration of struments, Inc., Union City, Calif) at 5-µm primers used in real-time PCR reactions and amplicon size are indicated. resolution; variable gains were used on the photomultiplier tube to acquire high in- bioavailability, vesicular storage/sequestra- RNA extraction. At 4 weeks post inocu- tensity scans without oversaturation. For tion, and cellular influx and extrusion are lation NBD (n = 7) and control (n = 5) rats each spot, background-subtracted signal mediated in large part by zinc-sequestering were terminally anesthetized with CO . 2 intensity, acquired using GenePix Pro 4.1 proteins (metallothioneins and albumin), Brain regions (cerebellum, hippocampus, software, was normalized for both Cy3 and amino acids (histidine and cysteine) and a and striatum) were immediately dissected, Cy5 expression by scaling individual spot family of zinc transporters (ZnT1-ZnT4) snap frozen in TRIzol (Invitrogen, Carls- intensities in each channel to the total in- (17, 57). Zinc is a potent physiological in- bad, Calif), and stored at -80°C. Total tensity of all spots on the array. Microarray ducer of metallothionein (MT) expression RNA was extracted from cerebellum, hip- experiments using cerebellar and hippo- through the zinc-dependent transcription pocampus, and striatum of individual ani- campal RNA sets were performed in trip- factor, MTF-1, and metal response ele- mals using acid phenol extraction. licate. Data were paired for each array, and ments in the promoter of MT genes (23). analyzed using the Cyber T web interface Conversely, MT is also intimately involved Microarray analysis. Equal amounts of (http://visitor.ics.uci.edu/genex/cybert/). Dif- in the regulation of zinc homeostasis and total RNA extracted from either cerebellum ferences in gene hybridization signal that bioavailability (29). or hippocampus of individual animals were met the following criteria were considered Here, we describe evidence that
Load more

Recommended publications
  • Ultrastructural Study of the Granule Cell Domain of the Cochlear Nucleus in Rats: Mossy Fiber Endings and Their Targets
    THE JOURNAL OF COMPARATIVE NEUROLOGY 369~345-360 ( 1996) Ultrastructural Study of the Granule Cell Domain of the Cochlear Nucleus in Rats: Mossy Fiber Endings and Their Targets DIANA L. WEEDMAN, TAN PONGSTAPORN, AND DAVID K. RYUGO Center for Hearing Sciences, Departments of Otolaryngoloby-Head and Neck Surgery and Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Maryland 2 1205 ABSTRACT The principal projection neurons of the cochlear nucleus receive the bulk of their input from the auditory nerve. These projection neurons reside in the core of the nucleus and are surrounded by an external shell, which is called the granule cell domain. Interneurons of the cochlear granule cell domain are the target for nonprimary auditory inputs, including projections from the superior olivary complex, inferior colliculus, and auditory cortex. The granule cell domain also receives projections from the cuneate and trigeminal nuclei, which are first-order nuclei of the somatosensory system. The cellular targets of the nonprimary projections are mostly unknown due to a lack of information regarding postsynaptic profiles in the granule cell areas. In the present paper, we examined the synaptic relationships between a heterogeneous class of large synaptic terminals called mossy fibers and their targets within subdivisions of the granule cell domain known as the lamina and superficial layer. By using light and electron microscopic methods in these subdivisions, we provide evidence for three different neuron classes that receive input from the mossy fibers: granule cells, unipolar brush cells, and a previously undescribed class called chestnut cells. The distinct synaptic relations between mossy fibers and members of each neuron class further imply fundamentally separate roles for processing acoustic signals.
    [Show full text]
  • Plp-Positive Progenitor Cells Give Rise to Bergmann Glia in the Cerebellum
    Citation: Cell Death and Disease (2013) 4, e546; doi:10.1038/cddis.2013.74 OPEN & 2013 Macmillan Publishers Limited All rights reserved 2041-4889/13 www.nature.com/cddis Olig2/Plp-positive progenitor cells give rise to Bergmann glia in the cerebellum S-H Chung1, F Guo2, P Jiang1, DE Pleasure2,3 and W Deng*,1,3,4 NG2 (nerve/glial antigen2)-expressing cells represent the largest population of postnatal progenitors in the central nervous system and have been classified as oligodendroglial progenitor cells, but the fate and function of these cells remain incompletely characterized. Previous studies have focused on characterizing these progenitors in the postnatal and adult subventricular zone and on analyzing the cellular and physiological properties of these cells in white and gray matter regions in the forebrain. In the present study, we examine the types of neural progeny generated by NG2 progenitors in the cerebellum by employing genetic fate mapping techniques using inducible Cre–Lox systems in vivo with two different mouse lines, the Plp-Cre-ERT2/Rosa26-EYFP and Olig2-Cre-ERT2/Rosa26-EYFP double-transgenic mice. Our data indicate that Olig2/Plp-positive NG2 cells display multipotential properties, primarily give rise to oligodendroglia but, surprisingly, also generate Bergmann glia, which are specialized glial cells in the cerebellum. The NG2 þ cells also give rise to astrocytes, but not neurons. In addition, we show that glutamate signaling is involved in distinct NG2 þ cell-fate/differentiation pathways and plays a role in the normal development of Bergmann glia. We also show an increase of cerebellar oligodendroglial lineage cells in response to hypoxic–ischemic injury, but the ability of NG2 þ cells to give rise to Bergmann glia and astrocytes remains unchanged.
