Relationship Between Lactic Acid Bacteria, Their Lipolytic Activity on Milk Phospholipids in Buttermilk and Potential Health Contribution

Relationship between lactic acid bacteria, their lipolytic activity on milk phospholipids in buttermilk and potential health contribution

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Karen Wang

Graduate Program in Food Science and Technology

The Ohio State University 2019

Master's Examination Committee:

Advisor: Dr. Rafael Jimenez-Flores,

Dr. Sheila Jacobi,

Dr. Hua Wang,

Dr. Ahmed Yousef

Copyrighted by

Karen Wang

2019

Abstract

Buttermilk is rich in milk fat globule membrane (MFGM), which consist of a well-defined group of milk phospholipids (MP). MP play an important role in brain and nervous system development. However, intact MP are also known for its low absorption in the intestine when compared with glycerolipids. Lactic acid bacteria (LAB) is one of the most common bacteria used in dairy products. Many of the LAB are beneficial for health, improving gut function, and regulating immune response. Moreover, the metabolites: the lipases and proteases produced by them can hydrolysate lipids and proteins, which can lead to better absorption of nutrients. Studies showed that metabolites produced by LAB are associated with increased absorption of sphingomyelin and potentially all the MP. The hypothesis is that LAB with lipolytic activity resulting from buttermilk fermentation with MP enriched can increase the presence of enzymes that can modify phospholipid and produce phospholipid hydrolysates with presumptive higher absorption. Bacteria characterization, classification and isolation were performed from the collection at OSU in Jiménez’ laboratory using 16S rDNA sequencing. Quantitative lipolysis and proteolytic activity were tested using α -naphthyl acetate, 4-nitrophenyl derivatives of C2-C14 and azocasien. Seven promising strains, one negative control, Staphylococcus warneri, and one positive control, Enterococcus faecalis were tested to screen their functional characteristics.

Testing includes resistance to digestion including resisting low pH and bile salts, high values in auto-aggregation and hydrophobicity, and antimicrobial activity against indicator pathogenic strains: Escherichia coli ATCC 25922 and Listeria innocua ATCC 51742. Furthermore, antibiotics resistance was tested using eight antibiotics: chloramphenicol, vancomycin, tetracycline, erythromycin, ampicillin, kanamycin, clindamycin, and streptomycin. Virulence

i factors (agg, ace, asa1, fbp, cbp, mazm, eFaA, hdc, odc, tdc, gelE, hyl, esp and cyt) were screened by polymerase chain reaction (PCR). Three strains were selected (Lactobacillus casei 2,

Lactobacillus helveticus 57B and, Lactobacillus acidophilus 70A) to continue in fermentation experiments. Selected strains were first grown in minimum medium to ensure their lipolysis ability in simple medium, then grown in 10% (w/v) skim milk (as control) and compared to those grown in 10% (w/v) buttermilk with or without 0.5% of MP added. Lipolysis products were analyzed by

TLC, and HPLC. A lipolytic enzyme was detected using native protein gel: zymogram technique and Coomassie blue staining. Protein bands stained with Coomassie blue were cut and sent to amino acid/peptide sequencing by LC-MS/MS to identify the enzyme. Most of the LAB strains could digest lipid and protein substrate. The three selected LAB strains showed to have better functional properties than the commercial probiotic control: E. faecalis, including resistance to digestion and the antibiotic resistance and virulence factor safety tests. The analysis results suggested LAB strains behave differently when fermented in different media. LAB strains can break down the MP and produce MP hydrolysate when fermented with a low concentration

(0.015%) of the MP. The LAB strains showed higher ability in producing lipolytic enzyme and phospholipid hydrolysate with additional MP. Buttermilk also proved to have more available MP for LAB strains utilization than skim milk. In conclusion, Lactobacillus strains were able to hydrolysate complex phospholipids producing lipolytic enzyme and formed phospholipid hydrolysates within one day of fermentation. Data also demonstrated LAB strains could help with digestion of phospholipids, and other lipid and protein substrates. The results of this work can be used to increase the bioavailability of MP and other dairy nutrients and their application in fortified dairy products and pharmaceuticals.

Keywords: lactic acid bacteria, milk phospholipid, buttermilk

ii Acknowledgment

I want to thank my advisor, Dr. Rafael Jimenez-Flores, for guiding me through the past two years. It has been an exciting and mind-blowing journey. I am grateful for his encouragement when I am feeling lost or incapable, the insightful suggestions for my research, the ever-glowing smile and for being very supportive all the time.

Also, I would like to express my gratitude to Dr. Sheila Jacobi, Dr. Hua Wang and Dr.

Ahmed Yousef for their insightful comments and encouragement, but also for the questions which inspired me to improve my research from various perspectives.

I want to thank our postdocs: Dr. Israel Garcia-Cano, Dr. Diana Rocha-Mendoza, Dr. Joana

Ortega-Anaya, Dr. Alice Marciniak. They are very patient and willing to help whenever I have questions about my research, experiments, and courses selection. Even when students are not in the best condition, they care about us and try to solve our problems. My lab-mates: Erica Kosmerl,

Po-Wei Yeh, Luis Real-Hernandez, Feiran Yu, Lin Zhang, Stiphany Tieu Sowmy

Sreenivasaraghavan, Desarae Johnson and Alba Mayta-Apaza for helping me with the experiments and together making an incredible lab team.

Last but not least, I would like to thank my family and friends who are always there, supporting me all the time.

iii Vita

Education

2017-Present…………...... M.S. Food Science and Technology, The Ohio State University, US

2010-2014…………...…...B.S. Nutrition and Health Sciences, Taipei Medical University, Taiwan

Work Experience

2017-Present………..……Graduate Research Associate, Food Science and Technology,

The Ohio State University, US

2015-2017………..………Registered Dietitian, Healthmed Pharmacy, Taiwan

2014-2014……………..…Dietetic Internship, National Taiwan University Hospital, Taiwan

Awards

2017………………. Department Associateship Award, The Ohio State University, US

2014………………. Outstanding Graduating Student Award, Taipei Medical University, Taiwan

2014………………. Outstanding Intern Awards, National Taiwan University Hospital, Taiwan

Publication

García-Cano, I., Rocha-Mendoza, D., Ortega-Anaya, J., Wang, K., Kosmerl, E., & Jiménez-Flores,

R. (2019). Lactic acid bacteria isolated from dairy products as potential producers of

lipolytic, proteolytic and antibacterial proteins. Applied microbiology and biotechnology.

doi:10.1007/s00253-019-09844-6

Fields of Study

Major Field: Food Science and Technology

iv Table of Contents

ABSTRACT ...... I ACKNOWLEDGMENT ...... III VITA ...... IV PUBLICATION ...... IV FIELDS OF STUDY ...... IV TABLE OF CONTENTS ...... V LISTS OF TABLES ...... VIII LIST OF FIGURES ...... IX LIST OF EQUATIONS ...... X I. INTRODUCTION ...... 1 II. LITERATURE REVIEW ...... 4 A. BUTTERMILK ...... 4 1. Origin and Composition ...... 4 2. Function Properties and Application in Industry ...... 6 3. Health benefit in buttermilk ...... 6 B. MILK FAT GLOBULE AND MILK FAT GLOBULE MEMBRANE (MFGM) ...... 7 1. Origin and Function ...... 7 2. Structure and Components ...... 8 C. MILK FAT GLOBULE MEMBRANE PROTEINS ...... 10 1. Composition, Structure, and Function ...... 10 2. Health Benefits ...... 12 D. MILK FAT GLOBULE MEMBRANE LIPIDS ...... 13 1. Composition, Structure, and Function ...... 13 2. Individual function and health benefits ...... 16 a. Phospholipids ...... 17 b. Sphingomyelin and sphingolipids ...... 18 c. Gangliosides ...... 19 d. Phosphatidylserine ...... 19 e. Phosphatidylcholine ...... 21 E. BACTERIA AND HEALTH ...... 23 1. Probiotics ...... 24 a. Selection Criteria ...... 24 b. Health Benefits ...... 25 c. Lactic Acid Bacteria ...... 26 F. STUDY OF MILK PHOSPHOLIPID AND LACTIC ACID BACTERIA ...... 28 III. MATERIALS AND METHODS ...... 29 A. ISOLATION, PRESERVATION, AND IDENTIFICATION OF LACTIC ACID BACTERIA ...... 29 1. Bacteria isolation ...... 29 2. Bacteria preservation ...... 29 3. Bacteria genomic identification with 16S rDNA sequencing ...... 30 B. ACTIVITY SCREENING AND SELECTION OF LACTIC ACID BACTERIA ...... 30 1. Culture Preparation ...... 30 2. Screening of lipolytic activity ...... 31 3. Screening of proteolytic activity ...... 32 v 4. Determination of esterase activity ...... 32 5. Protein content identification ...... 33 C. SCREENING OF FUNCTIONAL CHARACTERISTICS ...... 34 1. Low pH and bile salt resistance testing ...... 34 2. Cell Surface Hydrophobicity ...... 35 3. Determination of Auto-aggregation ...... 35 4. Antibiotics susceptibility ...... 36 5. Antimicrobial Activity ...... 37 6. Screening of gene encoding with virulence factors and biogenic amines ...... 38 D. MEDIUM FERMENTATION ...... 41 1. Minimum Media Fermentation with selected LAB Strains ...... 41 2. Milk Medium fermentation with selected LAB strains ...... 42 E. PHOSPHOLIPID HYDROLYSATES ANALYSIS ...... 43 1. Thin Layer Chromatography (TLC) ...... 43 2. High Performance Liquid Chromatography (HPLC) ...... 44 a. Lipid Extraction ...... 44 b. HPLC Analysis ...... 45 F. LIPOLYSIS ENZYME ANALYSIS ...... 46 1. Native Protein Electrophoresis ...... 46 a. Zymogram ...... 46 b. Coomassie Blue Staining ...... 47 2. Amino Acid/Peptide Sequencing by LC-MS/MS ...... 47 G. STATISTICAL ANALYSIS ...... 48 IV. RESULTS AND DISCUSSION ...... 49 A. BACTERIA GENOMIC IDENTIFICATION WITH 16S RDNA SEQUENCING ...... 49 B. ACTIVITY SCREENING AND SELECTION OF LACTIC ACID BACTERIA ...... 51 1. Screening of lipolytic activity (α-NPA) ...... 51 2. Screening of proteolytic activity ...... 53 3. Screening of esterase activity ...... 55 C. SCREENING OF FUNCTIONAL CHARACTERISTICS ...... 58 1. Low pH and bile salt resistance testing ...... 58 2. Cell Surface Properties (Hydrophobicity and Auto-aggregation) ...... 61 3. Antibiotics susceptibility ...... 68 4. Antibacterial Activity ...... 71 5. Screening of gene encoding with virulence factors and biogenic amines ...... 72 D. PHOSPHOLIPID HYDROLYSATES ANALYSIS ...... 76 1. Thin Layer Chromatography (TLC) ...... 76 a. Minimum Media Fermentation with selected LAB ...... 76 b. Milk Medium fermentation with selected LAB ...... 80 2. High Performance Liquid Chromatography (HPLC) ...... 89 a. Skim Milk Medium fermentation with selected LAB ...... 89 i. Skim milk medium ...... 89 ii. Skim milk medium with 0.5% MP (SMMP) ...... 95 b. Buttermilk Medium fermentation with selected LAB ...... 99 i. Buttermilk medium (BM) ...... 99 ii. Buttermilk medium with 0.5% of MP (BMMP) ...... 104 E. LIPOLYSIS ENZYME ANALYSIS ...... 108 1. Native Protein Electrophoresis ...... 108 a. Zymogram ...... 108 2. Amino Acid/Peptide Sequencing ...... 110 V. CONCLUSION ...... 111 vi A. PROTOCOLS FOR BUFFERS ...... 124 1. MRS broth (1Liter) ...... 124 2. MRS AGAR PLATE (1 LITER) ...... 124 3. 10X PBS solution (1Liter) ...... 124 4. Native Protein Electrophoresis Gel Preparation ...... 125 5. Native Protein Electrophoresis Buffer Preparation ...... 125 a. Separating gel buffer (2M Tris-HCl p.H 8.8) (100mL) ...... 125 b. Stacking gel buffer (1M Tris-HCl p.H 6.8) (100mL) ...... 126 c. 40% acrylamide/ bisacrylamide solution (37.5:1) (250mL) ...... 126 d. Coomassie blue staining solution (500mL) ...... 126 e. Destaining solution (500mL) ...... 126 B. WIZARD® GENOMIC DNA PURIFICATION KIT (DNA EXTRACTION) ...... 127 C. WIZARD®SV GEL AND PCR CLEAN-UP SYSTEM (PCR PRODUCT PURIFICATION) ...... 128 1. Agarose Gel Electrophoresis ...... 128 2. PCR Product Purification ...... 129

vii Lists of Tables

Table 1. Reagent and solution of measuring lipolytic activity used in sample, blank, control negative and control positive ...... 31 Table 2. The concentration of antibiotic solution and paper disc ...... 36 Table 3. The type and abbreviation of genes and their encoded factors ...... 39 Table 4. Primer set, size of PCR product, primer concentration and PCR condition ...... 39 Table 5. Genes and the corresponded primers used in gene amplification ...... 40 Table 6. List of mediums and their abbreviation used in medium fermentation ...... 42 Table 7. Gradient profile of HPLC-CAD ...... 45 Table 8. Scientific classification and number of identified strains isolated from the collection at OSU in Jiménez’ laboratory...... 50 Table 9. Survival percentage of testing strains under low pH and bile salt condition after 3h incubation...... 59 Table 10. Cell surface hydrophobicity (H %) and auto-aggregation (A %) of testing strains...... 64 Table 11. Antibiotic susceptibility of testing strains...... 70 Table 12. Antibacterial activity of testing strains against Escherichia coli ATCC 25922 and Listeria innocua ATCC 51742 ...... 72 Table 13. Presence of virulence factors and biogenic amines ...... 74 Table 14. Rf value of separated polar lipids/ non-polar lipids and free fatty acids (FFA) from minimum medium fermentation...... 79 Table 15. Rf value of separated polar lipids/ non-polar lipids and free fatty acids (FFA) from milk medium fermentation...... 87 Table 16. Retention time (min) of each peak in skim milk fermentation ...... 92 Table 17. Calculated amount (ug/mL) of each peak in skim milk fermentation ...... 93 Table 18. Calculated area (pA) of the unknown peak in skim milk and buttermilk fermentation 94 Table 19. Retention time (min) of each peak in buttermilk fermentation ...... 102 Table 20. Calculated amount (ug /mL) of each peak in buttermilk fermentation ...... 103

viii List of Figures Figure 1. Schematic representation of the different processing steps used in the manufacturing of butter, with their impact on milk matrix structure...... 5 Figure 2. Structure and secret mechanism of milk fat globule membrane in the mammary alveolus ...... 8 Figure 3. Structure of the fat globule with detailed arrangement of the main MFGM proteins .... 11 Figure 4. Schematic representation of the multilayer heterogeneous structure of the milk fat globule membrane ...... 11 Figure 5. Structure of milk phospholipids ...... 15 Figure 6. Structures of the sphingomyelin and its derivatives ...... 15 Figure 7. Two- and three-dimensional schematic representations of the organization of polar lipids in the milk fat globule membrane (MFGM)...... 16 Figure 8. The relative lipolytic activity of lactobacillus strains with α -naphthyl acetate substrate ...... 52 Figure 9. The relative proteolytic activity of lactobacillus strains with azocasein substrate...... 54 Figure 10. The relative esterase activity of non-pathogenic strains with 4-nitrophenyl derivatives (a)4-nitrophenyl acetate (NPA) (b) 4-nitrophenyl butyrate (NPB) (c) 4-nitrophenyl octanoate (NPO) (d) 4-nitrophenyl dodecanoate (NPD) (e) 4-nitrophenyl myristate (NPM) (f) 4-nitrophenyl palmitate (NPP) ...... 56 Figure 11. Summary of bacterial adhesion...... 61 Figure 12. Cell surface hydrophobicity (H %) of testing strains after 30 min of incubation...... 63 Figure 13. The role of auto-aggregation in biofilm formation...... 65 Figure 14. Auto-aggregation (A %) of testing strains after 1and 4 h incubation...... 67 Figure 15. Separated Polar Lipids/ Non-Polar Lipids and Free Fatty Acids (FFA) from Minimum Medium Fermentation ...... 78 Figure 16. Separated Polar Lipids from Milk Medium Fermentation ...... 83 Figure 17. Separated Non-Polar Lipids from Milk Medium Fermentation ...... 85 Figure 18. Separated Free Fatty Acid from Milk Medium Fermentation ...... 86 Figure 19. HPLC chromatogram of skim milk fermentation with selected strains and control .... 91 Figure 20. Comparison of HPLC chromatogram in skim milk fermentation ...... 95 Figure 21. HPLC chromatogram of skim milk fermentation added with 0.5% of MP with selected strains and control ...... 97 Figure 22. Comparison of HPLC chromatogram in skim milk fermentation added with 0.5% MP ...... 98 Figure 23. HPLC chromatogram of buttermilk fermentation with selected strains and control . 100 Figure 24. Comparison of HPLC chromatogram in buttermilk fermentation ...... 101 Figure 25. HPLC chromatogram of buttermilk fermentation added with 0.5% MP with selected strains and control ...... 105 Figure 26. Comparison of HPLC chromatogram in buttermilk fermentation added with 0.5% MP ...... 106 Figure 27. Zymogram analysis of lipolysis enzyme at 10 % native condition ...... 109

ix List of Equations Equation 1. Relative Lipolytic Activity ...... 33 Equation 2. Relative Proteolytic Activity ...... 33 Equation 3. Relative Esterase Activity ...... 33 Equation 4. Survival Percentage ...... 34 Equation 5. Hydrophobicity Percentage ...... 35 Equation 6. Auto-aggregation Percentage ...... 35

I. Introduction During butter churning, solid was separated from the aqueous phase, the previous coagulate into butter grains and the later got squeezed out. The aqueous phase contained protein, water- soluble ingredients, and most importantly, milk fat globule membrane (MFGM) (Byylund, 1995).

The MFGM is comprised of a monolayer of phospholipid coated with a layer of proteins. Both of them are surrounded by a phospholipid bilayer, creating the unique tri-layer membrane. The tri- layer MFGM contains many functional and health contributing proteins and lipids (S. S. Wu,

Richards, El Khoury, & Walsh, 2016) (Jukkola & Rojas, 2017) (Singh & Gallier, 2017). The numerous functional proteins of the MFGM can enhance triglycerides digestion, prevent coronary heart disease and inhibit pathogens growth and cell proliferation (Dewettinck et al., 2008) (El-

Loly, 2011) (Lönnerdal, 2014). The functional lipids, more specifically polar lipids including sphingomyelin (SM), gangliosides, phosphatidylethanolamine (PE), phosphatidylcholine (PC), phosphatidylserine (PS) and Phosphatidylinositol (PI) are also known as milk phospholipids (MP)

(Conway, Gauthier, & Pouliot, 2014) (Jukkola & Rojas, 2017). The MP have gained interests recently and shown to have various health benefits. The MP have been shown to play an essential role in brain and nervous system development, inhibit cell proliferation, positive effect on liver and lipid level in the blood, lower body cholesterol, and reduce inflammation. Moreover, MP inhibit pathogens binding to intestinal cells, which leads to improve gut immunity and gut microflora and decrease infection. Despite all the great health benefits, MP digestion and absorption are limited with poor efficiency. Additionally, digestion and absorption are affected by luminal factors like bile salts and other lipids. (Nilsson & Duan, 2006) (Dewettinck et al., 2008)

(El-Loly, 2011; Küllenberg, Taylor, Schneider, & Massing, 2012) (Conway et al., 2014) (Hernell,

Timby, Domellöf, & Lönnerdal, 2016). 1 Probiotics are well known for their health benefit in improving gastrointestinal (GI) function, regulating immune response, reduce infection and the various enzymes and metabolites produced by them can hydrolase nutrients which can lead to higher absorption. Moreover, probiotics can reduce pathogenic bacteria by releasing the antimicrobial agents and competitive inhibition, enhancing the prevalence of probiotics in the gut (Rolfe, 2000). One of the most common probiotics are lactic acid bacteria (LAB). Besides all the benefits described above, LAB strains also had synergistic effects on digestion, releasing various enzymes and essential nutrients including lipase, protease, vitamin B and essential amino acids into the intestine, which leads to food nutritional value improvement (Naidu, Bidlack, & Clemens, 1999). Moreover, LAB cultured dairy products are more easily digested due to the hydrolyzed and pre-digest milk components, including proteins, carbohydrates, fats, and lactose. The lipolytic and proteolytic activities of LAB were also confirmed (Shahani & Chandan, 1979). Not only the existed ability to utilize nutrients, but LAB also adapt to various environment and improve their efficiency and survival rate

(Lonvaud-Funel, 1999). More importantly, LAB adaptation to milk medium suggested that they are able to produce specialized enzymes that can utilize the dairy nutrients by regulating the encoded genes, acquiring milk-utilization genes and discarding useless plant associated-genes

(Goh, Goin, O’Flaherty, Altermann, & Hutkins, 2011) (Bachmann, Starrenburg, Molenaar,

Kleerebezem, & van Hylckama Vlieg, 2012). The previous study had shown that co-ingestion of sphingomyelin (SM), member of milk phospholipid, and fermented milk doubled the SM absorption compare to having SM alone. The finding indicated that the metabolites produced by culture bacteria, lactic acid bacteria (LAB), are associated with enhanced absorption and bioavailability of dietary sphingomyelin and possibly all of the MP (Morifuji et al., 2017).

2 However, the metabolites and metabolism of LAB strains and their relationship with milk phospholipid are still not well understand. The adaptation and the digestive enzymes releasing ability of LAB suggested that after fermented with MP enriched medium, the LAB strains might be able to produce milk phospholipids-associated enzymes, utilize MP as an energy source and the pre-digested MP will be easier for the human to digest and absorb. With this potential, this study hypothesizes that LAB with lipolytic activity resulting from buttermilk fermentation with enriched milk phospholipids (MP), can increase the presence of enzymes that can modify phospholipid and produce phospholipid hydrolysates with presumptive higher absorption. The objective of this project is to demonstrate the lipolytic and esterase activity of LAB in buttermilk fermentation with added milk phospholipids (MP) and identify the lipolysis enzyme and the lipolysis product/ phospholipid hydrolysate after fermentation. Moreover, observe the behavior of LAB strains when incubated in different media and the effect of concentration and sources of MP.

3 II. Literature Review

A. Buttermilk

1. Origin and Composition

During the process of butter making, the cream is agitated, creating a foam of large protein bubbles. The membrane of fat globules gets attracted to the air/water interface, and the fat globules

(containing crystallized fat and liquid butter oil under low temperature) aggregates in the foam.

Continuous agitation further pressurized the fat globules, causing the fat globule membrane to disrupt and releasing the fat inside. Fat globules then coagulate into butter grains and liquid containing casein, whey proteins, lactose, minerals, vitamins, and the disrupted membrane is released into the aqueous phase, the liquid also known as buttermilk. The diagram of the butter churning is shown in Figure 1. (Byylund, 1995) (Corredig, Roesch, & Dalgleish, 2003) (Gille,

2011) (Hickey et al., 2018). Buttermilk was thought to be a by-product or low-value product in the butter-making industry. Therefore, buttermilk had been heavily investigated for its potential use in both academia and industry for the last 20 years. Researchers now had found many uses of buttermilk in industry and various health benefits in its high concentration of milk fat globule membrane (MFGM) with health-promoting functional protein and polar lipids (Eyzaguirre &

Corredig, 2011) (Saffon, Jiménez-Flores, Britten, & Pouliot, 2015).

Buttermilk composition is similar to skim milk in protein, lactose, and ash content. For instance, over 80% of major proteins in buttermilk are casein and whey protein. The only difference in protein is the rest of the 20% of buttermilk proteins are from functional proteins from the MFGM. The significant difference between buttermilk and skim milk are the lipid amount and composition. Liquid buttermilk had 0.5-1.6% of lipids (4.6-14.5% in dry matter) while liquid skim milk had only 0.1-0.2% of lipid (0.3-1.5% in dry matter). They also have different polar lipids

4 composition: liquid buttermilk had 0.1-0.2% (1.2-2.1% in dry matter) of polar lipids but skim milk only had 0.015-0.02% (0.3% in dry matter). Buttermilk has a high concentration of lipid and polar lipids, containing 45 and 13 times more lipid and phospholipid than skim milk. (Morin, Britten,

Jiménez-Flores, & Pouliot, 2007) (Vanderghem et al., 2010) (Conway et al., 2014) (Lambert et al.,

2016).

