Gain-Of-Function P53 Mutants Have Widespread Genomic Locations Partially Overlapping with P63
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The TP53 Apoptotic Network Is a Primary Mediator of Resistance to BCL2 Inhibition in AML Cells
Published OnlineFirst May 2, 2019; DOI: 10.1158/2159-8290.CD-19-0125 RESEARCH ARTICLE The TP53 Apoptotic Network Is a Primary Mediator of Resistance to BCL2 Inhibition in AML Cells Tamilla Nechiporuk1,2, Stephen E. Kurtz1,2, Olga Nikolova2,3, Tingting Liu1,2, Courtney L. Jones4, Angelo D’Alessandro5, Rachel Culp-Hill5, Amanda d’Almeida1,2, Sunil K. Joshi1,2, Mara Rosenberg1,2, Cristina E. Tognon1,2,6, Alexey V. Danilov1,2, Brian J. Druker1,2,6, Bill H. Chang2,7, Shannon K. McWeeney2,8, and Jeffrey W. Tyner1,2,9 ABSTRACT To study mechanisms underlying resistance to the BCL2 inhibitor venetoclax in acute myeloid leukemia (AML), we used a genome-wide CRISPR/Cas9 screen to identify gene knockouts resulting in drug resistance. We validated TP53, BAX, and PMAIP1 as genes whose inactivation results in venetoclax resistance in AML cell lines. Resistance to venetoclax resulted from an inability to execute apoptosis driven by BAX loss, decreased expression of BCL2, and/or reliance on alternative BCL2 family members such as BCL2L1. The resistance was accompanied by changes in mitochondrial homeostasis and cellular metabolism. Evaluation of TP53 knockout cells for sensitivities to a panel of small-molecule inhibitors revealed a gain of sensitivity to TRK inhibitors. We relate these observations to patient drug responses and gene expression in the Beat AML dataset. Our results implicate TP53, the apoptotic network, and mitochondrial functionality as drivers of venetoclax response in AML and suggest strategies to overcome resistance. SIGNIFICANCE: AML is challenging to treat due to its heterogeneity, and single-agent therapies have universally failed, prompting a need for innovative drug combinations. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Network Medicine Approach for Analysis of Alzheimer's Disease Gene Expression Data
International Journal of Molecular Sciences Article Network Medicine Approach for Analysis of Alzheimer’s Disease Gene Expression Data David Cohen y, Alexander Pilozzi y and Xudong Huang * Neurochemistry Laboratory, Department of Psychiatry, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129, USA; [email protected] (D.C.); [email protected] (A.P.) * Correspondence: [email protected]; Tel./Fax: +1-617-724-9778 These authors contributed equally to this work. y Received: 15 November 2019; Accepted: 30 December 2019; Published: 3 January 2020 Abstract: Alzheimer’s disease (AD) is the most widespread diagnosed cause of dementia in the elderly. It is a progressive neurodegenerative disease that causes memory loss as well as other detrimental symptoms that are ultimately fatal. Due to the urgent nature of this disease, and the current lack of success in treatment and prevention, it is vital that different methods and approaches are applied to its study in order to better understand its underlying mechanisms. To this end, we have conducted network-based gene co-expression analysis on data from the Alzheimer’s Disease Neuroimaging Initiative (ADNI) database. By processing and filtering gene expression data taken from the blood samples of subjects with varying disease states and constructing networks based on that data to evaluate gene relationships, we have been able to learn about gene expression correlated with the disease, and we have identified several areas of potential research interest. Keywords: Alzheimer’s disease; network medicine; gene expression; neurodegeneration; neuroinflammation 1. Introduction Alzheimer’s disease (AD) is the most widespread diagnosed cause of dementia in the elderly [1]. -
Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal A
Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment. -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplement 1 Microarray Studies
EASE Categories Significantly Enriched in vs MG vs vs MGC4-2 Pt1-C vs C4-2 Pt1-C UP-Regulated Genes MG System Gene Category EASE Global MGRWV Pt1-N RWV Pt1-N Score FDR GO Molecular Extracellular matrix cellular construction 0.0008 0 110 genes up- Function Interpro EGF-like domain 0.0009 0 regulated GO Molecular Oxidoreductase activity\ acting on single dono 0.0015 0 Function GO Molecular Calcium ion binding 0.0018 0 Function Interpro Laminin-G domain 0.0025 0 GO Biological Process Cell Adhesion 0.0045 0 Interpro Collagen Triple helix repeat 0.0047 0 KEGG pathway Complement and coagulation cascades 0.0053 0 KEGG pathway Immune System – Homo sapiens 0.0053 0 Interpro Fibrillar collagen C-terminal domain 0.0062 0 Interpro Calcium-binding EGF-like domain 0.0077 0 GO Molecular Cell adhesion molecule activity 0.0105 0 Function EASE Categories Significantly Enriched in Down-Regulated Genes System Gene Category EASE Global Score FDR GO Biological Process Copper ion homeostasis 2.5E-09 0 Interpro Metallothionein 6.1E-08 0 Interpro Vertebrate metallothionein, Family 1 6.1E-08 0 GO Biological Process Transition metal ion homeostasis 8.5E-08 0 GO Biological Process Heavy metal sensitivity/resistance 1.9E-07 0 GO Biological Process Di-, tri-valent inorganic cation homeostasis 6.3E-07 0 GO Biological Process Metal ion homeostasis 6.3E-07 0 GO Biological Process Cation homeostasis 2.1E-06 0 GO Biological Process Cell ion homeostasis 2.1E-06 0 GO Biological Process Ion homeostasis 2.1E-06 0 GO Molecular Helicase activity 2.3E-06 0 Function GO Biological -