    [Show full text]
  • Cerebellar Granule Cells in Culture
    Proc. Nati. Acad. Sci. USA Vol. 83, pp. 4957-4961, July 1986 Neurobiology Cerebellar granule cells in culture: Monosynaptic connections with Purkinje cells and ionic currents (excitatory postsynaptic potential/patch-clamp) ToMoo HIRANO, YOSHIHIRo KUBO, AND MICHAEL M. WU Department of Neurobiology, Institute of Brain Research, School of Medicine, University of Tokyo, Tokyo, Japan Communicated by S. Hagiwara, March 6, 1986 ABSTRACT Electrophysiological properties of cerebellar tissue was dissociated by triturating with a fire-polished granule cells and synapses between granule and Purkinje cells Pasteur pipette in Ca-free Hanks' balanced salt solution were studied in dissociated cultures. Electrophysiological prop- containing 0.05% DNase and 12 mM MgSO4. The cells were erties of neurons and synapses in the mammalian central centrifuged at 150 x g at 40C and the pelleted cells were nervous system are best studied in dissociated cell cultures resuspended at a concentration of about 106 cells per ml in a because of good target cell visibility, control over the contents defined medium (9). One milliliter ofthe cell suspension from of the extracellular solution, and the feasibility of whole-cell newborn rats was plated first in a Petri dish (3.5 cm in patch electrode recording, which has been a powerful tech- diameter) containing several pieces ofheat-sterilized, poly(L- nique in analyzing biophysical properties of ionic channels in lysine)-coated coverslips, and then 1 ml of fetal cell suspen- small cells. We have applied this whole-cell recording technique sion was added. One-half of the culture medium was ex- to cultured cerebellar granule cells whose electrophysiological changed with fresh medium once a week.
    [Show full text]
  • FIRST PROOF Cerebellum
    Article Number : EONS : 0736 GROSS ANATOMY Cerebellum Cortex The cerebellar cortex is an extensive three-layered sheet with a surface approximately 15 cm laterally THE HUMAN CEREBELLUM (‘‘little brain’’) is a and 180 cm rostrocaudally but densely folded around significant part of the central nervous system both three pairs of nuclei. The cortex is divided into three in size and in neural structure. It occupies approxi- transverse lobes: Anterior and posterior lobes are mately one-tenth of the cranial cavity, sitting astride separated by the primary fissure, and the smaller the brainstem, beneath the occipital cortex, and flocculonodular lobe is separated by the poster- contains more neurons than the whole of the cerebral olateral fissure (Fig. 1). The anterior and posterior cortex. It consists of an extensive cortical sheet, lobes are folded into a number of lobules and further densely folded around three pairs of nuclei. The folded into a series of folia. This transverse organiza- cortex contains only five main neural cell types and is tion is then divided at right angles into broad one of the most regular and uniform structures in the longitudinal regions. The central vermis, named for central nervous system (CNS), with an orthogonal its worm-like appearance, is most obvious in the ‘‘crystalline’’ organization. Major connections are posterior lobe. On either side is the paravermal or made to and from the spinal cord, brainstem, and intermediate cortex, which merges into the lateral sensorimotor areas of the cerebral cortex. hemispheres. The most common causes of damage to the cerebellum are stroke, tumors, or multiple sclerosis.