Figure 1. Schematic representation of the different processing steps used in the manufacturing of butter, with their impact on milk matrix structure. (I) Pasteurized cream is churned in order to induce a phase inversion; (II) the milk fat globule membrane (MFGM) is ruptured; (III) the expelled liquid (i.e., sweet buttermilk) resulting from churning is drained, and butter grains are further processed (Conway et al., 2014).

5 2. Function Properties and Application in Industry

Majority of the liquid buttermilk is evaporated, and spray dried into buttermilk powder, reducing its large volume and extending its shelf life (Wong & Kitts, 2003). Due to the high concentration of lipid and phospholipid, buttermilk can act as emulsifier (Vanderghem et al., 2010)

(Eyzaguirre & Corredig, 2011) in salad dressing, improve water binding capacity (Morin, Pouliot,

& Jiménez-Flores, 2006), increase yield and improve mouthfeel and texture in yogurt making

(Hickey et al., 2018). The flavor and composition of buttermilk can also use in baked goods and dried mixes to improve quality and texture of bakery and confectionary (Morin et al., 2007)

(Madenci & Bilgiçli, 2014). Buttermilk powder can use as a substitute for milk powder solids in other dairy products. There are research showing that buttermilk ingredient has potential being encapsulant material to deliver bioactive compounds in health supplement or pharmaceuticals

(Augustin et al., 2015)

3. Health benefit in buttermilk

Buttermilk not only has its nutritional value in major protein, but it also contains a high concentration of milk fat globule membrane (MFGM). Studies showed that the functional protein and functional lipid on the MFGM have various health benefits to human (Corredig et al., 2003).

The full review of MFGM will be continued in the next chapter.

6 B. Milk Fat globule and Milk Fat Globule Membrane (MFGM)

1. Origin and Function

The origin of milk fat globule membrane can be sourced back to the milk secretion in cow’s mammary gland. An alveolus is a fundamental unit in the lactating mammary gland, a hallow lumen surrounded by a layer of lactating cells, creating a bottle like structure that is connected to the mammary duct. Milk components are secreted by lactating cells (lactocytes), a kind of specialized epithelial cells in the alveolus and mixed when going down to the lumen, mammary/ collecting duct and then into the cistern (S Patton & Keenan, 1975). Triacylglycerols (TAGs) are synthesized at the endoplasmic reticulum and accumulated into TAGs droplet. The droplet then got a monolayer of phospholipid and proteins from the endoplasmic reticulum (ER) membrane and released into the cytoplasm. These cytoplasmic lipid droplets coalesce together, transported to the apical membrane and secreted from the cell by a budding process. During secretion, large cytoplasmic lipid droplet is enveloped with the bilayer membrane from the lactating cells. The milk fat globule secreted into lumen now is coated with a tri-layer of phospholipid with associated proteins, carbohydrates and lipids from the membrane of the lactating cells, the tri-layer is also known as milk fat globule membrane (MFGM). The structure and secret mechanism of milk fat globule membrane in the mammary alveolus are shown in Figure 2. Due to the emulsifying ability, electrostatic and steric repulsions of the tri-layer membrane (MFGM), the lipids droplets are dispersed in milk without aggregating and coalescing with each other. These functional properties ensure the physicochemical stability of milk. There are also search showing that MFGM protects the fat globules from enzyme degradation (McManaman & Neville, 2003) (V. Spitsberg, 2005)

(Lopez, 2011) (S. S. Wu et al., 2016) (Singh & Gallier, 2017).

Figure 2. Structure and secret mechanism of milk fat globule membrane in the mammary alveolus (S. S. Wu et al., 2016).

2. Structure and Components

Milk fat globule has a diameter range from 0.1 to 15μm, with a mean diameter of 3-5 μm.

The size of the fat globule depends on the stage of lactation, breeds of cow, and diets. For example, diet added with polyunsaturated fatty acid (PUFA) and pasture can decrease the size of fat globules in bovines. The production of the smaller size of the fat globules also indicated higher production of the membrane materials in order to cover all the fat droplets (Lopez, 2011). The core of the fat

8 globules is made up with 98% of milk fat and little amounts of monoacylglycerols, diacylglycerols, free fatty acids, polar lipids, sterols and fat-soluble nutrients like carotenoids and vitamins A, D E and K. The MFGM, membrane that surrounded the fat droplet, has thickness range from 8 to 50nm, containing numerous bioactive molecules like proteins, glycoproteins, enzymes, neutral lipid, polar lipids and cholesterol (Lopez, 2011) (Eyzaguirre & Corredig, 2011) (Jukkola & Rojas, 2017)

(Singh & Gallier, 2017).

The structure of the membrane is comprised of 1) a monolayer of phospholipid coated with

2) a layer of proteins and both of them are surrounded with 3) a phospholipid bilayer, creating the unique tri-layer membrane, MFGM. The outer part of the phospholipid bilayer is rich in glycoproteins, enzymes, phosphoproteins, and cholesterol, but the distribution of each component is heterogeneous in different layers. For example, most of the lipids like phosphatidylcholine (PC) and sphingomyelin (SM) and proteins like periodic acid and shiff (PAS) 6/7, mucin 1, xanthine oxidase (XO) and proteose peptone 3 (PP3) are located in the outer part of the phospholipid bilayer.

On the other hand, phosphatidylethanolamine (PE) and other proteins are abundant in the inner part of the bilayer. The outer part of the bilayer can then separate into liquid-ordered domains

(lipid rafts) and liquid disordered domains, the previous is rich in sphingolipids and cholesterol while the latter is rich in glycerophospholipids like PE, PC, Phosphatidylinositol (PI) and phosphatidylserine (PS). PI and PS, on the other hand, mainly located at the monolayer of phospholipids. These components are important not because of their minor contribution to energy production, but due to the functional properties and physiological value, each component give.

The functional components in the MFGM can be classified into two parts: proteins and lipids. (S.

S. Wu et al., 2016) (Jukkola & Rojas, 2017) (Singh & Gallier, 2017).

9 C. Milk Fat Globule Membrane Proteins

1. Composition, Structure, and Function

MFGM contains only 1-4% of the proteins in milk, but there are more than 150 proteins had been discovered. These proteins made up 25-70% of the mass in MFGM. The main protein in

MFGM is the butyrophilin (BTN); it comprises about 40% of proteins in MFGM. The following protein is xanthine dehydrogenase/ oxidase (XDO/ XO) (12-13%) and other protein like mucin 1

(MUC 1), mucin 15 (MUC 15), periodic acid Schiff 6/7 (PAS 6/7), cluster of differentiation 36

(CD36), adipophilin (ADPH) and fatty acid binding protein(FABP), etc. (V. Spitsberg, 2005)

(Dewettinck et al., 2008). The proteins located differently through the tri-layer membrane: ADPH is located at the phospholipid monolayer and is firmly attached to the TAGs (lipid core). XDH/

XO exist between monolayer and bilayer and is closely connected to BTN, and ADPH. The combination of ADPH, XDH/ XO, and BTN assemble and stabilize the MFGM. MUC 1, MUC

15, BTN, CD33, CD 36 act as transmembrane protein at the phospholipid bilayer, while PAS 6/7 and PP3 are loosely attached to the bilayer surface. The location of each protein in MFGM is shown in 3 and Figure 4. (Dewettinck et al., 2008) (Vanderghem et al., 2010) (Holzmüller &

Kulozik, 2016) (Singh & Gallier, 2017).

Figure 3. Structure of the fat globule with detailed arrangement of the main MFGM proteins (Dewettinck et al., 2008).

Figure 4. Schematic representation of the multilayer heterogeneous structure of the milk fat globule membrane (Conway et al., 2014).

11 2. Health Benefits

Although MFGM proteins comprise only 1-4% of the protein in milk, many of them are have bioactive and health-promoting properties; BTN can suppress multiple sclerosis, a progressive autoimmune disease that can cause degeneration of in central nervous system (Mana et al., 2004). Due to the similar receptor on the MFGM, MFGM itself can interact with pathogenic bacteria and lower their binding to the epithelial membrane. In the meanwhile, XDH/ XO can act as a bactericidal agent in the gastrointestinal tract by producing reactive oxygen species, superoxide, and hydrogen peroxide. XDH/ XO was shown to inhibit the growth of Staphylococcus aureus and E.coli (Martin, Hancock, Salisbury, & Harrison, 2004). MUC 1 have a protective effect against rotavirus infection by inhibiting rotavirus binding (Kvistgaard et al., 2004), have inhibition on hemagglutination of Vibrio cholera and E. coli (Lönnerdal, 2014) and can decrease the binding of Yersinia enterolytica to the intestinal membranes by acting as a binding cites for infective agents

(Mantle, Basaraba, Peacock, & Gall, 1989). FABP has shown to inhibit cell proliferation by act as selenium carrier (V. L. Spitsberg, Matitashvili, & Gorewit, 1995), BRCA 1 and BRCA 2 showed to have inhibition of breast cancer and are also involved in the DNA repair process (Vissac et al.,

2002) (Daniels, Wang, Lee, & Venkitaraman, 2004). Lactophoricin can inhibit growth against

Samonella (Campagna, Mathot, Fleury, Girardet, & Gaillard, 2004). Mucins (MUC-1, MUC-4,

MUC-15), BTN, lactadherin, and CD36 might be able to enhance triglycerides digestion (Lopez

& Ménard, 2011). MFGM also have beta-glucuronidase inhibitor and Helicobacter pylori inhibitor to inhibit colon cancer and prevent gastric disease like gastritis and peptic ulcer disease (El-Loly,

2011) (X. Wang, Hirmo, Willen, & Wadström, 2001). Food fortified with MFGM proteins has beneficial effects on diarrhea in infants aged 6-11 months (Zavaleta et al., 2011). The antigens on

MFGM showed to have biochemical and immunological effects against coronary heart disease by

12 interacting with specific antibodies (V. Spitsberg, 2005) (Singh, 2006) (Dewettinck et al., 2008)

(El-Loly, 2011) (Lönnerdal, 2014) (Zou et al., 2015) (S. S. Wu et al., 2016).

D. Milk Fat Globule Membrane Lipids

1. Composition, Structure, and Function

MFGM lipids are comprised of 70% of neutral lipids and 26-30% of polar lipids. The previous includes 62% of triglycerides, ~10% of di-glycerides, less than 10% of mono-glycerides, sterols, esters and free fatty acids (of total lipids in MFGM). The latter includes 30-40% of phosphatidylethanolamine (PE), 20-35% of phosphatidylcholine (PC), 3-15% of phosphatidylserine (PS), 4-14% of Phosphatidylinositol (PI), 17-35% of sphingomyelin (SM), and trace amount of lysophosphatidlycholine (LPC) and lysophosphatidylethanolamine (LPE) (of total polar lipids) (El-Loly, 2011) (Conway et al., 2014) (Jukkola & Rojas, 2017). These polar lipids in

MFGM made up 60-70% of milk polar lipids and play a vital role in stabilizing fat globules in milk (oil/water emulsion). The polar lipids can further classify into two groups: glycerophospholipids and sphingolipids. They are the amphiphilic molecule with a hydrophobic tail and hydrophilic head. Glycerophospholipids are consist of 1) a glycerol backbone with two fatty acids chain (C14-24) esterified on position sn-1 and sn-2 and 2) a phosphate residue with a different organic group (ethanolamine, choline, serine or inositol) located on the sn-3 position.

Sphingolipids are also comprised of a backbone: spingoid base (sphingosine), a long chain aliphatic amine with a 2-3 hydroxyl group. A ceramide is formed when the amino group in sphingosine is attached to a saturated fatty acid. Different units like sugar and phosphate group then added to the ceramide, forming cerebroside and sphingomyelin (SM) (with phosphorylcholine). Another known sphingolipids are gangliosides; they are complex glycosphingolipids that has a oligosaccharides side chain and sialic acid. The structure of milk

13 phospholipids is shown in Figure 5. and Figure 6. As discussed in the previous chapter, the phospholipids located differently through the tri-layer membrane: most of the lipids like PC and

SM are located in the external part of the phospholipid bilayer, while PE, PI, and PS are abundant in the inner part of the membrane (Dewettinck et al., 2008) (Lopez, 2011) (Contarini & Povolo,

2013) (Conway et al., 2014).

Milk fat generally contains a short-to-medium chain length of fatty acids (FAs) (C4-C14).

However, milk phospholipids primarily consist of medium-to-long chain FAs: unsaturated FAs

(C18:1, C18:2 and C18:3) in glycerophospholipids and around 97% of saturated FAs (C16:0,

C22:0, C23:0 and C24:0) in SM. The high concentration of saturated fat enables SM to form lipid rafts with cholesterol. Lipid rafts locate at the surface of MFGM (was discussed in the previous chapter: MFGM-structure and composition) and are associated with signal transduction and cholesterol trafficking (van Meer & Lisman, 2002). The schematic representations of the organization of polar lipids in the MFGM are shown in Figure 7. Due to the stiff (less flexible) characteristic of the lipid rafts, they provide the weakened domains that can enhance the bioavailability of the MFGM, potentially provide 1) binding sites for digestive enzyme and help with lipid transport. 2) binding sites on microorganism and abnormal cells that can facilitate phagocytosis and apoptosis (Dewettinck et al., 2008) (Conway et al., 2014).

Figure 5. Structure of milk phospholipids (A) Glycerophospholipids and (B) sphingomyelin (Conway et al., 2014)

Figure 6. Structures of the sphingomyelin and its derivatives (Contarini & Povolo, 2013)

Figure 7. Two- and three-dimensional schematic representations of the organization of polar lipids in the milk fat globule membrane (MFGM). (A) Segregation of sphingomyelin in micro-domains in which the exogenous phospholipid fluorescent dye Rh-PE cannot integrate, and (B) three-dimensional representation of the organisation of polar lipids in the MFGM, showing the circular shape of the lipid rafts enriched in sphingomyelin. Not to scale (Lopez, Madec, & Jimenez-Flores, 2010)

2. Individual function and health benefits

MFGM not only have bioactive compounds in protein, polar lipids class, and the individual lipids also gain many interests these years and shown to have various health benefits. Lipids in

MFGM have shown to reshape gut microflora, decrease infection, positive effect on liver and lipid level in the blood, lower body cholesterol, and reduce inflammation. SM and gangliosides, both sphingolipids affect brain and nervous system development, being vital in cell signaling, inhibit cell proliferation, being anticholesterolemic, reduce inflammation and has a beneficial effect on gut immunity and gut microflora. 16 a. Phospholipids

Diet supplemented with buttermilk powder showed to decrease colonization of L. monocytogenes compare to skim milk diet in rats (Sprong, Hulstein, & Van der Meer, 2002).

Additionally, lipids in MFGM have a contribution to anti-rotavirus activity in monkey kidney cells

(Fuller, Kuhlenschmidt, Kuhlenschmidt, Jiménez-Flores, & Donovan, 2013). In the investigation of MFGM and its effect on cholesterol, mice study has shown that high-fat diet supplemented with phospholipid have beneficial effects on hepatomegaly, hepatic steatosis and serum lipid levels

(Wat et al., 2009). Another study showed that high-fat diet supplemented with milk phospholipids reduce the liver accumulation of intestinal cholesterol (CL) and increase fecal CL excretion in mice (Kamili et al., 2010). In the clinical studies, buttermilk (SM=0.6% of total fat) reduces plasma cholesterol and TG concentration in subjects aged 18-65 years old with mild-hypercholesterolemia compared to the placebo group (less than 0.1% of SM) (Conway et al., 2013). More recent studies have shown that formula enriched with phospholipids from MFGM showed significance less fever and improved behavior regulation in preschool children aged 2.5-6 years (Veereman-Wauters et al., 2012). Another study showed that infant formula supplemented with bovine MFGM lower the risk of acute otitis media and reduces antipyretics use in formula-fed infants and can modulate the immune system against pneumococcus vaccine in infant ages 2-6 months. (Timby et al., 2015)

17 b. Sphingomyelin and sphingolipids

SM plays a vital role in myelination, facilitating fast conduction in the nervous system.

Myelination occurs extensively during brain growth in gestation and newborn babies. Oral intake sphingomyelin showed increase myelination in rat with experimentally-inhibited myelination

(Oshida et al., 2003). Low-birth-weight infants fed with SM-fortified milk has a positive association with neurobehavior development when compared to control with egg SM. (Tanaka et al., 2013)

SM and its metabolites like ceramide, sphingosine, sphingosine 1-phosphate (SIP), ceramide-1-P (C1P) act as second messengers in cell signaling and can regulate apoptosis, cell- cycle arrest, cell survival, cell proliferation and inflammation (Futerman & Hannun, 2004)

(Wymann & Schneiter, 2008). SM affects the behavior of colonic cells and reduces the incidence of colon tumors in mice (Dillehay, Webb, Schmelz, & Merrill Jr, 1994). A similar study in mice also found that SM suppresses malignant tumors and early markers of colon carcinogenesis

(Schmelz et al., 1996). Another study showed that sphingolipids could reduce tumor formation and being both chemopreventive and having chemotherapeutic effects in mice (Lemonnier et al.,

2003). A later study also found that SM decreases colitis and colonic inflammatory lesions in mice

(Mazzei et al., 2011). However, there is conflict on SM and the effect on inflammatory. A study proposed that dietary SM may increase intestinal inflammation in mice (Fischbeck et al., 2011).

Long term diet supplemented with sphingolipids modifies plasma and hepatic cholesterol and glyceride metabolism in rats (Kobayashi, Shimizugawa, Osakabe, Watanabe, & Okuyama, 1997).

A similar study showed that sphingolipids could lower plasma cholesterol and TG and protect the liver from fat-induced steatosis in mice (Duivenvoorden et al., 2006). SM showed anticholesterolemic effects in rats by inhibiting intestinal absorption of cholesterol in the rat

18 (Nyberg, Duan, & Nilsson, 2000). Additionally, SM in milk showed better inhibition than egg SM, possibly due to the higher degree of saturation and longer chain in FA (Noh & Koo, 2004). In SM and their effect on gut health, oral SM increases neonatal gut maturation during the suckling period in the rat (Motouri et al., 2003).

c. Gangliosides

Gangliosides are essential in building cell membranes, brain, and nervous system. They are like sphingomyelin, also play an essential role in neurotransmission like myelination and axonal outgrowth. Furthermore, gangliosides can reshape gut microflora and lower inflammation. Infant formula supplemented with ganglioside have beneficial effects on cognitive development in healthy infants aged 0-6 months compared to standard infant formula (Gurnida, Rowan, Idjradinata,

Muchtadi, & Sekarwana, 2012). Another study showed that ganglioside-supplemented infant formula could modify gut microflora in newborns, increasing Bifidobacterium and lowering E.coli and improve gut immunity (Rueda, 2007). Formula enriched with (N-acetylneuraminyl) 2- galactosylglucosyl ceramide (GD3), a kind of ganglioside in human colostrum, protects newborn rat from necrotizing enterocolitis (Xu, Anderson, & Schwarz, 2013).

d. Phosphatidylserine

PS is present mostly in the brain and in all cell membranes. The structural and regulatory functions to membrane fluidity could regulate biological cell activity, involved in signal transduction and facilitates membrane-to-membrane fusion by releasing neurotransmitters like acetylcholine, dopamine, and norepinephrine. The concentration of PS in bovine milk is similar to human’s milk.

19 PS supplementation can improve decreases in neurotransmitter release, and loss of dendritic that was seen in 19 to 27-month-old rodents (Casamenti, Scali, & Pepeu, 1991) (Nunzi,

Milan, Guidolin, & Toffano, 1987). A similar study showed that PS was found to improve the spatial memory and the passive avoidance retention of aged impaired rats (Zanotti, Valzelli, &

Toffano, 1989). Additionally, PS can attenuate neuronal effects of aging and restore normal memory in rats. The preliminary finding in the same study showed that PS produced modest increases in the recall of word list in elderly with moderate cognitive impairment. However, PS did not show significant effect on elderly with probable AD (McDaniel, Maier, & Einstein, 2003).

In a clinical study, PS supplement affect different measures of brain function with patients with

Alzheimer’s disease (AD) (Heiss, Kessler, Mielke, Szelies, & Herholz, 1994). In a recent study,

PS extracted from bovine were used as a treatment in AD patients. The PS treatment increased the vocabulary, and picture matching scores after treatment and the score being significantly higher than the placebo group (Zhang, Yang, & Guo, 2015).

Due to the less amount of PS in milk compare to PS in soy, recent studies focus more on the soy PS and their effect on Alzheimer’s disease. Soy PS supplement helped to improve elderly with mild cognitive impairment with low score increase memory score and improved verbal recall after six months (Kato-Kataoka et al., 2010). Another study demonstrated that Soy PS having favorable effects on cognitive function in the elderly with memory complaints (Richter, Herzog,

Lifshitz, Hayun, & Zchut, 2013). Supplement contains soy PS and soy phosphatidic acid (PA), a precursor of other phospholipids, showed beneficial effects on AD patient and other elderly with memory or cognitive problems (Moré & Rutenberg, 2017)

20 e. Phosphatidylcholine

The PC is a structural ingredient in the cell membrane and being primary source of choline.

Choline is precursors for biosynthesis of membrane ingredients, SM, essential amino acid, and the neurotransmitter acetylcholine. The PC and choline both play essential roles in nervous system development. The concentration of PC in bovine milk showed similarity to human’s milk. In a human study, women below the 25th percentile for choline intake have twice the risk of having a baby with neural tube defects compared with women above the 75th percentile (Shaw, Carmichael,

Yang, Selvin, & Schaffer, 2004). Another study showed that poor choline concentration in the first half of pregnancy is associated with poor cognitive development (B. T. Wu, Dyer, King,

Richardson, & Innis, 2012). Diet supplemented with choline improve memory and learning in rats

(Zeisel, 2006). Additionally, PC administration showed to reduce knee joint inflammation like

NSAID drugs and reduced the adhesion and tissue accumulation of neutrophil leukocytes in arthritis rats (Hartmann et al., 2009). PC supplementation during pregnancy increases memory capacity in rodents offspring (Meck & Williams, 2003). PC also has potential against liver damage caused by pharmaceuticals, mushroom poisoning, alcoholic damage, and hepatitis B virus (Kidd,

2002). PC supplement has beneficial effects in patients with chronic hepatitis C in combination with interferon (Niederau, Strohmeyer, Heintges, Peter, & Göpfert, 1998). A recent study showed that PC supplement can significantly decrease TG levels and may help reduce LDL-C level in mild hyperlipidemia patients (Jan, Thondre, El-Chab, & Lightowler, 2017). Dietary supplementation with choline-related compounds improves the low S-adenosylmethionine to S- adenosylhomocysteine (SAM: SAH) and glutathione redox balance in children with cystic fibrosis

(Schall et al., 2016). However, recent research indicated a positive correlation between PC and

21 metabolic diseases such as type-2 diabetes and cardiovascular disease. However, after looking into the studies, they used questionnaires to gain dietary intake of PC rich food (like red meat), which is also proved to cause metabolic disease when consuming over suggested amount (Li et al., 2015)

(Zheng et al., 2016). Another study found that overconsumption of PC (diets rich in PC like red meat and egg yolk) can lead to the trimethylamine oxide (TMAO) production by gut bacteria.

TMAO is a renal toxin and biomarker for renal diseases. The author suggested PC-derivatives, another supplement called citicoline that will not convert into TMAO and still have the beneficial effect of PC (E Smith, Rouchotas, & Fritz, 2016) (Singh, 2006) (Dewettinck et al., 2008) (Vesper et al., 1999) (El-Loly, 2011; Küllenberg et al., 2012) (Conway et al., 2014) (Hernell et al., 2016)

(S. S. Wu et al., 2016).

22 E. Bacteria and health

Human interaction with bacteria had been a long history: From the beginning at birth, bacteria colonized into the sterile gut and propagated on all parts of the human body like skin, oral cavity, GI tract and vaginal cavity (Daliri & Lee, 2015). These bacteria tenants have been proved to protect and benefit the host through competing against pathogens, modulating the immune system, contributing food digestion, and producing the host essential nutrients (Lee, 2014). The composition of bacteria also determined the physiological, immune, metabolic, and behavioral status of their host. Studies have shown that aging caused the increased of facultative anaerobes and Gram-negative bacteria (mainly Enterobacter), decreased of the beneficial bacteria such as

Lactobacillus and Bifidobacterium and a reduction in bacteria diversity in the gut (Patel, Singh,

Panaich, & Cardozo, 2014). Additionally, lifestyle, including diet and exercise, can alter the balance of beneficial and non-beneficial bacteria (Grenham, Clarke, Cryan, & Dinan, 2011).

