MIAMI UNIVERSITY The Graduate School

Certificate for Approving the Dissertation

We hereby approve the Dissertation

of

Yunluan Cui

Candidate for the Degree:

Doctor of Philosophy

______Director Dr. Nicholas P. Money

______Reader Dr. Qingshun Q. Li

______Reader Dr. Richard C. Moore

______Reader Dr. M.H. Henry H. Stevens

______Graduate School Representative Dr. David J. Berg

ABSTRACT

DEVELOPMENT AND FUNCTION OF CONSTRICTING RING-FORMING NEMATOPHAGOUS FUNGI

by Yunluan Cui

Nematode-trapping fungi form specialized hyphal traps to capture and consume nematodes for energy and nutrients. Among the diverse trapping devices, constricting ring-forming fungi produce the most sophisticated three-celled ring traps and actively capture nematodes. When a nematode wedges its way through the aperture of the ring trap, the friction between its body and inner side of the ring triggers the trap cells to inflate three times their untriggered volume within 100 milliseconds. The snared nematode becomes colonized and digested by the predacious hyphae for nutrients. In this project, constricting ring-forming fungi Arthrobotrys brochopaga and Arthrobotrys dactyloides are studied with the aid of microscopic and molecular techniques, and new facets behind this fascinating predatory behavior of nematode-trapping fungi are revealed. Rapid response to external stimuli and fast configuration change demonstrated by constricting ring traps has evolved to capture prey. With the aid of a high speed camera and the application of mathematical modeling, we verified that the tripled volume change in normal-sized ring trap was accompanied by a 1.7-fold increase in the surface area independent of trap sizes. The giant ring trap is an inefficient trap form unable to reach full expansion to capture nematodes, which is explained by the unachievable ratio of surface area to volume. During the rapid shape change, the plasma membrane and cytoskeletons play critical roles in reconstruction of the cell shape. By using fluorescent-labeling techniques, we labeled the targeting cell structures and investigated their distribution and dynamics that are associated with the ring cell changes. The video indicated that the preexisting plasma membrane redistributed into the expanded area. This process is coordinated by actin filaments that asymmetrically deposit the cell wall building composition to the new cell boundary. Proteomic studies also facilitate the exploration of the cytological and molecular mechanism behind the trap development and function. A set of proteins associated with the production of predatory organs are differentially expressed between vegetative cells and ring trap cells. The finding of trap-development related proteins provides evidence that the life cycle transition from the saprophytic to predatory stage requires the morphological adaptation and energy input.

DEVELOPMENT AND FUNCTION OF CONSTRICTING RING-FORMING NEMATOPHAGOUS FUNGI

A DISSERTATION

Submitted to the faculty of Miami University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Department of Biology Botany Program

by

Yunluan Cui

Miami University Oxford, OH 2014

Dissertation Director：Dr. Nicholas P. Money

TABLE OF CONTENTS Page CERTIFICATE FOR APPROVING THE DISSERTATION ABSTRACT TITLE PAGE i TABLE OF CONTENTS ii LIST OF TABLES iv LIST OF FIGURES v DEDICATION vii ACKNOWLEDGEMENTS viii

CHAPTER 1. Background and literature review 1 Diversity and biology of nematophagous fungi 1 Classification and phylogeny of nematophagous fungi 2 Ecology of nematophagous fungi 5 Genomic and proteomic study of nematophagous fungi 7 Previous research on constricting ring-forming fungi 9 Research aims 10 References 12

CHAPTER 2. Rapid cell movement and associated membrane configuration change 26 Abstract 26 Introduction 26 Materials and Methods 28 Results 33 Discussion 36 References 39

CHAPTER 3. Actin filament distribution during the constricting ring trap development 52 Abstract 52 Introduction 52 Materials and Methods 54 Results 57

ii Discussion 59 References 61

CHAPTER 4. Analysis of ring trap development related proteins 77 Abstract 77 Introduction 77 Materials and Methods 79 Results 83 Discussion 84 References 88

CHAPTER 5. Significance and conclusions 96 Significance of research on constricting ring trap 96 Future research 98 References 100

iii LIST OF TABLES Page Table 1.1. Taxonomic groups of nematophagous fungi 17 Table 2.1. Parameter measurements of ring traps 41 Table 2.2. Comparison between increase in surface area and volume based on three models 42 Table 3.1. Plasmid and primers used in recombinant PCR for construction 66 of hybrid expression vector. Table 4.1. List of proteins and peptides identified by MASCOT 92

iv LIST OF FIGURES Page Figure 1.1. Diverse trapping organs formed by carnivorous Orbiliales 18 Figure 1.2. Constricting ring traps of Arthrobotrys dactyloides and a firmly captured nematode 19 Figure 1.3. Illustration of conidial traps of Arthrobotrys dactyloides and A. oligospora 20 Figure 1.4. Phylogenetic relationships among the nematode-trapping fungi based on 18S rDNA 21 Figure 1.5. A hypothesized pathway showing evolution of trapping devices formed by species in Orbiliaceae 22 Figure 1.6. A phylogenetic tree of nematode-trapping structures of Orbiliaceae 23 Figure 1.7. Development of ring traps through hyphal branch differentiation and accurate curvature 24 Figure 1.8. Inflation process of constricting ring traps of Arthrobotrys brochopaga 25 Figure 2.1. Conidia and constricting rings of Arthrobotrys dactyloides 43 Figure 2.2. Models used by Muller for volume calculation of constricted and non-constricted ring cells 44 Figure 2.3. Measurement of trap size using Image-Pro® Plus 6.2 45 Figure 2.4. Schematic diagrams of constricted and nonconstricted normal ring trap 46 Figure 2.5. Fungal material setup for scanning confocal microscopic imaging 47 Figure 2.6. Cryofixation equipment used in TEM sample preparation 48 Figure 2.7. Constriction rate of ring traps of different sizes 49 Figure 2.8. Configuration change of plasma membranes during trap constriction 50 Figure 2.9. Transmission electron micrographs showing the intracellular structure of the motor cells before and after trap constriction 51 Figure 3.1. Vector map of pBC74 67 Figure 3.2. Vector map of pAL3-Lifeact 68 Figure 3.3. A GFP expression vector harboring ToxA promoter, lifeact, and TagRFP 69 Figure 3.4. Recombinant PCR to generate hybridized pBC-hygro-Lifeact-TagRFP 70 Figure 3.5. Colony of Arthrobotrys brochopaga with massive conidia 71 Figure 3.6. Conidia with germination tubes and spherical shaped healthy protoplast 72 Figure 3.7. PCR products of ToxA promoter, Lifeact-TagRFP, and hybridized fragment 73 Figure 3.8. Transformed protoplasts containing pBChygro-Lifeact-TagRFP 74 Figure 3.9. Constricted and nonconstricted ring traps with RFP label 75 Figure 3.10. Effects of actin inhibitor cytochalasin D on the morphology traps 76

v Figure 4.1. Liquid culture of Arthrobotrys brochopaga with randomly distributed ring traps 93 Figure 4.2. Proteins extraction from lyoprized Arthrobotrys brochopaga and separation on 2D gels 94 Figure 4.3. MALDI-TOF mass spectrometry characterized peptide peaks of vacuolar ATP synthase B and RAX1 protein 95 Figure 5.1. Isolation of gene YOR301W from Arthrobotrys brochopaga 102 Figure 5.2. Multiple loops formed in liquid culture of Arthrobotrys brochopaga 103

vi Dedication

I would like to dedicate this dissertation to my daughter Sequoia Jiaqi Pan, who brought me new meaning of life. Having her in mind always, I have more passion to try things I have been dreaming to do in the future.

vii Acknowledgements

There are several faculty and staff of Miami University to whom I owe gratitude for facilitating the successful completion of this dissertation. I would like to thank my committee members Dr. Qingshun Q. Li, Dr. M. Henry H. Stevens, Dr. Richard C. Moore and Dr. David J. Berg, all who have offered constructive insight in their reviewing over the years. I would like to recognize Dr. Richard E. Edelmann and Matthew L. Duley of the Electron Microscopy Facility at Miami University for their advice with microscopic sample preparation, imaging and graphics. I would like to thank Dr. Mark Fisher (College of Mount St. Joseph, Cincinnati, OH) for his help in the mathematical modeling used in this dissertation. Special thanks are given to Dr. John Howes and Xiaoyun Deng in the Center for Bioinformatics & Functional Genomics at Miami University for their patient instruction on molecular methods and techniques that are critical for the completion of this dissertation. Appreciation is given to Dr. Lynda J. Ciuffetti (Oregon State University) for providing pCT74 transformation vector and its genetic map. I also give my sincere thanks to Mrs. Barbara Wilson of the Department of Botany, who creates a relaxed and friendly ambience for us to conduct research. Sincere gratitude is given to my academic advisor Dr. Nicholas Money for his support of my research all the time.

Many thanks to my fellow graduate students, especially Jie Wang, Jingyi Cao, Erin Stempinskim, and Aswati Subramanian. Your useful ideas and patient help with experimental problems allowed my research to make significant progress. I would like to thank my lab mate Mirabeth Oak. It has been fun sharing research progress with you.

Finally, I would like to thank my family and friends for their support throughout this long educational road. Their encouragement accompanies me all the time, brings me simple pleasure, and strengthens my resolve not to give up in times of difficulty. They watched me accomplish this meaningful life journey.

This research was supported by grants from the Academic Challenge Grant of Miami University and the research funding provided by the Graduate Research Forum.

viii CHAPTER 1 Background and literature review 1.1 Diversity and biology of nematophagous fungi Nematophagous fungi are natural enemies of nematodes that parasitize plants and animals. They use specific recognition and capture mechanisms to allure, attack, kill, and digest the nematodes to meet their nutrient demands (Barron, 1977). They are widely distributed and colonize a wide range of habitats from soil and wood to dung (Cooke and Godfrey, 1964). After Lohde (1874) made the first observation on the endoparasitic nematode-destroying fungus Harposporium, more species were added to the list of nematophagous fungi and descriptions of these fungi increased to such an extent that they caught the interest of many mycologists. Pioneering studies were performed by taxonomist Charles Drechsler, who isolated and described many nematophagous fungi over a period of almost 50 years, and paved the way for later taxonomic and physiological research (Drechsler, 1937, 1943, 1952). After decades of fundamental studies on their ecology, distribution, morphology and systematics, nematophagous fungi are still the subject of intensive research. Efficient capture of nematodes by nematode-destroying fungi is achieved through morphological adaptations of conidia (asexual spores) and mycelia (Fig. 1.1; Cooke and Godfrey, 1964; Gray, 1983). Four major groups are recognized based on their growth strategies, endoparasitic fungi, egg- and cyst-parasitic fungi, toxin-producing fungi, and predatory fungi (Barron and Thorn, 1987; Dackman et al., 1992; Duddington and Wyborn, 1972; Nordbring-Hertz et al., 2006; Liu et al., 2009). Endoparasitic species infect the nematodes with spores instead of extensive mycelia (Liu et al., 2009). Released ingestible or adhesive conidia from these obligate parasites are ingested through the nematode mouth, or adhere to the nematode integument before penetration (Lopez-Llorca et al., 2008). The completion of their life cycle varies depending on the host. Egg-and-cyst facultative parasitic fungi do not possess predatory organs, and mainly attack the eggshells of root-knot and cyst nematodes using zoospores or a device called the appressorium (Nordbring-Hertz et al., 2006). Toxin-producing species immobilize and digest nematodes using toxins secreted from specialized hyphal stalks (Barron and Thorn, 1987; Dong et al., 2004). Predatory fungi, also called nematode-trapping fungi, capture nematodes using diverse adhesive or non-adhesive trapping devices structurally modified from mycelia. The five most common types of traps are adhesive hyphal knobs, branches, networks, non-constricting rings, and constricting rings (Fig. 1.1). Adhesive knobs form as small ovoid or spherical cells on the ends of short branches spaced along non-adhesive hyphae. Nematodes are trapped on these terminal cells by adhesion. Adhesive branches are formed when the adhesive substances spread all over the

1 branches. The complex system of loops and three-dimensional networks are characterized by branches that curl round and anastomose with neighboring branches or parental hyphae. These reticulate capture devices are covered by an adhesive layer which mediates a firm attachment of the nematode and kills the prey through entanglement (Duddington and Wyborn, 1972). Nematophagous fungi that rely on mechanical strategies instead of adhesive traps to capture nematodes include species forming non-constricting rings and constricting rings. Non-constricting rings, so-called passive rings, are composed of three curved (arcuate) cells that create a lumen slightly smaller than the circumference of a nematode. The nematode becomes firmly wedged when it forces its way through. Similar structures are also found in constricting ring-forming fungi, which produce the most sophisticated ring traps borne on two-celled lateral branches. They attract worms in the vicinity of their colonies and when a worm attempts to pass its anterior end into the ring, the friction of its body against the ring cells triggers trap closure, resulting in snaring of the nematode by rapid trap constriction (Fig. 1.2; Muller, 1958). Because trap closure takes place in no more than 0.3 seconds, escape of the snared prey is impossible in most cases. Though sophisticated traps are mainly produced on modified hyphae, they can directly develop from germinating conidia without an intermediate hyphal phase as observed in the widespread species Arthrobotrys oligospora (adhesive three-dimensional network), and A. brochopaga and A. dactyloides (constricting ring traps) (Fig. 1.3; Dackman and Nordbring-Hertz, 1992; Nordbring-Hertz et al., 1995; Barron, 1977, 1981; Persmark and Nordbring-Hertz, 1997). Conidial traps that stick to the cuticle of passing nematodes can be carried away and spread before invasion and digestion of the prey. Considering their function, conidial traps may be viewed as an intermediate form between the nematode-predating and the endoparasitic fungi. Significantly, by attaching to the surface of the mobile nematode, fungal distribution is facilitated. Conidia that are transported away from antifungal chemicals could elude the fungicidal effect, therefore enhancing survival.

1.2 Classification and phylogeny of nematophagous fungi Nematophagous fungi are taxonomically diverse and the nematophagous habit evolved independently in different groups of fungi distributed in all fungal phyla (Table 1.1; Cooke and Godfrey, 1964; Lopez-Llorca et al., 2008). Nematode-exploiting species Myzocytium and Nematophthora in the Oomycota and Catenaria in the Chytridiomycota mainly use flagellated spores to predate nematodes. Members of Zoopagales in the Zygomycota comprise predators of microscopic organisms, and take advantage of adhesive

2 materials secreted by hyphae or hyphal protuberances to capture victims (Cooke and Godfrey, 1964). Toxin-producing species are found in the Basidiomycota. The representative species is in Nematoctonus, which originates from a toxin-producing ancestor in Pleurotus and develops adhesive spores to capture and digest nematodes (Koziak et al., 2007). The majority of predatory fungi are placed within the Orbiliales in the Ascomycota, which was previously classified as Hyphomycetes (an obsolete class of fungi) due to lack of sexual spores. Trapping Orbiliales are the most widespread predatory fungi (Pfister, 1997), which include the familiar genera such as Arthrobotrys, Monacrosporium, Dactylellina (formerly Dactylaria), and Duddingtonia. These nematode-destroying fungi produce diverse adhesive traps or active mechanical constricting ring traps (Li et al., 2000, 2005). Arthrobotrys spp. is characterized by adhesive networks. The same type of trap is also generated by species of Duddingtonia. Adhesive knobs and branches are the primary trap forms produced by Monacrosporium. Several species in the genus Dactylellina produce stalked adhesive knobs and non-constricting ring traps, or both. The most sophisticated constricting ring traps are produced by species within Arthrobotrys and Monacrosporium (Scholler and Rubner, 1999). The earliest taxonomic work on nematophagous fungi was carried out by Drechsler (1937), and generic classification concepts relied mainly on conidia and conidiophore characters. However, due to the great number of species showing intermediate conidia and conidiophore characteristics which do not fit in one or the other genus, the delimitation of the genera was challenged (Scholler, 1999), Rubner (1996) modified the classification by using morphology of trapping structures. Molecular approach in taxonomic research of predatory fungi in the following decades agreed with Rubner’s genera concepts and confirmed that trapping devices provide the most relevant morphological features than other morphological structures for taxonomic purpose (Liou and Tzean, 1997; Pfister, 1997; Ahrén et al., 1998; Scholler et al, 1999; Hagedorn and Scholler, 1999). The divergence time of trapping fungi from a non-predatory ascomycete ancestor was dated to approximate 248 million years ago based on fossil records (Jansson, 1986). Evolution evidences gradually became clear in subsequent research on the basis of molecular clock calibration (Yang et al., 2007). Now multigene analyses of DNA sequences are widely used to trace the origin of carnivore and the pattern of evolutionary development of trapping devices, and the phylogenetic investigation of predatory fungi has made considerable progress (Scholler et al., 1999; Liou and Tzean, 1997; Ahrén et al., 1998; Scholler et al., 1999; Li et al., 2005; Yang et al., 2007, 2012). Liou and Tzean (1997) using 5.8S rDNA sequence analysis proclaimed that

3 nematophagous fungi are monophyletic, and four clades each with a unique trapping structure were identified: adhesive networks, constricting rings, adhesive knobs and adhesive columns. Comprehensive phylogenetic analysis of the small subunit (SSU) ribosomal DNA (18S rDNA) from 15 species of Orbiliales and closely related non-parasitic species by Ahrén et al. (1998) offered more evidence to delineate major groups of nematode-trapping fungi. Their finding indicated that the predatory fungal genera Arthrobotrys, Monacrosporium, Dactylaria, Dactylella and Duddingtonia constitute a monophyletic and isolated clade among the unresolved cluster of ascomycetes, and phylogenetic relationships within this clade are more concordant with the morphology of infection structures, rather than that of conidial or conidiophore (Fig. 1.4). From the perspectives of the evolutionary origins and divergence of the predatory structures, three lineages were proposed by Ahrén et al. (1998) using different methods of tree reconstruction: species producing constricting rings, species producing adhesive trapping devices (such as adhesive knobs, branches, networks, and non constricting rings) and non-predatory species. Constricting ring-forming species were basal group and branched out as an independent lineage from other non-predatory species. Within the clade of nematode-trapping species, non-predatory species also exist as a separate group, indicating that the formation of trapping devices may have evolved at least twice independently among non-predatory fungi, which is concordant with those of Pfister (1997). Their work shed light on the phylogeny of nematode traps showing trapping mechanisms evolved several times among species within genus Orbilia (the teleomorph of Dactylella, Monacrosporium and Arthrobotrys) and form an exclusive fungal group characterized by nematode capture. Contrary to Ahrén’s viewpoint, analyses of sequences from nuclear 28S rDNA, 5.8S rDNA and ß-tubulin genes of nematode-trapping Orbiliales by Li et al. (2005) suggested that the adhesive knobs are the primary type of trapping devices and have closer phylogenetic affinities with non-predatory fungi. Following two evolutionary pathways, one branch leads to the formation of adhesive branches and three dimensional networks by retaining the adhesive materials on the hyphal surface and establishing more branch fusion. The other leads to lost of adhesive materials and emergence of non-constricting rings and constricting rings (Fig. 1.5). Latter studies on evolutionary trends based on rRNA-encoding DNA in the internal transcribed spacer region and three protein-coding genes (RNA polymerase II subunit gene, elongation factor 1-alpha gene, and beta-tubulin gene) proposed that constricting rings and adhesive traps are two distinct types of trapping mechanism that evolved as two separate

4 lineages (Yang et al., 2007). A recent study based on five protein-coding genes from a broad diversity of carnivorous fungi also verified this proposal (Yang, et al. 2012). The evolution of the adhesive trap-forming clade is ambiguous in that different hypotheses have been proposed based on genes and proteins used in molecular phylogenetic analyses. Yang et al. (2007, 2012) resolved the clades within the lineage of adhesive trap-forming fungi and suggested that various adhesive trapping devices are at a highly differentiated stage. Their data showed that adhesive network separated from other adhesive traps early and evolved at a steady speed. The adhesive knob evolved through stalk elongation with a final development of non-constricting rings (Fig. 1.6). Notably, increasing adhesive surface area and elongation of the adhesive structures from the mycelium are the evolutionary trends within the Orbiliales to increase predatory efficiency (Yang et al., 2012; Nordbring-Hertz et al., 2006).

1.3 Ecology of nematophagous fungi Trap induction Preliminary work on the morphogenesis of traps attempted to elucidate the environmental factors that were necessary for trap production. Different methods of ring trap induction were described in many articles (Cook and Dickinson, 1965; Balan and Lechevalier, 1972; Barron, 1977; Nordbring-Hertz et al., 2006). The majority of nematode-trapping fungi usually produced traps efficiently in the presence of nematodes, although some of them formed traps in response to the addition of synthetic short peptides, horse serum, or nematode culture wash-off to their culture media (Couch, 1937; Lawton, 1957). The Russian mycologist Soprunov (1966) conducted a series of trap morphogenesis assays showing that rainwater, distilled water containing sodium hydroxide, or 1-2% ethyl alcohol could stimulate trap formation in reticulate nematophagous fungi. Other experiments by Bartnicki-Garcia et al. (1964) showed that carbon dioxide and nemin, a morphogenic substance produced by nematodes, were necessary for the adhesive network formation. Recent research has shown that trap formation in Drechslerella stenobrocha could be enhanced by the addition of abscisic acid, and growth factors such as vitamins and amino acids were required by Arthrobotrys dactyloides (Xu et al., 2011). Competition for nutrients drives direct formation of traps from germinating conidia (Permarck and Nordbring-Hertz, 1997). Extracts from soil or cow dung can efficiently induce the formation of conidial traps in Arthrobotrys oligospora and A. dactyloides, respectively (Fig. 1.3). Though trap formation can be induced by nematodes or peptides, some species produced traps spontaneously as reported in

5 Arthrobotrys dactyloides. The hypothetical explanation was that a ring-forming substance was spontaneously generated during the growth of A. dactyloides, and that an external stimulus was dispensable (Zuckerman and Jansson, 1984).