KLF6 Depletion Promotes NF-Κb Signaling in Glioblastoma
OPEN Oncogene (2017) 36, 3562–3575 www.nature.com/onc ORIGINAL ARTICLE KLF6 depletion promotes NF-κB signaling in glioblastoma AP Masilamani1,2, R Ferrarese1,2, E Kling1,2, NK Thudi3, H Kim4, DM Scholtens5, F Dai1,2, M Hadler1,2, T Unterkircher1,2, L Platania1,2, A Weyerbrock1,2, M Prinz6,7, GY Gillespie8, GR Harsh IV9, M Bredel3,10 and MS Carro1,2,10 Dysregulation of the NF-κB transcription factor occurs in many cancer types. Krüppel-like family of transcription factors (KLFs) regulate the expression of genes involved in cell proliferation, differentiation and survival. Here, we report a new mechanism of NF- κB activation in glioblastoma through depletion of the KLF6 tumor suppressor. We show that KLF6 transactivates multiple genes negatively controlling the NF-κB pathway and consequently reduces NF-κB nuclear localization and downregulates NF-κB targets. Reconstitution of KLF6 attenuates their malignant phenotype and induces neural-like differentiation and senescence, consistent with NF-κB pathway inhibition. KLF6 is heterozygously deleted in 74.5% of the analyzed glioblastomas and predicts unfavorable patient prognosis suggesting that haploinsufficiency is a clinically relevant means of evading KLF6-dependent regulation of NF-κB. Together, our study identifies a new mechanism by which KLF6 regulates NF-κB signaling, and how this mechanism is circumvented in glioblastoma through KLF6 loss. Oncogene (2017) 36, 3562–3575; doi:10.1038/onc.2016.507; published online 6 February 2017 INTRODUCTION coding region have been controversial.16,18–22 KLF6 has been The NF-κB transcription factor family is oncogenic through proposed to perform its tumor suppression function by promoting suppression of programmed cell death, and promotion of tumor G1 cell cycle arrest mainly through cyclin-dependent kinase 15 growth and invasion.1 In tumors, NF-κB can be activated by inhibitor 1A (CDKN1A) promoter transactivation. -
KLF6-SV1 Overexpression Accelerates Human and Mouse Prostate Cancer Progression and Metastasis
KLF6-SV1 overexpression accelerates human and mouse prostate cancer progression and metastasis Goutham Narla, … , Mark A. Rubin, John A. Martignetti J Clin Invest. 2008;118(8):2711-2721. https://doi.org/10.1172/JCI34780. Research Article Oncology Metastatic prostate cancer (PCa) is one of the leading causes of death from cancer in men. The molecular mechanisms underlying the transition from localized tumor to hormone-refractory metastatic PCa remain largely unknown, and their identification is key for predicting prognosis and targeted therapy. Here we demonstrated that increased expression of a splice variant of the Kruppel-like factor 6 (KLF6) tumor suppressor gene, known as KLF6-SV1, in tumors from men after prostatectomy predicted markedly poorer survival and disease recurrence profiles. Analysis of tumor samples revealed that KLF6-SV1 levels were specifically upregulated in hormone-refractory metastatic PCa. In 2 complementary mouse models of metastatic PCa, KLF6-SV1–overexpressing PCa cells were shown by in vivo and ex vivo bioluminescent imaging to metastasize more rapidly and to disseminate to lymph nodes, bone, and brain more often. Interestingly, while KLF6-SV1 overexpression increased metastasis, it did not affect localized tumor growth. KLF6-SV1 inhibition using RNAi induced spontaneous apoptosis in cultured PCa cell lines and suppressed tumor growth in mice. Together, these findings demonstrate that KLF6-SV1 expression levels in PCa tumors at the time of diagnosis can predict the metastatic behavior of the tumor; thus, KLF-SV1 may represent a novel therapeutic target. Find the latest version: https://jci.me/34780/pdf Research article KLF6-SV1 overexpression accelerates human and mouse prostate cancer progression and metastasis Goutham Narla,1,2 Analisa DiFeo,1 Yolanda Fernandez,1 Saravana Dhanasekaran,3 Fei Huang,1 Jaya Sangodkar,1,2 Eldad Hod,2 Devin Leake,4 Scott L. -
Supplementary Data
SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche). -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.