Shifting in the composition may result in an increased chance of infection and chronic disease

(Patel et al., 2014). Hence, it is logical to assume supplementation of selected bacteria could contribute beneficial effect to human by restoring the unbalanced and potentially contributed to other health benefits. The selected bacteria is also known as probiotics (Lee, 2014).

23 1. Probiotics

a. Selection Criteria

Probiotic is the general term for live micro-organisms that confer health benefits on the host when administered in adequate amounts (FAO/WHO, 2002). Several properties have been demonstrated to be requirements for probiotic strain. 1) Strain identification by phenotypic and genotypic methods. Probiotic effects are strain-specific. Hence, it is necessary to know the genus and species of the probiotic strain. Additionally, In vitro, tests are essential. The tests can gain more knowledge of the strains and the working mechanism. In vitro tests including

2) Resistance to acid, pancreatic enzymes, and bile. Most of the probiotics need to be alive to confer their benefits. Therefore, the ability to survive the gastrointestinal system is critical. The first barrier for probiotic is the acidic environment in the stomach then the digestive enzymes and bile salt in the intestine. 3) Adhesion to the mucus or human epithelial cells and cell lines. Adult intestinal tract carries 1-2kg of microbes with over 1000 species and more than 7000 strains of bacteria (Grenham et al., 2011) (Lee, 2014). Probiotic needs to fight through layers and layers of original residents to reach the intestinal mucosa. Therefore, strong ability to attach and colonize in the gut is vital. 4) Antimicrobial activity against potential pathogenic bacteria. As mention previously, probiotic needs to compete with other bacteria in the gut. Consequently, the ability to produce antimicrobial agent can help them fight through numerous microorganisms. Moreover,

Safety requirements for probiotic, making sure they are not pathogenic or harmful. Several tests can be used 5) Determination of antibiotic resistance patterns. Bacteria can exchange their genes through conjugation. Thus, making sure the strains do not have excess antibiotic resistance or transferable genes. 6) Assessment of metabolic activities. Lactose intolerance patients have insufficient beta-galactosidase production. Ergo, the beta-galactosidase producing strain is a plus

24 in dairy associated bacteria like Lactobacillus. 7) Evaluation of overall safety. Probiotic strains must be nontoxic, nonpathogenic, and have Generally Recognized as Safe (GRAS) status. Finally,

8) in vivo studies using animal and humans to determine their actual health contribution

(Klaenhammer & Kullen, 1999) (FAO/WHO, 2002) (Daliri & Lee, 2015).

b. Health Benefits

Numerous of probiotic have been proved to improve GI function, infections, dermatological diseases and immune response, control dental caries (Stamatova & Meurman,

2009), contain and prevent reproductive and urinary tract infection (UTI), being vital to brain and central nervous system (CNS), having anti-pathogenicity, anti-diabetic, anti-obesity, anti-cancer and anti-inflammatory activities. Several mechanisms are involved: 1) improve the intestinal barrier 2) increased adhesion to intestinal mucosa and block out microorganism 3) inhibition of adhesion and translocation of pathogens. 4) Production of anti-microorganism substances such as organic acid, antimicrobial agent, and short chain fatty acid etc. 5) Competitive exclusion of pathogen 6) degradation of toxin receptor and 7) Stimulate immune response (Rolfe, 2000)

(Oelschlaeger, 2010) (Kerry et al., 2018).

GI function improvement by probiotic can be further elaborated as follow: Probiotic therapy could alleviate many kinds of diarrhea: antibiotic-induced diarrhea, traveler’s diarrhea, rotavirus diarrhea, and HIV/AIDS diarrhea. Moreover, mediate diarrhea and colitis and restore intestinal homeostasis that was broken by Clostridium difficile overgrowth. Due to the antagonistic properties of probiotics, it has protection against Helicobacter pylori and then prevents chronic gastritis, gastric and duodenal ulcers and stomach carcinoma caused by H. pylori. Decrease intestinal urease and improve the patient status of hepatic encephalopathy when combined probiotic with antibiotics. Assuage discomfort caused by lactose intolerance, inflammatory bowel 25 disease (IBD), irritable bowel syndrome (IBS), and constipation. Probiotic therapy had been target small bowel bacterial overgrowth and Pouchitis (Rolfe, 2000).

Probiotic could modulate the immune response by activating local macrophage and increase immunoglobulin A (IgA). The modulation then changed the cytokines profile through reduction of IgE and TNF alpha and increased IgA, interleukin -6 (IL-6), IL-12 and interferon- gamma to restore the balance of T helper subset 1 and 2 (Erickson & Hubbard, 2000) (Oelschlaeger,

2010). The probiotic treatment was also shown to reduce symptoms of atopic dermatitis and eczema (Vandenplas, Huys, & Daube, 2015). Studies also found that patients with older ages and metabolic disease, including obesity, diabetes having imbalanced gut microbiota. The finding suggested that probiotic intervention can restore the imbalanced and having treatment effects on the diseased gut (Patel et al., 2014) (Daliri & Lee, 2015).

c. Lactic Acid Bacteria Many bacteria have been recognized as probiotic, but the most prevalence genre is the

Lactobacillus and Bifidobacterium. Lactic acid bacteria (LAB) exert many beneficial effects in the

GI tract. They improve the intestinal barrier by inhibiting adhesion and propagation of pathogens.

The antimicrobial substances and the competitive exclusion further benefits LAB to survive and establish in mucosal. LAB strains also release various enzymes into the intestine, had potential synergistic effects on digestion, improved the nutritional value of food, and mitigate symptoms of intestinal malabsorption (Naidu et al., 1999). One of the studies also found that germ-free mice develop vitamin B deficiency after been fed with folate-deficient and pantothenic acid-deficient diet, while convention rat did not exert. The finding suggested that deficiency symptoms can be prevented by Enterobacteris, including Lactobacillus (Brown & Lamanna, 1977).

26 LAB have been used in fermented food for a long time, especially in dairy food.

Fermentation not only extends food shelf life, but it also improved the nutritional value of the food.

Studies have shown that compare to non-fermented milk, cultured yogurt increases feed efficiency and had better growth on the rat. LAB break down the protein, releasing easily digested amino acid, enhanced the bioavailability of minerals, increase vitamin B production. Additionally, LAB fermentation increases lysine, tryptophan, and methionine content and the bioavailability of essential amino acid in grains including rice, oats, corn, and barley (Gilliland, 1990).

Hydrolysis of milk components including proteins, fats, and lactose in fermented dairy food increased their digestibility: Although the calorie in the fermented dairy product is similar to non-fermented milk, cultured products are digested more easily due to the predigested protein, carbohydrates and fat. The lipolytic and proteolytic activities of LAB were confirmed by increased lipase and proteolytic activity (Shahani & Chandan, 1979). Moreover, LAB used in the wine industry have been reported to adapt to a hostile environment: LAB was first inoculated into a suitable medium before use. For example, Wine industry would use wine, grape juice, and yeast extract as a pre-inoculation medium. The pre-inoculation does not result in multiplication of the bacteria but force the bacteria to adapt to the medium. Consequently, the efficiency and survival rate under the harsh environment of starter was improved by the pre-inoculation (Lonvaud-Funel,

1999).

Another study investigated the genes inside Streptococcus thermophilus, one of the LAB.

They are equipped with genes associated with numerous nutrients enzyme. Usually, the genes are highly conserved or turned off. However, LAB adapt to the dairy medium and turn on the genes to produce specialized enzymes that can utilize the dairy nutrients. The adaptation, including of S. thermophilus was confirmed with genomic and transcriptome analysis (Goh, Goin, O’Flaherty,

27 Altermann, & Hutkins, 2011). Numbers of comparative genome studies also reported lipolysis, proteolysis and niche adaptation functions of LAB (Papadimitriou, Pot, & Tsakalidou, 2015)

(Kelleher, Bottacini, Mahony, Kilcawley, & van Sinderen, 2017). A more specific study used L. lactis isolated from plant and propagate them for 1000 generations in milk environment. Several evolved strains increased the acidification rates and biomass yields in milk. The genome sequencing also found gene mutation in these strains enhancing milk utilization ability and discarding useless plant associated-ability (Bachmann, Starrenburg, Molenaar, Kleerebezem, & van Hylckama Vlieg, 2012).

F. Study of Milk Phospholipid and Lactic Acid Bacteria

The previous study has shown co-ingestion of sphingomyelin and fermented milk double the serum ceramide levels (components of digested sphingomyelin) in rats, especially in the upper layer of fermented milk. This indicates that the metabolites produced by lactic acid bacteria are associated with the enhanced absorption and bioavailability of dietary sphingomyelin (Morifuji et al., 2017).

28 III. Materials and Methods

A. Isolation, Preservation, and Identification of lactic acid bacteria

1. Bacteria isolation

Lactic acid bacteria (LAB) strains were obtained from the collection at OSU in Jiménez’ laboratory, which were isolated from fermented dairy products including yogurt, cheese and fermented dairy drinks in different countries and by various brands. Ten microliters of LAB were inoculated in 5 mL of Lactobacilli MRS broth (Difco®, USA) and incubated at 37°C overnight.

Streak plate technique was used to plate LAB on MRS agar plate with 1.5% (w/v) of agar (Fisher

Scientific, USA) to solidify MRS broth and 0.0025% (w/v) of bromocresol green (Sigma-Aldrich,

USA) as pH and color indicator. The plates were incubated at 37°C for 24-72 hr until bacteria’s colonies were clear and visible. Colonies with different shape or color were regrown in MRS broth, and isolation steps above were repeated for complete isolation. Total of 136 strains of bacteria were isolated (Navidghasemizad, Hesari, Saris, & Nahaei, 2009) (Dewan & Tamang, 2007).

2. Bacteria preservation

Ten microliters of isolated bacteria were inoculated in 5mL of freshly prepared MRS broth and incubated at 37°C overnight. Culture media were transferred to autoclaved centrifugal tubes under sterile condition. Cells pellets were obtained by centrifuging at 4,000 rpm with Thermo

ScientificTM Sorvall TM Legend TM XFR centrifuge (Fisher Scientific, USA) for 15 minutes and supernatants were decanted. Four milliliters of sterilized MRS broth and glycerol mixture with a

4:1 ratio (80%: 20%) was added in the centrifugal tubes and mixed with cell pellet thoroughly.

One milliliters of the mixture were then transferred into 1.5 mL of sterile Nalgene™ General Long-

Term Storage Cryogenic Tubes (Fisher Scientific, USA), creating total of four glycerol-preserved

29 tubes for each strain. Cryogenic tubes were stored in -80°C fridge for the future experiment

(Navidghasemizad et al., 2009).

3. Bacteria genomic identification with 16S rDNA sequencing

Clean cell pellets obtained as previously described were used for the analysis. Genomic

DNA (gDNA) of LAB strains were extracted, and procedures were followed using Wizard® genomic DNA purification kit (Promega corporation, USA). 16S DNA gene amplifications were performed in 50 μL reaction mixture containing 1μg of DNA, 1X PCR buffer (without MgCl2),

1.5 mM MgCl2, 0.2 mM of dNTP mix, front primer: fD1 (5'-

CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG 3'), reverse primer: rD1 (5'-

CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC 3') (Weisburg, Barns, Pelletier, & Lane,

1991) (Sigma-Aldrich, USA) and 2U of Invitrogen Platinum® Taq DNA polymerase (Thermo

Fisher Scientific, USA). Amplifications were performed by C1000 Touch Thermal Cycler (CFX96

Real-Time System) (Bio-Rad, USA). Purification of PCR products was done by using Wizard®SV gel and PCR clean-up system (Promega corporation, USA). The purified PCR products of all 136 strains were sent to Macrogen Inc. (Seoul, Korea) to obtain DNA sequence. Strain names were identified by matching the DNA sequence result with Basic Local Alignment Search Tool (Blast)

(National Center for Biotechnology Information (NCBI), USA).

B. Activity Screening and Selection of Lactic Acid Bacteria

1. Culture Preparation

Cell pellets obtained as previously described were washed twice with 5mL of sterilize phosphate buffered saline (PBS) solution and resuspended in 5mL of sterilize PBS solution

(Matthews, Grbin, & Jiranek, 2007) Resuspended cell pellets were used as sample solution to test for their lipolytic and proteolytic activity and to measure the protein content.

2. Screening of lipolytic activity

α -naphthyl acetate (α-NPA) (Sigma-Aldrich, USA) reagent was created by adding 2mg of

α-NPA in 500μL of acetone and 1X of PBS solution was added up to 2mL, creating total 2mL of

α-NPA reagent. Indicator solution was created by mixing 5mg of Fast Red TR Salt hemi (zinc chloride) salt (Sigma-Aldrich, USA) with 50μL of Triton TM X-100 (Sigma-Aldrich, USA) and 1X of PBS solution was added up to 2mL, creating total 2mL of indicator solution (Mustranta, Forssell,

& Poutanen, 1995) (García-Cano et al., 2019). The undissolved α-NPA reagent and indicator solution were put on a shaker (Fisher Scientific, USA) to mix at 100rpm until all the solutes were dissolved. 50 μL of sample solution (resuspended pellet) was added in absorbance plate and mixed with 50 μL of α-NPA reagent. After 15 minutes of incubation at room temperature (RT) (25°C),

50μL of indicator solution was added into the mixture. Reagent and solution used in sample, blank, control negative and control positive are shown in Table 1. Absorbance was read at 420nm in

Fisherbrand™ accuSkan™ GO UV/Vis Microplate Spectrophotometer (Fisher Scientific, USA) and triplicates were made.

Non-pathogenic strains with lipolytic activity higher than average was selected to continue the screening process with different lipid substrate.

Table 1. Reagent and solution of measuring lipolytic activity used in sample, blank, control negative and control positive

Testing sample Substrate reagent Indicator solution Sample Sample solution α-NPA reagent Indicator solution Blank 1X PBS solution α-NPA reagent Indicator solution Control negative Sample solution 1X PBS solution Indicator solution Control positive 10mg/mL lipase solution α-NPA reagent Indicator solution (Sigma-Aldrich, USA)

31 3. Screening of proteolytic activity

Fifty milliliters of azocasein reagent was created by adding 0.5% of azocasein protease substrate (Sigma-Aldrich, USA) in 5mM of CaCl2, 200mM of NaCl and 1X of PBS was added up to 50mL creating total 50mL of azocasein reagent (Christen & Marshall, 1984) (Bendicho, Martı,

Hernández, & Martın, 2002) (García-Cano et al., 2019). The reagent was put on a shaker to mix at

100rpm until all the solutes were dissolved. 150μL of sample solution (resuspended pellet) was added in a 1.5mL eppendorff, mixed with 100μL of azocasein reagent and incubate at 37°C for 2 hours. Two hundred and fifty microliters of TCA solution were added into the eppendorff and the mixture was centrifuged at 15,000 rpm for 5 minutes. A hundred and twenty-five microliters of supernatant were transferred to absorbance plate and 125 μL of 1M NaOH was added to mix with the mixture. Blank was using PBS solution instead of sample solution. Absorbance was read at

440nm with spectrophotometer and triplicates were made.

4. Determination of esterase activity

Total 6 substrates, 4-nitrophenyl derivatives of C2, C4, C8, C12, C14 and C16 fatty acids,

4-nitrophenyl acetate (NPA), 4-nitrophenyl butyrate (NPB), 4-nitrophenyl octanoate (NPO), 4- nitrophenyl decanoate (NPD), 4-nitrophenyl myristate (NPM), 4-nitrophenyl chloroformate (NPC)

(Sigma-Aldrich, USA) were used to create 6 reagents by diluting pure substrate to 1mM with ethanol. Forty microliters of washed samples were mixed with 40 μL of reagent and 120 μL of

PBS in enpendorff (Pérez-Martín, Seseña, Izquierdo, & Palop, 2013) (Katz, Medina, Gonzalez, &

Oliver, 2002) (Hong et al., 2018). Mixed samples of cell pellets were centrifuged at 15,000 rpm for 5 minutes to eliminate cells and 100 μL of supernatant (in enpendorff) was transferred to 96- well plate. After all the samples were transferred into absorbance plate, the plate was incubated at

32 37°C for 30 minutes. Blank was using PBS instead of reagent. Absorbance was read at 405nm with spectrophotometer meter and triplicates were made.

5. Protein content identification

Cell pellets obtained as previously described were washed twice with same volume of saline solution (SS, NaCl 0.85%, pH 7.0) and resuspended in same volume of sterilized 0.85% saline solution. Pierce™ BCA Protein Assay Kit (Fisher Scientific, USA) was used to measure the protein content and 0-1.2 μL /mL of Bovine Serum Albumin (BSA) (Sigma-Aldrich, USA) was used to make standard curve (Peña-Montes et al., 2013). BCA working reagent was created by mixing BCA protein assay reagent A with BCA protein assay reagent B in 50:1 ratio. Twenty- five microliters of washed samples were added in absorbance plate and mix with 200 μL of working agent. The plate was put on a shaker to mix at 100rpm for 30 seconds and covered up.

After incubating at 37°C for 30 minutes, the plate was cooled down to RT. Blank was using 0.85% of saline solution instead of washed samples. Absorbance was read at 562nm and triplicates were made.

Relatively lipolytic, proteolytic activity and esterase activity was obtained by dividing the measured lipolytic, proteolytic, esterase activity by measured protein content.

Equation 1. Relative Lipolytic Activity

Relative Lipolytic Activity= Average lipolytic activity/ Average protein content

Equation 2. Relative Proteolytic Activity

Relative Proteolytic Activity= Average proteolytic activity/ Average protein content

Equation 3. Relative Esterase Activity

Relative Esterase Activity= Average esterase activity/ Average protein content

Seven promising strains, one negative control, Staphylococcus warneri, and one positive control, Enterococcus faecalis, extracted from a well-known probiotic product Symbioflor

(Symbiopharm, German) were selected to continue to screen for their functional properties.

C. Screening of functional characteristics

1. Low pH and bile salt resistance testing

Low pH medium (pH 2, 2.5 and 3) and bile salt medium (0.3% and 0.4%) was created by adding 0.1M HCl and bile salt (Sigma-Aldrich, USA) into MRS broth. All the testing medium was sent to autoclaved and cooled down. Cell pellets obtained as previously described were washed twice with 5mL of 0.85% saline solution and resuspended the cells in 5mL of sterilized 0.85% saline solution. Bacteria suspension was diluted to 10-7-10-8 CFU/mL at optical density 600nm

(OD600nm) (McFarland, 1907) (Sutton, 2011). The adjusted cells were inoculated again into low pH and bile salt medium and incubate at 37°C for 3 hours(Guo, Kim, Nam, Park, & Kim, 2010)

(Monteagudo-Mera et al., 2012)Control group did not inoculate any bacteria. The medium was serial diluted with sterilized 0.85% saline solution to gain control group (10-7), pH2 (10-1), pH 2.5

(10-4), 3 (10-4), 0.3% bile salt (10-6) and 0.4% bile salt (10-5) of original concentration. Two hundred microliters of diluted medium was incubated on MRS agar plate with 0.0025% of bromocresol green by spread plate technique and triplicates were made. The plates were incubated at 37°C for 36 hours and the colonies were counted. The survival percentage were calculated using the equation below:

Equation 4. Survival Percentage

Survival Percentage= [log (CFU/mL-strains)/ log (CFU/mL-control)] *100% 34

2. Cell Surface Hydrophobicity

Cell pellets were obtained as previously described were washed twice with same volume of 0.1M PBS solution and resuspended the cells in same volume of 0.1M PBS solution. The

OD600nm absorbance of resuspended cells were adjusted to 0.6.

Three milliliters of resuspended sample was mixed with 1mL of toluene (Sigma-Aldrich,

USA) and vortexed for 90 seconds in sterilized centrifugal tubes. The samples were then incubated at RT for 30 minutes. Lower samples were taken before and after 30 minutes incubation

(Jeronymo-Ceneviva et al., 2014) (Sirichokchatchawan et al., 2018). Absorbance was read at

600nm and triplicates were made. The percentage of hydrophobicity was calculated using the equation below:

Equation 5. Hydrophobicity Percentage

% Hydrophobicity= [(OD0-OD30)/ OD0] *100 where OD0 refers to initial OD value and OD30 refers to OD value measured after 30 minutes.

3. Determination of Auto-aggregation

Cell preparation was same as cell surface hydrophobicity test.

Three milliliters of resuspended sample was transferred into sterilized centrifugal tubes and vortexed for 10 seconds. The tubes were then incubated at 37°C for 4 hours. One hundred microliters of supernatant was taken at initial time (before incubation) and then every hour

(Jeronymo-Ceneviva et al., 2014) (Sirichokchatchawan et al., 2018) (de Souza et al., 2018)

Absorbance was read at 600nm and triplicates were made. The percentage of auto-aggregation was calculated using the equation below:

Equation 6. Auto-aggregation Percentage

35 % Auto-aggregation= [(OD0-OD60)/ OD0] *100 where OD0 refers to initial OD value and OD60 refers to OD value measured after 60 minutes.

4. Antibiotics susceptibility

Total 8 antibiotics: chloramphenicol (C), vancomycin (V), tetracycline (TE), erythromycin

(E), ampicillin (Amp), kanamycin (K), clindamycin (DA) and streptomycin (S) (Fisher Scientific,

USA) were reconstituted in sterilized distill water, concentration of antibiotic solution are shown in Table 2. Twenty microliters of antibiotic solution was apply on sterilized paper discs and dried.

Four microliters of preserved LABs were inoculated in 2 mL of MRS broth at 37°C overnight.

After mixing the cell and MRS broth thoroughly, 10 μL of fresh culture and 20 μL of autoclaved clean MRS broth was added to MRS agar plate with 0.0025% of bromocresol green by spread plate technique. After the plate was dried, 4 different antibiotic discs were placed on each plate.

The plates were put in 4°C for 3h to let the antibiotic has time to diffuse into MRS plate. The plates were then incubated at 37°C for 24-48 h. Zone diameter of each antibiotic disc was measured in milliliters and recorded. Control did not have any antibiotic disc placed. Duplicates were made. sensitive(S): zone diameter17.5mm, moderate sensitive(MS): 12.5-17.4mm, resistance(R):

12.4mm (Charteris, Kelly, Morelli, & Collins, 1998) (Cebeci & Gürakan, 2003) (Faghfoori,

Gargari, Saber, Seyyedi, & Khosroushahi, 2017) (de Souza et al., 2018).

Table 2. The concentration of antibiotic solution and paper disc

Antibiotics concentration Concentration (μg / μL) Concentrstion per disc (μg/ disc) Ampicillin (AMP) 0.5 10 Chloramphenicol (C) 1.5 30 Clindamycin (DA) 0.81 16.2 Erythromycin (E) 0.75 15 Kanamycin (K) 1.5 30 Streptomycin (S) 1.5 30 Tetracycline (TE) 1.5 30 Vancomycin (V) 1.5 30

5. Antimicrobial Activity

The agar well diffusion method was used to determine antibacterial activity of cell-free supernatant and washed LAB cells against indicator pathogenic strains: Escherichia coli ATCC

25922 and Listeria innocua ATCC 51742 (American Type Culture Collection, USA). Ten microliters of preserved pathogenic strains were inoculated in 5 mL of BHI medium at 37°C overnight. Clean cell pellets were obtained by centrifuging at 4,000 rpm for 5 minutes, washed twice with 5mL of 0.1M PBS solution and resuspended the cells in 5mL of 0.1M PBS solution.

Bacteria suspension was diluted to 10-7-10-8 CFU/mL at optical density (OD) 600nm (Guo et al.,

2010)

Supernatant and cells of the LAB strains were prepared by inoculating 10μL of preserved

LAB strains in 5 mL of MRS broth at 37°C overnight and centrifuged at 7,000rpm for 5 minutes.

Supernatants were transferred into 5mL sterilized tube, pH was adjusted to pH6.8-7.0 with 1N

NaOH and filter through 0.22μm PVDF filter (Pall Corporation, USA). Cells were washed twice with 5mL of 0.1M PBS solution and resuspended the cells in 5mL of 0.1M PBS solution. Cell/

-7 -8 bacteria suspension was diluted to 10 -10 CFU/mL at OD600nm (Argyri et al., 2013)

The hard agar medium was prepared by mixing Brain Heart Infusion (BHI) medium

(Sigma-Aldrich, USA) with 1.5% (w/v) of agar. Mixture was sent to autoclave at 121°C for 15 minutes and cooled down in RT for 10 minutes. Fifteen milliliters of warm autoclaved mixture was poured into sterile plates and waited until it solidifies. Plates were stored in 4°C fridge for later use. The soft agar medium was prepared by mixing BHI medium with 0.8% (w/v) of agar.