Infection biology of nematophagous fungi Recognition, penetration, and digestion of prey have been reviewed in many papers. Infection starts with mutual chemotaxis between the nematode host and the fungus, including a recognition phase followed by the attraction of the prey towards fungal hyphae or traps (Gray, 1983; Dijksterhuis et al., 1994; Lopez-Llorca et al., 2008). Nematodes demonstrate varied responses to different nematophagous fungi, which likewise have varied abilities to attract prey. Nematode orifices and eggs show notable attractiveness to motile spores of zoosporic nematophagous fungi (Jansson and Thiman, 1992). Hyphal traps are more attractive to the prey than the vegetative mycelium, and the sticky secretions are naturally only efficiently adhesive for eelworms (Duddington and Wyborn, 1972; Field and Webster, 1977; Jansson, 1982). Usually, increasing attraction to nematodes is accompanied by increasing dependence on nematodes. It confirmed by the observation that the aggressive predacious fungi are more attractive to the nematodes than those that are primarily saprophytes, and spontaneous trap-forming species are more efficient than passive predators in attracting prey (Jansson and Nordbring-Hertz, 1979; Zuckerman and Jansson, 1984). Following the attraction, effective adhesion of the prey among adhesive traps depends on nematode species, nematode surface properties, binding sites and life stage (Dijksterhuis et al., 1994). After eelworms are captured, they struggle violently within the first few hours, and then become moribund, unable to free themselves from the traps. The 1-2 hour time interval between capture and death also raises the possibility that nematode toxins might be the cause of eelworm death as proposed by Soprunov and Galiulina (1951) and Olthof and Estey (1963), who found that a nematotoxin secreted by Arthrobotrys spp. into culture media had a paralyzing effect on nematodes. Tunlid et al. (1991) claimed that immediately after the close physical contact between the host and predatory fungi, glycoproteins present on the adhesive surface of the net-forming species Arthrobotrys oligospora underwent reorganization, followed by activation of hydrolytic enzymes and initiation of signaling cascades that led to the formation of penetration structures. Subsequently, trap cell walls in contact with the prey dissolve and new cell walls form around the developing penetration tubes at the site of penetration. Through the combined action of digestive enzymes and the exertion of

6 mechanical force, the newly formed trophic infection hyphae penetrate the host cuticle and ramify throughout the lumen of the nematode (Dijksterhuis et al., 1994). Within 24 hours, the tissues are destroyed and absorbed, leaving an empty carcass. After depletion of available nutrients, the fungal colony extends outside the host and produces more spores for the next generation. Though there are differences in the structure of trapping devices, the process of nematode penetration and digestion show remarkable similarities among these predatory fungi (Nordbring-Hertz and Jansson, 1984; Dijksterhuis et al., 1991; Nordbring-Hertz, 2004).

1.4 Genomic and proteomic study of nematode-trapping fungi Saprophytism and predatism are two major life strategies for nematode-trapping fungi, and the flexible lifestyles adapt them to virtually any type of soil. Nematophagous fungi survive in soil as saprophytes, utilizing cellulose and other polysaccharides as nutrient resources (Jaffee, 2004). In environments with high carbon : nitrogen ratios, direct capture of nematodes by predatory fungi provides them with competitive advantages over strictly saprophytic fungi (Barron, 1992). As facultative parasites, dependence on nematodes for survival is varied among nematophagous fungi, but increasing predation ability as a response to nitrogen-limiting habitats evolved as a trend among cellulolytic or lignolytic fungi (Liu et al., 2009). Though development of specialized trapping structures is a key indicator of entry into a predatory life stage, the molecular controls behind these changes remain unclear. Transfer from saprophytic to parasitic stage requires the production of predacious devices and infection structures, which involves expression of genes related to carnivorous behavior. The genetic basis of trap development in Monacrosporium haptotylum, an adhesive knob-producing fungus, was revealed by Ahrén et al. (2005), who found significant differences in gene expression patterns between trap cells and vegetative hyphae. Genes that are differentially expressed in trap cells versus mycelia share high sequence similarity with those involved in regulating fungal morphogenesis, cell polarity, stress responses, and protein synthesis and degradation. A number of up-regulated genes in knob cells are homologues with those participating in glycogen and carbon metabolism, which is associated with carbohydrate storage and breakdown. Energy generated during this process would be used for adhesive trap production. Genes encoding peroxisomal associated proteins are also significantly up-regulated. These proteins are related to the formation of dense bodies that function in adhesive substance storage and secretion in trap cells, suggesting genes typical for predatory life stage are switched on. Global patterns of genes expressed by M. haptotylum during different stages of

7 infection were further examined with the aid of a cDNA microarray (Fekete et al., 2008). Dramatic shifts in the transcriptome during adhesion, penetration and digestion of the nematodes were observed. In the early stage of infection, genes associated with appressorium development (a structure used to penetrate the nematode cuticle) are highly expressed. One of these genes is a glycogen phosphorylase homologue, which encodes an enzyme that catalyzes the initial step of glycogen degradation, allowing generation of the pressure needed for penetration of the host. In the course of digestion, genes related to protein synthesis and metabolisms are dramatically up-regulated, and most of them are critical for fungal morphogenesis and pathogenesis. In the late phase of host colonization, the global pattern of genes reverts to the level before infection. Genomic and proteomic studies were also performed on net-forming Arthrobotrys oligospora, which live mainly as saprophytes in diverse soil environments. The development of three-dimensional networks indicates the switch from saprophytic to predatory life style (Yang et al., 2011). Despite variation in trap morphology, the interaction between the nematophagous fungi and their hosts are rather similar. Levels of intracellular proteins were analyzed during the early trap induction stage and the late trap formation stage. Signaling the host activates multiple fungal signal transduction pathways and initiates a series of cellular processes that result in morphological changes adapted to predatism. In the early stage of net trap formation, proteins participating in cell wall and membrane biogenesis, energy production and conversion, and intracellular trafficking are highly expressed, implying the need for energy and substrates for macromolecule biosynthesis during trap formation. In the early infection stage, proteins encoded by adhesion related genes increase sharply, which increases the efficiency of nematode capture. As host colonization starts, genes involved in glycerol synthesis are activated and result in penetration. In the meantime, proteins involved in biosynthesis of glucan, chitin and glycan are up-regulated to facilitate new cell wall formation and cell proliferation. Proteomic analysis of nematode-trapping fungi was performed on the knob-producing fungus Monacrosporium lysipagum (Khan et al., 2008). Based on a partial map of the proteome, over 50 housekeeping proteins and enzymes were identified. The transfer from vegetative hyphal growth to predatory trap formation is accompanied by increased levels of proteins involved in carbohydrate metabolism, energy conversion, and cell wall/membrane biogenesis. These results are concordant with previous molecular studies on other nematode-trapping fungi, showing that a key set of morphological- and pathogenicity-related proteins were differentially expressed during trap formation.

8 1.5 Previous research on constricting-ring-forming fungi The most elaborate trapping device among nematode-trapping fungi was discovered by Drechsler (1937) as a new species Arthrobotrys dactyloides Drechsler isolated from decaying roots. They are the most intricate and remarkable type of traps due to the ability to inflate the trap cells.

Morphological events during trap development Colonies of the nematode-trapping fungus Arthrobotrys dactyloides produce high densities of three-celled constricting rings along the hyphae within a few hours of close contact with nematodes. Trap development in A. dactyloides was recorded in detail by Higgins and Pramer (1967, Fig. 1.7), showing that hyphal rings were formed by a sequence of morphological events, in which the three curved cells grew successively from a short two-celled stalk. At the early stage of trap formation, the lateral branch differentiated into a short stalked primordium. The distal cell of the branch gave rise to a bud, which developed an arching growth pattern, and finally converged and fused with the stalk to form a closed ring. The timing of the complete trap formation took approximately 24 hours. The size of the constricting rings ranged from 14-19 µm in internal diameter and 6-8 µm in motor cell diameter (Muller, 1958). Newly formed traps could not function properly as confirmed in our experiments showing that the young traps could not be triggered to constrict by 20% ethanol. Trap morphology and formation processes are similar in all other constricting ring-forming species.

Trap constriction process and molecular basis Constriction of the ring trap involves a thigmotropic response. Naturally, the closure of these traps is triggered by nematode movement into the ring lumen, causing irreversible inflation of the motor cells to three times their untriggered volume within 100 milliseconds (Fig. 1.8). Three trap cells are in a state of high osmotic pressure, and as the cell wall breaks along the inner side of the ring, inner cell wall bulges inwards through the outer wall and snares the nematode (Fig. 2d; Barron, 1977). Other approaches to trigger constriction of the ring were also reported such as applying pressure on the inner side of the motor cells by a fine needle, treatment with 50oC hot water and electrical stimulation with a microelectrode (Drechsler, 1937; Muller, 1958; Zachariah, 1989). Experiments by Muller (1958) showed that the constriction of the traps could be slowed down more than 100 times by immersing the ring in a sucrose solution of appropriate strength between 0.2-0.5 M followed by slowly

9 diluting the solution with distilled water. Both the response time to the stimuli and the constriction process were significantly delayed under these conditions. Duddington (1957) commented “constriction is a remarkable natural phenomenon, and some kind of rearrangement of the molecules already present in the cell seems to be the motive force behind the swelling, rather than the simple intake of water by cell colloids.” Experiments on the molecular mechanisms of trap function began with the work by Chen et al. (2001), who found that G protein signal transduction and downstream cascade reactions were involved in the constriction process. A large number of G proteins are located in the inner side of the ring cells and can be activated by pressure exerted by a nematode. A subsequent increase in cytosolic calcium levels leads to the activation of calmodulin-regulated signal transduction and the opening of water channels, causing water to flood into the ring cells. After constriction, the outer diameter of the ring remains unchanged and the space encircled by the ring is filled by expanded cell boundary. Subsequently, the first gene involved in the trap constriction was identified as Ca2+/calmodulin-dependent protein kinase (CaMK) from A. dactyloides by Tsai et al. (2002).

1.6 Research Aims Despite decades of research on the nematode-trapping fungi, the mechanisms controlling trap formation and function are still far from understood, especially for constricting ring-forming fungi. In this project, two fungi that produce constricting ring traps were studied: Arthrobotrys dactyloides (forms small normal traps) and Arthrobotrys brochopaga (generates normal-sized traps and giant ring traps). Cell structures supposed to play essential roles in trap constriction process were labeled for functional study, and molecular evidences were also used for bringing together the development, function and architecture of the trapping device. Overall, this research was conducted to improve our understanding of the cellular and molecular mechanisms that control the development and function of constricting ring traps.

Aim 1. To model configuration changes of the plasma membrane to predict their role in trap development and function Constricting ring-forming species can produce normal-sized ring traps with diameters ranged from 20-30 µm and giant ring traps (ring trap variation) with an outer diameter over 100 µm (Insell and Zachariah, 1977, 1978). Based on configuration change before and after trap constriction, we build mathematical models to calculate the surface area

10 and volume. These data for the first time quantify the constriction process. The surface area and volume ratio are also provided to support an evolutionary advantage of normal-sized ring traps over giant traps. The dynamics of plasma membrane is recorded with a scanning confocal fluorescence microscope to determine how they are associated with fast cell movement. The images from transmission electron microscope demonstrating membraneous structural differences between normal traps and the giant traps further revealed that supplement of membrane for expanded cell boundary is important in determining configuration change.

Aim 2. To study the relationship between F-actin and the development of constricting ring traps The F-actin cytoskeleton system plays an important role in filamentous fungal morphogenesis by coordinating cell wall synthesis, cytoplasmic migration and organelle positioning. During the rapid cell expansion of ring traps, the actin cytoskeleton is highly possible to coordinate other organelle movement to affect the trap constriction. To give a better understanding of its role in trap function and verify our hypothesis, research was done to transform fungus with a hybrid vector harboring a fluorescence-labeled actin bind protein. By visualized the distribution and behavior of the actin cytoskeleton, we hope to gain a better understanding of how the F-actin and the specific cell shaping are coupled. Failure of proper assembly of actin filaments demonstrated in the actin inhibition assay enabled us to confirm the critical role of F-actin in the initiation of normal trap development.

Aim 3. To identify protein expression files in ring trap-forming Arthrobotrys spp. Constricting ring-forming Arthrobotrys spp. form stalked three-celled ring traps along the hyphae in the presence of nematodes. To provide insight into whether this specific development pattern of the constricting rings is associated with particular proteins that are involved in sensing environmental signals and organizing intracellular organelles at the ring-forming sites, a proteomic analysis was performed. Whole proteins were extracted from fungal cultures with and without traps, and separated on two-dimensional electrophoresis SDS gels followed by MALDI-TOF mass spectrometry for peptide identification. The particular expression file of a set of proteins provided by this project supplemented proteomic studies on nematophagous fungi by giving a more specific list of trap-forming associated proteins, including those that respond to external nutrient stimuli, participate in stress response, and control cell morphogenesis and polarity.

11 REFERENCES Ahrén, D., Tholander, M., Fekete, C., Rajashekar, B., Friman, E., Johansson, T., and Tunlid, A. 2005. Comparison of gene expression in trap cells and vegetative hyphae of the nematophagous fungus Monacrosporium haptotylum. Microbiology 151: 789-803.

Ahrén, D., Ursing, B. M. and Tunid, A. 1998. Phylogeny of nematode-trapping fungi based on 18S rDNA sequences. FEMS Microbiology Letters 158: 179-184.

Balan, J. and Lechevalier, H. A. 1972. The predaceous fungus Arthrobotrys dactyloides: induction of trap formation. Mycologia 64: 919-921.

Barron, G. L. 1977. The nematode-destroying fungi. Canadian Biological Publications Ltd: Guelph, Ontario, Canada.

Barron, G. L. 1981. Predators and parasites of microscopic animals. In Biology of Conidial Fungi 2: 167-200. Academic Press: New York.

Barron G. L. 1992. Lignolytic and cellulolytic fungi as predators and parasites. In: Carroll G. C. and Wicklow D. T. (eds), The Fungal Community, Its Organization and Role in the Ecosystems. 311-326. New York: Marcel Dekker.

Barron, G. L. and Thorn, R. G. 1987. Destruction of nematodes by species of Pleurotus. Canadian Journal of Botany 65: 774-778.

Bartnicki-Garcia, S., Eren, J. and Pramer, D. 1964. Carbon dioxide dependent morphogenesis in Arthrobotrys conoides. Nature 204: 804-804.

Chen, T., Hsu, C., Tsai, P., Ho, Y. and Lin, N. 2001. Heterotrimeric G-protein and signal transduction in the nematode-trapping fungus Arthrobotrys dactyloides. Planta 212: 858-863.

Cook, R. C. and Dickinson, C. H. 1965. Nematode-trapping species of Dactylella and Monacrosporium. Transactions of the British Mycological Society 48: 621-629.

Cooke, R. C. and Godfrey, B. E. S. 1964. A key to the nematode-destroying fungi. Transactions of the British Mycological Society 47: 61-74.

Couch, J. N. 1937. The formation and operation of the traps in the nematode catching fungus Dactylella bembicodes Drechsler. Journal of Elisha Mitchell Society 53: 301-309.

Dackman, C., Jansson, H. B. and Nordbring-Hertz, B. 1992. Nematophagous fungi and their activities in soil. Soil Biochemistry (eds. G. Stotzky and J. M., Bollag), Marcel Dekker, New York 7: 95-103.

Dackman, C. and Nordbring-Hertz, B. 1992. Conidial traps-a new survival structure of the nematode-trapping fungus Arthrobotrys oligospora. Mycological Research 96: 194-198.

Dijksterhuis, J., Harder, W., Wyss, U. and Veenhuis, M. 1991. Colonization and digestion of nematodes by the endoparasitic fungus Drechmeria coniospora. Mycological Research 95: 873-878.

12 Dijksterhuis, J., Veenhuis, M., Harder, W. and Nordbring-Hertz, B. 1994. Nematophagous fungi: physiological aspects and structure-function relationships. Advances in Microbial Physiology 36: 110-143.

Dong, J., Zhao, Z., Cai, L., Liu, S., Zhang, H., Duan, M. and Zhang, K. 2004. Nematicidal effect of freshwater fungal cultures against the pine-nematode, Bursaphelenchus xylophilus. Fungal Diversity 15: 125-135.

Drechsler, C. 1937. Some hyphomycetes that prey on free-living terricolous nematodes. Mycologia 29: 447-552.

Drechsler, C. 1943. A new nematode-capturing Dactylella and several related hyphomycetes. Mycologia 35: 339-362.

Drechsler, C. 1952. Another nematode-strangulating Dactylella and some related hyphomycetes. Mycologia 44: 533-556.

Duddington, C. L. and Wyborn, H. E. 1972. Recent research on the nematophagous hyphomycetes. The Botanical Review 38: 545-565.

Duddington, C. L. 1957. The Friendly Fungi; A New Approach to The Eelworm Problem. London: Faber.

Field, J. I. and Webster, J. 1977. Traps of predacious fungi attract nematodes. Transactions of the British Mycological Society 68: 3467-69.

Fekete, C., Tholander, M., Rajashekar, B., Ahrén, D., Friman, E., Johansson, T. and Tunlid, A. 2008. Paralysis of nematodes: shifts in the transcriptome of the nematode-trapping fungus Monacrosporium haptotylum during infection of Caenorhabditis elegans. Environmental Microbiology 10: 364-375.

Gray, N. F. 1983. Ecology of nematophagous fungi: distribution and habitat. Annals of Applied Biology 102: 501-509.

Gray, N. F. 1988. Diseases of Nematodes. Vol II. CRC Press, Boca Raton, Florida.

Hagedorn, G. and Scholler, M. 1999. A reevaluation of predatory orbiliaceous fungi. I. Phylogenetic analysis using rDNA sequence data. Sydowia 51: 27-48.

Higgins, M. L. and Pramer, D. 1967. Fungal morphogenesis: ring formation and closure by Arthrobotrys dactyloides. Science 155: 345-345.

Jaffee, B. A. 2004. Wood, nematodes, and the nematode-trapping fungus Arthrobotrys oligospora. Soil Biology & Biochemistry 36: 1171-1178.

Jansson, H. B. 1982. Predacity by nematophagous fungi and its relation to the attraction of nematodes. Microbial Ecology 8: 233-240.

13 Jansson, H. B. 1986. Some possible fossil nematophagous fungi. Transactions of the British Mycological Society 87: 471-474.

Jansson, H. B. and Nordbring-Hertz, B. 1979. Attraction of nematodes to living mycelium of nematophagous fungi. Journal of General Microbiology 112: 89-93.

Jansson, H. B. and Thiman, L. 1992. A preliminary study of chemotaxis of zoospores of the nematode-parasitic fungus Catenaria anguillulae. Mycologia 84: 109-112.

Khan, A., Williams, K. L., Soon, J. and Nevalainen, H. K. M. 2008. Proteomic analysis of the knob-producing nematode-trapping fungus Monacrosporium lysipagum. Mycological Research 112: 1447-1452.

Koziak, A. T. E., Cheng, K. C. and Thorn, R. G. 2007. Phylogenetic analyses of Nematoctonus and Hohenbuehelia (Pleurotaceae). Canadian Journal of Botany 85: 762-773.

Lawton, J. R. 1957. The formation of constricting rings in nematode catching Hyphomycetes grown in pure culture. Journal of Experimental Botany 8: 50-54.

Li, Y., Hyde, K. D., Jeewon, R., Cai, L. and Vijaykrishna, D. 2005. Phylogenetics and evolution of nematode-trapping fungi (Orbiliales) from nuclear and protein coding genes. Mycologia 97: 1034-1046.

Li, T., Zhang, K. and Liu, X. 2000. Taxonomy of nematophagous fungi (Chinese Scientific and Technological Publications, Beijing)

Liou, G. Y. and Tzean, S. S. 1997. Phylogeny of the genus Arthrobotrys and allied nematode-trapping fungi based on rDNA sequences. Mycologia 89: 876-884.

Liu, X., Xiang, M. and Che, Y. 2009. The living strategy of nematophagous fungi. Mycoscience 50: 20-25.

Lohde, G. 1874. Ueber einige neue parasitische Pilze. Tagebl. Versamml. Deutsch. Naturf. u. Aerzte 47: 203-206.

Lopez-Llorca, L. V., Macia-Vicente, J. G. and Jansson, H. B. 2008. Mode of action and interactions of nematophagous fungi. Integrated Management and Biocontrol of Vegetable and Grain Crops Nematodes 2: 51-76.

Muller, H. G. 1958. The constricting ring mechanism of two predacious Hyphomycetes. Transactions of the British Mycological Society 41: 341-364.

Nordbring-Hertz, B. 2004. Morphogenesis in the nematode-trapping fungus Arthrobotrys oligospora- an extensive plasticity of infection structures. Mycologist 18: 125-133.

Nordbring-Hertz, B. and Jansson, H. B. 1984. Fungal development, predacity, and recognition of prey in nematode-destroying fungi. Current Perspectives in Microbial Ecology, American Society for Microbiology, Washington, 327-333.

14 Nordbring-Hertz, B., Jansson, H. B. and Tunlid, A. 2006. Nematophagous fungi. Encyclopedia of Life Sciences. doi: 10.1038/npg.els.0004293

Nordbring-Hertz, B., Neumeister, H., Sjollema, K. and Veenhuis, M. 1995. A conidial trap-forming mutant of Arthrobotrys oligospora. Mycological Research 99: 1395-1398.

Olthof, TH. H. A. and Estey, R. H. 1963. A nematotoxin produced by the nematophagous fungus Arthrobotrys oligospora Fresenius. Nature 197: 514-515.

Persmark, L. and Nordbring-Hertz, B. 1997. Conidial trap formation of nematode-trapping fungi in soil and soil extracts. FEMS Microbiology Ecology 22: 313-323.

Pfister, D. H. 1997. Castor, Pollux and life histories of fungi. Mycologia 89: 1-23.

Rubner, A. 1996. Revision of predacious hyphomycetes in the Dactylella-Monacrosporium complex. Studies in Mycology 39: 1-134.

Scholler, M., Hagedorn, G. and Rubner, A. 1999. A reevaluation of predatory orbiliaceous fungi. II. A new generic concept. Sydowia 51: 89-113.