    [Show full text]
  • NEUROGENESIS in the ADULT BRAIN: New Strategies for Central Nervous System Diseases
    7 Jan 2004 14:25 AR AR204-PA44-17.tex AR204-PA44-17.sgm LaTeX2e(2002/01/18) P1: GCE 10.1146/annurev.pharmtox.44.101802.121631 Annu. Rev. Pharmacol. Toxicol. 2004. 44:399–421 doi: 10.1146/annurev.pharmtox.44.101802.121631 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on August 28, 2003 NEUROGENESIS IN THE ADULT BRAIN: New Strategies for Central Nervous System Diseases ,1 ,2 D. Chichung Lie, Hongjun Song, Sophia A. Colamarino,1 Guo-li Ming,2 and Fred H. Gage1 1Laboratory of Genetics, The Salk Institute, La Jolla, California 92037; email: [email protected], [email protected], [email protected] 2Institute for Cell Engineering, Department of Neurology, Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; email: [email protected], [email protected] Key Words adult neural stem cells, regeneration, recruitment, cell replacement, therapy ■ Abstract New cells are continuously generated from immature proliferating cells throughout adulthood in many organs, thereby contributing to the integrity of the tissue under physiological conditions and to repair following injury. In contrast, repair mechanisms in the adult central nervous system (CNS) have long been thought to be very limited. However, recent findings have clearly demonstrated that in restricted areas of the mammalian brain, new functional neurons are constantly generated from neural stem cells throughout life. Moreover, stem cells with the potential to give rise to new neurons reside in many different regions of the adult CNS. These findings raise the possibility that endogenous neural stem cells can be mobilized to replace dying neurons in neurodegenerative diseases.
    [Show full text]
  • Differences in the Developmental Patterns of Three Microtubule-Associated Proteins in the Rat Cerebellum’
    0270.8474/85/0504-0977$02.00/O The Journal of Neuroscience Copyright 0 Society for Neuroscience Vol. 5, No. 4, pp. 977-991 Printed in U.S.A. April 1985 Differences in the Developmental Patterns of Three Microtubule-associated Proteins in the Rat Cerebellum’ ROBERT BERNHARDT,2 GERDA HUBER,3 AND ANDREW MATUS Friedrich Miescher-lnstitut, P. 0. Box 2543, CH-4002 Base/, Switzerland Abstract MAPS are potentially important physiological regulators of neuronal differentiation. The developmental distribution patternS of microtubule- It has become clear that microtubules of different tissues and cell associated proteins (MAPS) 1, 2, and 3 were studied using types are characterized by different MAPS. Thus, a category of high three monoclonal antibodies. lmmunochemical staining at the molecular weight MAPS, later identified as MAP2, is exclusively light and electron microscopic levels demonstrated the spe- expressed in adult neurons where it is most concentrated in den- cific localization of each MAP in different cellular and sub- drites (Matus et al., 1981, 1983; Caceres et al., 1983, 1984; Wiche cellular compartments. (i) MAPS, which is specifically asso- et al., 1983; Bernhardt and Matus, 1984; De Camilli et al., 1984). ciated with dendritic microtubules in the adult brain, is strictly This suggested the possibility that MAP2 could be specifically associated with growing dendrites from the onset of their involved in the formation of dendritic microtubules and hence could formation. (ii) MAP3, a recently described MAP of M, = play a significant role in the regulation of dendrite growth. This idea 180,000, which in the adult brain is associated with neurofi- found further support from immunohistochemical data of developing lament-rich axons and glial processes, is associated with brain (Bernhardt and Matus, 1982; Matus et al., 1983; Burgoyne and axons from the beginning of outgrowth.
    [Show full text]
  • Cerebellar Cortical Neuron Responses Evoked from the Spinal Border Cell Tract
    Cerebellar cortical neuron responses evoked from the spinal border cell tract. Geborek, Pontus; Spanne, Anton; Bengtsson, Fredrik; Jörntell, Henrik Published in: Frontiers in Neural Circuits DOI: 10.3389/fncir.2013.00157 2013 Link to publication Citation for published version (APA): Geborek, P., Spanne, A., Bengtsson, F., & Jörntell, H. (2013). Cerebellar cortical neuron responses evoked from the spinal border cell tract. Frontiers in Neural Circuits, 7, [157]. https://doi.org/10.3389/fncir.2013.00157 Total number of authors: 4 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00 00 Download date: 04. Oct. 2021 ORIGINAL RESEARCH ARTICLE published: 08 October 2013 NEURAL CIRCUITS doi: 10.3389/fncir.2013.00157 Cerebellar cortical neuron responses evoked from the spinal border cell tract Pontus Geborek, Anton Spanne, Fredrik Bengtsson and Henrik Jörntell* Neural Basis of Sensorimotor Control, Department of Experimental Medical Science, Lund University, Lund, Sweden Edited by: Spinocerebellar systems are likely to be crucial for cerebellar hallmark functions such Egidio D’Angelo, University of Pavia, as coordination.