Mixture was sent to autoclave at 121°C for 15 minutes and cooled down in RT until temperature dropped to 45°C for later use. Two microliters of 10-7-10-8 CFU/mL target strains were mixed with

20mL of 45°C soft agar medium, overlaid on the solidified hard agar plates and waited until agar 37 was harden at RT. Wells of 7mm diameter were made with sterilized glass Pasteur pipette. One hundred microliters of cell-free supernatant and washed cells were added into the wells and dried in the hood for 30 minutes. Enterococcus durans was used as control positive. The plates were incubated at 37°C overnight and the zone of inhibition was observed. Duplicates were made (Kim

& Rajagopal, 2001) (C.-Y. Wang, Lin, Ng, & Shyu, 2010) (Monteagudo-Mera et al., 2012)

6. Screening of gene encoding with virulence factors and biogenic amines

DNA of LAB strains were extracted using Wizard® genomic DNA purification kit

(Promega corporation, USA). Total of 14 virulence factors agg, ace, asa1, fbp, cbp, mazm, eFaA, hdc, odc, tdc, gelE, hyl, esp and cyt were examined with PCR detection. The type and abbreviation of genes and their encoded factors are showed in Table 3. PCR amplifications were performed in 30 μL reaction mixture containing 1μg of DNA, 1X PCR buffer, 1.5 mM MgCl2,

0.2 mM of dNTP mix, forward primer, reverse primer (Genes, corresponded primers, primer concentration and PCR condition are showed in Table.4 and Table.5 (Sigma-Aldrich, USA) and

2U Platinum® Taq DNA polymerase (Thermo Fisher Scientific, USA). Amplifications were done by C1000 Touch Thermal Cycler (CFX96 Real-Time System). Condition of thermocycler reactions for each gene are shown in

Table 4.

After amplified with PCR, 30μL of PCR products were mixed with 3μL of 6X TriTrack

DNA Loading Dye (Thermo Fisher Scientific, USA) and 1μL of GeneRuler 1 kb DNA Ladder

(0.5 μg/μL) (Thermo Fisher Scientific, USA) was mixed with 1μL of loading dye. Thirty microliters of stained sample and 2μL of stained ruler were loaded into 200mL of 0.8% agarose gel (Sigma-Aldrich, USA) added with 2μL of Sybr Safe DNA gel Stain (Thermo Fisher Scientific,

38 USA). The agarose gel was then run at 120-140V in 1X TAE buffer (Bio-Rad, USA) until the dye reached the bottom of the agarose. The image was read with ChemiDoc™ Touch Imaging System

(Bio-Rad, USA) and analyzed with Image Lab software (Bio-Rad, USA) (Eaton & Gasson, 2001)

(Faghfoori et al., 2017) (de Souza et al., 2018)

Table 3. The type and abbreviation of genes and their encoded factors

Type Gene Encoded Factor ace Adhesion of Collagen asa1 Aggregation Substance cylA Cytolysin efaA Endocarditis Antigen esp Enterococcal Surface Protein Virulence Factor gelE Gelatinase hyl Hyaluronidase agg Aggregation Substance cbp Choline Binding Protein fbp Fibrinogen Binding Protein maz Membrane- associated Zinc Metaloprotease hdc Histidine Decarboxylase Activitty Biogenic Amines tdc Tyrosine Decarboxylase Activity odc Ornithine Decarboxylase Activity

Table 4. Primer set, size of PCR product, primer concentration and PCR condition

Multiplex PCR Primer set Primer concentration PCR conditions (μM) Virulence genes asa1-F/ asa1-R 0.14 (94°C 1 min, 56°C 1 min, 72°C 2 min) *30 cylA-F/ cylA-R 0.28 esp-F/ esp-R 0.28 gelE-F/ gelE-R 0.1 hyl-F/ hyl-R 0.14 Virulence genes ace-F/ ace-R 0.1 (94°C 1 min, 55°C 1 min, 72°C 2 min) *30 efaA-F/ efaA-R 0.1 Adhesion genes fbp-F/ fbp-R 2 (94°C 1 min, 55°C 1 min, 72°C 2 min) *30 Adhesion genes maz-F/ maz-R 2 (94°C 1 min, 55°C 1 min, 72°C 2 min) *30 Aggregation genes agg-F/ agg-R 0.4 (94°C 1 min, 52°C 1 min, 72°C 2 min) *30 Adhesion genes cbp-F/ cbp-R 2 (94°C 1 min, 52°C 1 min, 72°C 2 min) *30 Biogenic Amines hdc-F/ hdc-R 0.3 (94°C 1 min, 52°C 1 min, 72°C 2 min) *30 tdc-F/ tdc-R 1 odc-F/ odc-R 2

Table 5. Genes and the corresponded primers used in gene amplification

Gene Primers (5’-3’) PCR product size (bp) Reference GAATTGAGCAAAAGTTCAATCG (Martín-Platero, Valdivia, Maqueda, ace GTCTGTCTTTTCACTTGTTTC 1008 & Martínez-Bueno, 2009) GCACGCTATTACGAACTATGA (Martín-Platero et al., 2009) asa1 TAAGAAAGAACATCACCACGA 375 ACTCGGGGATTGATAGGC (Martín-Platero et al., 2009) cylA GCTGCTAAAGCTGCGCTT 688 GCCAATTGGGACAGACCCTC (Martín-Platero et al., 2009) efaA CGCCTTCTGTTCCTTCTTTGGC 688 AGATTTCATCTTTGATTCTTGG (Martín-Platero et al., 2009) esp AATTGATTCTTTAGCATCTGG 510 TATGACAATGCTTTTTGGGAT (Martín-Platero et al., 2009) gelE AGATGCACCCGAAATAATATA 213 ACAGAAGAGCTGCAGGAAATG (Martín-Platero et al., 2009) hyl GACTGACGTCCAAGTTTCCAA 276 AAGAAAAAGAAGTAGACCAAC (Eaton & Gasson, 2001) agg AAACGGCAAGACAAGTAAATA 1553 GGCGTCGACCACTTAAACTGATAGAGAGGAAT (Fortina et al., 2008) cbp CGCGCCGCAATTAATTATTAACTAGTTTCC 1121 GCGGTCGACAAACGAGGGATTTATTATG (Fortina et al., 2008) fbp CTGGCGGCCGCGTTTAATACAATTAGGAAGCAGA 1712 GCGGTCGACGACATCTATGAAAACAAT (Fortina et al., 2008) maz TCCGCGCCGCCTTAAACTTTCTCCTT 1268 AGATGGTATTGTTTCTTATG (Martín-Platero et al., 2009) hdc AGACCATACACCATAACCTT 367 GAYATNATNGGNATNGGNYTNGAYCARG (Martín-Platero et al., 2009) tdc CCRTARTCNGGNATAGCRAARTCNGTRTG 924 GTNTTYAAYGCNGAYAARACNTAYTTYGT (Martín-Platero et al., 2009) odc ATNGARTTNAGTTCRCAYTTYTCNGG 1446

D. Medium Fermentation

1. Minimum Media Fermentation with selected LAB Strains

Ten microliters of preserved LABs were inoculated in 5mL of MRS broth at 37°C overnight. One-percent of the overnight culture were reinoculated in minimum media (MM) with or without additional 0.5% (w/v) of milk phospholipid (MP) (SureStart™ MFGM Lipid 70 milk phospholipid; NZMP, Fonterra, Newzeland). Control group was minimum medium without culture with or without added MP. List of mediums and their abbreviation used in medium fermentation is shown in Table 6. Minimum media consisted of 0.1% of K2HPO4, 0.1% of KH2PO4,

0.5% of yeast extract, 0.025% of MgSO4, 0.0005% of NaCl and 4%of lactose or without carbohydrate (CHO) (Fisher Scientific, USA) (Sigma-Aldrich, USA) (Davis & Mingioli, 1950)

(Hassinen, Durbin, Tomarelli, & Bernhart, 1951) (Johnson, Madia, & Demain, 1981) (Parada, de

Caire, de Mule, & de Cano, 1998) (Narendranath, Thomas, & Ingledew, 2001)The inoculated media were incubated at 37°C for 4 weeks. Samples were taken right after culture was inoculated at day 1 and every week (day7, day14, day21 and day28). Samples were stored in -80°C fridge for future analysis.

2. Milk Medium fermentation with selected LAB strains

Ten microliters of preserved LABs were inoculated in 5mL of MRS broth at 37°C overnight. One percent of the overnight culture were reinoculated in 10% (w/v) reconstituted skim milk powder (Difco®, USA) and 10% (w/v) reconstituted butter milk powder (Dairy America,

USA) with or without additional 0.5% (w/v) of MP. Control group was milk medium without culture with or without added MP. List of mediums and their abbreviation used in medium fermentation is shown in Table 6. The inoculated media were incubated at 37°C for 1 day. Samples were taken right after culture was inoculated at day 1 and day2. Samples were stored in -80°C fridge for future analysis.

Table 6. List of mediums and their abbreviation used in medium fermentation

Type Minimum Medium Abbreviation Control Minimum Media with 4% lactose WL-C Control Minimum Media with 4% lactose + 0.5% Milk phospholipid WLMP-C Sample Minimum Media with 4% lactose + 1 LAB strain WL Sample Minimum Media with 4% lactose + 1 LAB strain+ 0.5% Milk phospholipid WLMP

Control Minimum Media without CHO WO-C Control Minimum Media without CHO + 0.5% Milk phospholipid WOMP-C Sample Minimum Media without CHO + 1 LAB strain WO Sample Minimum Media without CHO + 1 LAB strain+ 0.5% Milk phospholipid WOMP

Type Milk Medium Control Skim milk Medium SM-C Control Skim milk Medium+ 0.5% Milk phospholipid SMMP-C Sample Skim milk Medium + 1 LAB strain SM Sample Skim milk Medium + 1 LAB strain+ 0.5% Milk phospholipid SMMP

Control Buttermilk Medium BM-C Control Buttermilk Medium + 0.5% Milk phospholipid BMMP-C Sample Buttermilk Medium + 1 LAB strain BM Sample Buttermilk Medium + 1 LAB strain+ 0.5% Milk phospholipid BMMP

E. Phospholipid Hydrolysates Analysis

1. Thin Layer Chromatography (TLC)

Lipid extraction was done with CH3Cl: MeOH mixture to extract polar and non-polar lipid and hexane to extract free fatty acids. Two milliliters of collected samples from minimum media and milk medium fermentation was mixed with 3 mL of CH3Cl: MeOH (2:1) solution and vortex for 90 seconds to mix thoroughly. Samples were then centrifuge at 4000 rpm for 10 minutes and bottom part was extracted, stored in dark vials in -20°C fridge for future analysis. Hexane extraction was done by mixing 1 mL of sample with 2 mL of hexane. Following steps were as same as CH3Cl: MeOH extraction (Parada et al., 1998) (Krygier, Sosulski, & Hogge, 1982)

(Aveldano, 1988) (Tan, Ghazali, Kuntom, Tan, & Ariffin, 2009).

Five microliters of samples were dot on TLC silica plate with 0.5%MP, sphingomyelin

(SM), α-Phosphatidylinositol (PI) and α-Phosphatidylcholine (PC) from phospholipid kit (Sigma-

Aldrich, USA) as controls. The plates were run with 200mL of CH3Cl: MeOH: H2O (65:24:4) solution/ Petroleumether: ethyl ether: acetic acid (85:15:2)/ hexane: etheyl ether: chloroform: acetic acid (70:20:10:1.5) to separate polar lipids, non-polar lipids and free fatty acids, respectively. After drying, the plates were visualized with iodine chamber and the Rf value was calculated (Hara & Radin, 1978) (Rouser, Fleischer, & Yamamoto, 1970) (Kennerly, 1986)

2. High Performance Liquid Chromatography (HPLC)

a. Lipid Extraction

Lipid extraction was done with CH3Cl: MeOH solution with 1:2 ratio to extract lipids. 800-

μL of collected samples from milk medium fermentation was mixed with 3mL of CH3Cl: MeOH

(1:2) solution and vortex for 90 seconds to mix thoroughly. Samples were incubated at RT for 5 minutes and 1mL of chloroform and 1 mL of 1X PBS solution was added. Samples were centrifuge at 1000 rpm for 2 minutes, bottom part was extracted and transferred to dark vials. Extracted lipids were dried into powders, weight difference was recorded and stored in -20°C fridge for future analysis. The lipid powder was reconstituted with CH3Cl: MeOH solution with 9:1 ratio to reach final concentration of 1.5 mg/mL and filtered through 0.22 μm filter just before HPLC injection

(Yokomizo & Murakami, 2015).

b. HPLC Analysis

An UHPLC Systems (model: UltiMate™ 3000) coupled with Corona™ Veo™ RS

Charged Aerosol Detector (CAD) (Fisher Scientific, USA), Corona Air Compressor and Corona

1010 Nitrogen generator (Peak Scientific, USA). The samples and phospholipids were separated on a Syncronis Silica column (length: 250 mm, inner diameter: 4.6 mm, particle size: 5μm). A binary solvent system was used for the phospholipid elution: 3g/ L ammonium acetate (Solvent

A), acetonitrile: methanol (100:3, v/v) (Solvent B). The gradient profile is shown in Table 7. flow rate was set at 1.0mL/ min and the oven temperature was set at 55°C. PH9-1KT Phospholipid

Standard Kit (α-Phosphatidylcholine (PC), α-Phosphatidylethanolamine (PE), Sphingomyelin

(SM), α-Phosphatidylinositol (PI), α-Phosphatidyl-L-serine (PS), α-Lysophosphatidylcholine

(LPC) and α-Phosphatidic Acid (PA)) (Sigma-Aldrich, USA) were used as internal standards. All samples and standards were dissolved in CH3Cl: MeOH (9:1) and filtered through 0.22 μm filter before injection. The injection volume was set to 50 μL.

Table 7. Gradient profile of HPLC-CAD Time Flow (mL/ min) %A %B 0 1.0 5 95 2 1.0 5 95 35 1.0 25 75 40 1.0 25 75 41 1.0 5 95 50 1.0 5 95

F. Lipolysis Enzyme Analysis

1. Native Protein Electrophoresis

One milliliters of samples from minimum media and milk media fermentation were centrifuged at 8000rpm for 5 minutes and supernatant was collected. 30 microliters of supernatant was mixed with 10 μL of native sample buffer (Bio-Rad, USA) and 35 μL of the stained samples were load in 10% acrylamide native gel. The gel was run at 80V for 20 minutes and 140 V for 45 minutes under with 1X Tris/ Glycine buffer with precision plus protein™ dual color standards

(Bio-Rad, USA) as molecular ruler. Different staining techniques were used as followed.

a. Zymogram

The gel was washed with 50mL of distilled water for two times and shake in 100 mL of

10X PBS pH 7.5 with 5% (w/v) Trixton X-100 for 30 minutes at room temperature. Solution was poured out and the gel was immersed with 100mL 10X PBS pH 7.5 with 0.5% (w/v) Trixton X-

100 for 1 hour at 37°C. The gel was washed with distilled water and shake with 100 mL of substrate solution (60 mg of α -naphthyl acetate (α-NPA), 5 mL of acetone and 95mL of PBS solution) at

80 rpm for 1 hour at room temperature. The gel was washed with distilled water and immersed with 100 mL of developing solution (80 mg of fast red, 2.5 mL of Trixton X-100 and 97.5 mL of

PBS solution) overnight until the bands appear. The image was read with ChemiDoc™ Touch

Imaging System and analyzed with Image Lab software (Hunter & Burstone, 1960) (Goullet, 1973)

(García-Cano et al., 2019)

b. Coomassie Blue Staining

The gel was washed with 50mL of distilled water for two times and stained with 50 mL of

Coomassie blue staining solution for 2-3 hours. Destained with 50 mL of destaining solution for an hour, removed the destaining solution and added in fresh 50 mL of destaining solution to destain overnight. The image was read with ChemiDoc™ Touch Imaging System and analyzed with Image

Lab software (Schagger, Cramer, & Vonjagow, 1994)

2. Amino Acid/Peptide Sequencing by LC-MS/MS

The zymogram (enzymatic activity) and Coomassie blue gel (protein band) were put together to compare and identified the band that showed activity. The corresponded bands on

Coomassie blue gel were identified and excised. The band was placed in 1.5 mL and were sent to

Campus Chemical Instrument Center (CCIC), Mass Spectrometry and Proteomics Facility at The

Ohio State University (Columbus, Ohio, USA) to sequence and identification.

G. Statistical Analysis

Statistical analysis was performed using Microsoft 365 Excel software (Microsoft.,

Washington, US) to calculate mean, standard deviation (SD) and standard error (SE) in lipolytic activity, proteolytic activity, esterase activity, protein content identification, low pH and bile salt resistance testing, cell surface hydrophobicity, determination of auto-aggregation and antibiotics susceptibility. Log (CFU/mL) was also calculated in low pH and bile salt resistance testing. Scatter plots with linear regression line, equation and R-squared value was calculated/ made to determine protein content in protein content identification. The parameters in this study were presented as mean ± SD. Histograms and pie chart were made to visualize the result.

Statistical analysis was performed using SPSS software (IBM Inc., Armonk, NY). One-

Way ANOVA followed by Least Significant Difference (LSD) test was applied to detect significance difference (p<0.05) in lipolytic activity, proteolytic activity, cell surface hydrophobicity between strains (0, 30min), determination of auto-aggregation between strains (1 hr, 2hr, 3hr and 4hour), low pH (pH2, 2.5 and 3) and bile salt (0.3% and 0.4%) resistance testing between strains and low pH (pH2, 2.5 and 3) resistance testing within same strain. Paired t-tests were applied to detect significance difference (p<0.05) in bile salt resistance testing (0.3% and

0.4%) within same strain, cell surface hydrophobicity (0 and 30min) within same strain and determination of auto-aggregation (1 hour and 4hour) within same strain.

IV. Results and Discussion

A. Bacteria genomic identification with 16S rDNA sequencing

A total 136 strains of bacteria were isolated and identify with 16S rDNA sequencing and

BLAST database. Classification, bacteria strains names and the number of identified strains isolated from the collection at OSU in the Jiménez’ laboratory are shown in Table 8. The results showed that of the 136 strains, 132 strains were from the same Lactobacillace order and four other bacteria strains are from different orders. From the 132 strains, three families were classified; 129 strains were from the Lactobacillaceae family, two strains from the Enterococcaceae family

(strain Enterococcus faecium and Enterococcus mundtii) and one strain form the Streptococcaceae family (Streptococcus genera, strain Streptococcus thermophilus). The 129 strains in

Lactobacillaceae family can then subcategorize into two genera, 124 strains from the

Lactobacillus genera and five strains from the Pediococcus genera (Three strains of Pediococcus pentosaceus and two strains of Pediococcus acidilactici). In the Lactobacillus genera, there are 13 species of Lactobacillus strains: 32 strains of L. rhamnosus, 23 strains of L. reuteri, 13 strains of

L. helveticus, 11 strains of L. gasseri, nine strains of L. acidophilus, eight strains of L. paracasei, seven strains of L. johnsonii, six strains of L. casei, five strains of L. amylolyticus, four strains of

L. delbrueckii subsp, three strains of L. crispatus, two strains of L. amylovorus and one strain of L. pentosus.

Table 8. Scientific classification and number of identified strains isolated from the collection at OSU in Jiménez’ laboratory.

Family Genera Strain Number Lactobacillus rhamnosus 32 Lactobacillus reuteri 23 Lactobacillus helveticus 13 Lactobacillus gasseri 11 Lactobacillus acidophilus 9 Lactobacillus paracasei 8 Lactobacillus Lactobacillus johnsonii 7 Lactobacillaceae Lactobacillus casei 6 Domain: Bacteria Phylum: Firmicutus Lactobacillus amylolyticus 5 Class: Bacilli Lactobacillus delbrueckii subsp. 4 Order: Lactobacillaces Lactobacillus crispatus 3 Lactobacillus amylovorus 2 Lactobacillus pentosus 1 Pediococcus pentosaceus 3 Pediococcus Pediococcus acidilactici 2 Enterococcus faecium 1 Enterococcaceae Enterococcus Enterococcus mundtii 1 Streptococcaceae Streptococcus Streptococcus thermophilus 1 Other Bacteria Strains 4

The results of the screening work can be used to identify the strains and could give clues as to relationship of these strains to others found in commercial dairy products. This may be relevant in different aspects of quality assurance programs.

B. Activity Screening and Selection of Lactic Acid Bacteria

1. Screening of lipolytic activity (α-NPA)

Relative lipolytic activity was calculated by dividing the measured lipolytic activity by measured protein content to eliminate the difference in bacteria count (Equation 1). All of the

Lactobacillus strains showed to have lipolytic activity with the α -naphthyl acetate (α -NPA) substrate. However, they also show a broad range of value in lipolytic activity range from 1.14 to1.53. To examine the data more carefully, the Lactobacillus strains were grouped into 13 different Lactobacillus species and the relative lipolytic activity between different species and within same species were compared. The relative lipolytic activity of Lactobacillus strains are shown in Figure 8.

51 a b 1.5 1.5

1.4 1.4

1.3 1.3

1.2 1.2

1.1 1.1

1.0 1.0 24 45 69 73 78 87 93 18 50 85 90 95 8A 31B 37B 42B 46B 66C 14A 22B 43B 76B 81B 43D 61D 35A 37A 39A Relative Lipolytic Activity (nm/nm) LAB Stains Relative Lipolytic Activity (nm/nm) LAB Strains

i ii iii iv v c i ii d 1.5 1.5

1.4 1.4

1.3 1.3

1.2 1.2

1.1 1.1

1.0 1.0 3 7 Relative Lipolytic Activity (nm/nm) 34 20 75 94 16 32 25 68 4B 6C 1B Relative Lipolytic Activity (nm/nm) 33B 61C 23B 40B 15B 33C 57B 60B 52C 70C 71B 10A 23A 22A LAB Stains LAB Strains

i ii iii iv e 1.5

1.4

1.3

1.2

1.1

1.0 5 9 2 80 89 12 56 38 44 30 83 8B 1A 6D 57C 60C 72C 52B 61B 10B 28B 52A 70A 61A 72A 17A 28A 11A 31A 42A Relative Lipolytic Activity (nm/nm) LAB strains

Figure 8. The relative lipolytic activity of lactobacillus strains with α -naphthyl acetate substrate (a)Lactobacillus rhamnosus (b)Lactobacillus reuteri (c)(i) Lactobacillus helveticus, (ii) Lactobacillus gasseri (d)(i) Lactobacillus amylolyticus, (ii) Lactobacillus delbrueckii subsp, (iii) Lactobacillus crispatus, (iv) Lactobacillus amylovorus and (v) Lactobacillus pentosus (e)(i) Lactobacillus acidophilus, (ii) Lactobacillus paracasei, (iii) Lactobacillus johnsonii and (v)Lactobacillus casei 52 The result showed that 13 different Lactobacillus species has similar average (average:1.4) of relative lipolytic activity with α-NPA substrate. Data also showed there is not a significance difference between the 12 different Lactobacillus species group (p-value = 0.376). The difference existed only when compare the difference in all the Lactobacillus strains. Non-pathogenic strains with lipolytic activity higher than average (1.4) (n=93) were selected to continue to screen for their esterase activity with different lipid substrate. The significance of these results is that we can select among different genus and species-specific strains for our research. It is also possible to select

LAB strains that have been extensively studied, as well as some that are relatively unknown. For example, there is plenty of information and studies in Lactobacillus casei, while Lactobacillus pentosus or Enterococcus mundtii have been much less studied in the area of LAB fermentations or cheese (McSweeney & Sousa, 2000).

2. Screening of proteolytic activity

All of the Lactobacillus strains showed to have proteolytic activity with the azocasein substrate. However, they also show a broad range of value range from 0.90 to1.53. Lactobacillus strains were grouped into different lactobacillus species and the relative proteolytic activity between different species and within same species were compared. The relative proteolytic activity of Lactobacillus strains is shown in Figure 9. The result showed that 13 different Lactobacillus species has similar average (average:1.42) of relative proteolytic activity with azocasein substrate.

The statistic results also showed that there is no significance difference between the 13 different lactobacillus species group (p value=0.66). The difference existed when compare the difference in all the Lactobacillus strains.