Scholler, M. and Rubner, A. 1999. Arthrobotrys hertziana sp. nov. from the Canary Islands. Mycological Research 103: 764-768,

Soprunov, F. F. 1966. Predacious hyphomycetes and their application in the control of pathogenic nematodes. Israel Program for Scientific Translations 292.

Soprunov, F. F. and Galiulina, E. A. 1951. Carnivorous hyphomycetes in soil in Turkmenistan. Microbiology (Moscow) 20: 489-499.

Tsai, P., Tu, J. and Chen, T. 2002. Cloning of a Ca2+/calmodulin-dependent protein kinase gene from the filamentous fungus Arthrobotrys dactyloides. FEMS Microbiology Letters 212: 7-13.

Tunlid, A., Johansson, T. and Nordbring-Hertz, B. 1991. Surface polymers of the nematode-trapping fungus Arthrobotrys oligospora. Journal of General Microbiology 137: 1231-1240.

Xu, L., Lai, Y., Wang, L. and Liu, X. 2011. Effects of abscisic acid and nitric oxide on trap formation and trapping of nematodes by the fungus Drechslerella stenobrocha AS6.1. Fungal Biology 115: 97-101.

Yang, J., Wang, L., Ji, X., Feng, Y., Li, X., Zou, C., Xu, J., Ren, Y., Mi, Q., Wu, J., Liu, S., Liu, Y., Huang, X., Wang, H., Niu, X., Li, J., Liang, L., Luo, Y., Ji, K., Zhou, W., Yu, Z., Li, G., Liu, Y., Li, L., Qiao, M., Feng, L. and Zhang, K. 2011. Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights into nematode-trap formation. Plos Pathogens 7: e1002179.

Yang, Y., Yang, E., An, Z. and Liu, X. 2007. Evolution of nematode-trapping cells of predatory fungi of the Orbiliaceae based on evidence from rRNA-encoding DNA and multiprotein sequences. Proceedings of the National Academy of Sciences 104: 8379-8384.

15 Yang, E., Xu, L., Yang, Y., Zhang, X., Xiang, M., Wang, C., An, Z. and Liu, X. 2012. Origin and evolution of carnivorism in the Ascomycota (fungi). Proceedings of the National Academy of Sciences 109: 10960-5.

Zachariah, K. 1989. Chemical induction of trap closure in Dactylella brochopaga. Protoplasma 148: 87-93.

Zuckerman, B. M. and Jansson, H. 1984. Nematode Chemotaxis and possible mechanisms of host/prey recognition. Annual Review of Phytopathology 22: 95-113.

16 Table 1.1. Taxonomic groups of nematophagous fungi showing the morphological adaptations and functional relationships with nematodes (Dijksterhuis et al., 1994; Lopez-Llorca et al., 2008).

Phylum Genus (Order) Infection approach Relationship Myzocytium Zoospores Endoparasitic (Pythiales) Oomycota Endoparasitic Nematophthora Zoospores Egg- and female- (Leptomitales) parasitic Catenaria Endoparasitic Chytridiomycota Zoospores (Blastocladiales) female parasites Cystopage Zygomycota Stylopage Adhesive hyphae Nematode-trapping (Zoopagales) Non constricting ring Adhesive knobs/branches Monacrosporium Constricting ring Arthrobotrys Adhesive hyphae/networks Drechslerella Constricting ring Nematode-trapping Dactylaria Adhesive networks Duddingtonia Adhesive knobs and Ascomycota (Orbiliales) nonconstricting rings Adhesive conidia Adhesive conidia Hirsutella Hyphal invasion Drechmeria Endoparasitic Adhesive conidia Verticillium Egg parasitic (Hypocreales) Adhesive “hour-glass knobs”

Hohenbuhelia (teleomorph of Adhesive conidia Nematode-trapping Nematoctonus

Basidiomycota pleurotus) Nematoctonus Toxins Endoparasitic fungi Coprinus Adhesive traps /Toxins Toxin producing Pleurotus (Agaricales) Toxins Nematode-trapping

17 Figure 1.1. Diverse trapping organs formed by carnivorous Orbiliales. (a) simple adhesive network; (b) three dimensional adhesive network; (c) sessile adhesive knob; (d) stalked adhesive knob; (e) two dimensional adhesive network; (f) adhesive branches; (g) non-constricting ring; (h) constricting rings-open; (i) constricting ring-closed (Illustrations from Gray, 1988).

18 Figure 1.2. Constricting ring traps of Arthrobotrys dactyloides and a firmly captured nematode. Abundant traps are formed along the hyphae of A. dactyloides (a). A nematode is trapped by a constricting ring trap observed under light microscope (b) and scanning electron microscope (c); (d) scanning electron micrograph shows ruptured original cell wall (arrowhead) of constricting ring cells of a closed trap.

19 Figure 1.3. Illustrations of conidial traps: (a) and (b) constricting ring traps formed directly from conidia of Arthrobotrys dactyloides with the ability to capture nematodes (Persmark and Nordbring-Hertz, 1997); (c) and (d) conidial traps of Arthrobotrys oligospora function similarly as adhesive nets and efficiently capture a vermiform nematode (illustrated from Nordbring-Hertz et al., 1995).

20 Figure 1.4. Phylogenetic relationships among the nematode-trapping fungi based on 18S rDNA. Three lineages include constricting ring-forming species, non-predatory species (Dactylella oxyspora and Dactylella rhopalota) and those forming adhesive mycelia structures (nonconstricting ring included). Partial cladogram is modified from Ahrén et al., (1998). Commonly used synonyms are in parenthesis.

21 Figure 1.5. A hypothesized pathway showing evolution of trapping devices formed by species in Orbiliaceae based on analysis of 28S rDNA, 5.8S rDNA, and beta-tubulin gene (modified from Li et al., 2005).

22 Figure 1.6. A Bayesian-inferred phylogenetic tree of predatory Orbiliaceae based on five protein-coding genes (adopted from Yang et al., 2012). AC, adhesive column; SSK, sessile adhesive knob; SK stalked adhesive knob; NCR, nonconstricting ring; AN, adhesive net; CR, constricting ring.

23 Figure 1.7. Development of ring traps through hyphal branch differentiation and accurate curvature. Initiation of trap primordia (I) followed by arching developing pattern of trap cells (II) and final fusion between the growing tip and the trap stalk (III). Generation of a ring trap completed within 24 hours.

24 Figure 1.8. Inflation process of constricting ring trap of Arthrobotrys brochopaga triggered by 20% ethanol. Trap closure (a to d in succession) is completed in 5.0 seconds compared to 0.3 second triggered by nematodes (0.3 seconds). Bar = 20 µm.

25 Chapter 2 Rapid cell movement and associated membrane configuration change

ABSTRACT The constricting ring trap closes in a third of a second when a nematode touches the inner side of the trap motor cells; however, such rapid irreversible cell movement makes it difficult to calculate the configuration changes. In this research, new methods were developed to trigger ring trap constriction and a high speed video camera was used to record the constriction process. We performed direct measurements of several clearly defined parameters involved in the trap constriction, and applied the data in different models to calculate the change of the surface area and volume. Results showed that after the trap constricted the surface area consistently increased 1.7-fold accompanied with 3-fold increase in volume in both normal-sized and giant ring traps. It suggests that the expansion of motor cells is limited to a certain level independent of the trap sizes. Favorable surface area to volume ratio is an indicator of cell function, and this ratio before and after trap constriction was calculated. We found that the ratio in giant ring traps was unfavorable comparing with that in normal-sized ring traps. From an evolutionary perspective, the result reasonably explained why natural selection favors the normal-sized traps. Membrane dynamics was also observed with the aid of microscopic technique, and it verified that the pool of pre-existing membrane and intracellular vesicles play an important role in trap expansion by affecting the supply of membranous materials to the enlarged trap boundary.

2.1 Introduction Arthrobotrys dactyloides and A. brochopaga are common and well-studied constricting ring-forming fungi, both characterized by slow hyphal growth. Upright and unbranched high conidiophores are 200-400 µm in height, and bear a group of 4-10 two-celled conidia (Fig. 2.1a; Drechsler, 1937; Haard, 1968). Ring traps are three-celled and supported on two-celled stalks. Though the ring sizes vary among fungal colonies, the average outside diameter of the rings is normally 20-30 µm (Drechsler, 1937; Muller, 1958). The trap diameter of A. brochopaga was slightly larger than that of A. dactyloides. The constricted motor cells are more or less spherical, and constrained at both ends where they join with the other two motor cells. Different strains show variation in trap size, trap-forming ability, and capturing ability (Kumar and Singh, 2006). Normal-sized ring trap is not the only induced trap formed by constricting ring-forming Arthrobotrys spp. In rare cases, A. brochopaga can generate giant traps sitting on

26 two-celled stout stalks. Giant traps with diameters over five times wider than that of normal-sized traps are also found (Fig. 2.1b). The supporting stalk cells of giant traps are wider in diameter than the parent hyphae, and in rare cases they are able to inflate (Fig. 2.1c). The radian of the cell comprising the trap is larger than that of normal-sized traps, and the length of cells comprising the trap does not increase after the formation of the trap. Therefore, giant traps can not be formed through enlargement of normal-sized ring traps (Insell and Zachariah, 1977, 1978). When produced naturally, they are only a very small proportion of induced traps in the culture under unknown factors. The first occurrence of giant traps is observed after the crops of fully functional constricting ring traps are established. Though generation of giant traps can be enhanced by chemical mutagenesis, their initiation and development mechanisms are still unknown (Insell and Zachariah, 1977; Liu et al., 2012). The trap forming process is basically the same as the normal traps. However, there is still doubt about their capability of capturing and killing the prey, and potential for generating predaceous trophic hyphae. Studies on the configuration change of normal-sized ring traps and giant ring traps were limited. Due to the rapid cell movement, quantifying the trap constriction in constricting ring trap-forming fungi was difficulty. Muller (1958) used mathematical models for the first time to verify Comandon and de Fonbrune’s prediction (1938) that trap inflation resulted in an increase more than triples in the motor cell volume. In the first model, he assumed the constricted motor cell as fusiform (Fig. 2.2a). By artificially intersecting it into six continuous cylinders, he was able to determine the volume of constricted motor cell by summing up 2 2 2 2 volumes of each cylinder expressed as V=1/6(d1 + d2 +d3 +…+ d6 )1/4πL (V: motor cell volume, dn: diameter of each cylinder, L: total length of one motor cell). The calculated volume inflation factor is 3.3. In the second model, he hypothesized the ring trap as torus (Fig. 2.2b) and obtained a rough concordant increase factor 3.2. However, the relation between the surface area and volume before and after trap constriction were never reported in previous articles. Considering that the surface area to volume ratio has biological significance by determining the cell size and fate, this value may provide useful information on trap constriction biomechanics. Taking the giant traps into account, the sizes of constricting ring traps vary in a wide range, and the change in the surface area is not consistent. Efficient closure of the traps may largely depend on intracellular structures. The debates overs the cell structures accounting for the rapid changes in the surface area and volume of ring trap cells arose from Couch (1937) and Duddington (1957), who suggested corporative action of colloidal material and water

27 imbibition through the ring stalk were the cause of trap expansion. Availability of water surrounding the ring traps as a critical factor causing trap expansion was suggested at the meantime by Rudek (1975), who found that applying firm air currents over traps only triggered the central motor cell’s expansion partially. Limited water intake through the stalk might slow the trap closure and impede full cell expansion. Benefiting from the prolonged constriction process caused by diluting sugar solutions, he was able to divide the trap constriction process into several stages, including pre-inflation, inflation and post-inflation. He focused on the arrangement of vacuoles and protoplasmic activity, proposing that motor cell expansion was achieved through liquid accumulation by vacuoles, which finally filled a considerable portion of the inflated cell. Muller believed that slippages of micro fibrils located along the inner wall of the ring trap also accounted for the expanding area after constriction. All of these findings are in close agreement with the conclusion that changes in osmotic potential of the cell and permeability of the cell membranes were related to rapid expansion. Additional support came from the intracellular fine structures of constricted and non-constricted ring cells revealed by Heintz and Pramer (1972), who demonstrated that membrane-bound inclusions and labyrinthine networks localized on the luminal side of the rings were redistributed or disappeared after trap constriction. The dynamic of constricting ring traps in active carnivorous fungi have not been comprehensively investigated in respect to functional morphology, physiology and biomechanics over decades. As the state-of-the-art methods develop, high-speed cinematography, micro-mechanical manipulation method, and physical modeling were widely used to verify mechanisms involved in fast cell movement. In this project, well-defined parameters (i.e., surface area and volume of motor cells, and internal/external diameter of ring traps, etc.) obtained from microscopic images were applied to build a mathematical model. By relating the increase factors of volume and surface area with cell constriction rates, new facets of constriction process was revealed. Furthermore, thedistribution and dynamics of the plasma membrane invaluably help to supplement our understanding of the trap constriction process.

2.2 Materials and methods 2.2.1 Fungal strains and growth condition Arthrobotrys dactyloides (ATCC 15595) and Arthrobotrys brochopaga (ATCC 13897) were ordered from ATCC (American Type Culture Collection). Cultures were maintained on 1.7% BBLTM corn meal agar slants at 25oC with subculture once every two months. Nematodes (Caenorhabditis elegans Carolina Biological Supply) were applied to 2-week-old

28 culture for trap induction.

2.2.2 Microscopy technique in recording constricting trap closure Ring traps were randomly selected from 20 culture plates. Fungal block with 1 cm x 1 cm surface area occupied by ring traps were cut off from the media. To trigger trap closure, 20 µl of 20% ethanol was applied to the edge of the culture. To record the closure process of constricting ring traps, a PixelFly CCD camera (Cooke Corp. Romulus, MJ) was use. Images were extracted from the video and used in measurement of motor cell dimensions, which were compiled using Image-Pro® Plus 6.2 (Media Cybernetics Inc., Bethesda, MD; Fig. 2.3).

2.2.3 Mathematical modeling to estimate increase factors of surface area and volume before and after trap constriction Two models were developed to estimate changes in surface area and volume of motor cells before and after constriction. These models involve particular assumptions about the configuration and were developed using empirical data on width and length of motor cell and trap diameter. Constricted motor cells are assumed to be spheres in the first model and ellipsoidal in the second model (Fig. 2.4).

In the following diagrams, S1 and V1 represented the total surface area and volume of non-constricted traps; r is the radius of the motor cell; R is the radius of the non-constricted ring trap

r R

2 2 2 2 S1=2πr x 2πR=4π rR; V1=πr x 2πR=2π r R

29 Model I: from torus to sphere

r”

r R

2 2 4 3 3 S2=3x4π r" = 12π r" ; V2=3x r" =4π r" 3

r"is the radius of the constricted motor cell. If we assume the external diameter of the motor cell remains the same after trap constriction, the radius of a constricted motor cell should be: R  r r"= therefore, 2

3 2  (R  r) S2=3π(R+r) ; V2= 2 Therefore, the increase factor of surface area and volume could be represented respectively by:

2 S 2 3(R  r) 1 =  S1 4Rr

3 3 V2  (R  r) (R  r)  1   2 2  2 V1 4 r R 4r R

Model II: from torus to solid of revolution If the constricted motor cell is assumed to be the solid of revolution formed by the quadratic function y  f (x)  x 2 -b around x -axis, the area and volume of one motor cell could be given by the definite integral, in which the constants could be calculated by substituting experiment-obtained parameters of the motor cell. In this model, the length of motor cell (l ) is equal to the length created by the intersection of y  f (x)  x 2 -b on l l x -axis, therefore, the range of x is   x  . The width of motor cell is equivalent to 2 2 the length created by dissection of solid revolution on y -axis.

30

l l 2 dy 2 2 ' 2 S3  2 l y 1 ( ) dx  2 l f (x) 1 ( f (x)) dx   2 dx 2

l l 2 2 2 2 2 V3= l  ( f (x)) dx   l (ax  b) dx   2 2 Therefore, the increase factors of surface area and volume could be represented by:

S3 V3 2  ;  2  S1 V1

2.2.4 Fungal sample staining with FM4-64 FM4-64 is a membrane-selective probe that stains the plasma membrane through endocytosis in eukaryotic cells. Agar block (0.5 mm x 0.5 mm x 0.2 mm) bearing networks of traps was cut out from the colony and carefully placed, hyphal side down, in liquid medium containing 25 µM FM4-64® (Invitrogen) on a No.1 cover glass (Fisher Scientific; Fig. 2.5). After two-minute staining in dark, fungal block was washed with ice old Hanks’ Balanced Salt Solution (HBSS).

2.2.5 Membrane dynamics recording using scanning confocal microscope The prepared sample was triggered for trap constriction by applying a drop of 25% ethanol over the agar block. Video recordings of trap constriction were captured with camera attached to Olympus FV500 Fluoview Confocal microscope with Green HeNe Laser and TRITC filter (Semrock TxRED4040A).

2.2.6 Freeze-substitution Growth of fungal specimen One-layered dialysis tubing was cut into 1 cm x 1 cm square and deionized by boiling in deionized water containing 0.1 M EDTA for 1 hour, followed by an additional 1

31 hour of boiling in water. The dialysis membrane was cooled at room temperature and placed aseptically on growing colonies. After new hyphae covered the membrane, nematodes were supplied to the culture for trap induction. Hyphae surrounding the membrane were severed using a sharp scalpel and the supporting membrane was transferred to a new noncolonized location on the agar for at least 1 hour.

Freeze substitution solution preparation

Osmium tetroxide (OsO4) and uranyl acetate were dissolved to HPLC-grade o anhydrous acetone which was pre-cooled at -80 C to make 2% OsO4 and 0.05% uranyl acetate substitution fluid. The fluid was aliquot to 2 mL metal weight attached polypropylene vials previously pierced with small holes on the lid. Vials were placed in precooled acetone contained in a glass jar with sides lined with dry ice, and stored in -80oC for 1 hour prior to cryofixation.

Cryofixation Cryogen reservoir was slowly lowered into 1 L stainless steel Dewar (Cole-Parmer Instrument Company, Chicago, IL) which was filled with liquid nitrogen. Propane was sprayed into the freezing reservoir to create propane bath (Fig. 2.6). Membranes supporting fungal cells were thrust into propane bath slightly off from the vertical entry. Once all the samples were frozen, they were transferred using glass pipette to liquid nitrogen for temporary storage.

Freeze substitution The cryofixed specimens were placed into the pre-cooled vials containing substitution fluid and stored at -80oC. Solution was refreshed once during 4-day substitution period. Following substitution, samples were rinsed by being transferred to -80oC pre-cooled vials containing HPLC acetone, and slowly warmed up at -20oC for 2 hours, 4oC for 1 hour, and finally room temperature for 1 hour in the fume hood. Samples were finally rinsed in 100% anhydrous acetone four times each for 30 minutes.

Infiltration, embedment and cell selection Specimens were infiltrated with acetone: Spurr’s resin mixture to pure resin. After completion of 100% resin infiltration, the membranes were placed with fungal side down onto a glass slide previously coated with tetrafluorethylene release agent (TFE). The specimen was

32 covered by placing 2 mL 100% resin and a transparent film over the resin, to create a 0.5 mm thick resin embedment sandwich. After polymerization was completed at 60oC, top films were pealed off and the polymerized embedment was finally removed from the tetrafluorethylene-treated glass slide. Dialysis tubing membrane was left embedded. Samples were examined with phase-contrast light microcopy. Giant traps were marked and excised from the embedment and mounted on blank resin stubs for ultra-thin sectioning.

Ultra-sectioning, post fixation, transmission electron microscope imaging Sectioned materials was stained using aqueous 1% uranyl acetate for 15 minutes and lead citrate for 4 minutes at room temperature. Sample was imaged using Zeiss 10 conventional transmission electron microscope (Zeiss, Thornwood, NY)

2.3 Results 2.3.1. Modeling of constricting ring traps before and after trap closure Measurements of ring trap sizes were obtained using Image-Pro® Plus 6.2 software from 35 video recordings of trap constriction (Table 2.1). For the normal-sized constricting 3 ring traps, the surface area and the total volume before trap constriction were S1 = 2.1 x 10 2 3 3 µm and V1 = 3.7 x 10 µm . For giant traps, the surface area and volume before constriction 4 2 4 3 were Sgiant = 1.69 x 10 µm and Vgiant = 6.02 x 10 µm . In our first model that treated motor cell expansion as a transformation from torus to R  r sphere, with the expanded radius as r " (r"  9.7 ), the total surface area increased to 2 3 2 4 3 S2 = 3.5 x 10 µm and the trap volume expanded to V2 = 1.1 x 10 µm . The mean increase in

S 2 trap surface area and total volume during inflation were thus by a factor of 1   1.7 and S1

V2  1   3.0 , respectively. The factors for the increase in surface area and volume based on V1 this model were in close agreement with the results obtained using Muller’s model (Muller, 1958), which estimated the factors as 1.4 and 3.2 (Table 2.2). Direct measurements from the video recordings showed that after trap constriction, the three junctions between motor cells moved towards to the trap center slightly. The diameter of the inflated motor cell was 10.5 µm, slightly larger than that of the trap which was assumed to maintain the unchanged outer diameter R+r. Therefore, when we applied the data

33 that we measured directly from the video clip, the calculated final surface area and volume were 4.2 x 103 µm2and 1.5 x 104 µm3, respectively. The resulting increase factor of surface area and volume was 2.0 and 4.1, respectively. The results were larger than the calculation from Muller’s model. For the giant traps, none of the expanded traps reach their maximum size after stimulation, and the changes in configuration could only be applied in our second model. Constricted motor cells were treated as ellipsoids in our second model. The three dimensional shape of the motor cell was represented by the solid of revolution formed by y  f (x)  x 2  b around x  axis . To facilitate this calculation, we located one motor cell of the trap on the x - y coordinate system by aligning the width of the trap cell along the x  axis and the maximum expansion direction along the y  axis . When the normal-sized ring trap reach full expansion, the length of its radius along the x  axis and y  axis were the same, as 21.0 µm with our measurement. The quadratic function with constants was y  f (x)  0.095x 2 10.52 . The surface area estimated with this function was 3.6 x 103 µm2.