    [Show full text]
  • Neurogenesis in the Adult Human Hippocampus
    1998 Nature America Inc. • http://medicine.nature.com ARTICLES Neurogenesis in the adult human hippocampus PETER S. ERIKSSON1,4, EKATERINA PERFILIEVA1, THOMAS BJÖRK-ERIKSSON2, ANN-MARIE ALBORN1, CLAES NORDBORG3, DANIEL A. PETERSON4 & FRED H. GAGE4 Department of Clinical Neuroscience, Institute of Neurology1, Department of Oncology2, Department of Pathology3, Sahlgrenska University Hospital, 41345 Göteborg, Sweden 4Laboratory of Genetics, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, California 92037, USA Correspondence should be addressed to F.H.G. The genesis of new cells, including neurons, in the adult human brain has not yet been demon- strated. This study was undertaken to investigate whether neurogenesis occurs in the adult human brain, in regions previously identified as neurogenic in adult rodents and monkeys. Human brain tissue was obtained postmortem from patients who had been treated with the thymidine analog, bromodeoxyuridine (BrdU), that labels DNA during the S phase. Using im- munofluorescent labeling for BrdU and for one of the neuronal markers, NeuN, calbindin or neu- ron specific enolase (NSE), we demonstrate that new neurons, as defined by these markers, are generated from dividing progenitor cells in the dentate gyrus of adult humans. Our results further indicate that the human hippocampus retains its ability to generate neurons throughout life. Loss of neurons is thought to be irreversible in the adult human one intravenous infusion (250 mg; 2.5 mg/ml, 100 ml) of bro- brain, because dying neurons cannot be replaced. This inability modeoxyuridine (BrdU) for diagnostic purposes11. One patient to generate replacement cells is thought to be an important diagnosed with a similar type and location of cancer, but with- http://medicine.nature.com cause of neurological disease and impairment.
    [Show full text]
  • Monoclonal Antibodies to Specific Astroglial and Neuronal Antigens Reveal the Cytoarchitecture of the Bergmann Glia Fibers in the Cerebellum’
    0270.6474/84/0401-0265$02.00/O The Journal of Neuroscience Copyright 0 Society for Neuroscience Vol. 4, No. 1, pp. 265-273 Printed in U.S.A. January 1984 MONOCLONAL ANTIBODIES TO SPECIFIC ASTROGLIAL AND NEURONAL ANTIGENS REVEAL THE CYTOARCHITECTURE OF THE BERGMANN GLIA FIBERS IN THE CEREBELLUM’ ANGEL L. DE BLAS Department of Neurobiology and Behavior, State University of New York at Stony Brook, Stony Brook, New York 11794 Received May 11, 1983; Revised August 22, 1983; Accepted August 22, 1983 Abstract The cytoarchitecture of the cerebellar Bergmann fibers in the adult rat was investigated. Two monoclonal antibodies, one specific for the Bergmann fibers and astrocyte processes and the other specific for the cell bodies and dendrites of the Purkinje cells as well as an antiserum to the glial fibrillary acidic protein, were used in immunocytochemical peroxidase-antiperoxidase assays. The Bergmann fibers are revealed as columns organized in long vertical palisades parallel to the longitudinal plane of the folium. The palisades are not continuous; instead they are formed by sets of two to six aligned Bergmann fibers. Each of these sets of Bergmann fibers is separated from its longitudinally aligned neighbors by gaps. Each Bergmann fiber is formed by a bundle of two to four Bergmann glia processes which frequently show a helical organization. These results help to reconcile the different views on the organization of the .Bergmann fibers derived from the’studies done with the light microscope versus those done with the electron microscope. The Bergmann glia may play a fundamental role in directing the geometrical organi- zation of the cerebellar constituents.
    [Show full text]
  • The Modifiable Neuronal Network of the Cerebellum
    Japanese Journal of Physiology, 34, 781-792, 1984 MINIREVIEW The Modifiable Neuronal Network of the Cerebellum M asao ITO Department of Physiology, Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo, 113 Japan An outstanding feature of the cerebellum known since the classic histological work of Ramon y Cajal is the relative simplicity and highly ordered geometry of its neuronal network. The cerebellar neuronal network consists of five major types of cortical neurons (Purkinje, basket, stellate, Golgi, and granule cells), two major types of afferents (mossy and climbing fibers), and the subcortical cells in the vestibular and cerebellar nuclei. When the neuronal network structure of the cerebellum was comprehensively dissected and described in great detail in the 1960s, and summarized by ECCLES,ITO, and SZ.ENTAGOTHAI[8], it was taken as a challenge to understand more completely the complex functions of the central nervous system using these fundamental studies of the brain as groundwork for future elucidation. As the gap between our understanding of the brain and our knowledge of neuronal networks is in general so large, hope has arisen that cere- bellar physiology may successfully fill the gap rather soon. Rigorous efforts using numerous newly-introduced techniques have been devoted during the past two decades, yielding remarkable progress that meets expectations at least to some extent. A number of problems remain to be solved, however, before we fully understand the cerebellum. It seems important at this point to review the major achievements of the past two decades in order to gain a clearer perspective of cerebellar physiology for the coming decade.