53 a 1.6 b 1.6 1.5 1.5 1.4 1.4 1.3 1.3 1.2 1.2 1.1 1.1 (nm/nm) 1.0 (nm/nm) 1.0 0.9 0.9 0.8 0.8 Relative Proteolytic Activity Relative Proteolytic Activity 24 45 69 73 78 87 93 8B 18 84 88 92 14B 31B 37B 42B 46B 66C 22B 43B 66B 35A 37A 39A 81A 43D 61D LAB Strains LAB Strains

i ii i i ii iv v c 1.6 d 1.6 i i 1.5 1.5 1.4 1.4 1.3 1.3 1.2 1.2 1.1 1.1 1.0 (nm/nm) 1.0 ()nm/nm 0.9 0.9 0.8 0.8 Relative Proteolytic Activity 25 68 1B 8A 6D Relative Proteolytic Activity 33C 52C 70C

57B 60B 10B 71B 4B 33B 61C 20 75 40B 16 6C LAB Strains LAB Strains

i i iii iv e 1.6 1.5 i 1.4 1.3 1.2 1.1

(nm/nm) 1.0 0.9 0.8 5 9 7 2 Relative Proteolytic Activity 80 89 13 56 38 44 30 83 1A 52B 57C 61B 60C 72C 28B 11B 52A 70A 11A 61A 72A 10A 17A 28A 31A 42A LAB Strains

Figure 9. The relative proteolytic activity of lactobacillus strains with azocasein substrate. (a)Lactobacillus rhamnosus (b)Lactobacillus reuteri (c)(i) Lactobacillus helveticus, (ii) Lactobacillus gasseri (d)(i) Lactobacillus amylolyticus, (ii) Lactobacillus delbrueckii subsp, (iii) Lactobacillus crispatus, (iv) Lactobacillus amylovorus and (v) Lactobacillus pentosus (e)(i) Lactobacillus acidophilus, (ii) Lactobacillus paracasei, (iii) Lactobacillus johnsonii and (v)Lactobacillus casei

54 The importance of these results is the observation that the proteolytic activity is dependent on the strain. Furthermore, this activity is consistent with LAB strains function in dairy products.

This finding is also consistent with the maturation and the flavor/texture development in aged cheeses or in surface ripened ones; LAB can utilize proteins and the amino acid could contribute to different flavor in cheese ripening (Steele, Broadbent, & Kok, 2013).

3. Screening of esterase activity

Relative esterase activity was calculated by dividing the measured esterase activity by measured protein content to eliminate the difference in bacteria count (Equation 3). The relative esterase activity of non-pathogenic strains with potential high lipolytic activity are shown in Figure

10. The result showed that strain S. thermophilus 53 (green column) had high lipolytic activity with all 6 kinds of substrates (4-NPA, 4-NPB, 4-NPO, 4-NPD, 4-NPM and 4-NPP). Strain L. acidophilus 5 (yellow column) had high lipolytic activity with 4-NPA, 4-NPB, 4-NPM and 4-NPP substrate, medium activity in 4-NPD, but low in 4-NPO. Strain L. crispatus 40B (yellow column) had high activity in 4-NPA and 4-NPP, medium activity in 4-NPM, but low in 4-NPB, 4-NPO and

4-NPD. Although L. acidophilus 5 and L. crispatus 40B showed high activity in some of the substrate, they also showed poor activity in the rest of the substrate. Due to the unclear mechanism of how LAB utilizing MP, strains with the ability to hydrolyte all of the substrates were preferred.

7 strains (orange columns): L. casei 2, L. rhamnosus 14B, L. rhamnosus 36, L. rhamnosus 37B, L. rhamnosus 42B, L. helveticus 57B and L. acidophilus 70A had showed constant (medium to high) activity in all of the 6 substrates.

55 a 2.0 b 7.0 1.8 NPA) - 1.6 6.0 1.4 5.0 1.2 4.0

1.0 NPB) -

0.8 (4 3.0 0.6 2.0

0.4 Relative Lipolytic Activity 1.0 0.2 Relative Proteolytic Activity (4 0.0 0.0 24 36 41 69 73 85 94 20 91 6B 6C 1A 1A 11B 28B 40B 60B 70B 35A 46A 81A 10A 17A 31A 46A 60A c 3.0 d 0.5 NPD) NPO) 2.5 - - 0.4 2.0 0.3 1.5

1.0 0.2

0.5 0.1 Relative Lipolytic Activity (4 Relative Lipolytic Activity (4 0.0 0.0 24 36 41 69 73 85 94 24 36 41 69 73 85 94 6B 6B 1A 1A 10A 17A 31A 46A 60A 10A 17A 31A 46A 60A e 0.30 f 0.40 0.35

0.25 NPP) NPM) - - 0.30 0.20 0.25

0.15 0.20

0.15 0.10 0.10 0.05 0.05 Relative Lipolytic Activity (4 Relative Lypolitic Activity (4 0.00 0.00 24 36 41 69 73 85 94 24 36 41 69 73 85 94 6B 6B 1A 1A 10A 17A 31A 46A 60A 10A 17A 31A 46A 60A Figure 10. The relative esterase activity of non-pathogenic strains with 4-nitrophenyl derivatives (a)4-nitrophenyl acetate (NPA) (b) 4-nitrophenyl butyrate (NPB) (c) 4-nitrophenyl octanoate (NPO) (d) 4-nitrophenyl dodecanoate (NPD) (e) 4-nitrophenyl myristate (NPM) (f) 4-nitrophenyl palmitate (NPP)

56 The lipolytic and proteolytic results had similarities. LAB strains had similar ability to break down lipid and protein. There was no significance difference between each lactobacillus group. The difference existed when compare the difference in all the Lactobacillus strains. This means that every strain has different and unique ability in utilizing the nutrients, even when they belong to the same strains (1B and 33C are L. rhamnosus but have significance difference in proteolytic ability). The lipolytic and proteolytic activity is strain specific. The lipolysis and proteolysis reaction caused by LAB strains were studied extensively in cheese and wine flavor development: Selected LAB strains are able to produce esterase that can hydrolyze esterase and generate flavor contributing substances (Katz et al., 2002) (Matthews et al., 2007) (Pérez-Martín et al., 2013) (Hong et al., 2018). Moreover, there are many studies demonstrated the high esterase activity in S. thermophilus and LAB strains such as Lactococcus lactis, L. casei, L. fermentum, L. helveticus, L. rhamnosus, L. plantarum (S-Q Liu et al., 2004). Another study also found that thermophilic Streptococci have more than double of esterolytic activity than Lactococcal strains

(Crow, Holland, Pritchard, & Coolbear, 1994) (Shao-Quan Liu, Holland, & Crow, 2001). The finding in this experiment match with the result in previous studies: S. thermophilus showed high esterolytic ability, which was greater than other tested LAB strains. The screening of esterase showed that more specific substrate can further identify promising strains. This also suggested that the lipolytic and proteolytic method using α -NPA and azocasein substrate were not very selective in LAB strains. On the other hand, the lipolytic testing can still be used in preliminary screening, it eliminated about 32% of low activity strains and reduce the extensive labor in later experiment.

57 C. Screening of functional characteristics

Seven promising strains, one negative control, Staphylococcus warneri, and one positive control, Enterococcus faecalis, extracted from a well-known probiotic product Symbioflor

(Symbiopharm, German) were selected to continue to screen for their functional characteristics.

1. Low pH and bile salt resistance testing

The ability to resist gastrointestinal (GI) tract condition is one of the important characteristics. In order to give actual health benefits, sufficient amount of selected strains are needed. Higher survival rate means the strains are more stable, maintaining cell membrane functionality, intracellular pH and the stability of DNA, RNA and proteins (Sirichokchatchawan et al., 2018). The result of survival percentage under low p.H (pH 2,2.5 and 3) and bile salt (0.3 and 0.4%) condition are shown in Table 9. After 3h incubation in MRS broth, all the strains showed zero tolerance under p.H2 condition. Four LAB strains: L. rhamnosus 42B, L. rhamnosus 14B, L. acidophilus 70A and L. helveticus 57B showed to have significance higher survival rate than the rest of the strains under pH 2.5 condition. They exhibited 67.91, 69.22, 74.83 and 76.66 % of survival rate, while other strains did not show any sign of growing. All of the testing strains showed to have significant higher survival rate at p.H 3. L. casei 2, L. rhamnosus 14B and L. helveticus

57B had the highest survival percentage at 92.59, 89.27 and 89.92 %. However, E. faecalis (S), the commercial probiotic product, only have 50.67 % of survival rate. S. warneri 76A, the control negative, have 66.59 % of survival rate under p.H3 condition. All the 7 Lactobacillus testing strains have significance higher survival rate than the pathogen strain and commercial strain under low pH.

58 In the bile salt tolerance testing (0.3 and 0.4%), all the strains showed good resistance rate except L. rhamnosus 37B. After 3h of incubation in 0.4% of bile salt MRS medium, L. casei 2, S. warneri 76A and E. faecalis S had significantly higher survival percentage than other testing

Lactobacillus strains, having 92.96, 95.69 and 90.48 % of survival rate. L. rhamnosus 37B showed it cannot tolerate the 0.4 % of bile salt medium. Under 0.3 % of bile salt condition, all the strains have survival rate range from 85-94 %, while L. rhamnosus 37B only had 74.16 % survival rate in

0.3% of bile salt medium, which is significantly lower than other strains in the same condition. All the strains had significantly higher resistance rate at 0.3 % bile salt than 0.4 % bile salt condition, except the strains (L. casei 2, S. warneri 76A and E. faecalis S) that already showed to have high survival rate at 0.4 % bile salt condition.

Table 9. Survival percentage of testing strains under low pH and bile salt condition after 3h incubation.

Survival Percentage pH2 pH2.5 pH3 Bile 0.4% Bile 0.3% L. casei 2 0 ± 0a,1 0 ± 0a,1 92.59 ± 1.10a,2 92.96 ± 0.60af,1 94.81 ± 0.73a,1 L. rhamnosus 14 0 ± 0a,1 69.22 ± 0.85b,2 89.27 ± 0.23ab,3 79.91 ± 1.64b,1 92.76 ± 0.11ab,2 L. rhamnosus 36 0 ± 0a,1 0 ± 0a,1 87.85 ± 1.08c,2 69.46 ± 5.87c,1 93.44 ± 0.15ab,2 L. rhamnosus 37B 0 ± 0a,1 0 ± 0a,1 86.10 ± 0.24d,2 0 ± 0d,1 74.16± 0.00c,2 L. rhamnosus 42B 0 ± 0a,1 67.91 ± 0.89c,2 84.52 ± 1.34d,3 74.87 ± 1.17e,1 87.43 ± 0.76de,2 L. helveticus 57B 0 ± 0a,1 76.66 ± 0.48d,2 89.92 ± 0.37b,3 73.89 ± 1.77e,1 85.27 ± 4.25d,2 L. acidophilus 70A 0 ± 0a,1 74.83 ± 0.51e,2 85.69 ± 0.36d,3 68.90 ± 0.79c,1 90.50 ± 4.08be,2 S. warneri 76A 0 ± 0a,1 0 ± 0a,1 66.59 ± 1.01e,2 95.69 ± 0.24f,1 94.80 ± 0.40a,1 E. faecalis S 0 ± 0a,1 0 ± 0a,1 50.67 ± 0.00f,2 90.48 ± 0.39a,1 90.63 ± 4.05b,1 Data presented as mean ± SD. Different lower case letter (a,b,c,d,e,f) within the same column indicates significance difference between strains. Different number (1,2,3) within the same row indicates significance difference within the same strains in survival rate at low pH (pH 2, 2.5 and 3) and bile salt (0.3 and 0.4 %)

59 When compared to other studies, tolerance to GI tract condition varies between LAB species and strains. One of the studies showed that after 3 h of incubation, four L. plantarum strains still have 70-90 % of survival rate under pH 2 condition. The same study also demonstrated that

L. plantarum having more than 75 % of survival rate at condition with 0.5 % of bile salt

(Sirichokchatchawan et al., 2018), while another study found that L. paracasei, L. casei and L. rhamnosus did not shown any growing after 3 h of incubation under pH 2 and 2.5 condition. Bile salt tolerance having 6.47-8.05 log cfu/mL viable counts after 3 h incubation at 0.4 % of bile salt.

The author also suggested that lactobacillus strains are less resistant than L. lactis strains

(Monteagudo-Mera et al., 2012). The latter study has a closer match with the result here in GIT tolerance testing: The similar acid tolerance at pH 2 and 2.5 and similar 0.4 % of bile salt tolerance

(In our testing , L. casei and L. rhamnosus had 6.5-8.05 log cfu/mL viable counts after 3 h incubation at 0.4 % of bile salt).

GIT tolerance test is important because we want to make sure the bacterial strains we are using are able to survive the harsh environment in GI tract. The test demonstrated both promising candidates and sensitive strains. The results of the GI tolerance test can be used in future analysis and studies: Strains with high survival rate are favorable in dairy product and nutraceutical development and our classification gives confidence in clinical studies, while sensitive strains can be used in tolerance improvement studies.

60 2. Cell Surface Properties (Hydrophobicity and Auto-aggregation)

Cell surface hydrophobicity measures the bacteria ability to adhere to hydrophobic compounds and intestinal mucosa cells, which can facilitate the first contact between microorganism and host. Additionally, hydrophobicity of the bacteria has influence on the adhesion capacity and auto aggregation in the later process. Bacteria with high hydrophobicity usually have strong interactions with mucosal cells. Figure 11. is showing the summary of bacterial adhesion (de Wouters, Jans, Niederberger, Fischer, & Rühs, 2015) (de Souza et al., 2018).

Figure 11. Summary of bacterial adhesion. The capacity of bacteria to adhere is a function of physico-chemical charges and surface properties of a bacteria. These properties can be measured quantitatively using rheological and tensiometric methods as illustrated in the upper part of the figure. Through bacterial adsorption at a hydrophobic interface, the interfacial elasticity is increased and depending on the bacterial characteristics, interfacial tension can be decreased. These measurable parameters can be used as quantitative measures for physico-chemical characteristics to different bacterial strains. These physicochemical properties can be used to predict bacteria's potential to adhere to biological surfaces like the intestinal mucosa as illustrated in the lower part of the figure (de Wouters et al., 2015).

61 The result of tested value of hydrophobicity (t 30) and auto-aggregation (t 1, t 2, t 3 and t

4) are shown in Table 10, Figure 12 and Figure 14. After 30 min of incubation under 37°C, 76A-

S. warneri showed to have significance higher value (17.42 %) in hydrophobicity percentage (H

%) than other testing strains. On the other hand, the 7 selected Lactobacillus strains, and E. faecalis had only 0-7 % in hydrophobicity testing. Due to the significance difference between S. warneri 76A and other testing strains, additional statistical analysis (Figure 12- b)were done to eliminate the effect of S. warneri 76A and to look closer to the 7 selected Lactobacillus strains.

The result without S. warneri 76A showed that L. casei 2 had higher value (7.21 %) in the LAB strains in hydrophobicity. L. casei 2 also showed to have significance higher value than the commercial probiotic, E. faecalis. Although E. faecalis is a commercialized probiotic, it did not show outstanding ability in hydrophobicity (0.61 %) and were not significance different from other testing LAB strains. This indicated that the strain might not have strong ability to bind to gut cells.

One of the studies have shown that Enterococcus faecalis having 12.6-14.7 % of hydrophobicity and other LAB strains (L. curvatus, L. fermentum, L. rhamnosis and L. delbrueckii) having 43.7-78.9 % with hexane (Svetoslav Dimitrov Todorov, Furtado, Saad, Tome, & Franco,

2011). Another study found that twelve L.casei strains having 9.66-54.85 % and seven

L. fermentum having 0.3-68.81% of hydrophobicity with hexane (de Souza et al., 2018). A study using toluene demonstrated that four L. plantarum having around 20-80 % of the surface hydrophobicity (Sirichokchatchawan et al., 2018). The LAB strains used in this experiment having only 1.81-7.21 % of hydrophobicity. However, a 2008 study found that strains with high hydrophobicity did not adhere to HT-29 cells, while strains with relatively low hydrophobicity adhere to HT-29 cells at 63 % (Svetoslav D Todorov, 2008). The author in a 2011 study also indicated that hydrophobicity can facilitate the adhesion, but it is not a requirement for strong

62 adherence. Hydrophobicity varies between species and strains (Svetoslav Dimitrov Todorov et al.,

2011).

a 20 a b 20 18 18 16 16 14 14 12 12 10 10 ab a ab 8 ab 8 ab ab ab 6 ab ab ab 6 Hydrophobicity (%) ab Hydrophobicity (%) ab 4 4 b b 2 b 2 b 0 0

2 - L. casei 2 - L. casei 76A- S. Swarneri - E. faecalis S - E. faecalis 14 - L. rhamnous36 - L. rhamnous37B- L. rhamnous42B- L. rhamnous57. - L. helveticus 57. - L. helveticus 70A- L. acidophilus 14 - L. rhamnosus36 - L. rhamnosus37B- L. rhamnosus42B- L. rhamnosus70A- L. acidophilus

Figure 12. Cell surface hydrophobicity (H %) of testing strains after 30 min of incubation. (a)H % of 7 selected Lactobacillus strains, S. warneri and E. faecalis (b) H % of 7 selected Lactobacillus strains and E. faecalis (without S. warneri). Different lower case letter (a,b) indicates significance difference between strains in hydrophobicity (t30)

Table 10. Cell surface hydrophobicity (H %) and auto-aggregation (A %) of testing strains.

H% A% 1h A% 2h A% 3h A% 4h L. casei 2 7.21 ± 1.03AB 1.50 ± 2.04a,1 53.63 ± 3.24ac,2 54.84 ± 2.97ac,2 61.64 ± 1.92a,3 L. rhamnosus 14 3.67 ± 2.28AB 1.95 ± 2.38ab,1 44.50 ± 1.95be,2 47.03 ± 2.16bd,2 54.12 ± 3.32b,3 L. rhamnosus 36 5.03 ± 3.24AB 1.06 ± 1.26a,1 52.99 ± 0.47c,2 53.16 ± 2.16c,2 59.49 ± 3.60a,3 L. rhamnosus 37B 3.27 ± 4.08AB 2.76 ± 3.88ab,1 59.35 ± 2.06d,2 57.58 ± 2.20a,2 61.94 ± 3.04a,2 L. rhamnosus 42B 3.10 ± 5.15AB 0.35 ± 2.19a,1 43.16 ± 2.50e,2 43.82 ± 1.45d,23 47.28 ± 2.12c,3 L. helveticus 57B 3.27 ± 1.15AB 1.88 ± 4.55ab,1 41.63 ± 2.98e,12 48.20 ± 0.66b,2 50.91 ± 2.99bc,2 L. acidophilus 70A 1.81 ± 1.37B 0.72 ± 0.58a,1 47.88 ± 0.17bf,2 47.40 ± 2.73b,2 51.69 ± 1.81bc, 3 S. warneri 76A 17.42 ± 25.16A 3.17 ± 1.61ab,1 57.15 ± 2.04ad,2 64.69 ± 1.62e,3 68.34 ± 1.92d,4 E. faecalis S 0.61 ± 1.04B 6.16 ± 2.20b,1 51.44 ± 1.94cf,2 56.44 ± 1.11ac,3 60.93 ± 2.73a,4 Data presented as mean ± SD. Different capital letter (A, B) within the same column indicates significance difference between strains in hydrophobicity (t30). Different lower case letter (a,b,c,d,e,f) within the same column indicates significance difference between strains in auto-aggregation (t1, t2, t3 and t4). Different number (1,2,3,4) within the same row indicates significance difference within the same strains in auto-aggregation (t1, t2, t3 and t4)

64 The auto-aggregation testing measures the bacteria ability of self-binding. Same bacteria bind together to facilitate the biofilm formation. The bacterial clump can also protect them from harsh environment like intestinal mucosa. Bacteria with high aggregation ability has higher chance to successfully colonize in gut. The role of auto-aggregation in biofilm formation is shown in

Figure 13.

Figure 13. The role of auto-aggregation in biofilm formation.

Autoaggregation can lead to biofilm formation in two ways: planktonic bacteria can either attach to a substrate surface as single cells and then recruit more planktonic cells via aggregation to form a single microcolony, or planktonic cells aggregate in suspension and then settle on the substrate surface. Both pathways can lead to the formation of biofilm (Trunk, Salah Khalil, & Leo, 2018).

After 1 h of incubation under 37°C, all the testing strains showed only 0-6 % of growing in auto-aggregation. After 2 h of incubation, all the strains had significance growth (41-59 %). L. rhamnosus 37B having the highest value (59.35 %), followed by S. warneri 76A (57.15 %) and 2-

L. casei (53.63 %). There was not much growing during 2 to 3 h for the 7 LAB strains. However,

S. warneri 76A and E. faecalis S continue to grow and showed significance higher ability between incubation time 2-3h. After 4 h of incubation, S. warneri 76A showed to have the highest value

(68.34 %) between testing strains, L. casei 2, L.rhamnosus 36 , L. rhamnosus 37B and E. faecalis

65 S showed to be significance higher than the rest of the testing strains. After 2 h of incubation, 3 strains (L. rhamnosus 37B, L. rhamnosus 42B and L. helveticus 57B) reached the top ability of the strains and slowed down the aggregation, while other strains continued to have significance growth.

The growing curve of auto-aggregation showed there are significance growth between 1 to 2 h of incubation time, then the growing reached plateau, starting to slow down.

One of the studies have shown that E. faecalis having around 80 % of auto-aggregation and other testing LAB strains (L. curvatus, L. fermentum, L. rhamnosis and L. delbrueckii) having only 10 % of auto-aggregation after 1h incubation under 37°C (Svetoslav Dimitrov Todorov et al.,

2011). Similar study showed that twelve L.casei strains and seven L. fermentum having 80-96 % of auto-aggregation after 1h incubation under 37°C (de Souza et al., 2018). Another study took reading not only 1 h of incubation, but also 2h, 3h and 4h. In the study, four L. plantarum demonstrated 10, 10-20, 10-25 and 38-43 % of ability after 1 h, 2h, 3h and 4h incubation under

37°C (Sirichokchatchawan et al., 2018), while the testing strains in this experiment showed 0.7-

2.8, 41-60, 43-64, 47-68 %. When compare to other finding after 1 h incubation, the testing LAB strains did not show the best ability. However, they have significance higher ability than other studies after 2, 3and 4h incubation. Microorganism and ingested food stay around 30-50 h in large intestine, where the main base of the bacteria is. The delayed clumping in the testing strains might be helpful for them to colonize in the large intestine.

66 70 # * * * * 60

30 aggregation (%) -

Auto 20

0 2 - L. casei 14 - L. 36 - L. 37B- L. 42B- L. 57. - L. 70A- L. 76A- S. S - E. rhamnosus rhamnosus rhamnosus rhamnosus helveticus acidophilus warneri faecalis

After 1hr After 4hr

Figure 14. Auto-aggregation (A %) of testing strains after 1and 4 h incubation. Comparison of 1 and 4h incubation time and the H % of 7 selected Lactobacillus strains, S. warneri and E. faecalis. # and* symbols indicate significance difference between strains in auto- aggregation (t4) The importance of this result is that we differentiate LAB strains with promising activity and strains that did not exert the best in hydrophobicity and auto-aggregation properties. We also found that our results have some inconsistency with other studies: This either indicates that our strains are not the optimal strains to set camp in human gut or the methods we were using were not representative. This suggested that other adherence testing should be used to further validate the finding in this study. For example, Caco-2 cell in vitro adhesion study (C.-Y. Wang et al., 2010).

On the other hand, hydrophobicity testing with toluene is a relative fast and easy method to gain results and to form an idea of the kind of surface of these bacteria. Therefore, toluene hydrophobicity test can still be used as a screening method when there are a lot of samples. But, if the number of samples are acceptable, other methods might be a better choice.

67 3. Antibiotics susceptibility

One of the important characteristics for human consumption is that the bacteria must be safe. They cannot be carriers of transferable antibiotic resistant genes (Pinto, Franz, Schillinger, &

Holzapfel, 2006). This is due to bacteria can pass their transferable genes to others (pathogenic bacteria) through conjugation.

The result of antibiotic susceptibility test is shown in Table 11. Testing LAB strains showed to have similar pattern in antibiotic resistance; they are resistance to kanamycin (K) and vancomycin (V) but sensitive to chloramphenicol (C), tetracycline (TE), erythromycin (E), ampicillin (Amp), clindamycin (DA) and streptomycin (S). L. acidophilus 70A only showed to have resistance in vancomycin (V). S. warneri 76A showed resistance to erythromycin (E) and E. faecalis being resistance to 3 antibiotics: streptomycin (S), kanamycin (K) and clindamycin (DA).