4 3 Final volume was estimated as V3 = 1.2 x 10 µm . The increase in surface area and total volume was 1.7 and 3.1, respectively. Giant traps could not achieve full expansion in our observation, and when we located the constricted trap cell on x  y coordinate system, we measured the average width and length of the traps were 71.9 µm along the x  axis and 42.9 µm along the y  axis . The quadratic function that formed solid of revolution could be represented byy  f (x)  0.0165x 2  21. 44,

4 2 which gave us the surface area and volume of the inflated trap cells as Sgiant = 5.3 x 10 µm , 5 3 Vgiant = 1.7 x 10 µm . The percent of the region in the giant ring trap that were not constricted were calculated. Finally, the surface area and volume of the partially constricted trap were 2.8 x 104 µm2 and 1.9 x 105 µm3, respectively. The surface area increased 1.7 fold and the volume increase 3.1 fold.

2.3.2 Trap closure rate among ring traps of different sizes Almost 100 percent trap constriction occurs immediately after applying 25% ethanol to the fungal colony. Mechanical stimulation with micropipettes, which simulated the movement of the nematode worm through the ring lumen, showed that it took several seconds before the ring trap could respond. In both treatments, full expansion was achieved by normal-sized ring traps. However, giant ring traps could not constrict completely to occlude

34 the traps. Detailed trap closure process of Arthrobotrys dactyloides and A. brochopaga was recorded using a PixelFly CCD camera and the closure rate was represented by the increase of motor cell width through the recording process. When stimulated with a micropipette, there was a lag time of approximate 6-8 seconds immediately before the explosive volume increase (Fig. 2.7a). The maximum increase in the cell volume was achieved in less than 0.2 seconds in most cases. Stimulation of the traps with 25% ethanol slowed down the closure process, and motor cells reach their maximum sizes in 6 seconds (normal-sized traps) and 13 seconds (giant traps). Following the rapid expansion period, the expansion rate eventually levels off. Meanwhile, the expansion rate of giant ring traps was the same as the normal-sized constricting ring traps when measured as the diameter increase of the trap cell (Fig. 2.7b). Our videos also showed that stimulating one motor cell could result in inflation of all motor cells in some trials, or partial inflation in only one or two motor cells, implying that the motor cells of the traps are not independent sensors, instead, they communicate with each other through the constrained connection and signal transmission occurs through the septa.

2.3.3. Surface area to volume ratio before and after trap constriction The motor cell comprising the ring trap is a metabolic compartment where a multitude of chemical reactions occur. The ratio of the surface area and volume of motor cells before and after constriction were calculated for assessing cell physiology and behavior. Surface area to volume ratio after trap constriction dropped from0.56 to 0.28 in normal-sized ring traps and from 0.28 to 0.13 in giant ring traps.

2.3.4. Plasma membrane distribution during trap closure Our practice by triggering the trap with 25% ethanol slowed down the natural reaction of trap constriction approximately 50 times in both Arthrobotrys dactyloides and A. brochopaga, and made it sufficient to observe the process in details. New plasma membrane and premature cell wall ruptured the overlying cell wall and contributed to the new cell boundary as revealed in the scanning electron micrograph (Fig. 2.8A). The inner wall bulging out was continuous and extensible, suggesting that they existed before the constriction happened. To explain the generation of the expanded trap cell surface, living traps stained with FM4-64 was viewed with the scanning confocal fluorescence microscopy, showing that the plasma membrane lining the inner surface of the ring rearranged, and membranous network was gradually pushed to the expanded region of the constricted cell towards the center of the ring trap. During this process, the vacuole-like regions in the protoplasm

35 increased in size and some vacuoles coalesced to form a large clear vacuole finally (Fig. 2.8B). Series video recordings also revealed that networks of membranes beneath the inner portion of the ring cells were reorganized, and generated a larger clear area occupied the swollen ring cell. Within a fraction of a second, the other two cells composed of the normal trap reacted in the same way without being touched. In the giant ring-forming traps, the bulge of new cell boundary started in the middle of the triggered cell, but usually failed to reach complete expansion. Ultrastructures of such special ring trap were used to explain this phenomenon.

2.3.5. Ultrastructure of giant ring traps Giant ring traps were imaged using transmission electron microscopy. Arthrobotrys spp. belongs to Ascomycota indicating by woronin bodies located on the septum along the hyphae (Fig. 2.9A-B). Differences of the ultrastructure distinguished giant traps from normal-sized traps include the larger electron-lucent region between the cell wall and the plasma membrane and sparse distribution of inclusions in giant ring traps before trap closure. Micrographs also showed that cytoplasm of the giant ring cells stained less densely. A concentration of inclusions comprised of a sheeted array of individual thickening vesicles was distributed against the cell wall, and the organelles did not fill the entire motor cell, leaving a transparent region throughout the cell (Fig. 2.9C). A number of ultrastructural changes were evident after trap closure, including disappearance of labyrinthine networks and electron-lucent regions. The volume increase during trap constriction was accompanied by the fusion of several inclusions, forming a continuous membranous network spreading through the cell. However, no large vacuole was observed in our images (Fig. 2.9D).

2.4. Discussion Fast cell movement is very common in nature, and many organisms demonstrate rapid cell movement for different reasons. The telegraph plant (Codariocalyx motorius) is able to rotate its small lateral leaflets, and this rapid movement is a strategy to maximize light by tracking the sun. Plants also use rapid cell movement to facilitate the spread of seeds or pollen. For example, the squirting cucumber (Ecballium agreste) can forcefully eject their seeds within 1 second when the fruit is ripe; the dogwood bunchberry (Cornus canadensis) flower opens its petals and fires pollen in less than 0.5 milliseconds; the white mulberry tree holds the record for the fastest plant movement with flower petal movement taking 25 μs, in excess of half the speed of sound (Taylor et al., 2006). Others take advantage of rapid cell movement to avoid grazing, which is particularly common in plants that are attractive to herbivores. The

36 representative species is Mimosa pudica, which close their compound leaves to dislodge harmful insects. The most interesting group responds to stimuli rapidly for efficient capture of prey. The time scale of such predation movements can be as short as several milliseconds (Poppinga et al., 2013). Organisms perform the extraordinary motion includes plants using snap traps such as Venus’ Flytraps (Dionaea muscipula) and its sister species waterwheel plants (Aldrovanda vesiculosa), which shut traps within 100 seconds. The carnivorous sundew plant uses touch-sensitive tentacles to snap prey into its sticky leaf trap, and the snap action takes place in just 75 milliseconds (Hartmeyer, 2010; Poppinga et al., 2012; Hartmeyer et al., 2013). The bladderwort (Utricularia spp.) uses suction traps to engulf small prey within 0.5 miliseconds (Singh et al., 2011; Vincent et al., 2011). Beyong the plant kindom, a diverse of fungi also take advantage of fast movement to capure prey. For instance, constricting ring-forming Arthrobotrys spp. studied in this project produce active traps which respond rapidly to mechanical stimuli with capture movements. The rapid constriction of ring trap-forming fungus in about 0.3 second is one of the fastest movements in the fungal kingdom. The ability to capure prey at a rapid speed evolved undoubtedly as an advanced trait for predacious organisms. The active traps or mechanism increased the chance to obtain nutrient. As demonstrated in the predicted phylogenic tree based on rDNA and protein-coding sequences (Fig. 1.5), the constricting ring-forming fungi evolved as a terminal trap form as a necessary consequence, verifying that volutionary trend favored those that have increasing capture efficiency. Another interesting conclusion is that the constricting ring trap as a highly specialized trapping organ coevolving by mechanical fungi-nematode interaction also exists. For example, the slightly smaller diameter of ring trap than that of the nematode body maximizes the necessary friction between the worm and trap required for trap constriction; the vertical alignment of the traps along the hyphae matches the nematode’s movement plane. Fast cell movement in most case is associated with changes in the surface area and volume. Though the volume change during trap constriction was studied by Muller, the mathematical models he used for calculating the surface area and volume were not perfect because he overlooked one important fact that the connections between the motor cells remained constrained when the trap cells expanded. Our video recordings showed that the constrained area was pulled towards the center of traps when the motor cells expand, and the outline of the trap slightly deformed. In comparison, our model is closer to the real trap configuration change. Taking the the surface area and the volume into consideration at the same time gives us more comprehensive understanding of this dynamic process.

37 The surface area to volume ratio is not only related to the trap efficiency, it also determines the fate of the motor cells. When a cell becomes larger, the increase in the surface area is slow than that in the volume. Considering that substance and energy exchanges take place through the plasma membrane, the surface area to volume ratio become too small for a cell to survive when the cell increases its size. Larger cells have slower diffusion rates than smaller cells, and spherical cells will have slower diffusion rates than elongated cells. As a cell expands or increases in its volume, the cell’s ratio of surface area to volume decreases. All the mathematical models in our research showed that the constricted trap cells have their volume more than tripled after constricted with 1.7-fold increase in the surface area. The surface area to volume ratio sharply decreases. If giant traps reach full expansion, then, the ratio of surface area to volume would be significantly reduced. Providing that the motor cell of the giant trap expands beyond a certain limit, not enough materials will be able to cross the septa fast enough to accommodate the increasing cellular volume; moreover, secondary messenger in the signal transmission pathway would not mediate the primary stimuli fast enough to perform the rapid capture movement. This reasonably explained why the giant ring trap cannot fully constrict and why giant cells usually lysed in our culture. Therefore, favorable surface area/volume ratios should be maintained for future development of predaceous hyphae, otherwise the expanded trap cells cease to function. Studies on the membranous structures also invaluably help to explain the rapid trap constriction process. Though morphologically different, the cellular structures of two configurations of trap cells help to confirm that the dynamics of ring traps is due to their unique membranous structure. Fine structures present in the open trap include membrane-bound inclusions, labyrinthine networks and electron-lucent regions. In agree with previously published transmission electron micrographs, labyrinthine matrices, as the result of partial fusion between the inclusions, were organized into sheets localized densely on the luminal side of the ring cell only (Heintz and Pramer, 1972). Their location might explain why cell expansion occurred toward the trap center. Between the plasma membrane and cell wall on the luminal side of the ring is an electron-lucent region. After the trap constricts, inclusion membranes fuse and release the contents to the cytoplasm. Structures such as labyrinthine networks and inclusions disappear, implying that these structures are the resource of the increased surface. Incorporation of previously formed membrane meets the requirement for large, rapid, and irreversible increase in surface area and volume. Though the fibrillar portion of the cell wall ruptures, the inner premature portion remains intact and guarantees the cell viability. The abundant vesicles could transport cell wall materials that could be used in

38 predatory hyphae development to the enlarged cell surface. Our finds that the ring trap expansion involves redistribution and organization of intracellular inclusions and vesicles are also supported by an interesting observation from a series of videos recoding the trap closure process. It displayed that approximate six seconds was present between the application of the external stimuli and the explosive trap expansion in all cases, which is supposed to allow the arrangement of molecules necessary for vesicle reorganization, docking and fusion. Electron micrographs also explain the reason at cellular level that giant traps could not completely close and motor cells were unable to reach their maximum size. The limited supply of membrane from inclusions was insufficient to contribute to a fully expanded cell surface through inclusion fusion, which explained why the complete closure of giant ring traps was rarely observed in the culture. Volume increase by merely imbibing water from the surrounding area could not be the only mechanism controlling giant ring trap constriction; it was also subject to the availability of the supplied membranous materials. Since it is an inefficient trap form, generation of such trap as a predatory organ is assumed to be a waste of energy.

REFERENCES Comandom, J. de Fonbrune, P. 1938. Recherches experimentales sur les champignons predateurs du sol. CR Soc Biol (Paris) 129: 619-625.

Couch, J. N. 1937. The formation and operation of the traps in the nematode-catching fungus Dactylella bembicodes. Journal of the Elisha Mitchell Scientific Society 53: 301-309.

Drechsler, C. 1937. Some hyphomycetes that prey on free-living terricolous nematodes. Mycologia 29: 447-552.

Duddington, C. L. 1957. The Friendly Fungi; A New Approach to The Eelworm Problem. London: Faber.

Haard, K. 1968. Taxonomic studies on the genus Arthrobotrys corda. Mycologia 60:1140-1159.

Hartmeyer, I. and Hartmeyer, S. R. H. 2010. Snap-tentacles and runway lights. Carnivorous Plant Newsletter 39: 101-103.

Hartmeyer, I., Harmeyer, S. R. H., Masselter, T., Seidel, R., Speck, T. and Poppinga, S. 2013. Catapults into a deadly trap: The unique prey capture mechanism of Drosera glanduligera. Carnivvorous Plant Newsletter 42: 4-14.

Heintz, C. E. and Pramer, D. 1972. Ultrastructure of nematode-trapping fungi. Journal of Bacteriology 110: 1163-1170.

39 Insell, J. P. and Zachariah, K. 1977. A biometrical analysis of the giant constricting ring mutant of the predacious fungus Dactylella brochopaga. Protoplasma 93: 305-310.

Insell, J. P. and Zachariah, K. 1978. Some ring-trap mutants of the fungus Dactylella brochopaga Drechsler. Archives of Microbiology 117: 221-226.

Kumar, D. and Singh, K. P. 2006. Variability in Indian isolates of Arthrobotrys dactyloides Drechsler: a nematode-trapping fungus. Current Microbiology 52: 293-299.

Liu, K., Tian, J., Xiang, M. and Liu, X. 2012. How carnivorous fungi use three-celled constricting rings to trap nematodes. Protein Cell 3: 325-328.

Muller, H. G. 1958. The constricting ring mechanism of two predacious Hyphomycetes. Transactions of the British Mycological Society 41: 341-364.

Poppinga, S., Hartmeyer, S. R. H., Seidel, R., Masselter, T., Hartmeyer, I. and Speck, T. 2012. Catapulting tentacles in a sticky carnivorous plant. PLoS ONE 7: e45735.

Poppinga, S., Masselter, T. and Speck, T. 2013. Faster than their prey: New insights into the rapid movements of active carnivorous plant traps. Bioessays 35: 649-657.

Rudek, W. T. 1975. The constriction of the trapping rings in Dactylaria brochopaga. Mycopathologia 53: 193-197.

Schroeder, J. I., Hedrich, R. and Fernandez, J. M. 1984. Potassium-selective single channels in guard cell protoplasts of Vicia faba. Nature 312: 361-362.

Singh, A. K., Prabhakar, S. P. and Sane, S. P. 2011. The biomechanics of fast prey capture in aquatic bladderworts. Biology Letter 7: 547-550.

Taylor, P. E., Card, G., House, J., Dickinson, M. H. and Flagan, R. C. 2006. High-speed pollen release in the white mulberry tree, Morus alba L. Sexual Plant Reproduction 19: 19-24.

Vincent, O., Weißkopf, C., Poppinga, S., Masselter, T., Speck, T., Joyeux, M., Quilliet, C. and Marmottant, P. 2011. Ultra-fast underwater suction traps. Proceedings of the Royal Society-Biological Sciences 278: 2909-2914.

Zachariah, K. 1989. Chemical induction of trap closure in Dactylella brochopaga. Protoplasma 148: 87-93.

40 Table 2.1. Measurements from 35 ring traps using Image-Pro® Plus 6.2 software.

Before constriction After constriction Measured Mean + Measured range Mean + s.e.m. Normal traps range (µm) s.e.m. (µm) (µm) (µm) Trap inner radius (R) 13.4 - 19.3 15.8 (1.8) - - Ring cell radius (r) 3.3 - 3.9 3.5 (0.2) - - Motor cell length (l) 26.4 - 33.1 31.8 - - Inflated motor cell width (w) - - 18.5 - 24.6 21.0 (1.9) Before constriction After constriction Measured Mean + Measured range Mean + s.e.m. Giant traps range s.e.m. (µm) (µm) (µm) (µm) Trap inner radius (R’) 54.4 - 63.9 60.5 (2.6) - - Ring cell radius (r’) 6.9 - 7.4 7.1 (0.2) - - Motor cell length (l) 100.8 - 120. 2 108.5 (6.0) 66.5 - 76.8 71.9 (3.2) Inflated motor cell width (w) - - 37.2 - 45.6 42.9 (2.9)

1. 25 video records of normal-sized ring traps and 10 video records of giant traps were applied. 2. Surface area and volume calculated using mean values for trap inner radius, ring cell radius, and sizes of constricted motor cell.

41 Table 2.2. Comparison between increase in surface area and volume based on three models showing values before and after trap constriction.

Models Increase in surface area Increase in volume Muller’s model 1.4 3.2 Model I (Sphere ) predicted 1.7 3.0 Measured 2.0 4.1 Model II (Ellipsoid ) Normal traps 1.7 3.2 Giant traps 1.7 3.1

42 Figure 2.1. Conidia and giant ring trap of Arthrobotrys dactyloides. (a) Two-celled conidia supported by conidiophore; b) the external diameter of giant traps exceed in size five times that of the normal ring traps; c) a partial closed giant trap, only one cell of which has inflated. Scale bars, a = 10 µm, b and c = 20 µm.

43 Figure 2.2. Models used by Muller (1958) for volume calculation of constricted and non-constricted ring cells; a) the first model assuming each motor cell as fusiform after constriction; b) the second model assuming the entire trap as a torus before and after trap constriction. Sketches show cross-section and longitudinal section of a trap.

44 Figure 2.3 Measurement of trap size using Image-Pro® Plus 6.2, showing a giant trap before and after constriction.

45 Figure 2.4. Schematic diagrams of normal-sized ring traps and giant traps constricted before and after constriction. Nonconstricted traps are modeled as torus (a and d). Constricted traps are modeled as sphere (b) trap or ellipsoids (c and e).

46 Figure 2.5. Fungal material setup for scanning confocal microscopic imaging.

47 Figure 2.6. Cryofixation equipment used in TEM sample preparation through plunge freezing method. Propane gas sprayed into liquid N2 cooled reservoir turned to propane bath.

48 Figure 2.7. Constriction rate of ring traps of different sizes. A) Trap constriction in normal-sized ring traps triggered by a micropipette that simulates nematode movement. B) Trap constriction in normal-sized ring traps and giant ring traps triggered by 25% ethanol that slows down the closure process. Each point represents the mean value + standard error of the mean collected from video clips.

49 Figure 2.8. Configuration change of the plasma membrane during trap constriction. A) Scanning electron micrograph showing new plasma membrane and premature cell wall (circle) ruptured original cell wall (arrow); B) FM4-64 staining of the plasma membrane showing dynamics of plasma membrane in the process of trap closure. One motor cell is highlighted by arrow.

50 Figure 2.9. Transmission electron micrographs showing the intracellular structure of the motor cell before and after a trap constriction. A-B) Woronin bodies on both sides of septum; C) Before trap constriction, numerous inclusions (arrow) are located beneath the plasma membrane. D) Membranous vesicles (arrowhead) form networks distributing over the partially closed trap cell. Cells were prepared by freeze substitution. Bar = 1 µm.

51 Chapter 3 Actin filament distribution during the constricting ring trap development

ABSTRACT Cytoskeletal elements, particularly the actin filaments, function as a dynamic filamentous network whose remodeling underlies the fundamental process of shape determination, cytokinesis, and cell-cell interaction. The closure of the constricting ring is the most sophisticated fungal cell movement and involves a series of cellular changes. To investigate how the actin cytoskeleton is engaged in such fast fungal cell movement, we used molecular fluorescence-labeling technique and efficient fungal transformation system, in which RFP labeled actin fusion protein aided the tracking of fungal actin in trap cells. Actins were organized into patches and evenly distributed in all three trap cells. By imaging their distribution before and after ring trap closure, we found that actin patches appeared to concentrate at the region proximal to the center of the trap. Actin serves an important role in constricting ring-forming fungi by engaging in specific cable distribution through the motor cells of constricting ring trap. Actin inhibition assay demonstrated that abnormal actin polymerization alter the usual trap development pattern by generating short stalk-like cells, aberration hyphae and nondirective branching without further development of ring trap cells. Our results suggested that microfilament bundles play a role in cytoplasmic streaming of vesicles and facilitate the asymmetrical transportation of these vesicles to the developing trap branch.