    [Show full text]
  • The Long Journey of Pontine Nuclei Neurons : from Rhombic Lip To
    REVIEW Erschienen in: Frontiers in Neural Circuits ; 11 (2017). - 33 published: 17 May 2017 http://dx.doi.org/10.3389/fncir.2017.00033 doi: 10.3389/fncir.2017.00033 The Long Journey of Pontine Nuclei Neurons: From Rhombic Lip to Cortico-Ponto-Cerebellar Circuitry Claudius F. Kratochwil 1,2, Upasana Maheshwari 3,4 and Filippo M. Rijli 3,4* 1Chair in Zoology and Evolutionary Biology, Department of Biology, University of Konstanz, Konstanz, Germany, 2Zukunftskolleg, University of Konstanz, Konstanz, Germany, 3Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland, 4University of Basel, Basel, Switzerland The pontine nuclei (PN) are the largest of the precerebellar nuclei, neuronal assemblies in the hindbrain providing principal input to the cerebellum. The PN are predominantly innervated by the cerebral cortex and project as mossy fibers to the cerebellar hemispheres. Here, we comprehensively review the development of the PN from specification to migration, nucleogenesis and circuit formation. PN neurons originate at the posterior rhombic lip and migrate tangentially crossing several rhombomere derived territories to reach their final position in ventral part of the pons. The developing PN provide a classical example of tangential neuronal migration and a study system for understanding its molecular underpinnings. We anticipate that understanding the mechanisms of PN migration and assembly will also permit a deeper understanding of the molecular and cellular basis of cortico-cerebellar circuit formation and function. Keywords: pontine gray nuclei, reticulotegmental nuclei, precerebellar system, cortico-ponto-cerebellar circuitry, Hox genes Edited by: Takao K. Hensch, INTRODUCTION Harvard University, United States Reviewed by: The basal pontine nuclei (BPN) (also known as basilar pons, pontine gray nuclei or pontine nuclei Masahiko Takada, (PN)) and the reticulotegmental nuclei (RTN) (also known as nucleus reticularis tegmenti pontis) Kyoto University, Japan are located within the ventral portion of the pons.
    [Show full text]
  • Signal Transmission in the Parallel Fiber-Purkinje Cell System Visualized
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 13014-13017, December 1994 Neurobiology Signal transmission in the parallel fiber-Purkinje cell system visualized by high-resolution imaging (rat/brain slice/cerebelium/optical recordings/voltage-sensitive dyes) IVO VRANESIC*, ToSHIO IIJIMA*, MICHINORI ICHIKAWA*, GEN MATSUMOTO*, AND THOMAS KNOPFELtt *Electrotechnical Laboratory, Supermolecular Science Division, 1-1-4 Umezono, Tsukuba, Ibaraki 305, Japan; and tCentral Nervous System Research, K-125.6.12, Ciba, CH-4002 Basel, Switzerland Communicated by Richard F. Thompson, September 19, 1994 ABSTRACT We investigated the synaptic transmission in MATERIALS AND METHODS the parallel fiber-PurkinJe cell system at high spatio-temporal Cerebellar Slices and Recording Setup. Wistar rats (either resolution by using voltage-sensitive dyes and an imaging sex, aged between 16 days and 5 weeks) were anesthetized by system. In rat cerebellar slices, cut in the frontal plane or in a exposure to diethyl ether and then decapitated. Slices were cut plane of the cerebellar surface, local electrical stimulation from the cerebellar vermis in parafrontal planes ("frontal" induced volleys of action potentials in the parallel fibers; slices, 200 ,um) or in parallel to the cerebellar surface ("su- subsequent postsynaptic responses from Purkiaje cells were perficial" slices, 400 ,um) with a Vibroslice (Campden Instru- observed along the volleys' entire trajectories. Furthermore, ments) and left to recover for 30-60 min at 32°C in continu- the formation of an ordered spatial gradient in parallel fiber ously oxygenated (95%02/5% C02) artificial cerebrospinal conduction velocity across the depth of the molecular layer fluid (ACSF, 147 mm Na+/5 mM K+/2 mM Ca2+/2 mM during postnatal development was observed.
    [Show full text]