Lactobacilli strains being resistance to vancomycin can be traced back to 1998. Author reported that within the 43 strains they tested, all 16 of the L. acidophilus and 2 of the L. delbreuckii were sensitive to vancomycin, while other 25 strains (15 of the L. rhamnosus, 2 of the L. paracasei, 2 of the L. plantarum, and one each of the L. fermentum, L. confusus, L. salivarius, L. buchneri, L. sp. and L. casei) were resistance (Hamilton-Miller & Shah, 1998). More recent study, on the other hand, demonstrated that almost all of the testing strains are resistant to vancomycin and kanamycin(C.-Y. Wang et al., 2010) (Monteagudo-Mera et al., 2012) (Jeronymo-Ceneviva et al.,

2014) (de Souza et al., 2018). Nevertheless, the vancomycin resistance found in the LAB strains were considered to be intrinsic or natural resistance and being non-transferable. The resistance to vancomycin in lactobacillus strains are caused by the presence of D-Ala-D-lactate in peptidoglycan rather than normal peptide D-Ala-D-Ala, which is the target of the vancomycin

(Monteagudo-Mera et al., 2012).

68 The importance of the result is that we found the antibiotic resistant pattern in LAB strains in our collection. Due to the expense, time and amount of work in 16s sequencing, the antibiotic resistant pattern can be used as a preliminary screening to identify potential LAB strains. This can also be used to identify other bacteria. For example, differentiate fecal coliforms and fecal

Streptococci, and E.coli and Enterococcus spp. (Whitlock, Jones, & Harwood, 2002).

Table 11. Antibiotic susceptibility of testing strains.

C E S K DA Amp TE V Strain Name Code (30 μL/disc) (15 μL/disc) (30 μL/disc) (30 μL/disc) (16.2 μL/disc) (10 μL/disc) (30 μL/disc) (30 μL/disc) L. casei 2 S S S R S S S R L. rhamnous 14B S S S R S S S R L. rhamnous 36 S S S R S S S R L. rhamnous 37B S S S R S S S R L. rhamnosus 42B S S S R S S S R L. helveticus 57B S S S R S S S R L. acidophilus 70A S S S S S S S R S. warneri 76A S R S S S S S S E. faecalis S S S R R R S S S

C=Chloramphenicol, E= Erythromycin, S= Streptomycin, K= Kanamycin, DA= Clindamycin, Amp= Ampicillin, TE= Tetracycline, V= Vancomycin. The concentration of antibiotics is expressed in microgram per disc (μL/disc). Sensitive(S): zone diameter17.5mm, Moderate Sensitive(MS): 12.5-17.4mm, Resistance(R): 12.4mm

4. Antibacterial Activity

Bacteriocins producing bacteria can inhibit competing bacteria by the antimicrobial polypeptides they produce. Not only the bacteriocin produced by LAB strains can prevent growing of other bacteria, the by-product from the fermentation: lactic acid, hydrogen peroxide, and ethanol etc. also demonstrated inhibitory of pathogenic strains. Bacteriocins and other by-product can act as food preservatives and being a “natural” ingredient in the clean label food product (Šušković et al., 2010).

The result of antibacterial activity test is shown in Table 12. Only the additional control positive E. durans included in this experiment had shown antibacterial activity against L. innocua

ATCC 51742 in both resuspended cells and cell-free supernatant (CFS). The testing LAB strains,

S. warneri and E. faecalis did not produce bacteriocins that have antibacterial activity against target strains: E. coli ATCC 25922 and L. innocua ATCC 51742 in resuspended cells and CFS.

Many of the LAB strains have shown antibacterial activity against both Gram positive and Gran negative bacteria: E. coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, E. faecalis, S. aureus and Bacillus subtilis with L. crispatus and L. gasseri in previous study (Kim & Rajagopal, 2001).

However, (Monteagudo-Mera et al., 2012) (Sirichokchatchawan et al., 2018) also found that the

L. paracasei, L. casei, L. rhamnosus, and L. plantarum strains having antibacterial activity with the low pH caused by lactic acid, but they were not the best bacteriocins producing bacteria against

S. aureus, L. innocua, L. monocytogenes and E. coli. This match with the result in this experiment.

The result of this study demonstrated that neutralized CFS were less aggressive than low pH ones.

This again underscores the importance of the by-product like lactic acid in LAB strains and their

71 protective characteristic against pathogenic bacteria (Šušković et al., 2010). The bacteriocins in the E. durans also showed to work better on Gram positive pathogens (L. innocua) than Gram negative (E. coli). This can be used in targeted pathogen studies, making the most relevant use of these strains and their bacteriocins.

Table 12. Antibacterial activity of testing strains against Escherichia coli ATCC 25922 and Listeria innocua ATCC 51742

E. coli ATCC 25922 L. innocua ATCC 51742 Cell CFS Cell CFS 2 - L. casei - - - - 14 - L. rhamnosus - - - - 36 - L. rhamnosus - - - - 37B- L. rhamnosus - - - - 42B- L. rhamnosus - - - - 57. - L. helveticus - - - - 70A- L. acidophilus - - - - 76A- S. warneri - - - - S - E. faecalis - - - - E -E. durans - - + + CFS: cell-free supernatant, (-): zone diameter7.5mm, (+): 12.5mm 5. Screening of gene encoding with virulence factors and biogenic amines

The presence of genes encoded with virulence factors means the bacteria have more chance to possess the characteristic and give harm to human host. For example, If the bacteria have the gene coded with fibrinogen-binding protein (adhesion protein), this increase the chance for potential adhesion to intestinal mucosa (de Souza et al., 2018).

The result of virulence genes screening is shown in Table 13. All the testing LAB strain did not show to have gene encoding with virulence factor in agg, ace, asa1, fbp, cbp, mazm, eFaA, gelE, hyl, esp and cyt but only in biogenic amines: hdc, tdc and odc (histidine decarboxylase, tyrosine decarboxylase and ornithine decarboxylase). L. casei 2 and L. helveticus 57B strains had only one gene encoded with biogenic amines (tdc and hdc), while the other LAB strains had more 72 than one biogenic amine genes. Surprisingly, S. warneri 76A having only hdc gene, while E. faecalis S, the commercial strains having ace, efaA, hyl, agg, fbp and tdc genes.

The presence of these genes did not mean their genes were turned on, even the genes were turned on and LAB strains were producing biogenic amines, these were as expected. Many of the

LAB strains were isolated form cheese, which is rich in histidine and tyrosine. Bacteria fermentation can transform these amino acids into biogenic amines. Low level of biogenic amines in food are not considered a serious risk to population, healthy people can get rid of them really fast without having any symptoms. These amines can only cause adverse effect when consumed in excessive amounts or with certain drugs like medication for depression; monoamine oxidase inhibitors (MAOIs) (Stratton, Hutkins, & Taylor, 1991).

The significance of the result is that the method can be used to differentiate pathogenic and innocuous strains in a relatively fast way. Strains with virulence factors can also be used in further studies. For example, strains with hyl (hyaluronidase) genes can be investigated focusing on their enzyme activity and used as potential antibacterial agent(s) (Bollet, Bonner, & Nance, 1963).

Table 13. Presence of virulence factors and biogenic amines

Type Virulence Factor Biogenic Amines

Gene ace asa1 cylA efaA esp gelE hyl agg cbp fbp maz hdc tdc odc L. casei 2 ------+ - L. rhamnosus 14 ------+ - + L. rhamnosus 36 ------+ L. rhamnosus 37B ------+ + + L. rhamnosus 42B ------+ + - L. helveticus 57B ------+ - - L. acidophilus 70A ------+ + - S. warneri 76A ------+ - - E. faecalis S + - - + - - + + - + - - + - + symbol indicates the presence of genes, - symbol indicates the absence of genes

Three strains with high lipolytic activity and with great functional properties were selected:

(Lactobacillus casei 2, Lactobacillus helveticus 57B and, Lactobacillus acidophilus 70A) and applied in medium for fermentation.

Common Lactobacillus probiotic are L. plantarum, L. paracasei, L. acidophilus, L.casei,

L. rhamonosus, L cripatus, L. gasseri, L. reuteri and L. bulgaricus. There are still not a lot of probiotic information and study on the L. helveticus. Most of the study focus on the dairy industry.

The functional properties testing result indicates the possibility of combining health contributing

LAB with dairy product, creating a health promoting dairy functional product.

The reason of LAB classification is because we are trying to find out LAB strains associated new health benefit(s). The health promoting compounds produced by LAB strains and

LAB strains themselves are viewed as future products for human wellbeing. Therefore, it is best to determine if the selected LAB strains pose functional properties in the sense of the word of low risk for human health.

D. Phospholipid Hydrolysates Analysis

1. Thin Layer Chromatography (TLC)

TLC analysis are able to separate lipids relatively faster and can analyze many samples together. Therefore, TLC was used in lipid analysis of minimum medium and milk fermentation to get a first glance at the samples.

a. Minimum Media Fermentation with selected LAB

The result of separated polar lipids/ non-polar lipids and free fatty acids from minimum medium (MM) fermentation are shown in Figure 15 and the Rf value is shown in Table 14. Figure

15 (a) showed that minimum media (MM) without carbohydrate (WO) did not have any bands in polar lipids separation, while MM without CHO + 0.5% Milk phospholipid (MP) (WOMP) had 5 to 6 different bands. The similar result also shown in Figure 15 (b), MM with 4% lactose (WL) had no bands, while MM with 4% lactose + 0.5% MP (WLMP) had 5 to 7 bands: The MM added with MP tend to have more bands than the MM without added MP. The potential source of these bands was the added MP, MP degradation during thermo processing (autoclaved) or 37 °C storage,

MP and milk medium interaction and metabolites of MP from fermentation. Three of the bands

(Rf: 0.08-0.11, 0.12 and 0.19-0.20) from WOMP and WLMP were similar to MP (control) bands

(Rf: 0.10, 0.11 and 0.16), suggesting they are from the added MP. Two of the them (Rf: 0.08-

0.11and 0.19-0.20) are also match with the sphingomyelin (SM) and PC control. Two of the bands

(0.39-0.42 and 0.58-0.59) from WOMP and WLMP did not match with the MP (control) bands and existed in different conditions: before fermentation, after fermentation and also in control medium (without inoculated bacteria). One of the bands (Rf: 0.39-0.42) match with the PE control.

This indicates that these bands were from MP degradation or interaction product of MP and milk medium. 76 WOMP and WLMP medium both showed to have a unique band around Rf value 0.73-

0.74. Moreover, WLMP had another band at Rf value 0.07, which only existed in fermented medium. This suggested that these bands were from bacteria metabolites of MP during fermentation. The WLMP band at Rf value 0.07 was found only in WLMP medium after fermentation, and WOLP did not show to have this band. It is possible that the selected LAB strains grew better in the medium with carbohydrate, one of the essential nutrients, and had more ability/ strength to utilize the added MP or the ability to produce polar lipids. The result of non-polar lipids separation showed that WO, WOMP and WL medium did not show any bands in the non-polar lipids separation, only WLMP medium had bands at Rf value 0.25 (Figure 15-C). The free fatty acid (FFA) separation showed similar result as separation of non-polar lipids: only WLMP medium had bands at Rf value 0.26 after fermentation. These bands were only from WLMP fermented medium, this again suggested that these bands were from bacteria metabolites during fermentation.

The production of the bacteria metabolites could be due to the added MP, 4 % lactose or the combination of them all.

77 a b

c d

Figure 15. Separated Polar Lipids/ Non-Polar Lipids and Free Fatty Acids (FFA) from Minimum Medium Fermentation (a)Separated polar lipids from WO and WOMP medium. (b) Separated polar lipids from WL and WLMP medium. (c) Separated Non-Polar lipids from WL and WLMP medium. (d) Separated FFA from WOMP and WLMP medium. WO= Minimum Media (MM) without CHO, WOMP= MM without CHO + 0.5% Milk phospholipid (MP), WL= MM with 4% lactose, WLMP= MM with 4% lactose + 0.5% MP. D1= Unfermented Medium at Day 1 without selected LAB strains, D21=Fermented Medium at Day 21, 1= L. casei 2, 2= L. helveticus 57B, 3= L. acidophilus 70A, C=control (without bacteria)

Table 14. Rf value of separated polar lipids/ non-polar lipids and free fatty acids (FFA) from minimum medium fermentation.

Rf Value Minimum Medium 0.5%MP Control WO WOMP WL WLMP MP D1 D21 Control D1 D21 Control 0.96 0.73 0.74 0.58 0.58 0.58 0.59 0.59 0.59 Polar Lipids PE 0.42 0.42 0.42 0.39 0.39 0.39 0.29 PC 0.19 0.19 0.19 0.20 0.20 0.20 0.16 0.12 0.12 0.12 0.12 0.12 0.12 0.11 SM 0.11 0.11 0.11 0.08 0.08 0.08 0.10 0.07 Control WO WOMP WL WLMP MP Non-Polar D1 D21 Control Lipids 0.25 Control WO WOMP WL WLMP MP Free Fatty Acid D1 D21 Control

0.26 WO= Minimum Media (MM) without CHO, WOMP= MM without CHO + 0.5% Milk phospholipid (MP), WL= MM with 4% lactose, WLMP= MM with 4% lactose + 0.5% MP. D1= Unfermented Medium at Day 1 without selected LAB strains, D21=Fermented Medium at Day 21, C=control (without bacteria), PC= phosphatidylcholine, SM= sphingomyelin, PE=phosphatidylethanolamin

b. Milk Medium fermentation with selected LAB

The result of separated polar lipids/ non-polar lipids and free fatty acids from milk medium fermentation are shown in Figure 16, Figure 17 and Figure 18 and the Rf value is shown in Table

15. The polar lipids result (Figure 16) showed that all of the medium (also MP and control) has the same band at Rf value: 0.94-0.97. It is possible that the band (lipid) was the nature lipid that existed in the milk medium, also in concentrated MP. The other explanation is that the lipid comes from bovine source/ processed cow’s milk, which all the medium and the concentrated MP were gained from.

In Figure 11(a), skim milk medium (SM) only had the band at Rf value: 0.94-0.97 in polar lipids separation. Figure 16 (b), (c) and (d) showed that there are three bands (Rf: 0.19-0.28, 0.13-

0.20 and 0.12-0.18) in skim milk medium with 0.5 % of milk phospholipid (SMMP), buttermilk medium (BM) and buttermilk medium with 0.5 % of milk phospholipid (BMMP) that match with the MP (control) (Rf: 0.29, 0.16 and 0.11), suggesting the polar lipids were both in processed MP concentrate ( SMMP, BMMP and concentrated MP) and also in nature MP (BM) in the medium.

The three bands match with the control of sphingomyelin, PI and PC. BMMP medium had an extra band (Rf: 0.1) that others (including SMMP) did not show. The extra band is also similar to the one of the bands in MP (control) (Rf: 0.1). It is possible that LAB strains in BMMP had many resources to use, therefore, instead of utilizing the added MP, they used the nature MP existed in the buttermilk, leaving the added MP intact. In the SMMP medium, there were only little or none of the nature MP in skim milk. The LAB strains had no choice but have to make use of the added

MP. Therefore, lipid at Rf value: 0.1 was break down into other pieces and cannot be seen at 0.1

Rf value in SMMP medium.

80 SMMP, BM and BMMP medium showed to have a same band (Rf value: 0.39-0.44), which

SM and concentrated MP did not show. The band is a match with PE. This can be explained by the MP degradation after autoclave. The band was from MP existed in all medium and incubation caused the disintegration of the MFGM, releasing the PE from the membrane. But the concentration in SM is too low, that TLC did not have enough resolution to show it. BM and

BMMP medium both showed to have two bands at Rf: 0.63-0.83 and 0.89 but was not shown in concentrated MP, SM and SMMP medium. These bands are likely from nature phospholipid in the buttermilk medium.

The most interesting band (Rf value: 0.08) was showed in the BMMP medium after fermentation (Figure 16-d). The band was not found in concentrated MP, other medium, control or before fermentation. It is possible that the band (lipid) was MP hydrolysate/ bacteria metabolites of MP during fermentation. This can be explained by the hypothesis of this study: the presence of concentrated MP turned on some of the genes in LAB strains or acted as gene regulator; in another word, LAB strains adapted to the environment that is rich in MP (added MP) and started to use the

MP. The reason other medium did not exert the band can be explained in two ways: First, the concentration of phospholipid is not enough in SM, therefore, the TLC did not have clear bands.

Second, the structure of the concentrated MP was damaged or too complex for the LAB strains to use. Therefore, LAB strains preferred nature form of the phospholipid. LAB strains can only utilize phospholipid that is originally in buttermilk medium and then produce the unique band (Rf value:

0.08). This can also explain that although SMMP had the added MP and BM had its nature phospholipid, they both did not had the unique band (Rf value: 0.08). In the SMMP medium, the added MP turn on the genes of the LAB strains, but the added MP were not operable. There was also lack of nature form of phospholipid that the LAB strains can use. In the BM medium, the MP

81 concentration was not high enough to turn on the gens or the phospholipid hydrolysate from buttermilk phospholipid was in low concentration that TLC does not have enough resolution to see it.

82 a b

c d

Figure 16. Separated Polar Lipids from Milk Medium Fermentation (a)skim milk medium (SM). (b) skim milk medium with 0.5 % of milk phospholipid (SMMP). (c) buttermilk medium (BM). (d) buttermilk medium with 0.5 % of milk phospholipid (BMMP). D1= Unfermented Medium at Day 1 with selected LAB strain, D2=Fermented Medium at Day 2 1= L. casei 2, 2= L. helveticus 57B, 3= L. acidophilus 70A, C=control (without bacteria)

83 The non-polar lipids result (Figure 17) showed that BM and BMMP medium had three similar bands (Rf: 0.11-0.13, 0.24 and 0.19-0.3) which other medium and MP control did not show.

These bands are likely from the nature lipid in the buttermilk medium. BMMP also had a unique band at Rf value: 0.22. The band did not match with the MP (control) bands and existed in different conditions of BMMP: before fermentation, after fermentation and in control medium (without inoculated bacteria). This indicates that the band was from MP degradation or interaction product of MP and milk medium. Similar result was also observed in minimum media fermentation: medium added with MP showed bands that did not belongs to the MP control (Table 14.).

The FFA result (Figure 18.) showed that only BM had a band at Rf value: 0.56. The possible source of the band was the nature MP (MP in buttermilk medium) degradation during thermo processing or 37 °C storage. BMMP was made of same BM medium but did not show similar bands in FFA separation. It is possible that the added MP interact with the nature MP in

BMMP, making the MP in nature form harder to degrade. Therefore, the FFA were not release into the medium and the band were not shown in FFA separation.

84 a

a b

c d

Figure 17. Separated Non-Polar Lipids from Milk Medium Fermentation (a) skim milk medium (SM). (b) skim milk medium with 0.5% of milk phospholipid (SMMP). (c) buttermilk medium (BM). (d) buttermilk medium with 0.5% of milk phospholipid (BMMP). D1= Unfermented Medium at Day 1 with selected LAB strain, D2=Fermented Medium at Day 2 1= L. casei 2, 2= L. helveticus 57B, 3= L. acidophilus 70A, C=control (without bacteria)

85 a b

c d

Figure 18. Separated Free Fatty Acid from Milk Medium Fermentation (a) skim milk medium (SM). (b) skim milk medium with 0.5% of milk phospholipid (SMMP). (c) buttermilk medium (BM). (d) buttermilk medium with 0.5% of milk phospholipid (BMMP). D1= Unfermented Medium at Day 1 with selected LAB strain, D2=Fermented Medium at Day 2 1= L. casei 2, 2= L. helveticus 57B, 3= L. acidophilus 70A, C=control (without bacteria)

Table 15. Rf value of separated polar lipids/ non-polar lipids and free fatty acids (FFA) from milk medium fermentation.

Rf Control SM SMMP BM BMMP MP Value D1 D2 Control D1 D2 Control D1 D2 Control D1 D2 Control 0.97 0.97 0.97 0.97 0.97 0.97 0.96 0.96 0.96 0.94 0.94 0.94 0.96 0.89 0.89 0.89 0.89 0.89 0.89 0.83 0.83 0.83 0.63 0.63 0.63 Polar PE 0.44 0.44 0.44 0.39 0.39 0.39 0.39 0.39 0.39 Lipids PC 0.28 0.28 0.28 0.20 0.20 0.20 0.19 0.19 0.19 0.29 PI 0.20 0.20 0.20 0.13 0.13 0.13 0.16 0.16 0.16 0.16 SM* 0.18 0.18 0.18 0.12 0.12 0.12 0.12 0.12 0.12 0.11 0.10 0.10 0.10 0.10 0.08 SM SMMP BM BMMP MP D1 D2 Control D1 D2 Control Non- 0.30 0.30 0.30 0.29 0.29 0.29 Polar

Lipids 0.24 0.24 0.24 0.24 0.24 0.24 0.22 0.22 0.22 0.11 0.11 0.11 0.13 0.13 0.13 Free SM SMMP BM BMMP MP

Fatty D1 D2 Control

Acid 0.56 0.56 0.56

D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria) SM=skim milk medium, SMMP= skim milk medium with 0.5% of milk phospholipid, BM=buttermilk medium, BMMP= buttermilk medium with 0.5% of milk phospholipid (BMMP), PE=phosphatidylethanolamine, PC= phosphatidylcholine, PI=phosphatidylinositol, SM*= sphingomyel 87

The result from MM and milk fermentation both showed that after fermentation, there is an additional band appeared at Rf value: 0.07-0.08 in the polar lipid separation. After compare to other studies, it is likely that the unidentified band belong to lysophospholipids. Lysophosphlipids were reported in milk previously, but many were considered artifacts or due to lipolytic enzyme activity (El-Loly, 2011) . This seems a match with our hypothesis and result in TLC analysis: The

Lysophospholipids were formed after the action of phospholipase produced by LAB strains.

One of the studies tried to develop a method to separated phospholipid and lysophospholipids with 1-D TLC. At first, they were not able to separate them with simple plate.

However, after trying several different methods, they found that by utilizing a silica plate with 0.4

% ammonium sulphate and a developing solvent of chloroform: methanol: acetic acid: acetone: water (40:25:7:4:2, v/v), they are able to separate 5 phospholipids (PS, PE, PI, PC and SM) and 3 lysophospholipids (LPS, LPE and LPC) (W.-Q. Wang & Gustafson, 1992).

2-D TLC was also performed to separate phospholipids (PC, PS, PI and PE) and lysophospholipids (LPC). Silica plate was developed with solvent containing chloroform: methanol: ammonia (65:25:5, v/v/v). The plate was further developed in the 2-D with solvent containing chloroform: acetone:methanol: glacial acetic acid:water (50:20:10: 10:5,v/v/v/v/v)

(Fuchs, Süß, Teuber, Eibisch, & Schiller, 2011).

The importance of the result is that it confirmed the hypothesis we made earlier: LAB strains produce lipid-associated compounds after fermentation with milk phospholipids. The MM fermentation proved the existence of the lipid-associated compound and milk fermentation experiments further confirmed that the compound produced by LAB strains is only present in the more complex environment.

88 2. High Performance Liquid Chromatography (HPLC)

a. Skim Milk Medium fermentation with selected LAB

i. Skim milk medium

The HPLC chromatogram of skim milk fermentation is shown in Figure 14. The retention time (minute) and calculated amount (µg/mL) of each peak are shown in Table 16 and Table 17

Figure 19-A and Table 16. showed that before fermentation, skim milk medium with selected LAB strains had a PE peak around retention time 26.65-26.89 (min), while skim milk medium without bacteria (control) did not showed the PE peak. This suggested that the PE comes from the LAB strains, possibly from bacteria membrane. PS and PE were found to be one of the bacterial membrane materials (Gorby, Beveridge, & Blakemore, 1988). Another study demonstrated PE and

PC being the most abundant phospholipid in bacteria (Rütters, Sass, Cypionka, & Rullkötter, 2002).

The amount of the PE varies between different LAB strains (63.69, 71.65 and 32.18µg/mL), this can be due to the unhomogenized sampling and lipid extraction, human identification error of the peak or nature difference of concentration in the medium. All of them had low amount of the PE and tiny peak on the chromatogram.

After a day of fermentation, all of the samples appeared a peak around retention time 21.43-

21.87 (min). The comparison of before and after fermentation and control is shown in Figure 20.

Due to the unknown nature of the peak, the concentration could not be calculated. The area was recorded instead and shown in Table 18. L. casei 2, L. helveticus 57B, L. acidophilus 70A and control (w/o bacteria) having area: 15.96, 17.10, 15.23 and 1.24. The LAB strains had similar area of the peak, while control had only 1.24. The appearance of the unidentified peak after fermentation also indicated that LAB strains can make use of the nature, but low concentration of

MP existed in skim milk medium and produce the metabolites of the MP. The peak in the control

89 can be explained by the hypothesis that after fermentation/ incubation at 37°C, medium with selected LAB strains were able to utilize the little amount of the MP existed in skim milk and then produce compounds that appeared chromatogram after fermentation. The tiny peak in control can be due to the incubation temperature can also break down the MP in skim milk and produce similar compounds as the LAB strains. The concentration/ area of the peak in control is really low, without the aid of chromatogram analysis, naked eyes couldn’t identify it.