3.1 Introduction to the role of F-actin in fungal development Actin is a protein found in all eukaryotic cells and as a crucial component of the cytoskeleton. It participates in cytokinesis, cell motility, shape determination, and a variety of other morphogenic events (Small et al., 1982, 1995, 1998, 1999). Polymeric filamentous actin, also called F-actin, is one form of cellular actins. It is an asymmetrical polymer of G-actin monomers, and further form double helix structure of microfilaments by two parallel F-actin strands laying on each other (Berepiki et al., 2011). It is reported to serve an important role in the establishment of cell-cell and cell-matrix interactions (Amos and Amos, 1991; Bray, 1992). To serve diverse roles in the cell development, actin interacts with a broad spectrum of proteins (Small et al., 1998, 1999). Regulation of microfilament dynamics is facilitated by actin binding proteins (ABPs), such as cofilin, which disassembles F-actin; profilin, which sequesters G-actin; and capping proteins, which cap the plus end of filaments and inhibit their

52 disassembly (Berepiki et al., 2011). Actin filaments are associated with microtubules (Hoch and Staples, 1983), microvesicles (Bourett and Howard, 1990; Hoch and Howard, 1980), spindle pole bodies, and microfilamentous septal belt (Girbardt, 1979; Hoch and Howard, 1980; Patton and Marchant, 1978; Soll and Mitchell, 1983). With the aid of certain proteins such as the Arp2/3 complex, fimbrin and tropomyosin, special structural such as patches, cables, and actomyosin contractile rings are formed with the orderly organization and arrangement of F-actin. Different functions are associated with higher order structures. For example, actin cables are important in polarized transport; actin cytokinetic rings are contractile structures that guide septum formation during cytokinesis; actin cortical patches locate at sites of active endocytic uptake, mediating endocytosis and plasma membrane infusion during endocytosis in both filamentous fungi and yeast (Berepiki et al., 2011). A newly discovered structure around the cell nucleus is the perinuclear F-actin collar ring (Kopecká et al., 2013). Functioning as an intracellular funicular cabin for the cell nucleus, perinuclear actin cables suspend the nucleus in the central position in the cell and move the nucleus along the polarity axis of actin cables (Kopecka et al., 2001, 2012). Importantly, the variety of actin arrays performs mechanical functions in fungal growth and development. Actin proteins are found in both the cytoplasm and the cell nucleus (Grummt, 2006). Their distribution and dynamics are regulated by cell membrane signal transduction pathways that integrate received stimuli and stimulate the restructuring of the actin networks as a response. The dynamics of the actin cytoskeleton in yeasts demonstrate that an induced mutation in actin or actin-stabilizing treated actin could cause a decrease of actin turnover, and is linked to cell aging and death (Hamann et al., 2008; Gourlay et al., 2004). Conversely an increase in actin turnover by disturbing the expression of an actin-bundling protein SCP1 can resulted in the activation of a pathway that regulates cell longevity, leading to lifespan extension of dividing and non-dividing yeast cells (Gourlay et al., 2004; Heeren et al., 2004). Manipulation and visualization of actin filaments to reflect their distribution and function in cells requires the use of advanced microscopy and video technology. Previous research on the visualization of actin filaments was conducted using fluorescence microscopy with the aid of either fluorophore-conjugated phallotoxins or actin antibodies in yeast and a variety of Basidiomycota fungi (Anderson and Soll, 1986; Heath, 1987; Hoch and Staples, 1983; Jackson and Heath, 1990; Raudaskoski et al., 1988, 1991; Roberson, 1992; Runeberg et al., 1986; Salo et al., 1989; Temperli et al., 1990; Tiburzy et al., 1990). Localization of fungal actin was first achieved using immuno-electron microscopy in the rice blast pathogen, Magnaporthe grisea, showing actin is associated with an exclusion zone in the cytoplasm

53 presented in the mature penetration peg. Its location concentrated in the peripheral cytoplasm of subapical regions of the hyphal tip and the core-region of the Spitzenkörper (Bourett and Howard, 1990). Actin in penetration pegs is thought to be not merely associated with the growing tip but also involved in the generation of penetration force through directed cytoplasmic elongation (Bourett and Howard, 1991, 1992). The distribution of the actin cytoskeleton was also studied in the plant pathogenic fungus Sclerotium rolfsii using immunofluorescence techniques and immunocytochemistry, showing that actin fibers are mainly localized in the hyphal tip by forming a plaque positioned parallel to the long hyphal axis in the peripheral cytoplasmic regions (Roberson, 1992). Actin filaments are concentrated in vesicle-rich area; particularly in a specific region of the hyphal apical called the Spitzenkörper, suggesting their involvement in tip growth (Grove, 1978). Directional apical expansion involves the coordinated migration of vesicles transporting raw materials for cell growth (Wessels, 1986; Harold, 1990). In a wide variety of studies on fungal actin, F-actin facilitates polarized tip growth through participation in the regulation of organelle distribution, vesicle delivery and fusion at the growth site, and the location of calcium channels (Gooday, 1995; Jackson and Heath, 1993). Disruption of F-actin in certain studies using actin-destabilizing chemicals confirmed its function in normal apical growth, tip shape, and septum formation. Studies on actin filaments demonstrate their diverse patterns and distribution by forming unique and complex structures, which are associated with different functions in both yeast and filamentous fungi. However, their distribution and dynamics are unknown in nematophagous fungi that form constricting rings. The goal of this chapter is to describe the organization of the F-actin cytoskeleton during trap growth and development in these fungi. To achieve this goal, we constructed an expression vector that harbored an actin fusion protein and a red fluorescent protein which are under control of ToxA promoter. A scanning confocal microscope was applied to visualize the F-actin cytoskeleton in these nematophagous fungi.

3.2 Materials and methods 3.2.1 Construction of lifeact-RFP containing vector Plasmid pCT74 was a gift from Dr. Lynda M. Ciuffetti (Department of Botany and Plant Pathogens, Oregon State University, OR; gene map provided in Fig. 3.1). Plasmid pAL-3-Lifeact and pBC-hygro were purchased from Fungal Genetics Stock Center (gene map provide in Fig. 3.2, Fig. 3.3). Propagated plasmids were extracted from E. coli according to the protocol provided with the plasmid extraction mini-kit (GenScript L00420). Firstly,

54 restriction enzyme site Xho was engineered into the forward primer ToxAF and an 18 bp overlap sequence complimentary to Lifeact-TagRFP was engineered into the reverse primer ToxAR. Secondly, this pair of primers was used to amplify a 400 bp fragment containing ToxA promoter and partial ToxA gene from pCT74 via polymerase chain reaction (PCR). To amplify an approximate 800 bp fragment containing Lifeact and Tag RFP from pAL3-Lifeact, we designed a 19 bp sequence complimentary to the ending sequence of ToxA in the forward primer LifeactF and restriction enzyme site ClaI in the reverse primer LifeactR. PCR was performed with 100 ng plasmid DNA in a standard 25 μl reaction under standard PCR reaction conditions with 61oC and 60oC annealing temperatures, respectively. After PCR reaction, each fragment contained an overhang region that shared the same sequence with the other fragment. Next we performed atypical PCR using single primer ToxAF and the first-step PCR products from pCT74 to generate a single strand of ToxA fragment, and used LifeactR with the amplification product of pAL3-Lifeact to generate a single strand of Lifeact-RFP. We then ran another 20 cycles of atypical PCR by combined these PCR products. Since each fragment contained a complimentary overlapping region, the amplification product served as an amplification template and primer. PCR was performed using 63.5oC as the annealing temperature. At the end of this step, the recombination fragment linked ToxA promoter and Lifeact-RFP together. Finally we used a pair of primers, ToxAF and LifeactR, to perform 30-cycle of PCR to allow amplification of the recombinant gene (Fig. 3.4). PCR product purification and gel fragment purification were performed after each step according to the instruction in the QIAquick PCR purification kit (QIAGEN Sciences, MD, USA) and the Wizard SV gel and PCR clean-up system (Promega, Madison, WI, USA).

3.2.2 Fungal protoplast preparation A 3 mm x 3 mm block covered by hyphae was cut and transferred from Arthrobotrys brochopaga stock culture to 3.8% potato dextrose agar and cultured in the dark for 7-10 days o at 24 C. When the fungal colony covered the media, 10 ml 0.9 M H2O2 was used to flush each culture plate to stimulate conidia formation. After a 10-minute treatment, H2O2 solution was drained and the plate was uncovered to dry for 5 minutes in the aerated hood. Cultures were incubated in the dark at 24oC to allow the generation of conidia. After three days, we used distilled H2O to flush the culture to collect the conidia. Conidia concentration was calculated by counting the conidia using a hemocytometer under a light microscope. Conidia108 were inoculated in 0.3% sabouraud liquid broth modified antibiotic medium 13 (BBL) (pH 7.5) in 125 ml flasks on a rotary shaker (160 rpm) at 24oC for 2 days to allow conidia germination.

55 After 2 days, the germinating conidia and young mycelium were harvested and washed with

50 ml of MN solution (0.3 M MgSO4, 0.3 M NaCl). Wet mycelium 0.5 g was resuspended in 5 ml MN buffer containing 5 mg/ml snailase from Helix pomatia (B&K Technology Group, China Co. Ltd); 5 mg/ml lysing enzyme from Trichoderma harzianum (Sigma Aldrich); lyticase from Arthrobacter luteus (Sigma Aldrich); and 5 mg/ml cellulose; and incubated on a shaker (180 rpm) at 28oC for 3 hours. Protoplasts were isolated from the undigested mycelia and cell wall fragments by passing the enzyme digestion mixture through sterilized lens paper. Protoplasts were then precipitated by centrifugation at 5,000 rpm for 3 minutes at room temperature. The pelleted protoplasts were washed twice in 5 ml 1 M sorbitol and centrifuged at 3,000 rpm for 5 minutes. The protoplast pellet was resuspended in 1 ml of 1 M sorbitol and

100 mM CaCl2 buffer. Protoplasts were counted using a hemeocytometer.

3.2.3 Fungal transformation and transformant selection DNA-mediated transformation of fungi was performed according to the methods described by Paul Bowyer (2001), Xu et al., (2005a, b). For restriction enzyme-mediated transformation, we mixed 150 μl of protoplasts (1 x 107 - 5 x 107 /ml) with 40-60 U restriction enzyme HindIII (in buffer II) and 10 μg linear plasmid pBChygro-lifeact-RFP (linearized by 20 U HindIII just before transformation) in a 15 ml Falcon tube. Transformation was carried out on ice for 20-30 minutes. Then we added 600 μl of PTC solution (50% polyethylene glycol 6000, PEG 6000, 20 mM Tris-HCl, pH 7.5, 50 mM CaCl2) to the mixture with gentle mixing, followed by incubation at room temperature for another 20 minutes. At the end of the transformation, we add 5 ml 1 M sorbitol and 100 mM and centrifuge the tube at 4000 g for 5 minutes. Subsequently, the protoplasts resuspended in 10 ml of ice-cold regeneration medium

(RM: 1.2 M D-sorbitol, 1% potato dextrose broth, 0.2% yeast extract, 0.1% K2HPO4, 0.05%

MgSO4 and 0.3% NaNO3) or (1 M sucrose, 0.5% yeast extract and 0.1% bacto-peptone) and incubated on shaker at 26oC for 12 hours or overnight. Then we transferred the aliquots of protoplast suspensions onto selection medium (regeneration medium containing 0.5% agar, 200 μg/ml of hygromycin B and 100 μg/ml ampicillin). The transformant colonies were established after 6-day incubation at 24oC in dark. Nematode extracts will be applied to the recovered fungal colonies, and after 2 hours incubation, hyphae with the branching stalk cells will be selected for live cell imaging. For electroporation, 108 conidia were suspended in ice-cold EB (10 mM Tris-HCl pH 7.5, 270 mM sucrose, 1 mM Lithium-acetate) and then 2 μg plasmid pBChygro-lifeact-RFP were added, and kept on ice for 15 minutes. Electroporation was performed using BioRad

56 electroporation. Immediately after electroporation, ice cold YED (1% yeast extract, 2% D-glucose and 5 mM uridine) were added to the proponent fungal cells, and kept on ice for another 15 minutes. A control experiment was carried out using pBChygro constructed with the Tag-RFP but without the lifeact sequence, which express RFP but cannot bind filament actins. It will be used as a background control.

3.2.4 Laser scanning confocal microscopy of living cells AX70 light microscopy (Zeiss) was used for imaging. A set of filter Texas Red (excitation: 545/30 nm, emission 620/60 nm) was used to observe fluorescence from molecular Tag-RFP.

3.3 Results 3.3.1 Protoplast generation The potential for using protoplasts as tools in genetic studies in fungi makes them useful as recipients in transformation and transduction. To obtain large quantity of protoplasts, it was necessary to collect sufficient viable conidia from the culture. We found that 6-week fungal colonies cultured at 25oC in dark enabled a large amount of conidia production.

Alternatively, the conidial production was promoted by 0.9 M H2O2 (Fig. 3.5). Though it is impossible to synchronize the growth of filamentous fungi, a collection of a population of conidia germinating approximately at the same time allowed the generation of protoplasts more efficiently and more homogeneous in terms of physiological condition such as organelle distribution and biochemistry (Fig. 3.6). Our experiment found that protoplast yield was higher during the initial germinated phase of conidia than in filamentous hyphae. Protoplast production was affected by several variables. Factors such the buffer, digestion enzyme system and digestion time were critical for successful generation of protoplasts. Osmotic stabilizers CaCl2, NaCl and sorbitol guaranteed integrity, maximum yield and stability of the released protoplasts. Incubation for 3-4 hours allowed morphological and biochemical systems to remain intact with active protoplasts, and had little influence on the regenerative capacity. We observed that increasing the digestion time or incubation in the buffer resulted in larger protoplast size, which required a longer time to regenerate after transformation. Cell wall formation initiated the regeneration stage, and the production of a complete and functional cell was usually achieved within 24 hours.

57 3.3.2 Construction of hybridized vector containing fluorescent tagged F-actin Vector pBC-hygro, which relies on antibiotic resistance conferred by a modified form of fungal hygromycin B phostranserase (hph) gene for selection (Silar, 1995; Carroll et al., 1994), was used as a template for the construction of transformation vector pBChygro-Lifeact-TagRFP (Fig. 3.7). ToxA promoter drove the expression of lifeact and RFP, which were cloned downstream. Sequence analysis confirmed successful vector construction. To test the ability of the expression vector to drive expression of down stream genes, the resultant construct was transformed into protoplasts of A. brochopaga. Positive transformants demonstrated efficient expression of fluorescent proteins (Fig. 3.8).

3.3.3 F-actin distribution before and after trap closure Tag RFP-linked actin filaments were observed under Texas Red filter showing that actin complex was present in ring traps and trap stalk (Fig. 3.9). It was organized into patches and evenly distributed in all three trap cells. Actin-absent regions shown as translucent areas were occupied by numerous vacuoles. After trap closure, fluorescent labeled actin patches appeared to concentrate at the region proximal to the center of the trap. Actin meshwork was readily distinguished from ground cytoplasm. A high density of actin was presented in the connection between two trap cells. Lifeact-RFP patches were also closely associated with the stalk cells.

3.3.4 Effects of actin inhibitor on trap development and function Cytochalasin D is an inhibitor of actin polymerization, and disrupts actin microfilament activity by preventing polymerization of actin monomers (Allen et al., 1980). In ourllen experiment we tested the effect of cytochalasin D on actin dynamics for proper trap development and function. By investigating the initial stage of trap formation after treatment with a wide range of cytochalasin D concentration (0.1-10 μM), we found that 1 μM cytochalasin D started to change the growth properties of developing cells and caused arrest of the cell cycle (Fig. 3.10B). Though trap stalks were produced perpendicularly along the hyphae, the following generation of arching motor cells was not observed. The results showed that the state of the actin filaments strongly influenced the trap development possibly by disturbing the trafficking routes through the cytoplasm provided by actin networks and blocking the signal transduction. As concentration increased, developing hyphae demonstrated abnormal crooked and deformed tips and short branches (Fig. 3.10C). No trap stalks were observed. A drastic inhibitory effect on the growth rate of the fungal colony was

58 observed evaluated by culture diameter. Such effect was also demonstrated in the liquid culture. This study showed a strong dependence of trap cell development on the organization and degree of polymerization of actin filaments. However, among mature traps (produced 48 hours after nematode inoculation on the culture), 87% traps (26/30 tests) functioned normally assessed by complete constriction. This implied that mechanical properties of the traps were not affected once the traps matured.

3.4 Discussion For many years, reports have been made on successful experiments to formulate digestion solution to strip fungal cells of their rigid cell wall in order to obtain protoplasts alive which could be regenerated under favorable conditions (Minoru et al., 1984; Balasubramanian et al., 2003). However, due to the spatial arrangement of polymer components such as beta-glucan, chitin microfibrils, and cellulose, fungal cell wall are not easy to be digested (Peberdy, 1978a, b, 1979). There are no universal techniques and conditions for the protoplast generation because the diversity of the wall composition and the arrangement of these component polymers among different fungal species. Typically preparing a cocktail of several lytic enzymes was reported to be effective to lyse the rigid cell wall and liberate protoplasts (Peaberdy and Ferenczy, 1985). In this study, large-scale production of fungal protoplasts from germinating conidia were achieved by applying enzyme cocktail, including snailase, lysing enzyme from Trichoderma harzianum, lyticase from Arthrobacter luteus and cellulose. The crude enzyme preparations and commercially available lytic enzymes were effective against a wide range of fungal species. Our lytic enzyme system enabled us to get enough vigorous protoplasts that were useable for fungal transformation. Different versions of fluorescent proteins have been constructed into expression vectors to expand the color palette of markers and widely used as the premier in reporter for investigation of gene expression and protein localization (Chalfie et al., 1994). Since the green fluorescent protein (GFP) was first cloned from the jellyfish Aequorea Victoria in 1992 by Prasher, derivatives were shortly thereafter successfully conferred fluorescence to cultures in diverse organisms such as mammals (Pines, 1995), plants (Haseloff and Amos, 1995; Sheen et al., 1995) and yeast (Flach et al., 1994; Niedenthal et al., 1996). ToxA promoter from Pyrenophora triticirepentis, was reported strong enough to drive the expression of EYEP, ECFP and mRFP1, and applicable in heterologous expression in ascomycetes. It has showed promise to be useful for variety of gene expression study in filamentous fungi (Ciuffetti et al., 1997; Lorang et al., 2001; Andrie et al., 2005). The constructed vector in our experiment

59 conferred bright cytoplasmic RFP-actin to A. brochopaga, and has proven very useful for driving strong expression of exogenous genes. Actin localization in filamentous fungi was aided with fluorescence microscopy with either fluorophore-conjugated phalotoxins (Anderson and Soll, 1986; Heath, 1987; Hoch and Staples, 1983a; Jackson and Heath, 1990; Raudaskoski et at., 1988; Runeberg et al., 1986; Salo et al., 1989; Temperli et al., 1990) or antibodies raised against animal actins (Raudaskoski et al., 1988, 1991; Roberson, 1992; Runeberg et al., 1986; Salo et al., 1989; Temperli et al., 1990; Tiburzy et al., 1990). Previous reports on actin distribution in fungal hyphae displayed their wide existence in diverse forms. For example, they were observed as actin cables throughout the hypha, the hyphal apex and septa, and they were also associated with small short-lived patches in the cortical cytoplasm that localized at subapical region (Delgado-Alvarez et al., 2010). This project demonstrated for the first time how F-actin cytoskeleton was distributed in the nematode-destroying fungi Arthrobotrys brochopaga. It reflected distinct roles of actin filaments and broadens the spectrum of F-actin structures in filamentous fungi. Though previous research highlighten the role of microtubuels in the hyphal growth direction (Riquelme et al., 1998), there is no doubt that the cytoskeletal networks coordinately control the hyphal morphogenesis. The effect of cytochalasin D on actin is achieved through inhibiting both the association and dissociation of subunits at the barbed end of actin (Brown and Spudich, 1981; Flanagan and Lin, 1980). In our study, it was used to elucidate the effect of abnormal actin polymerization on trap development. Previous research showed that cytochalasin caused an increase in branching and dry weight at low concentration, and induced swollen and irregular hyphae, even inhibition of growth at high concentration (Allen et al., 1980). Various fungal strains might show different responses with respect to their sensitivity to the cytochalasin. The effect of the cytochalasin D on Arthrobotrys brochopaga was to alter the usual trap development pattern. The initial response at low concentrations of this drug demonstrated the generation of short stalk-like cells without further development of ring trap cells. High concentrated drug treatment exhibited aberration hyphal development and nondirective branching without trap formation. Development of traps can be regarded as a specific growth pattern of a branching hypha, and the directional branch extension could result in a ring trap. To our knowledge, this growth pattern requires the presence of location-specific vesicles and is possibly associated with asymmetric cell wall deposits. Vesicles were believed to contain various enzymes and cell wall precursors. Inhibition of microfilament bundles would affect the cytoplasmic streaming of these vesicles and disturb

60 transportation of the vesicles to the site of incorporation. Though the action of filaments with respect to their participation in signal transduction and directional localization of organelle remains to be worked out, the results of our study suggested that the proper organization of actin filament was associated with normal growth of the ring traps. Compared with conventional approaches for the labeling of cytoskeletal filaments, transformation of fungal cell with fluorescence labeled targeting gene offers a more convenient and effective took, especially by the combination with a fluorescence gene that would allow gene expression to be traced.

REFERENCES Allen, E. D., Aiuto, R. and Sussman, A. S. 1980. Effects of cytochalasins on Neurospora crassa I. Growth and Ultrastructure. Protoplasma 102: 63-75.

Amos, L. A. and Amos, W. B. 1991. Molecules of the cytoskeleton, London/l Macmillan.

Anderson, J. M. and Soll, D. R. 1986. Differences in actin localization during bud and hypha formation in the yeast Candida albicans. Journal of General Microbiology 132: 2035-2047.

Andrie, R. M., Martinez, J. P. and Ciuffetti, L. M. 2005. Development of ToxA and ToxB promoter-driven fluorescent protein expression vectors for use in filamentous ascomycetes. Mycologia 97: 1152-1161.

Balasubramanian, N., Juliet, G. A., Srikalaivani, P. and Lalithakumari, D. 2003. Release and regeneration of protoplasts from the fungus Trichothecium roseum. Canadian Journal of Microbiology 49: 263-268.

Berepiki, A., Lichius, A. and Read, N. D. 2011. Nature Reviews Microbiology 9: 876-887.

Bourett, T. M. and Howard, R. J. 1990. In vitro development of penetration structures in the rice blast fungus Magnaporthe grisea. Canadian Journal of Botany 68: 329-342.

Bourett, T. M. and Howard, R. J. 1991. Ultrastructural immunolocalization of actin in a fungus. Protoplasma 163: 199-202.

Bourett, T. M. and Howard, R. J. 1992. Actin in penetration pegs of the fungal rice blast pathogen, Magnaporthe grisea. Protoplasma 168: 20-26.

Bowyer, P. 2001. DNA-mediated transformation of fungi. Molecular and Cellular Biology of Filamentous Fungi. Oxford University Press, 33-46.

Bray, D. 1992. Cell movements. London: Garland.

Brown, S. S. and Spudich, J. A. 1981. Mechanism of action by cytochalasin: evidence that it binds to actin filament ends. Journal of Cell Biology 88: 657-662.

61 Carroll, A. M., Sweigard, J. A. and Valent, B. 1994. Improved vectors for selecting resistance to hygromycin. Fungal Genetics Newsletter 41:22.

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. and Prasher, D. C. 1994. Green fluorescent protein as a marker for gene expression. Science 263: 802-805.

Ciuffetti, L. M., Tuori, R. P. and Gaventa, J. M. 1997. Asingle gene encodes a selective toxin causal to the development of tan spot of wheat. Plant Cell 9:135-144.

Delgado-Alvarez, D. L., Callejas-Negrete, O. A., Gómez, N., Freitag, M., Roberson, R. W., Smith, L. G. and Mouriño-Pérez, R. R. 2010. Visualization of F-actin localization and dynamics with live cell markers in Neurospora crassa. Fungal Genetics and Biology 47: 573-586.

Flanagan, M. D. and Lin, S. 1980. Cytochalasins block actin filament elongation by binding to high affinity sites associated with F-actin. Journal of Biological Chemistry 255: 835-838.

Flach, J., Bossie, M., Vogel, J., Corbett, A., Jinks, T., Willins, D. A. and Silver, P. A. 1994. A yeast RNA-binding protein shuttles between the nucleus and the cytoplasm. Molecular and Cellular Biology 14: 8399-8407.

Girbardt, M. 1979. A microfilamentous septal belt (FSB) during induction of cytokinesis in Trametes versicolor. Experimental Mycology 3: 215-228.

Gooday, G. W. 1995. They dynamics of hyphal growth. Mycological Research 99: 385-394.

Gourlay, C. W., Carpp, L. N., Timpson, P., Winder, S. J. and Ayscough, K. R. 2004. A role for the actin cytoskeleton in cell death and aging in yeast. Journal of Cell Biology 164: 803-809.

Grove, S. N. 1978. The cytology of hyphal tip growth. In: The Filamentous Fungi, III: Developmental Mycology 28-50. New York, J. Wiley and Sons.

Grummt, I. 2006. Actin and myosin as transcription factors. Current Opinion in Genetics & Development 16: 191-196.

Hamann, A., Brust, D. and Osiewacz, H. D. 2008. Apoptosis pathways in fungal growth, development and ageing. Trends in Microbiology 16: 276-283.

Harold, F. M. 1990. To shape a cell: an inquiry into the causes of morphogenesis of microorganisms. Microbiological Reviews 54: 381-431.

Haseloff, J. and Amos, B. 1995. GFP in plants. Trends in Genetics 11: 327-328.

Heath, I. B. 1987. Preservation of a labile cortical array of actin filaments in growing hyphal tips of the fungus Saprolegnia ferax. European Journal of Cell Biology 44: 10-16.

Heeren, G., Jarolim, S., Laun, P., Rinnerthaler, M., Stolze, K., Perrone, G. G., Kohlwein, S. D., Nohl, H., Dawes, I. W. and Breitenbach, M. 2004. The role of respiration, reactive oxygen species and oxidative stress in mother cell-specific ageing of yeast strains defective in the RAS signaling pathway. FEMS Yeast Research 5:157-167.

62 Hoch, H. C. and Howard, R. J. 1980. Ultrastructure of freeze-substituted hyphae of the basidiomycete Laetisaria arvalis. Protoplasma 103: 281-297.

Hoch, H. C. and Staples, R. C. 1983. Visualization of actin in situ by rhodamine-conjugated phalloin in the fungus Uromyces phaseoli. European Journal of Cell Biology 32: 52-58.

Jackson, S. L. and Heath, I. B. 1990. Visualization of actin arrays in growing hyphae of the fungus Saprolegnia ferax. Protoplasma 154: 66-70.

Jackson, S. L. and Heath, I. B. 1993. Roles of calcium ions in hyphal tip growth. Microbiological Reviews 57: 367-382

Kopecká, M., Kawamoto, S. and Yamaguchi, M. 2013. A new F-actin structure in fungi: actin ring formation around the cell nucleus of Cryptococcus neoformans. Microscopy 62: 295-301.

Kopecká, M., Gabriel, M., Takeo, K., Yamaguchi, M., Hata, K. and Yoshida, S. 2001. Microtubules and actin cytoskeleton in Cryptococcus neoformans compared with ascomycetous budding and fission yeast. European Journal of Cell Biology 80: 303-311.

Lorang, J. M., Tuori, R. P., Martinez, J. P., Sawyer, T. L., Redman, R. S., Rollins, J. A., Wolpert, T. J., Johnson, K. B., Rodriguez, R. J., Dickman, M. B. and Ciuffetti, L. M. 2001. Green fluorescent protein is lighting up fungal biology. Applied and Environmental Microbiology 67: 1987-1994.

Minoru, Y., Yutaka, K., Akikazu, A. and Takaaki, F. 1984. Rapid method for converting fungal cells into protoplasts with a high regeneration frequency. Experimental Mycology 8: 386-390.

Niedenthal, R. K., Riles, L., Johnston, M. and Hegemann, J. H. 1996. Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast. Yeast 12: 773-786.

Patton, A. M. and Marchant, R. 1978. An ultrastructural study of septal development in hyphae of Polyporus biennis. Archives of Microbiology 118: 271-278.

Peberdy, J. F. 1978a. Wall biogenesis by protoplasts. In Fungal Walls and Hyphal Growth. Cambridge University Press, London.

Peberdy, J. F. 1978b. Protoplasts and their development. In The Filamentous Fungi 3: 119-131. Edward Arnold, London.

Peberdy, J. F. 1979. Fungal protoplasts: isolation, reversion, and fusion. Annual Review of Microbiology 33: 21-39.

Peberdy, J. F. and Ferenczy, L. 1985. Fungal Protoplasts: applications in biochemistry and genetics. Volume 6. Marcel Dekker, Inc.

Pines, J. 1995. GFP in mammalian cells. Tends in Genetics 11: 326-327.

Raudaskoski, M., Salo, V. and Niini, S. S. 1988. Structure and function of the cytoskeleton in filamentous fungi. Karstenia 28: 49-60.

63 Raudaskoski, M., Rupes, I. and Timonen, S. 1991. Immunofluorescence microscopy of the cytoskeleton in filamentous fungi after quick-freezing and low-temperature fixation. Experimental Mycology 15: 167-173.

Riquelme, M., Reynaga-Peña, C. G., Gierz, G. and Bartnicki-Garcia, S. 1998. What determines growth direction in fungal hyphae? Fungal Genetics and Biology 24: 101-109.

Roberson, R. W. 1992. The actin cytoskeleton in hyphal cells of Sclerotium rolfsii. Mycologia 84: 41-51.

Runeberg, P., Raudaskoski, M. and Virtanen, I. 1986. Cytoskeletal elements in the hyphase of the homobasidiomycete Schizophyllum commune visualized with indirect immunofluorescence and NBD-phallacindin. European Journal of Cell Biology 41: 25-32.

Sheen, J., Hwang, S., Niwa, Y., Kobayashi, H. and Galbraith, M. 1995. Green-fluorescent protein as a new vital marker in plant cells. The Plant Journal 8: 777-784.

Silar, P. 1995. Two new easy-to-use vectors for transformation. Fungal Genetics Newsletter 42: 73.

Small, J. V., Rottner, K., Hahne, P. and Anderson, K. 1999. Visualising the actin cytoskeleton. Microscopy Research and Technique 47: 3-17.

Small, J. V., Herzog, M. and Anderson, K. 1995. Actin filament organization in the fish keratocyte lamellipodium. Journal of Cell Biology 129: 1275-1286.

Small, J. V., Rinnerthaler, G. and Hinssen, H. 1982. Organization of actin meshworks in cultured cells: the leading edge. Cold Spring Harb Symo Quant Biology 46: 599-611.

Small, J. V., Rottner, K. and Kaverina, I. 1999. Functional design in the actin cytoskeleton. Current Opinion in Cell Biology 11:54-60.

Small, J. V., Rottner, K., Kaverina, I. and Anderson, K. I. 1998. Assembling an actin cytoskeleton for cell attachment and movement. Biochimica et Biophysica ACTA/General Subjects (Amsterdam) 1404: 271-281.

Salo, V., Niini, S. S., Virtanen, I. and Raudaskoski, M. 1989. Comparative immunocytochemistry of the cytoskeleton in filamentous fungi with dikaryotic and multinucleate hyphae. Journal of Cell Science 94: 11-24.

Soll, D. R. and Mitchell, L. H. 1983. Filament ring formation in the dimorphic yeast Candida albicans. Journal of Cell Biology 96: 486-493.

Temperli, E., Roos, U-P. and Hohl, H. R. 1990. Actin and tubulin cytoskeletons in germlings of the oomycete fungus Phytophthora infestans. European Journal of Cell Biology 53: 75-88.

Tiburzy, R., Hock, H. C., and Staples, R. C. 1990. Isolation and identification of actin from the phytopathogenic filamentous fungus Uromyces appendiculatus. European Journal of Cell Biology 53: 364-372.

64 Wessels, J. G. H. 1986. Cell wall synthesis in apical hyphal growth. International Review of Cytology 104: 37-39.

Jin, X., Mo, M. H., Wei, Z., Huang, X. W. and Zhang, K. Q. 2005a. Transformation and mutagenesis of the nematode-trapping fungus Monacrosporium sphaeroides by restriction enzyme-mediated integration (REMI). The Journal of Microbiology 43: 417-423.

Xu, J., Mo, M., Huang, X. and Zhang, K. 2005b. Improvement on genetic transformation in the nematode-trapping fungus Arthrobotrys oligospora and its quantification on dung samples. Mycopathologia 159: 533-538.

65 Table 3.1. Plasmid and primers used in recombinant PCR for construction of hybrid expression vector.

Plasmids gene Resistance Reference pCT74 ToxA promoter Ampicillium pAL3-Lifeact Lifeact-TagRFP Ampicillium pBC-hygro hph Chloramphenicol FGN42:73

Amplified genes Primers Tm Sequences ToxAF 60.8oC ToxAF: TCAGTCTCGAGTGGAATGCATGGAGGAG Partial ToxA ToxAR 64.4oC CAAATCTGCGACACCCAT CCATGGCCTATATTCATTCAAT LifeactF 63.8oC GAATGAATATAGGCCATGG ATGGGTGTCGCAGATTTG Lifeact-TagRFP LifeactR 59.5oC TACC ATCGAT TTACTTGTACAGCTCGTCCATG Restriction enzyme sites are underlined and overlapped fragment is in italics

66 Figure 3. 1. Vector map of pBC74 (from J. Lorang, Oregon State University). This vector harbors a 416 bp length of ToxA promoter and partial ToxA gene constructed in a Blueskrip backbone, with ampicillin resistant gene and hygromycin resistant cassette inserted at SAlI site.

Sequence of constitutive ToxA promoter region and partial of ToxA gene from Pyrenophora tritici-repentis. Restriction enzyme sites (ClaI and NcoI) are underlined.

5’ATCGATGGAATGCATGGAGGAGTTCTGTACGCGCAATTCCGCTCTCCGTAAGGATGCTTCGGA GGTGCACATGGTCTCATACATGTAGGCCCGACGAGGATCGAGTCGGTTCCGAAGTAGGATCGTC TCGATTGTTGGGCATCATTGCATGGACATTCAGAGGGCCTACTGATACCTGGAATCCGCACCGTC CGGCTACCTAGCAATAAGATTCTGTGTATATAAAGGGCTAAGGTGTCCGTCCTTGATAAAACCAC CACCCTCAACAACTTACCTCGACTATCAGCATCCCGTCCTATCTAACAATCGTCCATCGGTATCC AACTCCAACTCTATTCGCAGGGTCCTAGAATCGTAAGTACACGCTTATATCTTGTTGCCAGCGAT AGCTGACAATGAATGAATATAGGCCATGG 3’

67 Figure 3.2. Vector map of pAL3-Lifeact. The expression vector harbors the Lifeact gene (50 bp) and Tag red fluorescent gene (734 bp).

Sequence of Lifeact-GS-linker-N-terminal and TagRFP region. Restriction enzyme sites are underlined. GGATCC: BamHI; CCATGG: NcoI; GATATC: EcoRV; GTCGAC: SalI; CTCGAG: XhoI

Ggatccatgggtgtcgcagatttgatcaagaaattcgaaagcatctcaaaggaagaaggctcgatggtgtctaagggcgaagagctgattaaggagaac atgcacatgaagctgtacatggagggcaccgtgaacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccat gagaatcaaggtggtcgagggcggccctctccccttcgccttcgacatcctggctaccagcttcatgtacggcagca……cttcaagaccacatacagat ccaagaaacccgctaagaacctcaagatgcccggcgtctactatgtggaccacagactggaaagaatcaaggaggccgacaaagagacctacgtcgag cagcacgaggtggctgtggccagatactgcgacctccctagcaaactggggcacaaacttaatggcatggacgagctgtacaagtaagatatcaagctta tcgataccgtcgacctcgag

68 Figure 3.3. A GFP expression vector harboring ToxA promoter, lifeact, and TagRFP. Plasmid pBC-hygro-Lifeact is based on pBC-hygro which contains chloramphenicol resistant gene for bacteria selection and hygromycin B resistant gene for transformed fungal selection.

Sequence of multiple clone site in pBC-hygro.

Ggtaccgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatccactagttctaga gcggccgccaccgc

69 Figure 3.4. Recombinant PCR to generate hybridized vector pBC-hygro-Lifeact-TagRFP. This transformation vector has 1.2 kb fragment of ToxA-Lifeact-TagRFP region fused to pBC-hygro at the XhoI and ClaI sites.

70 Figure 3.5. Colony of Arthrobotrys brochopaga on 17% potato dextrose agar with massive conidia enhanced by 0.9 M H2O2 treatment (two-celled conidia shown in-frame figure).

71 Figure 3.6. Conidia with germination tubes and spherical shaped healthy protoplast released by cocktail enzyme digestion. A) Young conidia developing germ tubes (arrow); B) protoplasts (arrowhead) released from the germinating conidia demonstrating uniform devoid of residual cell walls.

72 Figure 3.7. RCR products of ToxA promoter region (`418 bp, lane1), Lifeact-TagRFP (~820 bp, lane 2), and the hybridized fragment (~1.2 kb, lane 3).

73 Figure 3.8. Transformed protoplasts containing pBChygro-Lifeact-TagRFP. (a-b) transformed protoplasts (arrows) after 12 hours under bright field and Texas Red filter showing the expression of the Tag-RFP; (c-d) transformed protoplast (arrowhead) after 36 hours under bright filed and Texas Red filter set showing RFP. The generated hyphae inherited the RFP-containing vector, indicating the successful integration of the transformation plasmid into the fungal genome.

74 Figure 3.9. Transformed Arthrobotrys brochopaga harboring pBChygro-Lifeact-TagRFP. A ring trap before constriction under bright field (A) and Texas Red filter (B) showing distribution of actin skeleton; a constricted ring trap under bright filed (C) and Texas Red filter set (D) showing more concentrated distribution of actin networks toward the center of the trap. Bar = 20 µm.

75 Figure 3.10. Effects of actin inhibitor cytochalasin on the morphology of trap-generating hyphae of Arthrobotrys brochopaga. A) Normal hyphae growth on 17% corn meal agar; B) Low concentrated (1 μM) cytochalasin treated hyphae showing ceased development of traps; C) High concentrated cytochalasin (10 μM) treated hyphae showing nondirectional growth. Scale Bars = 30 µm.

76 Chapter 4 Analysis of ring trap development related proteins

ABSTRACT Two-dimensional electrophoresis and mass spectrometry offers a unique approach to study nematophagous fungi trapping mechanism at protein level. Protein analyses on constricting ring-forming fungi at vegetative and predatory stage provided useful information on the role of important proteins that play critical roles in trap development and function. Proteins of significance include structural protein, such as mitochondrial ribosomal protein s24, COX3 mRNA-specific translational activator PET494, and YLR242c, which contribute to the structural integrity of the ribosome and mitochondrion; Bud site selection protein RAX1 homologue, required for the establishment of the bipolar budding pattern and bud site selection, supposed to function in trap generation site selection and maintain arching pattern of branching hyphae; vacuolar ATP synthase B in the membranes of vacuoles, Golgi apparatus and other coated vesicles might function to catalyze transmembrane movement of substances in metabolically active cells, and enhances hydrolase activity. Other proteins include those that participate in mRNA transcription and protein translation, as 40S ribosomal protein SO-B transcription factor. The result revealed a key set of predation-related proteins, and it will serves as a start for the study of trap development- and function- related protein function to understand the potential pathway involved in predation lifestyle transition.

4.1 Introduction Development of specialized trapping structures occurs during the predatory stage of a fungal life cycle is a fascinating feature that guarantees the successful predation by the nematophagous fungi (Barron, 1977). Naturally, nematophagous fungi survive in soil as saprophytes, utilizing cellulose and other polysaccharides as nutrient resources (Nordbring-Hertz et al., 2006). In environments with high carbon/nitrogen ratios, direct capture of nematodes by predatory fungi provides them with competitive advantage over strictly saprophytic fungi. The formation of trapping devices enables these fungi to adapt to low nutrient environments (Barron, 2003; Yang et al., 2012). As facultative predators, the degree of dependence on nematodes for survival varies among nematophagous fungi, but increasing predatory ability more efficient trapping seems to have evolved as a response to nitrogen-limiting habitats (Liu et al., 2009). The remarkable morphological adaptations in these fungi and their dramatic predating strategies are fascinating. Transfer from the saprophytic to predatory stage requires the production of

77 predacious devices from hyphal branches. Trap development can be constitutive or is induced in response to signals from surrounding soils and host nematodes (Dijksterhuis et al., 1994). Trap formation involves multiple structural adaptations that accommodate carnivorous behavior. For example, all adhesive traps, including knobs, branches and nets, share common features such as the numerous cytosolic organelles (dense bodies) and extracellular polymers, both of which perform specific corresponding functions in predation (Dijksterhuis et al., 1994; Tunlid et al., 1991). The genetic basis of trap development in Monacrosporium haptotylum was investigated by Ahrén et al. (2005) by comparing the global pattern of gene expression with expressed sequence tags (ESTs). Based on four different cDNA libraries which were constructed from fungal mycelium and trapping knobs, they found down-regulated genes accounted for 10.6% of the total number of fungal cloned genes and up-regulated genes accounted for 6.8%. Genes that were differentially expressed in trap cells versus mycelia shared high sequence similarity with those involved in regulating fungal morphogenesis, cell polarity, stress responses, and protein synthesis and degradation. A number of up-regulated genes in knob cells were homologues with those participating in glycogen metabolism. Others were related to the formation of dense bodies that function in the storage and secretion of adhesive substances in trap cells during the switch to the predatory phase. A significant proportion of genes that had putative roles in transcription, cellular transport and transport mechanism, cell death and aging, and DNA synthesis, however, showed lower expression levels in knobs than in the mycelium Global patterns of gene expression during different stages of infection were further examined in knob-producing M. haptotylum with the aid of a cDNA microarray (Fekete et al., 2008). There were dramatic shifts in the transcriptome during fungal adhesion, penetration and digestion of the nematodes. In the early stage of infection, genes associated with glycogen metabolism were highly expressed to generate the pressure needed for penetration of the host. In the course of digestion, genes related to protein synthesis and metabolisms were dramatically up-regulated, and most of them are critical for fungal morphogenesis and pathogenesis. In the late phase of host colonization, gene expression reverts to that occurring pre-infection. Intracellular proteins have also been analyzed during the induction and trap formation stages in the net-forming species Arthrobotrys oligospora, which lives mainly as a saprophyte in diverse soil environments. The development of three-dimensional networks involves a response to the signals the host receives and a series of cellular processes that

78 result in morphological changes (Yang et al., 2011). In the early stage of trap formation, rising demands for energy and substrates for macromolecule biosynthesis are coupled with increased levels of proteins that participate in cell wall and membrane biogenesis, energy production and conversion, and intracellular trafficking. In the early infection stage, proteins encoded by adhesion-related genes increase sharply to enable nematode capture. As host colonization starts, proteins involved in biosynthesis of glycerol, glucans, glycans and chitin are activated to facilitate new cell wall formation and cell proliferation, which results in host penetration. Proteomic analysis of the knob-producing fungus Monacrosporium lysipagum has been based on a partial proteome map, and over 50 housekeeping proteins and enzymes were identified (Khan et al., 2008). The switch from vegetative hyphal growth to predatory trap formation is accompanied by increased levels of proteins involved in carbohydrate metabolism, energy conversion, and membrane and cell wall biogenesis. These results are concordant with previous molecular studies on other nematode-trapping fungi, showing that a key set of trap morphological- and pathogenicity-related proteins were differentially expressed during trap formation. In this study, we aimed to identify proteins that were crucial for shaping trap morphology. To achieve this goal, a protocol was designed to ensure the efficient extraction of proteins from liquid-cultured fungi mycelia. With the aid of the high resolution of two-dimensional gels after electrophoresis, we were able to compare the protein expression patterns between fungal samples with traps and vegetative mycelia. Trypsin digestion and MALDI-TOF mass spectrometry were used to identify distinct proteins contributing to trap formation. The proteomic study provided us with powerful experimental tools to answer some open mechanistic questions such as whether the trap development is associated with expression of trap-specific proteins.

4.2 Materials and Methods Fungal culture Arthrobotrys brochopaga (ATCC12897) was grown on corn meal agar for one week. Agar blocks covered with abundant mycelium were cut and transferred to 125 ml 17% sabouraud dextrose broth at pH 7.4 and incubated at 24oC for the production of mycelia.

Protein extraction Two-week old mycelia were harvested by centrifugation at 20,000 g for 10 minutes. The pellet was suspended in 1 ml PGSK buffer and centrifuged at 20,000 g for another 10

79 minutes. The mycelia pellet was stored in liquid nitrogen overnight and then ground up in a mortar in liquid nitrogen. To dissolve the proteins, 30 mg of lyophilized powder was transferred to 1.5 ml chaotrope sample solution containing 7 M urea, 2 M thiorea, 4% (w/v) CHAPS, 0.7 M mercaptoethanol, and 20 μl protease cocktail. The sample mixture was centrifuge at 20,000 g for 20 minutes at 4oC, and the supernatant was collected and precipitated with 10% (w/v) TCA in ice-cold acetone containing 0.07% (v/v) 2-mercaptoethanol. After gentle mixing, the solution was incubated on ice for 30 minutes and then spun at 20,000 g for 10 minutes. The harvested pellet was washed with ice-cold acetone containing 0.07% (v/v) 2-mercaptoethanol. Total protein was recovered by centrifugation at 20,000 g for 15 minutes at 4oC. Finally, the supernatant was removed and the protein pellet was settled to air dry. The dried protein pellet was dissolved in 1 ml of rehydration buffer containing 7 M urea, 2 M thiorea, 4% carrier CHAPS, 50 mM DTT, 3/10 40% ampholytes (0.2% v/v), and bromophenol blue. Soluble and membrane associated proteins were totally extracted and used for protein analysis. Experiments were replicated 3 times.