Another change is in the control; control did not have the PE peak before, but the peak appeared after a day of incubation at 37°C. It is possible that low amount of MFGM in skim milk disrupted under high temperature (37°C) when compare to reirrigated temperature (0-7°C) (Stuart

Patton, Long, & Sooka, 1980). Therefore, PE from the MFGM released into skim milk and then raised the amount of PE from 0 to 80.50 µg/mL. The amount of PE also changed after fermentation:

L. casei 2 and L. acidophilus 70A showed higher amount of PE after fermentation (71.65 to 80.22 and 32.18 to 68.70µg/mL), while L. helveticus 57B showed a decreased from 71.65 to 57.79µg/mL.

Again, because of the low concentration of PE, the differences could be due to unhomogenized sampling and lipid extraction, human identification error of the peak or nature difference of concentration in the medium. It is also possible that the unbalanced equilibrium between PE releasing after storing/ incubation and LAB strains using the MP can lead to the variance result.

90 A-i

A-ii

A-iii

A-iv

B-i

B-ii

B-iii

B-iv

Figure 19. HPLC chromatogram of skim milk fermentation with selected strains and control (A) Skim milk medium before fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria) (B) Skim milk medium after fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria)

Table 16. Retention time (min) of each peak in skim milk fermentation

Peak Name SMD1-2 SMD1-57 SMD1-70 SMD1-C SMD2-2 SMD2-57 SMD2-70 SMD2-C Unknown Peak 21.60 21.87 21.84 21.43 PE 26.65 26.77 26.89 26.79 26.75 27.86 26.86 Peak Name SMPD1-2 SMPD1-57 SMPD1-70 SMPD1-C SMPD2-2 SMPD2-57 SMPD2-70 SMPD2-C PI 16.63 16.30 16.38 16.35 16.36 16.34 16.30 Unknown Peak 21.68 21.87 21.96 PS 25.32 24.83 25.91 25.60 24.95 24.65 24.73 24.57 PE 27.34 26.99 26.99 26.97 26.95 26.98 26.95 26.98 PC 36.66 36.29 36.24 36.23 36.22 36.24 36.23 SM 39.26 40.29 38.98 38.96 38.97 38.98 38.97 SM=skim milk medium, SMP= skim milk medium with 0.5% of milk phospholipid D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria), PE= phosphatidylethanolamine, PI= Phosphatidylinositol, PS= phosphatidylserine, PC= phosphatidylcholine, SM= sphingomyelin

92 Table 17. Calculated amount (ug/mL) of each peak in skim milk fermentation

Peak Name SMD1-2 SMD1-57 SMD1-70 SMD1-C SMD2-2 SMD2-57 SMD2-70 SMD2-C PE 63.69 71.65 32.18 0.00 80.22 57.79 68.70 80.50 Peak Name SMPD1-2 SMPD1-57 SMPD1-70 SMPD1-C SMPD2-2 SMPD2-57 SMPD2-70 SMPD2-C PI 234.27 0.00 82.50 92.19 95.28 84.99 91.83 408.26 PS 154.17 73.78 333.33 76.46 139.27 134.38 160.81 611.21 PE 707.93 178.31 463.20 337.62 281.04 294.86 315.44 1620.49 PC 878.06 0.00 531.32 355.19 345.70 292.17 291.49 2005.55 SM 850.43 0.00 725.35 269.69 177.07 245.20 258.89 1939.44 SM=skim milk medium, SMP= skim milk medium with 0.5% of milk phospholipid D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria), PE= phosphatidylethanolamine, PI= Phosphatidylinositol, PS= phosphatidylserine, PC= phosphatidylcholine, SM= sphingomyelin 0 ug/mL 0-200 ug/mL 200-400 ug/mL Above 400 ug/mL

93 Table 18. Calculated area (pA) of the unknown peak in skim milk and buttermilk fermentation

Area SMD1-2 SMD1-57 SMD1-70 SMD1-C SMD2-2 SMD2-57 SMD2-70 SMD2-C Unknown Peak 0.00 0.00 0.00 0.00 15.96 17.10 15.23 1.24 SMPD1-2 SMPD1-57 SMPD1-70 SMPD1-C SMPD2-2 SMPD2-57 SMPD2-70 SMPD2-C Unknown Peak 0.00 0.00 0.00 0.00 18.01 28.32 32.21 0.00 Area BMD1-2 BMD1-57 BMD1-70 BMD1-C BMD2-2 BMD2-57 BMD2-70 BMD2-C Unknown Peak 0.00 0.16 0.00 0.00 16.52 25.59 18.37 0.00 BMMPD1-2 BMMPD1-57 BMPD1-70 BMPD1-C BMPD2-2 BMPD2-57 BMPD2-70 BMPD2-C Unknown Peak 0.00 0.00 0.00 0.00 10.48 18.89 22.73 0.00 SM=skim milk medium, SMP= skim milk medium with 0.5% of milk phospholipid BM- buttermilk medium, BMP= buttermilk medium with 0.5% of milk phospholipid D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria) 0 pA 0-10 pA 10-20pA Above 20 pA

Figure 20. Comparison of HPLC chromatogram in skim milk fermentation (a) Before Fermentation (b) After fermentation (c) Control (w/o) bacteria

ii. Skim milk medium with 0.5% MP (SMMP)

The HPLC chromatogram of skim milk fermentation with 0.5% of MP is shown in Figure

21. Chromatogram of medium with L. helveticus 57B in Figure 21-A-ii appeared to be different from the other medium with LAB strains; it was lack of the PI, PC and SM peak and had really low amount of PE. This suggested that the lipid extraction in this sample were not done successfully and therefore will not be considered in later result and discussion. The retention time

(min) and calculated amount (µg/mL) of each peak are shown in Table 16 and Table 17 Before fermentation/ incubation, medium with LAB strains and control all showed to have 5 peaks

95 representing PI (retention time: 16.30-16.63 min), PS (25.32-25.91 min), PE (26.99-27.34 min),

PC (36.24-36.66 min) and SM (38.98-40.29 min). Medium with LAB strains tend to have higher concentration in PE, PC and SM than the control sample. The PE peak was also observed in the skim milk medium (before fermentation) and was thought to be the membrane materials in the

LAB strains. The SMMP medium showed additional PC and SM peaks when compare to skim milk medium and had higher concentration than control. This suggested that the presence of additional MP and LAB strains are able to disrupt the stability of MFGM and release the phospholipid.

After a day of fermentation, the concentration of each phospholipid dropped in the SMMP medium with LAB strains, while the control had higher amount of phospholipids detected. The control had increased amount of phospholipids are due to the incubation release them into the medium. However, the decreased in the testing medium indicates that the LAB strains made used of the MP and therefore lower the concentration of MP (PI, PS, PE, PC and SM) after fermentation.

The unidentified peak in skim milk medium also appeared in SMMP medium after fermentation at retention time 21.68-21.96 min. The comparison of before and after fermentation and control is shown in Figure 22. The area was recorded and shown in Table 18. L. casei 2, L. helveticus 57B,

L. acidophilus 70A and control having area: 18.01, 28.32, 32.21 and 0. The peak only got detected after fermentation, it did not appear before fermentation or in the control sample. This finding suggested that LAB strains were able to utilize the MP in the medium, causing the lower amount of MP after fermentation and then produce MP by-product that got detected in the HPLC analysis.

96 A-i

A-ii

A-iii

A-iv

B-i

B-ii

B-iii

B-iv

Figure 21. HPLC chromatogram of skim milk fermentation added with 0.5% of MP with selected strains and control (A) Skim milk medium added with 0.5% of MP before fermentation. (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria) (B) Skim milk medium added with 0.5% of MP after fermentation. (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria)

97 a

Figure 22. Comparison of HPLC chromatogram in skim milk fermentation added with 0.5% MP (a) Before Fermentation (b) After fermentation (c) Control (w/o) bacteria

The skim milk results confirmed the finding in TLC: there is also a yet unidentified peak in the HPLC chromatogram. Moreover, HPLC has higher resolution than TLC. Therefore, we can see more information in the chromatograms. The compound was observed in the medium with even the lowest amount of MP. TLC methods can be used to identify the unknown compound in fermented medium without any MP and fermented medium with at least 0.6 % of MP (Conway et al., 2014). However, HPLC-MS analysis is still needed to have a higher accuracy on resolution and characterization of the chemical nature of this compound.

98 b. Buttermilk Medium fermentation with selected LAB

i. Buttermilk medium (BM)

The HPLC chromatogram of butter fermentation is shown in Figure 23. The chromatogram of BM showed to be more complex and had higher concentration of MP than skim milk medium.

The retention time (min) and calculated amount (µg/mL) of each peak are shown in Table. 19 and

Table. 20. Before fermentation, all of the BM samples showed to have 5 peaks representing PI

(retention time: 16.18-16.53 min), PS (24.99-25.25 min), PE (27.00-27.21 min), PC (36.30-36.44 min) and SM (39.07-40.23). Medium with LAB strains tend to have slightly higher concentration in PE, but not in other phospholipids. The unidentified appeared in BM medium with L. helveticus

57B before fermentation. Calculated area (pA) of the unknown peak in skim milk and buttermilk fermentation is shown in Table 18. The peak showed around retention time 22.37 min, but only had 0.16 of the area.

After a day of fermentation, the concentration of phospholipid dropped slightly in the BM medium with LAB strains and the concentration also decreased in control sample. This is not as same as the result in skim milk medium. The unidentified peak also appeared after fermentation in BM medium with LAB strains at retention time 21.99-22.29. The comparison of before and after fermentation and control is shown in Figure 24. The area was recorded and shown in Table

18. L. casei 2, L. helveticus 57B, L. acidophilus 70A and control having area: 16.52, 25.59, 18.37 and 0. The peak only got detected after fermentation, it only appeared with really low amount before fermentation and did not showed in the control sample. This finding match with the result from the skim milk medium fermentation.

99 A-i

A-ii

A-iii

A-iv

B-i

B-ii

B-iii

B-iv

Figure 23. HPLC chromatogram of buttermilk fermentation with selected strains and control (A) Buttermilk medium before fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria) (B) Buttermilk medium after fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria) 100

Figure 24. Comparison of HPLC chromatogram in buttermilk fermentation (a) Before Fermentation (b) After fermentation (c) Control (w/o) bacteria

101

Table 19. Retention time (min) of each peak in buttermilk fermentation

Peak Name BMD1-2 BMD1-57 BMD1-70 BMD1-C BMD2-2 BMD2-57 BMD2-70 BMD2-C PI 16.18 16.36 16.43 16.53 16.52 16.48 16.50 16.47 Unknown Peak 22.37 21.99 22.29 22.08 PS 24.99 25.07 25.02 25.25 25.11 25.02 25.05 25.04 PE 27.00 27.07 27.07 27.21 27.13 27.10 27.10 27.13 PC 36.37 36.30 36.31 36.44 36.36 36.36 36.35 36.41 SM 39.07 39.04 38.98 40.23 39.15 39.05 39.10 39.10 Peak Name BMPD1-2 BMPD1-57 BMPD1-70 BMPD1-C BMPD2-2 BMPD2-57 BMPD2-70 BMPD2-C PI 17.50 17.54 16.78 16.33 16.35 19.16 16.38 16.31 Unknown Peak 21.68 24.65 21.84 PS 26.23 26.67 25.78 25.65 24.84 27.58 24.85 25.00 PE 28.21 28.22 27.43 27.02 27.04 29.83 27.02 26.98 PC 37.48 37.53 38.25 38.48 36.28 39.14 36.28 36.23 SM 40.30 41.70 41.21 41.84 39.00 41.84 38.99 38.86 BM=buttermilk medium, BMP= buttermilk medium with 0.5% of milk phospholipid D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria), PI= Phosphatidylinositol, PS= phosphatidylserine, PE= phosphatidylethanolamine, PC= phosphatidylcholine, SM= sphingomyelin

102 Table 20. Calculated amount (ug /mL) of each peak in buttermilk fermentation

Peak Name BMD1-2 BMD1-57 BMD1-70 BMD1-C BMD2-2 BMD2-57 BMD2-70 BMD2-C PI 199.39 201.67 201.56 147.25 137.68 141.09 136.07 123.42 PS 193.02 99.50 98.48 137.00 123.50 73.47 72.20 73.50 PE 348.72 215.06 222.55 198.74 233.53 226.14 250.81 167.30 PC 297.72 278.42 232.64 225.83 236.34 230.52 233.91 163.74 SM 204.28 157.08 237.78 217.36 150.50 219.26 262.94 96.82 Peak Name BMPD1-2 BMPD1-57 BMPD1-70 BMPD1-C BMPD2-2 BMPD2-57 BMPD2-70 BMPD2-C PI 245.74 442.95 322.72 327.46 181.22 145.55 156.95 202.60 PS 195.90 257.24 229.57 232.77 121.53 96.06 102.16 121.47 PE 592.31 766.54 641.92 733.59 456.17 336.85 445.45 472.19 PC 963.21 763.99 1051.01 1095.40 662.53 421.27 564.04 450.38 SM 1026.95 282.54 29.51 767.50 490.87 316.95 669.29 413.87 BM=buttermilk medium, BMP= buttermilk medium with 0.5% of milk phospholipid D1= Unfermented Medium at Day 1 with selected LAB strains, D2=Fermented Medium at Day 2, C=control (without bacteria), PI= Phosphatidylinositol, PS= phosphatidylserine, PE= phosphatidylethanolamine, PC= phosphatidylcholine, SM= sphingomyelin 0 ug/mL 0-200 ug/mL 200-400 ug/mL Above 400 ug/mL

103

ii. Buttermilk medium with 0.5% of MP (BMMP)

The HPLC chromatogram of butter fermentation is shown in Figure 25. The chromatogram of BMP looks alike with the result from BM medium but with higher concentration of the phospholipids. The retention time (min) and calculated amount (µg /mL) of each peak are shown in Table.19 and Table.20. Before fermentation, all the BMP samples had 5 peaks representing PI

(retention time: 16.33-17.54 min), PS (25.78-26.67 min), PE (27.02-28.22 min), PC (37.48-38.48 min) and SM (40.30-41.84 min). The SM level in BMP various between medium with different strains and samples. BMP with L. acidophilus 70A showed to be significantly lower than other samples (29.51µg/mL), while L. casei 2 had the highest concentration of SM (1026.95µg/mL).

Other than the SM level, the rest of the concentration of phospholipids were similar between samples.

After a day of fermentation, the concentration of phospholipid dropped slightly in the BMP medium with LAB strains and the concentration also decreased in control sample. This finding is same as the BM medium but not same as the result in skim milk medium. The unidentified peak also appeared after fermentation in BMP medium with LAB strains at retention time 21.68-4.65.

The comparison of before and after fermentation and control is shown in Figure 26. The area was recorded and shown in Table 18 L. casei 2, L. helveticus 57B, L. acidophilus 70A and control having area: 10.48, 18.89, 22.73 and 0. The peak only got detected after fermentation, it only appeared with really low amount before fermentation and did not showed in the control sample.

This finding match with the result from the skim milk and BM medium fermentation.

104 A-i

A-ii

A-iii

A-iv

B-i

B-ii

B-iii

B-iv

Figure 25. HPLC chromatogram of buttermilk fermentation added with 0.5% MP with selected strains and control (A) Buttermilk medium added with 0.5% MP before fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria) (B) Buttermilk medium added with 0.5% MP after fermentation (i) L. casei 2 (ii) L. helveticus 57B (iii) L. acidophilus 70A (iv) control (w/o bacteria)

105 a

Figure 26. Comparison of HPLC chromatogram in buttermilk fermentation added with 0.5% MP (a) Before Fermentation (b) After fermentation (c) Control (w/o) bacteria

The HPLC result in different medium showed similar result: 1) PE peak before fermentation, suggesting the PE is from bacteria membrane. 2) PE peak after storage/ incubation, this is possibly due to the MFGM disintegration at body temperature 3) The unidentified peak appeared after fermentation at retention time 21-22 and 4) the inconsistent phospholipid content after fermentation, which is possibly due to the bacteria utilization. Due to the previous TLC result, the unidentified peak was suggested to be lysophospholipids. However, there are many kinds of lysophospholipid like LPC, LPS, LPE, LPI. It is possible that the peak was comprised of several peak that has similar elution time. In order to identify the exact compound, there are several ways to achieve: 1) Apply lysophospholipid standards in the original method and tried to identify the exacted compounds 2) further separate the peak with different column or different solvent 3) isolate the peak and send to lipid profiling by NMR 4) apply successful method used in other study. 106 Other studies have demonstrated using HPLC to separate phospholipid and lysophospholipids. One of the studies mentioned C18 column (3.5m, 0.5 mm i.d.×150 mm length;

25◦C) with a gradient of acetonitrile in 0.1% aqueous formic acid can successfully separate lysophospholipids. The total ion chromatogram (TIC) and extracted ion chromatograms(EIC) showed that LPC was first eluted around retention time 20min (Barroso & Bischoff, 2005).

Another study used silica 5-mm column with a mobile phase A of hexane: 2-propanol: 25 mM potassium acetate (pH 7.0):ethanol: glacial acetic acid (367:490:62:100:0.6, v/v/v/v/v/) (by volume), solvent B with hexane:2-propanol:25 mM potassium acetate (pH 7.0):acetonitrile: glacial acetic acid(442:490:62:25:0.6, v/v/v/v/v) at 30°C successfully separated PE, PI, PC, SM,

LPI and LPE (Lesnefsky, Stoll, Minkler, & Hoppel, 2000). Separating different acyl-group of lysophospholipids by using a reverse-phase column (250 mm × 1.5 mm inner diameter, 3 μm particle size; Shiseido)] with a gradient elution of solvent A (5 mM ammonium formate in water, pH 4.0) and solvent B (5 mM ammonium formate in 95% (v/v) acetonitrile, pH 4.0) at 150 μl/min

(Okudaira et al., 2014)

The importance of the results is as followed: 1) medium with low amount of MP can be utilized by LAB strains 2) Buttermilk has shown to be a very good substrate for these bacteria to follow a methabolic path that seems to generate in the bacteria enzymes that hydrolyze phospholipids more efficiently. This in turn, may have a positive effect in food digestion and absorption.

107 E. Lipolysis Enzyme Analysis

1. Native Protein Electrophoresis

a. Zymogram

The zymogram analysis of lipolysis enzyme in buttermilk medium is shown in Figure 27-

A. According to the molecular marker (lane 2), lane 3, 4 and 5 showed a faint band at 100kDa molecular weight. This indicated that there is a 100 kDa enzyme that is responsible for the lipolysis activity in buttermilk medium. The result of buttermilk medium with 0.5% of MP (BMMP) is shown in Figure 27-B. Lane 2, 3 and 4 showed to have the similar band at the same molecular weight (100kDa) and had more intense band than the BM medium. On the other hand, lane 5

(control) did not showed any band at the same place.

The finding suggested that both medium had the enzyme that is responsible for the lipolysis activity. The unidentified enzyme was produced by LAB strains but not from the original medium.

It is suggested that the genes in the LAB strains were turned on by the appearance of the MP. The different intensity of the band could be due to LAB strains in BMMP medium produce more of the enzyme than BM medium alone. Both medium (BM and BMMP medium) had the phospholipids, but in different concentration; BMMP had higher concentration of the MP, while

BM had less. Therefore, LAB strains produce more enzyme when they were fermented with higher concentration of MP.

108 1. 2. 3. 4. 5 B 1. 2. 3. 4. 5 A 250 150 100

MW kDa Figure 27. Zymogram analysis of lipolysis enzyme at 10 % native condition (A)Buttermilk medium (1) control (w/o) bacteria (2) molecular weight standards (3) L. casei 2 (4) L. helveticus 57B (5) L. acidophilus 70A (B) Buttermilk Medium with 0.5% of MP (1) molecular weight standards (2) L. casei 2 (3) L. helveticus 57B (4) L. acidophilus 70A (5) control (w/o) bacteria

The significance of the results is that it successfully imaged the appearance of the active enzyme. The different intensity of the bands also confirmed the difference in MP concentration having an influence on the enzyme production. This result combined TLC and HPLC results all suggests that MP fermentation with selected LAB strains are able to produce a lipid-derived compound as a result of enzyme action that is consistent with lipid digestion improvement. This also confirmed our hypothesis: LAB with lipolytic activity in buttermilk fermentation with added milk phospholipids (MP) can yield enzymes that can modify phospholipid and produce phospholipid hydrolysates that are indicators of better digestion.

109 2. Amino Acid/Peptide Sequencing

The first attempt of peptide sequencing result did not turn out great. More samples are needed to be sent for a more accurate result. Compare to other studies, (García-Cano et al., 2019) found an 86kDa protein and suspected it to be phosphoesterase. There are other studies demonstrated the 85 kDa soluble form of phospholipase A2 (Nemenoff et al., 1993) (Soydan,

Tavares, Weech, Tremblay, & Bennett, 1996) (Tischfield, 1997). Another study isolated a 97 kDa protein from guinea pig intestine. The enzyme was identified as phospholipase A2 with lysophospholipase activity (phospholipase B). The enzyme is able to hydrolyze glycerol- phosphocholine (GPC) and produce lysophosphatidylcholine (LPC). The further investigation also suggested that the 97kDa enzyme can break down glycerol-phosphoethanolamine (GPE)

(Gassama-Diagne, Fauvel, & Chap, 1989).

Combining the results of phospholipid hydrolysates and lipolysis enzyme action and identification, they all suggest that LAB strains were affected by the appearance of the MP and then produced lipolysis enzyme to utilize the MP, breaking phospholipid into what we can call a phospholipid hydrolysate. This is again confirming our hypothesis: LAB with lipolytic activity in buttermilk fermentation with added milk phospholipids (MP) can yield enzymes, not normally produced in media without MP, which can modify phospholipids and produce phospholipid hydrolysate. Selected LAB strains with lipolytic activity that helped with the phospholipid digestion and produce potential compounds that might have higher absorption rate in human gut.

110 V. Conclusion

In conclusion, the present work studied the interaction between lactic acid bacteria and milk phospholipids and their effect upon fermentation, phospholipids concentration and characterized the metabolic behavior of lactic acid bacteria. Overall, the results suggested that LAB strains are able to digest and break down the lipids and proteins more efficiently if they first are allowed to ferment substrates containing MP. Therefore, their inclusion in the diet can lead to higher digestion and absorption of lipid and protein and also other complex nutrients like phospholipids.

Additionally, since phospholipids are frequently present stabilizing emulsions, their digestion can break the emulsion and make the emulsified lipid more available for absorption in the gut.

The functional characteristic screening showed that LAB strains are able to resist digestive system. The preliminary safety screening also indicated selected LAB strains have better properties than some commercial strains. The screening methods are able to differentiate promising strains in a relatively fast and less laborious way. LAB strains showed ability to digest the complex phospholipids after fermentation with skim milk, buttermilk and additional milk phospholipids.

The ability of produce lipolytic enzymes of the LAB strains increase with the appearance and concentration of MP. The higher concentration of the MP, the higher production of the lipid- derived compounds (phospholipid hydrolysate) and the working enzyme. Lastly, the identification of the hydrolysate enzyme and the detection of a lipid-derived compound (phospholipid hydrolysate) after fermentation confirmed our hypothesis: LAB with lipolytic activity in buttermilk fermentation with added milk phospholipids (MP) can yield enzymes that can modify phospholipid and produce phospholipid hydrolysates that are indicators of better digestion.