Quantitative protein assay Before rehydrating IPG strips, we performed a protein quantity assay based on the Bradford standard procedure to determine the concentration of solubilized protein. The standard used in this experiment was bovine serum albumin O.D.595 (Bio-Rad 500-0002). Reagents in the rehydration buffer used in our research were compatible with the Bio-Rad protein assay. Protein concentration was calculated based on a standard curve. A volume of sample equivalent to 250 μg protein was placed in a fresh Eppendorf tube with fresh rehydration buffer added to bring the final volume to 200 μl, which was used in the following IPG strip rehydration.

IPG strip rehydration IPG strips of 11 cm length with pH range 4-7 (Bio-Rad) were used in this study. Rehydration of IPG strips was completed in the rehydration/equilibration tray by loading them into a 200 μl rehydration buffer which was pre-dissolved with 250 μg of protein sample. Strips were covered with 3 ml mineral oil and left on a level bench overnight for complete absorption.

Isoelectric focusing (IEF) We drained the rehydrated IPG strips from the mineral oil and transferred each of

80 them to a clean channel in the PROTEAN IEF cell with the correct polarity positioning. The wire electrode at each end of the channel was previously covered with a clean paper wick soaked with 10 μl of deionized water. Each IPG strip was covered with 2-3 ml mineral oil. Parameter setting varied according to sample and buffer composition, sample quantity, IPG length and pH range. A primary concern is to ensure that the current does not to exceed 50 μA per IPG strip. The first dimension isoelectric focusing was performed at 10oC, and the focusing was complete when the voltage reached 8,000 V or volt-hours rose to 30,000-40,000 V-hr. To attain the optimal focusing result, we programmed the PROTEAN IEF cell for the following four steps: linearly increased the voltage to 250 V for 15 minutes, to 8,000 V for 3 hours, then rapidly increased the voltage to 10,000 V for 40,000 volt-hours, and finally slowly decreased the voltage and maintained the IEF at 50 V.

Equilibration and SDS-PAGE It is necessary to equilibrate the IPG strips in SDS-containing buffer prior to running the second dimension to eliminate the effect of charges on the peptides. First, the IPG strips were transferred into the rehydration tray containing 4 ml equilibration buffer I (6 M urea, 0.375 M Tris-HCl, pH 8.8, 20% glycerol, 2% (w/v) dithiothreitol). To facilitate the reduction and alkylation of proteins, the tray was placed on an orbital shaker and gently shaken for 10 minutes. After 10 minutes IPG strips were transferred to 4 ml equilibration buffer II (6 M urea, 0.375 M Tris-HCl, pH 8.8, 20% glycerol, 2.5% (w/v) iodoacetamide) and incubated for another 10 minutes. Equilibrated IPG strips were briefly rinsed in 1 x TGS running buffer (Tris - glycine - SDS) and placed in a precast SDS gel cassette which was overlaid with 0.5% agarose solution (0.5% agarose, 1x Tris/glycine/SDS, 0.003% Bromophenol Blue). We performed the second dimensional electrophoresis in an electrophoresis cell filled with 1x TGS running buffer, and started the electrophoresis with 200 V constant voltages. At the end of electrophoresis, the protein gel was removed from the electrophoresis cell and placed in G-250 Coomassie blue staining solution for overnight staining.

Standard SDS gel staining, destaining and imaging The gels were stained at room temperature in staining solution (0.025% Coomassie brilliant blue R250, 40% methanol, 7% acetic acid) for 6 hours or overnight, and destained first in destaining solution I (40% methanol, 7% acetic acid) for approximately 30 minutes to remove excess stain. The second destaining was completed in destaining solution II (7% acetic acid, 5% methanol) with renewal twice a day until most protein spots stood out from

81 the gel background. Stained gels were scanned and analyzed with PDQuest software (Bio-Rad Laboratories, Inc., Hercules, CA), and spots were manually edited including spot delete, join, and splits. Artifactual spots such as smear and streak, as well as spots that were unable to be analyzed were erased from the images. Protein gels could be stored in a refrigerator at 4oC for up to two months.

Trypsin digestion and sample preparation for mass spectrometry Spots of acceptable darkness on the gel were used for identification of proteins because the genome of Arthrobotrys brochopaga is unknown hence the chances for identification of decent darkness spots is likely. We performed in-gel trypsin digestion of proteins according to the procedure modified from the Promega Trypsin in-Gel protein digestion protocol (Flannery et al., 1989; Shevchenko et al., 1996; Rosenfeld et al., 1992). All of the samples were dried in a speed-vacuum concentrator (Savant Speed Vac Concentrator, Model SVC-100 H) until the volume was reduced to approximately 10 ml. This took different lengths of time depending on the sample size and the speed-vacuum. Samples labeled for mass spectrometry could be stored at 4oC shortly before the next step. Trypsin used in this work was porcine sequencing-grade modified trypsin (Promega, CA, USA).

MALDI-TOF mass spectrometry MALDI-MS calibration standard and crystal matrix used in this experiment was ProteoMass Angiotensin (Sigma Aldrich A8846) and Cyano-4-hydroxycinnamic acid (Sigma Aldrich C8982), respectively. The protein sample was mixed with equal volume of matrix, and loaded onto the metal plate and scanned using MALDI-TOF Mass spectrometry. FlexControl and FlexAnalysis were used for data collection.

Data analysis and protein identification The peptide mass range of 600-3000 Da was used for the database search. Data were analyzed using two different protein search tools: MASCOT and Protein Prospector (MS-FT http://prospector.ucsf.edu). Based on the peaks characterizing each digested protein, corresponding proteins of the highest similarity were identified. The genome of Arthrobotrys brochopaga is unknown; therefore, the database was searched against all data from all species. When the peptide masses were matched to protein sequences in the database, the intensities of matched peptides and sequence coverage for the identification of proteins were also considered for better match.

82 4.3 Results Separation and detection of protein spots on 2D gels Different fragmentation of fungal materials and multiple sample extraction solutions that contained the neutral chaotrope (such as urea or a mixture of urea and thiourea), DTT reductant and CHAPS detergent were tested for global proteome extraction and purification. Final concentration of protein in the extraction solution was 3 mg/ml and extraction rate equaled 15% of the initial dry mycelia used for protein extraction. In our work, the optimization of sample preparation was achieved by liquid nitrogen grinding and ultrasonic fragmentation combined with TCA-acetone precipitation.

Identification of proteins in mycelia with ring traps Extraction of proteins from the pure traps was not successful as performed in another trap-forming fungus Monacrosporium lysipagum (Khan et al., 2008). Initially, attempts were made in this research to extract proteins from the trap cells only, but it was found that detachment of pure ring traps was not possible and material for the proteomic study was insufficient. Protein maps from the vegetative and predatory stages of A. brochopaga showed that over five hundred of peptides were detected using Coomassie blue staining after eliminating the background signals. By comparing two gels using PDQuest 2D analysis software (Fig. 4.2 A-B), we found 70 proteins (12.4%) showed significantly different expression. For database search and function study, we focused on seven peptide spots of these proteins that were noticeably expressed in ring traps, and matched each spot to a protein in the database. These identified proteins via MASCOT include homologues that were associated with energy generation and budding site selection (Table 4.1). One protein was mitochondrial ribosomal protein s24 from Cryptococcus neoformans var. neoformans, which contributes to the structural integrity of the ribosome. Another protein involved in energy-production was COX3 mRNA-specific translational activator PET494 from Zygosaccharomyces rouxii. It codes a peripheral membrane protein that is localized mainly on the mitochondrial inner membrane and is required for the expression of the mitochondrial gene cytochrome c oxidase subunit III (COX3) (McMullin and Fox, 1993). Bud site selection protein RAX1 homologue from putative Candida dubliniensis CD36 was another interesting gene, which is a multi-pass membrane protein and is required for the establishment of the bipolar budding pattern. This protein plays a role in selecting bud sites at both the distal and proximal poles of daughter cells as well as determining the division site on mother cells. Vacuolar ATP synthase B from Penicilium chrysogenum was also detected in the protein

83 expression profile. It is found in the membranes of vacuoles and Golgi apparatus and other coated vesicles, and functions to catalyze transmembrane movement of substances. When vesicle fusion activity increases in metabolically active cells, this protein also enhances hydrolase activity. 40S ribosomal protein SO-B from Trichoderma reesei functioning in protein translation also demonstrated increased expression in trap cells. 40S subunit interacts with initiation factor eIF1 during initiation phase of protein translation and facilitates scanning of messenger RNAs (Maitra et al., 1997; Rabl et al., 2011). Other proteins included transcription factor from Pichia pastoris GS115, which plays a critical role in regulating the unfolded protein response (De Schutter et al., 2009). Membrane structure-associated protein also showed increase expression, and the identified homologous protein is membrane protein YLR242c from yeast Saccharomyces cerevisiae. This protein functions in transport of membrane anchor glycosylphosphatidylinositol intermediates into ER lumen and is required for normal intracellular sterol amount and distribution (Kajiwara et al., 2008; Swain et al., 2002; Tinkelenberg et al., 2000; Tong et al., 2010). These data represent the first 2D gel comparison maps of proteins from a nematode-trapping fungi for which the genome has not been sequenced, and it is the first report on proteomic analysis of constricting ring-forming fungi Arthrobotrys spp. A key set of structural proteins and energy production related proteins are differentially expressed in ring trap cells, providing insight on the requirement of morphological changes and energy-input for the production of predatory organs. Cross-species identification is feasible in this research, because most cytoplasmic proteins are conserved across fungal species. However, structure proteins such as those present in cell wall are specific to fungal species, and therefore, homology of these proteins is less likely.

4.4 Discussion The key object of this study was to create a proteome map of Arthrobotrys brochopaga with trap-development associated protein identifications. 2D protein maps facilitated comparison of proteins extracted from the mycelia with and without traps and will aid further studies of pathogenicity-related proteins and the predation process. The global proteome extraction with no further modifications enabled the separation of over five-hundred proteins at a high resolution. Success of protein identification in our study was comparable with other proteomic studies involving filamentous fungi for which there is no genomic information available. For example, in the work of Khan et al. (2008), 20% of proteins out of 500 spots were identified from the total protein extracts of Moacrosporium lysipagum using a

84 cross-species identification method. Previous research has reported potential proteins that are related to trap formation from nematode-trapping fungi such as adhesive knob-forming Arthrobotrys species. These authors found that most of the proteins are house-keeping proteins, which participate in basic cell communication and signaling pathways (Ahrén et al., 2005; Khan et al., 2008; Fekete et al., 2008; Yang et al., 2011). A gene expression microarray study of Monacrosporium haptotylum carried out by Ahrén et al. (2005) showed that homologues for genes that were up-regulated in adhesive knob cells include glycogen phosphorylase, ubiquinol, cytochrome c oxireductase, alkaline serine protease, cuticle degrading serine protease, ribosomal proteins, heat-shock proteins and ATP synthase. In addition, tubulin beta and alpha chain, actin gamma, transaldolase, and peroxidase/catalase were also commonly identified proteins present in knob forming M. lysipagum. In my study, significant differences were found in protein patterns between vegetative hyphae and the trap cells. A suite of proteins related to constricting ring-trap development were identified, including homologues that are associated with energy generation. Previous proteomic research on constricting ring-forming fungus by Tsai et al. (2002) cloned Ca2+/calmodulin-dependent protein kinase gene (CaMKs) from Arthrobotrys dactyloides and explored its function during trap response to the external stimuli. They found that trap cells could convert and transduct the extracellular signals into the cells by changing cytosolic Ca2+ levels, and subsequent activation of calmodulin-regulated components in the trap cells results in opening of the water channels. The water in the surrounding environment rushes into motor cells, resulting in trap constriction (Chen et al., 2001). These authors hypothesized that CaMKs is involved in the signal transduction pathway by mediating protein phosphorylation, which further amplifies and diversifies the action of Ca2+-mediated signals (Hook and Means, 2001; Stull, 2001). CaMKs is one of the important proteins responsible for rapid inflation of motor cells and plays a critical role in the signal-induced fungal predation stage. Our results are most meaningful in the case of RAX1, a bud site selection related protein. The presence of RAX1 is especially interesting because it has at least two functions. In addition to facilitating the localization of other bud site selection proteins, such as a distal bipolar budding landmark BUD8 and the proximal pole landmark BUD9 (Fujita et al., 2004; Kang et al., 2004), it also interacts with RAX2 protein, which is required for the maintenance of the bipolar budding pattern. The mechanism for selection of a trap generation site in constricting ring-forming fungi is unknown. RAX1 and coordinating bud site selection

85 proteins are highly likely to participate in locating the ring trap generation sites. A potential hypothesis is that RAX1 is expressed after receiving an external signal (polysaccharides secreted from nematodes) and coordinated with the down-stream proteins to assemble trap-forming related molecules to the trap generation site. Additionally, it is reported that RAX1 functions in cytokinesis by forming a ring concentrated at the mother-bud neck and the tip of the bud. During the cytokinesis, the RAX1 ring splits and endows each progeny cell with a RAX1 ring with the additional RAX1 localized at the distal bud pole of the newborn daughter cell. RAX1 ring might be involved in cytokinesis when the branching hyphal cell developed into three trap cells. During axial budding, RAX1 facilitates the transient localization of Bud3p, Bud4p, or Ax12p/Bud 10p at the cortex (Chant and Herskowitz, 1991; Halme et al., 1996; Roemer et al., 1996; Sanders and Herskowitz, 1996). Deletion of some of these genes will convert the bud-site selection to a different budding pattern. In S. cerevisiae, the bud-site on the cell cortex is predetermined. Different from yeast cells, positioning of the trap cell in nematophagous fungi is supposed to be induced by landmark proteins at random positions along the hyphae. Cortical proteins may also provide the positional information to direct future trap generation events. Our results are also meaningful in the case of the translation activator PET494 protein. Translational activator PET494 of COX3 mRNA coded by a nuclear gene is associated with the inner mitochondrial membrane. This suggests the possibility that PET494 may play a role in localizing hydrophobic cytochrome oxidase subunit III to the inner mitochondrial membrane (McMullin and Fox, 1993). Meanwhile, activator protein PET494 mediates an interaction between the targeting mitochondrial coded cytochrome c oxidase subunit III (COX3) mRNA and the ribosomal small subunit (Haffter et al., 1991; Costanzo and Fox, 1986). Since cytochrome c oxidase is a critical enzyme in the mitochondrial respiratory chain and helps with the production of ATP, COX3 mRNA translation activator PET494 facilitate energy production by activating COX3 translation. PET494 proteins could only be detected in cells overproducing this protein; therefore, significant expression of this protein in trap producing cells implies that trap production is an energy-consuming process. The finding of this protein suggests active growth and enhanced metabolism during the transition from vegetative hyphae to trap cells. Vacuolar ATP synthase B identified in trap cells belongs to the ATPase alpha/beta chains family, and it functions in vacuolar network acidification and the ATP metabolic process. This housekeeping enzyme could acidify various compartments of the endocytic pathway, which plays a key role in protein sorting, intracellular balance of H+ and many other

86 cellular processes (Yamashiro et al., 1990; Forgac, 1989; Mellman et al., 1986). The increased expression of vacuolar ATP synthase B is essential for maintaining the proper pH state of the vacuole. This is crucial for normal growth and function of the expanded trap cells after they intake three times the volume of water. Another important role of vacuolar ATP synthase B is that it couples the energy of ATP hydrolysis to proton transport across intracellular membranes and powers the transmembrane movement of substances. A wide range of vesicle and vacuole fusion occurs during irreversible trap expansion (Chapter 3), and the distribution of inclusion through transmembrane transportation guarantees material supply for cell development. A previous study also showed that subunit B of vacuolar ATPase has an actin binding site that mediates interactions between vacuolar ATP synthase and actin filament (Zuo et al., 2006). The potential role of actin during trap constriction has been presented in the previous chapter, and it provides insights into how actin filaments coordinately function and contribute to fast trap constriction. Another prominent function of the fungal vacuole is to serve as a storage site for calcium. In species with fast responding time, vacuoles are believed to provide temporary, high speed storage for calcium ions. Previous research (Stull, 2001) modeled the calmodulin and Ca2+ during the trap constriction. As a dynamic structure, vacuole can rapidly modify its morphology (Ostrowicz et al., 2008). It is likely that the rather complex picture of cell expansions is more due to the coordinate effect that involves the actin network and vacuoles. Proteins are expressed in response to developmental programs such as trap organ production (Gladfelter, 2006). Other up-regulated proteins were involved in cell wall and membrane biogenesis (membrane protein YLR242C) and the activation of protein translation (40S ribosomal protein SO-B). Large generation of energy associated proteins such as the mitochondrial ribosomal protein s24 also implied the high energy demand. In summary, the analyses of the proteome profiles of constricting ring-forming fungi revealed a key set of predation-related proteins, and provided useful information on how the fungus made corresponding changes at the protein level and adapted to a predatory life style. Though the missing genome data limits the protein identification in A. brochopaga, intracellular protein profile will aid the exploration of cellular processes, major metabolic pathways and potential signal conduction during the early trap induction stage and the late stage of trap formation.

87 REFERENCES Ahrén, D., Tholander, M., Fekete, C., Rajashekar, B., Friman, E., Johansson, T. and Tunlid, A. 2005. Comparison of gene expression in trap cells and vegetative hyphae of the nematophagous fungus Monacrosporium haptotylum. Microbiology 151: 789-803.

Barron, G. L. 1977. The nematode-destroying fungi. Canadian Biological Publications Ltd: Guelph, Ontario, Canada.

Barron, G. L. 2003. Predatory fungi, wood decay, and the carbon cycle. Biodiversity 4: 3-9.

Chant, J. and Herskowitz, I. 1991. Genetic control of bud site selection in yeast by a set of gene products that constitute a morphogenetic pathway. Cell 65: 1203-1212.

Chen, T. H., Hsu, C. S., Tsai, P. J., Ho, Y. F. and Lin, N. S. 2001. Heterotrimeric G-protein and signal transduction in the nematode-trapping fungus Arthrobotrys dactyloides. Planta 212: 858-863.

Costanzo, M. C. and Fox, T. D. 1986. Product of Saccharomyces cerevisiae nuclear gene PET494 activates translation of a specific mitochondrial mRNA. Molecular and Cellular Biology 6: 3694-3703.

De Schutter, K., Lin, Y. C., Tiels, P., Van Hecke, A., Glinka, S., Weber-Lehmann, J., Rouzé P., Van de Peer, Y. and Callewaert, N. 2009. Genome sequence of the recombinant protein production host Pichia pastoris. Nature Biotechnology 27: 561-566.

Dijksterhuis, J., Veenhuis, M., Harder, W. and Nordbring-Hertz, B. 1994. Nematophagous fungi: physiological aspects and structure-function relationship. Advances in Microbial Physiology 36: 111-143.

Fekete, C., Tholander, M., Rajashekar, B., Ahrén, D., Friman, E., Johansson, T. and Tunlid, A. 2008. Paralysis of nematodes: shifts in the transcriptome of the nematode-trapping fungus Monacrosporium haptotylum during infection of Caenorhabditis elegans. Environmental Microbiology 10: 364-375.

Flannery, A. V., Beynon, R. J. and Bond, J. S. 1989. Proteolysis of proteins for sequencing analysis and peptide mapping. Proteolytic Enzymes: A Practical Approach. Beynon, R. J. and Bond, J. S., eds., IRL Press, Oxford, 45.

Forgac, M. 1989. Structure and function of vacuolar class of ATP-driven proton pumps. Physiological Reviews 69: 765-796.

Fujita, A., Lord, M., Hiroko, T., Hiroko, F., Chen, T., Oka, C., Misumi, Y. and Chant, J. 2004. Rax1, a protein required for the establishment of the bipolar budding pattern in yeast. Gene 327: 161-169.

Gladfelter, A. S. 2006. Control of filamentous fungal cell shape by septins and formins. Nature Reviews Microbiology 4: 223-229.

88 Haffter, P., McMullin, T. W. and Fox, T. D. 1991. Functional interactions among two yeast mitochondrial ribosomal proteins and an mRNA-specific translational activator. Genetics 127: 319-326.

Halme, A., Michelitch, M., Mitchell, E. L. and Chant, J. 1996. Bud10p directs axial cell polarization in budding yeast and resembles a transmembrane receptor. Current Biology 6: 570-579.

Hook, S. S. and Means, A. R. 2001. Ca2+/CaM-dependent kinases: from activation to function. Annual Review of Pharmacology and Toxicology 41: 471-505.

Kajiwara, K., Watanabe, R., Pichler, H., Ihara, K., Murakami, S., Riezman, H. and Funato, K. 2008. Yeast ARV1 is required for efficient delivery of an early GPI intermediate to the first mannosyltransferase during GPI assembly and controls lipid flow from the endoplasmic reticulum. Molecular Biology of the Cell 19: 2069-2082.

Kang, P. J., Angerman, E., Nakashima, K., Pringle, J. R. and Rakr, H-O. 2004. Interactions among Rax1p, Rax2p, Bud8p, and Bud9p in marking cortical sites for bipolar bud-site selection in yeast. Molecular Biology of the Cell 15: 5145-5157.

Khan, A., Williams, K. L., Soon, J. and Nevalainen, H. K. M. 2008. Proteomic analysis of the knob-producing nematode-trapping fungus Monacrosporium lysipagum. Mycological Research 112: 1447-1452.

Liu, X., Xiang, M. and Che, Y. 2009. The living strategy of nematophagous fungi. Mycoscience 50: 20-25.

Maitra, J., Chaudhuri, J., Chaudhuri, J. and Si, K. 1997. Function of Eukaryotic Translation Initiation Factor 1A (eIF1A) (Formerly Called eIF-4C) in Initiation of Protein Synthesis. The Journal of Biological Chemistry 272: 7883-7891.

McMullin, T. W. and Fox, T. D. 1993. COX3 mRNA-specific translational activator proteins are associated with the inner mitochondrial membrane in Saccharomyces cerevisiae. Journal of Biological Chemistry 268: 11737-11741.

Mellman, I., Fuchs, R. and Helenius. 1986. Acidification of the endocytic and exocytic pathways. Annual Review of Biochemistry 55: 663-700.

Nordbring-Hertz, B., Jansson, H. B. and Tunlid, A. 2006. Nematophagous fungi. Encyclopedia of Life Sciences. doi: 10.1038/npg.els.0004293

Ostrowicz, C. W., Meiringer, C. T. and Ungermann, C. 2008. Yeast vacuole fusion: a model system for eukaryotic endomembrane dynamics. Autophagy 4: 5-19.

Rabl, J., Leibundgut, M., Ataide, S. F., Haag, A. and Ban, N. 2011. Crystal Structure of the Eukaryotic 40S Ribosomal Subunit in Complex with Initiation Factor 1. Science 331: 730-736.

89 Roemer, T., Madden, K., Chang, J. and Snyder, M. 1996. Selection of axial growth sites in yeast requires Axl2p, a novel plasma membrane glycoprotein. Genes & Development 10: 777-793.

Rosenfeld, J., Capdevielle, J., Guillemot, J. C. and Ferrara, P. 1992. In-gel digestion of proteins for internal sequence analysis after one- or two-dimensional gel electrophoresis. Analytical Biochemistry 203: 173-179.

Sanders, S. L. and Herskowitz, I. 1996. The Bud4 protein of yeast, required for axial budding, is localized to the mother/bud neck in a cell cycle-dependent manner. The Journal of Cell Biology 134: 413-427.

Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Analytical Chemistry 68: 850-858.

Stull, J. T. 2001. Ca2+-dependent cell signaling through calmodulin–activated protein phosphatase and protein kinases minireview series. Journal of Biology and Biochemistry 276: 2311-2312.

Swain, E., Stukey, J., McDonough, V., Germann, M., Liu, Y., Sturley, S. L. and Nichels, J. T. 2002. Yeast cells lacking the ARV1 gene harbor defects in sphingolipid metabolism. Complementation by human ARV1. Journal of Biological Chemistry 277: 36152-36160.

Tinkelenberg, A. H., Liu, Y., Alcantara, F., Khan, S., Guo, Z., Bard, M. and Sturley, S. L. 2000. Mutations in yeast ARV1 alter intracellular sterol distribution and are complemented by human ARV1. Journal of Biological Chemistry 275: 40667-40670.

Tong, F., Bilheimer, J., Shechtman, C. F., Liu, Y., Crooke, R., Graham, M., Cohen, D. E. and Rader, D. J. 2010. Decreased expression of ARV1 results in cholesterol retention in the endoplasmic reticulum and abnormal bile acid metabolism. Journal of Biological Chemistry 285: 33632-33641.

Tsai, P., Tu, J. and Chen, T. 2002. Cloning of a Ca2+/calmodulin-dependent protein kinase gene from the filamentous fungus Arthrobotrys dactyloides. FEMS Microbiology Letters 212: 7-13.

Tunlid, A., Johansson, T. and Nordbring-Hertz, B. 1991. Surface polymers of the nematode-trapping fungus Arthrobotrys oligospora. Journal of General Microbiology 137: 1231-1240.

Yamashiro, C. T., Kane, P. M., Wolczyk, D. F., Preston, R. A. and Stevens, T. H. 1990. Role of vacuolar acidification in protein sorting and zymogen activation: a genetic analysis of the yeast vacuolar. Molecular and Cellular Biology 10: 3737-3749.

Yang, E., Xu, L., Yang, Y., Zhang, X., Xiang, M., Wang, C., An, Z. and Liu, X. 2012. Origin and evolution of carnivorism in the Ascomycota (fungi). Proceedings of the National Academy of Sciences 109: 10960-5.

90 Yang, J., Wang, L., Ji, X., Feng, Y., Li, X., Zou, C., Xu, J., Ren, Y., Mi, Q., Wu, J., Liu, S., Liu, Y., Huang, X., Wang, H., Niu, X., Li, J., Liang, L., Luo, Y., Ji, K., Zhou, W., Yu, Z., Li, G., Liu, Y., Li, L., Qiao, M., Feng, L. and Zhang, K. 2011. Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights into nematode-trap formation. Plos Pathogens 7: e1002179.

Zuo, J., Jiang, J., Chen, S. H., Vergara, S., Gong, Y., Xue, J., Huang, H., Kaku, M. and Holliday, L. S. 2006. Actin binding activity os subunit B of vacuolar H+-ATPase is involved in its targeting to ruffled membranes of osteoclasts. Journal of Bone and Mineral Research 21: 714-721.

91 Table 4.1. List of proteins and peptides identified by MASCOT that are expressed during trap development.

Protein ID via MASCOT Spot # Mt (kDa) PI T-test C. I. MALDI-TOF-MAS Score mitochondrial ribosomal protein 1 s24 Cryptococcus neoformans 58 174,807 9.4 95 var. neoformans JEC21 hypothetical protein 2 CHGG_07316 Chaetomium 60 114,018 5.8 95 globosum CBS 148.5 COX3 mRNA-specific 3 translational activator PET494 70 26,046 9.2 95 Zygosaccharomycesrouxii bud site selection protein rax1 4 homologue, putative Candida 60 63,284 6.8 95 dubliniensis CD36 transcription factor Pichia 5 58 21,786 9.8 95 pastoris GS115 membrane protein YLR242c - 6 48 38,625 9.1 95 yeast Saccharomyces cerevisiae 40S ribosomal proteins SO-B 7 44 31,421 5.0 95 Trichoderma reesei Vacuolar ATP synthase B 8 57 55,842 5.2 95 Penicillium chrysogenum a A 2D gel map of these identified proteins is shown in Fig. 4.2.

92 Figure 4.1. Liquid culture of Arthrobotrys brochopaga with randomly distributed ring traps along the hyphae.

93 Figure 4.2. Proteins extraction from lyoprized Arthrobotrys brochopaga and separation on 2D gels on a linear pH rang 4-7 (left to right). Lane 1: protein marker; lanes 2-5: chaotrope sample solution containing 7 M urea, 2 M thiorea, 4% (w/v) CHAPS, 0.7 M mercaptoethanol, and 20 μl protease cocktail, fungal tissue broke down by liquid nitrogen-grind and ultrasonic fragmentation (lane 2), liquid nitrogen-grind (lane 3), and liquid grind with glass beads (lane 4), and ultrasonic fragmentation (lane 5). A-B) Expression profiles of proteins extracted from fungal culture with traps (a) and no traps (b).

94 Figure 4.3. MALDI-TOFF mass spectrometry characterized peptide peaks of vacuolar ATP synthase B and RAX1 proteins

95 CHAPTER 5. Significance and discussion

5.1 Significance of research on nematode-trapping fungi Root-knot and cyst nematodes are global pests causing damage and severe yield losses in agriculture and horticulture. Along with viruses, bacteria, insects and invertebrates that parasitize or predate nematodes, fungi play a major role in consuming a substantial biomass of nematodes (Stirling, 1991; Jatala, 1986). The number of fungi that were found associated with nematodes exceeds 160 species in 70 genera (Qadri, 1989). As a subject of research over several decades, more and more nematode-destroying fungi displaying diverse morphological characteristics are discovered every year (Wang et al., 2007). An efficient biological control was introduced by Stirling (1991) as “a reduction of nematode populations which is accomplished through the action of living organisms other than the nematode-resistant host plant, which occurs naturally or through the manipulation of the environment or the introduction of antagonists.” The potential for biological control of pathogenic nematodes was investigated long time ago by Duddington (1972), and since then the predacious fungi have been recognized as a distinct category of fungi to highlight their ecological significances (Mankau, 1980; Mérillon and Ramawat, 2012). In response to environmental and health concerns, nematode destroying fungi are viewed as potential biocontrol agents to avoid the use of many hazardous nematicides (Nordbring-Hertz, 2006). Traditionally, applying biological control of nematodes involves two approaches: through formulation and addition of large quantities of fungi to the soil, or boosting the activity of the existing fungi by soil amendments (Kim and Riggs, 1992). So far, the performance of endoparasitic fungi (Hirsutella. rhossoliensis and Drechmeria. coniospora) and egg-parasitic fungi (P. chlamydosporia) have achieved desired outcomes by reducing nematode population. However, the biological control agents are confined to laboratory testing and are not commercially available for field application. Nematophagous fungi constantly associate with nematodes in the rhizosphere and constitute the front line defense for roots against pathogen attack; therefore they can destroy the prey in many types of soil and are ideal biocontrol agents (Siddiqui and Mahmood, 1996; Weller, 1988; Giuma and Cooke, 1974). The nematode-trapping fungus A. oligospora and the nematode egg parasite Verticillium chlamydosporium have the ability to colonize barley and tomato roots by penetrating the cell walls of epidermal and cortical cells through the formation of appressoria. They do not prevent normal plant growth, and complete their life cycle inside the root cells (Bordallo et al., 2002a, 2002b; Lopez-Llorca et al., 2002). Though

96 plants respond through defense reactions by generating tubers filled with lignin deposition and other cell wall structures, the fungal colonization always wins. They further modify root cells to resist parasite infection by inducing lignin, protein deposits and callose. Root colonization by nematophagous fungi is endophytic, causing no symptoms in infected plants. Sometimes, such endophytic growth in certain plant species benefits plant growth by inhibiting other plant parasitic fungi such as Gaeumannomyces graminis var. tritici (Monfort et al., 2005). Such endophytic colonization by nematophagous fungi also occurs in roots of monocots and dicots, supporting their wide application in crop plant protection (Lopez-Llorca et al., 2006). Not only used for plant protection, nematophagous fungi have extended their application to control animal parasitic nematodes. Feeding animals with fungal mycelium containing chlamydospores of nematode-trapping fungi gradually is a promising approach to overcome the development of drug resistance by animals (Nordbring-Hertz, 2006). Spores passed through animal guts can grow and produce traps in the feces and surrounding grass. The fungal colonies target newly-hatched juveniles of the parasites and largely reduce the nematode burden in the field. Concerns about the spread of biological control agents have been addressed by analysis of the genetic variation of a world collection of Duddingtonia flagrans, which confirmed that strains are unlikely to recombine with local strains, not even with isolates derived from the same country (Ahrén et al., 2004). After a more thorough and expanded study of nematophagous fungi, pathogenicity and survival of these introduced biocontrol agents could be enhanced through genetic engineering. For example, through genetic transformation mutants containing additional copies of PII gene, an important protease gene participating in infection structure production, are able to produce more traps and increase the speed of capture and killing of nematodes in Arthrobotrys oligospora (Åhman et al., 2002). Field experiments show that the nematode-trapping fungus A. dactyloides could significantly reduce root-knot nematode infection on tomatoes (Bourne et al., 1996). Therefore, efficient manipulation of trap formation will give us a perspective on management of agriculturally destructive nematodes. Though special emphasis is placed on the relationship between nematode-trapping fungi and the nematodes, they are also bounded together with other organisms. For example, as mycoparasites, nematode-trapping fungi extend their colonization capacity to A. oligospora. They absorb nutrients by coiling their hyphae around the host hyphae and disintegrating the host fungal cell cytoplasm (Olsson and Persson, 1994; Nordbring-Hertz et al., 2006). Interactions with fungi provide a new insight to extend their potential application in biological

97 control. In addition, nematophagous fungi constitute a complex system with many other microscopic animals such as rotifers and protozoa, and they synergistically control biological balance in nature (Duddington and Wyborn, 1972).

5.2 Future research There is a higher abundance of nematophagous fungi in the rhizosphere than in root-free soil (Persmark and Jansson, 1997). However, predacious fungi are susceptible to antagonism from other soil fungi, vulnerable to soil fungistasis, and unable to compete in harsh soil conditions and changeable environment (Cooke, 1964; Cooke, 1968; Mankau, 1962; Lamberti and Ciancio, 1992). More efforts need to be made to increase their chance of successful colonization of plant roots, such as introducing or improving particular soil microhabitats, or synchronize maximum fungal growth with the emergence of nematode juveniles. Understanding of the environmental conditions, particularly nutrient status necessary for trap formation, would strengthen our overall knowledge of their ecology. Studying nematophagous fungi at molecular level aroused decades ago and developed very rapidly. Modern molecular technique will aid the exploration of proteins associated with trap development and function, which will provide useful information on trapping mechanism. Development of predatory ability is mediated by a series of proteins that participate in trap morphology determination and signal conduction pathway. By verifying the function of each specific peptide, we will be able to find factors that control the fungal predatory process. The proteomic analysis presented in this research provides an important conceptual focus for detailed analysis of the molecular biology and evolution of parasitism and predates within nematode-trapping fungi. It would be interesting to look at the protein expression profiles among a variety of trap forms formed by different species and find out the pattern. It would be informative to relate expressed proteins with the corresponding trap forms. Furthermore, proteomic studying on other trap-forming fungi (e.g., non-constriction ring traps) will provide valuable comparisons and information on evolution and morphological divergence among these nematophagous fungi. The function of essential genes in various aspects of ring trap development and function still remain to be answered, since classical genetic approaches such as mutant screening are not available. Tailoring the right strategy to study the gene function, especially develop a powerful tool for targeted gene disruption is a complicated task. The discovery of RNA interference has been the recent breakthrough in the study of gene function. As a complementary to homologous recombination that is widely used in gene targeting, RNAi

98 become a powerful reverse genetic tool and overcome the time-consuming and inefficiency adverse conditions (Nakayashiki, 2005). RNA silencing in gene inactivation is flexible in that it induces gene suppression in a sequence-specific manner. RNAi helps to investigate the effects of an essential gene on a phenotype of interest (Nakayashiki and Nguyen, 2008). Particularly in our research, gene YOR301W encoding Rax1 protein was successfully cloned from Arthrobotrys brochopaga (Fig. 5.1), and this resulting protein has significant homology to yeast YOR301W. Future research may take advantage of RNAi silence technique to turn down the expression of YOR301W to verify its role in the ring trap development. RNA silencing would shed light on unexpected roles of essential genes functioning in trap development. In the postgenomics era, a number of transformation system and gene manipulation strategies have been developed and significant number of fungal genomes now sequenced, functional genomics promises to uncover a great deal of nematode-trapping fungi. Filamentous fungal cells demonstrate a rich array of cell geometries by taking various shapes and sizes (Alberti-Segui et al., 2001). Trap-forming fungi always successfully form a closed three-celled trap through accurate merging between the advancing tip of the developing ring cell and the stalk bud. The unique development and maintenance of the arching of branching hyphae during the ring trap formation is strikingly interesting. Though time lapse record of ring trap morphogenesis was reported, studies on the mechanism that controls the hyphal branch differentiation and curvature is still in progress. Moreover, alternative trap forms such as giant ring traps and multi-loops observed in our culture make the mechanisms that are responsible for the morphogenesis of the curling growth pattern of the hyphae more complex (Fig. 5.2). However, since the cellular and molecular methods have been widely used in filamentous fungi study, factors that coordinate accurate trap cell curvature and merger can be explored in many ways. For example, fluorescence-labelling of fungal cell structures such as Spitzenkörper, vacuole, nucleus and cytoskeleton could help to reveal the cellular features that allow these fungi to form functional traps. Gene manipulation by knocking out particular genes will provide important information to study the molecular basis responsible for controlling the degree of trap cell curvature, and thereby, trap cell length, and ring diameter. With the increasing knowledge of their physiology, development and genetics, nematode destroying fungi will have better survival and growth over a wide range of ecological habitats, obtain advantageous competition with soil microorganisms, and acquire an increased predatism potential to nematodes. Successful production of nematode-trapping fungi in a usable form and at a commercial scale will be achieved in cropping systems in the

99 future.

REFERENCES Åhman, J., Johansson, T., Olsson, M., Punt, P. J., Van den Hondel, C. and Tunlid, A. 2002. Improving the pathogenicity of a nematode-trapping fungus by genetic engineering of subtilisin with nematotoxic activity. Applied and Environmental Microbiology 68: 3408-3415.

Ahrén. D., Faedo, M., Rajashekar, B. and Tunlid, A. 2004. Low genetic diversity among isolates of the nematode-trapping fungus Duddingtonia flagrans-evidence for a recent worldwide dispersion from a single common ancestor. Mycological Research 108: 1205-1214.

Alberti-Segui, C., Dietrich, F., Altmann-Johl, R., Hoepfner, D. and Philippsen, P. 2001. Cytoplasmic dynein is required to oppose the force that moves nuclei towars the hyphal tip in the filamentous ascomycete Ashbya gossypii. Journal of Cell Science 114: 975-986.

Bordallo, J. J., Lopez-Llorca, L. V., Jasson, H-B., Salinas, J., Persmark, L. and Asensio, L. 2002a. Effects of egg-parasitic and nematode-trapping fungi on plant roots. New Phytologist 154: 491-499.

Bordallo, J. J., Lopez-Llorca, L. V., Jansson, H-B., Salinas, J., Persmark, L. and Asensio, L. 2002b. Colonization of plant roots by egg-parasitic and nematode-trapping fungi. New Phytologist 154: 491-499.

Bourne, J. M., Kerry, B. R. and De Leij, F. A. A. M. 1996. The importance of the host plant on the interaction between root-knot nematodes (Meloidogyne spp.) and the nematophagous fungus, Verticillium chlamydosporium Goddard. Biocontrol Science and Technology 6: 539-548.

Cooke, R. C. 1964. Ecological characteristics of nematode-trapping Hyphomycetes 2. Germination of conidia in soil. Annals of Applied Biology 54: 375-379.

Cooke, R. C. 1968. Relationships between nematode-destroying fungi and soil-borne phytonematodes. Phytopathology 58: 909-913.

Duddington, C. L. and Wyborn, H. E. 1972. Recent research on the nematophagous hyphomycetes. The Botanical Review 38: 545-565.

Lamberti, F. and Ciancio, A. 1992. Biological Control of Plant Parasitic Nematodes. Biological Control of Plant Diseases 230: 17-20.

Giuma, A. Y. and Cooke, R. C. 1974. Potential of Nematoctonus conidia for biological control of soil-borne phytonematodes. Soil Biology and Biochemistry 6: 217-220.

Jatala, P. 1986. Biological control of plant parasitic nematodes. Annual Review of Pathopathology 24: 453-489.

Kim, D. G. and Riggs, R. D. 1992. Biological Control. American Phytopathological Society, Washington, 133-142.

100 Lopez-Llorca, L. V., Bordallo, J. J., Salinas, J., Monfort, E. and López, M. L. 2002. Use of light and scanning electron microscopy to examine colonisation of barley rhizosphere by the nematophagous fungus Verticillium chlamydosporium. Micron 33: 61-67.

Lopez-Llorca, L. V., Jansson, H-B., Vicente, J. G. M. and Salinas, J. 2006. Nematophagous fungi as root endophytes. Soil Biology 9: Microbial Root Endophytes.

Mankau, R. 1962. Soil fungistasis and nematophagous fungi. Phytopathology 52: 611-615.

Mankau, R. 1980. Biocontrol: fungi as nematode control agents. Journal of Nematology 12: 244-252.

Mérillon, J. M. and Ramawat, K. G. 2012. Plant Defence: Biological Control. Progress in Biological Control 12, Spring Science + Business Media B. V.

Monfort, E., Lopez-Llorca, L. V., Jansson, H-B., Salinas, J., Park, J. O. and Sivasithamparam, K. 2005. Colonisation of seminal roots of wheat and barley by egg-parasitic nematophagous fungi and their effects on Gaeumannomyces graminis var. tritici and development of root-rot. Soil Biology and Biochemistry 37: 1229-1235.

Nakayashiki, H. 2005. RNA silencing in fungi: mechanisms and applications. FEBS Letters 579: 5950-5957.

Nakayashiki, H. and Nguyen, Q. B. 2008. RNA interference: roles in fungal biology. Current Opinion in Microbiology 11: 494-502.

Nordbring-Hertz, B., Jansson, H-B. and Tunlid, A. 2006. Nematophagous Fungi. In: Encyclopedia of Life Sciences. John Wiley & Sons, Ltd: Chichester.

Olsson, S. and Persson, Y. 1994. Transfer of phosphorus from Rhizoctonia solani to the mycoparasite Arthrobotrys oligospora. Mycological Research 98: 1065-1068.

Persmark, L. and Jansson, H. 1997. Nematophagous fungi in the rhizosphere of agricultural crops. FEMS Microbiology Ecology 22: 303-312.

Qadri, A. N. 1989. Fungi associated with sugarbeet cyst nematode in Jerash, Jordan. M.Sc. Thesis, University of Jordan.

Siddiqui, Z. A. and Mahmood, I. 1996. Biological control of plant parasitic nematodes by fungi: a review. Bioresource Technology 58: 229-239.

Stirling, G. R. 1991. Biological Control of Plant Parasitic Nematodes. Progress Problems and Prospects. CAB International, Wallingford, UK.

Wang, C-Y., Mo, M-H., Li, X., Tian, B-Y. and Zhang, K-Q. 2007. Morphological characteristics and infection processes of Nematophagous Harposporium with reference to two new species. Fungal Diversity 26: 287-304.

Weller, D. M. 1988. Biological control of soil-borne plant pathogens in the rhizosphere with bacteria. Annual Review of Phytopathology 26: 379-407.

101 Figure 5.1. Isolation of gene YOR301W from Arthrobotrys brochopaga. 280 bp Rax1 coding gene is amplified using designed forward primer.

102 Figure 5.2. Multiple loops formed in liquid culture of Arthrobotrys brochopaga. Bar = 10 µm.

103