111 References

Argyri, A. A., Zoumpopoulou, G., Karatzas, K.-A. G., Tsakalidou, E., Nychas, G.-J. E., Panagou, E. Z., & Tassou, C. C. (2013). Selection of potential probiotic lactic acid bacteria from fermented olives by in vitro tests. Food microbiology, 33(2), 282-291. Augustin, M., Bhail, S., Cheng, L., Shen, Z., Øiseth, S., & Sanguansri, L. (2015). Use of whole buttermilk for microencapsulation of omega-3 oils. Journal of functional foods, 19, 859- 867. Aveldano, M. I. (1988). Phospholipid species containing long and very long polyenoic fatty acids remain with rhodopsin after hexane extraction of photoreceptor membranes. Biochemistry, 27(4), 1229-1239. Bachmann, H., Starrenburg, M. J., Molenaar, D., Kleerebezem, M., & van Hylckama Vlieg, J. E. (2012). Microbial domestication signatures of Lactococcus lactis can be reproduced by experimental evolution. Genome research, 22(1), 115-124. Barroso, B., & Bischoff, R. (2005). LC–MS analysis of phospholipids and lysophospholipids in human bronchoalveolar lavage fluid. Journal of Chromatography B, 814(1), 21-28. Bendicho, S., Martı, G., Hernández, T., & Martın, O. (2002). Determination of proteolytic activity in different milk systems. Food Chemistry, 79(2), 245-249. Bollet, A. J., Bonner, W. M., & Nance, J. L. (1963). The presence of hyaluronidase in various mammalian tissues. J Biol Chem, 238(3522), 7. Braun, M., Flck, B., Cotting, C., Monard, F., & Giuffrida, F. (2010). Quantification of phospholipids in infant formula and growing up milk by high-performance liquid chromatography with evaporative light scattering detector. Journal of AOAC International, 93(3), 948-955. Brown, J. P., & Lamanna, C. (1977). Role of gut bacterial flora in nutrition and health: a review of recent advances in bacteriological techniques, metabolism, and factors affecting flora composition. Critical Reviews in Food Science & Nutrition, 8(3), 229-336. Byylund, G. (1995). Tetra Pak dairy processing handbook. Tetra-Pak Processing Systems, Lund, Sweden. Campagna, S., Mathot, A.-G., Fleury, Y., Girardet, J.-M., & Gaillard, J.-L. (2004). Antibacterial activity of lactophoricin, a synthetic 23-residues peptide derived from the sequence of bovine milk component-3 of proteose peptone. Journal of Dairy Science, 87(6), 1621-1626. Casamenti, F., Scali, C., & Pepeu, G. (1991). Phospatidylserine reverses the age-dependent decrease in cortical acetylcholine release: a microdialysis study. European journal of pharmacology, 194(1), 11-16. Cebeci, A., & Gürakan, C. (2003). Properties of potential probiotic Lactobacillus plantarum strains. Food microbiology, 20(5), 511-518. Charteris, W. P., Kelly, P. M., Morelli, L., & Collins, J. K. (1998). Antibiotic susceptibility of potentially probiotic Lactobacillus species. Journal of food protection, 61(12), 1636-1643. Christen, G. L., & Marshall, R. (1984). Selected properties of lipase and protease of Pseudomonas fluorescens 27 produced in four media. Journal of Dairy Science, 67(8), 1680-1687. Contarini, G., & Povolo, M. (2013). Phospholipids in milk fat: composition, biological and technological significance, and analytical strategies. International Journal of Molecular Sciences, 14(2), 2808-2831. Conway, V., Couture, P., Richard, C., Gauthier, S., Pouliot, Y., & Lamarche, B. (2013). Impact of buttermilk consumption on plasma lipids and surrogate markers of cholesterol homeostasis 112 in men and women. Nutrition, Metabolism and Cardiovascular Diseases, 23(12), 1255- 1262. Conway, V., Gauthier, S., & Pouliot, Y. (2014). Buttermilk: much more than a source of milk phospholipids. Animal Frontiers, 4(2), 44-51. Corredig, M., Roesch, R., & Dalgleish, D. (2003). Production of a novel ingredient from buttermilk. Journal of Dairy Science, 86(9), 2744-2750. Crow, V. L., Holland, R., Pritchard, G. G., & Coolbear, T. (1994). The diversity of potential cheese ripening characteristics of lactic acid starter bacteria: 2. The levels and subcellular distributions of peptidase and esterase activities. International Dairy Journal, 4(8), 723- 742. Daliri, E. B.-M., & Lee, B. H. (2015). New perspectives on probiotics in health and disease. Food Science and Human Wellness, 4(2), 56-65. Daniels, M. J., Wang, Y., Lee, M., & Venkitaraman, A. R. (2004). Abnormal cytokinesis in cells deficient in the breast cancer susceptibility protein BRCA2. Science, 306(5697), 876-879. Davis, B. D., & Mingioli, E. S. (1950). Mutants of Escherichia coli requiring methionine or vitamin B12. Journal of bacteriology, 60(1), 17. de Souza, B. M. S., Borgonovi, T. F., Casarotti, S. N., Todorov, S. D., & Penna, A. L. B. (2018). Lactobacillus casei and Lactobacillus fermentum Strains Isolated from Mozzarella Cheese: Probiotic Potential, Safety, Acidifying Kinetic Parameters and Viability under Gastrointestinal Tract Conditions. Probiotics and antimicrobial proteins, 1-15. de Wouters, T., Jans, C., Niederberger, T., Fischer, P., & Rühs, P. A. (2015). Adhesion potential of intestinal microbes predicted by physico-chemical characterization methods. PloS one, 10(8), e0136437. Dewan, S., & Tamang, J. P. (2007). Dominant lactic acid bacteria and their technological properties isolated from the Himalayan ethnic fermented milk products. Antonie van Leeuwenhoek, 92(3), 343-352. doi:10.1007/s10482-007-9163-5 Dewettinck, K., Rombaut, R., Thienpont, N., Le, T. T., Messens, K., & Van Camp, J. (2008). Nutritional and technological aspects of milk fat globule membrane material. International Dairy Journal, 18(5), 436-457. Dillehay, D. L., Webb, S. K., Schmelz, E.-M., & Merrill Jr, A. H. (1994). Dietary sphingomyelin inhibits 1, 2-dimethylhydrazine-induced colon cancer in CF1 mice. The Journal of nutrition, 124(5), 615-620. Duivenvoorden, I., Voshol, P. J., Rensen, P. C., van Duyvenvoorde, W., Romijn, J. A., Emeis, J. J., . . . Nieuwenhuizen, W. F. (2006). Dietary sphingolipids lower plasma cholesterol and triacylglycerol and prevent liver steatosis in APOE* 3 Leiden mice–. The American journal of clinical nutrition, 84(2), 312-321. E Smith, R., Rouchotas, P., & Fritz, H. (2016). Lecithin (Phosphatidylcholine): Healthy Dietary Supplement or Dangerous Toxin? The Natural Products Journal, 6(4), 242-249. Eaton, T. J., & Gasson, M. J. (2001). Molecular screening of Enterococcusvirulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol., 67(4), 1628-1635. El-Loly, M. (2011). Composition, properties and nutritional aspects of milk fat globule membrane- a review. Polish Journal of Food and Nutrition Sciences, 61(1), 7-32. Erickson, K. L., & Hubbard, N. E. (2000). Probiotic immunomodulation in health and disease. The Journal of nutrition, 130(2), 403S-409S.

113 Eyzaguirre, R. Z., & Corredig, M. (2011). Milk Lipids| Buttermilk and Milk Fat Globule Membrane Fractions. Faghfoori, Z., Gargari, B. P., Saber, A., Seyyedi, M., & Khosroushahi, A. Y. (2017). The investigation of the diversity of lactobacilli spp. and assessment their some probiotic properties in traditional dairy products in East Azerbaijan province in Iran. Iranian journal of pharmaceutical research: IJPR, 16(4), 1538. FAO/WHO. (2002). Guidelines for the Evaluation of Probiotics in Food. Fischbeck, A., Leucht, K., Frey-Wagner, I., Bentz, S., Pesch, T., Kellermeier, S., . . . Hausmann, M. (2011). Sphingomyelin induces cathepsin D-mediated apoptosis in intestinal epithelial cells and increases inflammation in DSS colitis. Gut, 60(1), 55-65. Fortina, M., Ricci, G., Borgo, F., Manachini, P., Arends, K., Schiwon, K., . . . Grohmann, E. (2008). A survey on biotechnological potential and safety of the novel Enterococcus species of dairy origin, E. italicus. International journal of food microbiology, 123(3), 204-211. Fuchs, B., Süß, R., Teuber, K., Eibisch, M., & Schiller, J. (2011). Lipid analysis by thin-layer chromatography—a review of the current state. Journal of Chromatography A, 1218(19), 2754-2774. Fuller, K., Kuhlenschmidt, T., Kuhlenschmidt, M. S., Jiménez-Flores, R., & Donovan, S. M. (2013). Milk fat globule membrane isolated from buttermilk or whey cream and their lipid components inhibit infectivity of rotavirus in vitro. Journal of Dairy Science, 96(6), 3488- 3497. Futerman, A. H., & Hannun, Y. A. (2004). The complex life of simple sphingolipids. EMBO reports, 5(8), 777-782. García-Cano, I., Rocha-Mendoza, D., Ortega-Anaya, J., Wang, K., Kosmerl, E., & Jiménez-Flores, R. (2019). Lactic acid bacteria isolated from dairy products as potential producers of lipolytic, proteolytic and antibacterial proteins. Applied microbiology and biotechnology. doi:10.1007/s00253-019-09844-6 Gassama-Diagne, A., Fauvel, J., & Chap, H. (1989). Purification of a new, calcium-independent, high molecular weight phospholipase A2/lysophospholipase (phospholipase B) from guinea pig intestinal brush-border membrane. Journal of Biological Chemistry, 264(16), 9470-9475. Gille, D. (2011). The health aspects of buttermilk components. A review. ALP Sci, 540, 1-22. Gilliland, S. E. (1990). Health and nutritional benefits from lactic acid bacteria. FEMS Microbiology reviews, 7(1-2), 175-188. Goh, Y. J., Goin, C., O’Flaherty, S., Altermann, E., & Hutkins, R. (2011). Specialized adaptation of a lactic acid bacterium to the milk environment: the comparative genomics of Streptococcus thermophilus LMD-9. Paper presented at the Microbial cell factories. Gorby, Y. A., Beveridge, T. J., & Blakemore, R. P. (1988). Characterization of the bacterial magnetosome membrane. Journal of bacteriology, 170(2), 834-841. Goullet, P. (1973). An esterase zymogram of Escherichia coli. Microbiology, 77(1), 27-35. Grenham, S., Clarke, G., Cryan, J. F., & Dinan, T. G. (2011). Brain–gut–microbe communication in health and disease. Frontiers in physiology, 2, 94. Guo, X.-H., Kim, J.-M., Nam, H.-M., Park, S.-Y., & Kim, J.-M. (2010). Screening lactic acid bacteria from swine origins for multistrain probiotics based on in vitro functional properties. Anaerobe, 16(4), 321-326.

114 Gurnida, D. A., Rowan, A. M., Idjradinata, P., Muchtadi, D., & Sekarwana, N. (2012). Association of complex lipids containing gangliosides with cognitive development of 6-month-old infants. Early Human Development, 88(8), 595-601. Hamilton-Miller, J., & Shah, S. (1998). Vancomycin susceptibility as an aid to the identification of lactobacilli. Letters in applied microbiology, 26(2), 153-154. Hara, A., & Radin, N. S. (1978). Lipid extraction of tissues with a low-toxicity solvent. Analytical biochemistry, 90(1), 420-426. Hartmann, P., Szabó, A., Erős, G., Gurabi, D., Horváth, G., Németh, I., . . . Boros, M. (2009). Anti-inflammatory effects of phosphatidylcholine in neutrophil leukocyte-dependent acute arthritis in rats. European journal of pharmacology, 622(1-3), 58-64. Hassinen, J., Durbin, G., Tomarelli, R., & Bernhart, F. (1951). The minimal nutritional requirements of Lactobacillus bifidus. Journal of bacteriology, 62(6), 771. Heiss, W.-D., Kessler, J., Mielke, R., Szelies, B., & Herholz, K. (1994). Long-term effects of phosphatidylserine, pyritinol, and cognitive training in Alzheimer's disease. Dementia and Geriatric Cognitive Disorders, 5(2), 88-98. Hernell, O., Timby, N., Domellöf, M., & Lönnerdal, B. (2016). Clinical benefits of milk fat globule membranes for infants and children. The Journal of pediatrics, 173, S60-S65. Hickey, C. D., O'Sullivan, M. G., Davis, J., Scholz, D., Kilcawley, K. N., Wilkinson, M. G., & Sheehan, J. J. (2018). The effect of buttermilk or buttermilk powder addition on functionality, textural, sensory and volatile characteristics of Cheddar-style cheese. Food Research International, 103, 468-477. Holzmüller, W., & Kulozik, U. (2016). Isolation of milk fat globule membrane (MFGM) material by coagulation and diafiltration of buttermilk. International Dairy Journal, 63, 88-91. Hong, Q., Liu, X., Hang, F., Zhao, J., Zhang, H., & Chen, W. (2018). Screening of adjunct cultures and their application in ester formation in Camembert-type cheese. Food microbiology, 70, 33-41. Hunter, R. L., & Burstone, M. S. (1960). The zymogram as a tool for the characterization of enzyme substrate specificity. Journal of Histochemistry & Cytochemistry, 8(1), 58-62. Jan, M., Thondre, P., El-Chab, A., & Lightowler, H. (2017). The effect of dietary phosphatidylcholine supplementation on lipid profile in mild hyperlipidaemic individuals. Proceedings of the Nutrition Society, 76(OCE4). Jeronymo-Ceneviva, A. B., de Paula, A. T., Silva, L. F., Todorov, S. D., Franco, B. D. G. M., & Penna, A. L. B. (2014). Probiotic properties of lactic acid bacteria isolated from water- buffalo mozzarella cheese. Probiotics and antimicrobial proteins, 6(3-4), 141-156. Johnson, E. A., Madia, A., & Demain, A. L. (1981). Chemically defined minimal medium for growth of the anaerobic cellulolytic thermophile Clostridium thermocellum. Applied and Environmental Microbiology, 41(4), 1060. Jukkola, A., & Rojas, O. J. (2017). Milk fat globules and associated membranes: Colloidal properties and processing effects. Advances in colloid and interface science, 245, 92-101. Kamili, A., Wat, E., Chung, R. W., Tandy, S., Weir, J. M., Meikle, P. J., & Cohn, J. S. (2010). Hepatic accumulation of intestinal cholesterol is decreased and fecal cholesterol excretion is increased in mice fed a high-fat diet supplemented with milk phospholipids. Nutrition & metabolism, 7(1), 90. Kato-Kataoka, A., Sakai, M., Ebina, R., Nonaka, C., Asano, T., & Miyamori, T. (2010). Soybean- derived phosphatidylserine improves memory function of the elderly Japanese subjects

115 with memory complaints. Journal of clinical biochemistry and nutrition, 1009240057- 1009240057. Katz, M., Medina, R., Gonzalez, S., & Oliver, G. (2002). Esterolytic and lipolytic activities of lactic acid bacteria isolated from ewe's milk and cheese. Journal of food protection, 65(12), 1997-2001. Kelleher, P., Bottacini, F., Mahony, J., Kilcawley, K. N., & van Sinderen, D. (2017). Comparative and functional genomics of the Lactococcus lactis taxon; insights into evolution and niche adaptation. BMC genomics, 18(1), 267. Kennerly, D. A. (1986). Improved analysis of species of phospholipids using argentation thin-layer chromatography. Journal of Chromatography A, 363(2), 462-467. Kerry, R. G., Patra, J. K., Gouda, S., Park, Y., Shin, H.-S., & Das, G. (2018). Benefaction of probiotics for human health: A review. Journal of food and drug analysis, 26(3), 927-939. Kidd, P. (2002). Phospholipids: versatile nutraceuticals for functional foods. Functional foods and nutraceuticals, 1-5. Kim, J.-W., & Rajagopal, S. (2001). Antibacterial activities of Lactobacillus crispatus ATCC 33820 and Lactobacillus gasseri ATCC 33323. JOURNAL OF MICROBIOLOGY-SEOUL-, 39(2), 146-148. Klaenhammer, T. R., & Kullen, M. J. (1999). Selection and design of probiotics. International journal of food microbiology, 50(1-2), 45-57. Kobayashi, T., Shimizugawa, T., Osakabe, T., Watanabe, S., & Okuyama, H. (1997). A long-term feeding of sphingolipids affected the levels of plasma cholesterol and hepatic triacylglycerol but not tissue phospholipids and sphingolipids. Nutrition Research, 17(1), 111-114. Kosmerl, E. (2019). Milk Phospholipid Analysis on HPLC-CAD. Krygier, K., Sosulski, F., & Hogge, L. (1982). Free, esterified, and insoluble-bound phenolic acids. 1. Extraction and purification procedure. Journal of Agricultural and Food Chemistry, 30(2), 330-334. Küllenberg, D., Taylor, L. A., Schneider, M., & Massing, U. (2012). Health effects of dietary phospholipids. Lipids in health and disease, 11(1), 3. Kvistgaard, A., Pallesen, L., Arias, C., Lopez, S., Petersen, T., Heegaard, C., & Rasmussen, J. (2004). Inhibitory effects of human and bovine milk constituents on rotavirus infections. Journal of Dairy Science, 87(12), 4088-4096. Lambert, S., Leconte, N., Blot, M., Rousseau, F., Robert, B., Camier, B., . . . Gésan-Guiziou, G. (2016). The lipid content and microstructure of industrial whole buttermilk and butter serum affect the efficiency of skimming. Food Research International, 83, 121-130. Lee, Y. K. (2014). What could probiotic do for us? Food Science and Human Wellness, 3(2), 47- 50. Lemonnier, L. A., Dillehay, D. L., Vespremi, M. J., Abrams, J., Brody, E., & Schmelz, E. M. (2003). Sphingomyelin in the suppression of colon tumors: prevention versus intervention. Archives of biochemistry and biophysics, 419(2), 129-138. Lesnefsky, E. J., Stoll, M. S., Minkler, P. E., & Hoppel, C. L. (2000). Separation and quantitation of phospholipids and lysophospholipids by high-performance liquid chromatography. Analytical biochemistry, 285(2), 246-254. Li, Y., Wang, D. D., Chiuve, S. E., Manson, J. E., Willett, W. C., Hu, F. B., & Qi, L. (2015). Dietary phosphatidylcholine intake and type 2 diabetes in men and women. Diabetes care, 38(2), e13-e14.

116 Liu, S.-Q., Baker, K., Bennett, M., Holland, R., Norris, G., & Crow, V. (2004). Characterisation of esterases of Streptococcus thermophilus ST1 and Lactococcus lactis subsp. cremoris B1079 as alcohol acyltransferases. International Dairy Journal, 14(10), 865-870. Liu, S.-Q., Holland, R., & Crow, V. L. (2001). Purification and properties of intracellular esterases from Streptococcus thermophilus. International Dairy Journal, 11(1-2), 27-35. Lönnerdal, B. (2014). Infant formula and infant nutrition: bioactive proteins of human milk and implications for composition of infant formulas. The American journal of clinical nutrition, 99(3), 712S-717S. Lonvaud-Funel, A. (1999). Lactic acid bacteria in the quality improvement and depreciation of wine Lactic acid bacteria: Genetics, metabolism and applications (pp. 317-331): Springer. Lopez, C. (2011). Milk fat globules enveloped by their biological membrane: unique colloidal assemblies with a specific composition and structure. Current Opinion in Colloid & Interface Science, 16(5), 391-404. Lopez, C., Madec, M.-N., & Jimenez-Flores, R. (2010). Lipid rafts in the bovine milk fat globule membrane revealed by the lateral segregation of phospholipids and heterogeneous distribution of glycoproteins. Food Chemistry, 120(1), 22-33. Lopez, C., & Ménard, O. (2011). Human milk fat globules: polar lipid composition and in situ structural investigations revealing the heterogeneous distribution of proteins and the lateral segregation of sphingomyelin in the biological membrane. Colloids and Surfaces B: Biointerfaces, 83(1), 29-41. Madenci, A. B., & Bilgiçli, N. (2014). Effect of whey protein concentrate and buttermilk powders on rheological properties of dough and bread quality. Journal of food Quality, 37(2), 117- 124. Mana, P., Goodyear, M., Bernard, C., Tomioka, R., Freire‐Garabal, M., & Linares, D. (2004). Tolerance induction by molecular mimicry: prevention and suppression of experimental autoimmune encephalomyelitis with the milk protein butyrophilin. International immunology, 16(3), 489-499. Mantle, M., Basaraba, L., Peacock, S., & Gall, D. (1989). Binding of Yersinia enterocolitica to rabbit intestinal brush border membranes, mucus, and mucin. Infection and immunity, 57(11), 3292-3299. Martin, H. M., Hancock, J. T., Salisbury, V., & Harrison, R. (2004). Role of xanthine oxidoreductase as an antimicrobial agent. Infection and immunity, 72(9), 4933-4939. Martín-Platero, A. M., Valdivia, E., Maqueda, M., & Martínez-Bueno, M. (2009). Characterization and safety evaluation of enterococci isolated from Spanish goats' milk cheeses. International journal of food microbiology, 132(1), 24-32. Matthews, A., Grbin, P. R., & Jiranek, V. (2007). Biochemical characterisation of the esterase activities of wine lactic acid bacteria. Applied microbiology and biotechnology, 77(2), 329- 337. Mazzei, J. C., Zhou, H., Brayfield, B. P., Hontecillas, R., Bassaganya-Riera, J., & Schmelz, E. M. (2011). Suppression of intestinal inflammation and inflammation-driven colon cancer in mice by dietary sphingomyelin: importance of peroxisome proliferator-activated receptor γ expression. The Journal of nutritional biochemistry, 22(12), 1160-1171. McDaniel, M. A., Maier, S. F., & Einstein, G. O. (2003). “Brain-specific” nutrients: a memory cure? Nutrition, 19(11-12), 957-975.

117 McFarland, J. (1907). The nephelometer: an instrument for estimating the number of bacteria in suspensions used for calculating the opsonic index and for vaccines. Journal of the American Medical Association, 49(14), 1176-1178. McManaman, J. L., & Neville, M. C. (2003). Mammary physiology and milk secretion. Advanced drug delivery reviews, 55(5), 629-641. McSweeney, P. L., & Sousa, M. J. (2000). Biochemical pathways for the production of flavour compounds in cheeses during ripening: A review. Le Lait, 80(3), 293-324. Meck, W. H., & Williams, C. L. (2003). Metabolic imprinting of choline by its availability during gestation: implications for memory and attentional processing across the lifespan. Neuroscience & Biobehavioral Reviews, 27(4), 385-399. Monteagudo-Mera, A., Rodríguez-Aparicio, L., Rúa, J., Martínez-Blanco, H., Navasa, N., García- Armesto, M. R., & Ferrero, M. Á. (2012). In vitro evaluation of physiological probiotic properties of different lactic acid bacteria strains of dairy and human origin. Journal of functional foods, 4(2), 531-541. Moré, M., & Rutenberg, D. (2017). Soy Lecithin-Derived Phosphatidylserine Plus Phosphatidic Acid: Effects on Brain Functions in Elderly Patients with Alzheimer’s Disease and Dementia. Aging Sci, 5(179), 2. Morifuji, M., Kitade, M., Oba, C., Fukasawa, T., Kawahata, K., Yamaji, T., . . . Sugawara, T. (2017). Milk fermented by lactic acid bacteria enhances the absorption of dietary sphingomyelin in rats. Lipids, 52(5), 423-431. Morin, P., Britten, M., Jiménez-Flores, R., & Pouliot, Y. (2007). Microfiltration of buttermilk and washed cream buttermilk for concentration of milk fat globule membrane components. Journal of Dairy Science, 90(5), 2132-2140. Morin, P., Pouliot, Y., & Jiménez-Flores, R. (2006). A comparative study of the fractionation of regular buttermilk and whey buttermilk by microfiltration. Journal of Food Engineering, 77(3), 521-528. Motouri, M., Matsuyama, H., Yamamura, J.-i., Tanaka, M., Aoe, S., Iwanaga, T., & Kawakami, H. (2003). Milk sphingomyelin accelerates enzymatic and morphological maturation of the intestine in artificially reared rats. Journal of pediatric gastroenterology and nutrition, 36(2), 241-247. Mustranta, A., Forssell, P., & Poutanen, K. (1995). Comparison of lipases and phospholipases in the hydrolysis of phospholipids. Process Biochemistry, 30(5), 393-401. Naidu, A., Bidlack, W., & Clemens, R. (1999). Probiotic spectra of lactic acid bacteria (LAB). Critical reviews in food science and nutrition, 39(1), 13-126. Narendranath, N., Thomas, K., & Ingledew, W. (2001). Effects of acetic acid and lactic acid on the growth of Saccharomyces cerevisiae in a minimal medium. Journal of Industrial Microbiology and Biotechnology, 26(3), 171-177. Navidghasemizad, S., Hesari, J., Saris, P., & Nahaei, M. R. (2009). Isolation of lactic acid bacteria from Lighvan cheese, a semihard cheese made from raw sheep milk in Iran. International Journal of Dairy Technology, 62(2), 260-264. Nemenoff, R., Winitz, S., Qian, N., Van Putten, V., Johnson, G., & Heasley, L. (1993). Phosphorylation and activation of a high molecular weight form of phospholipase A2 by p42 microtubule-associated protein 2 kinase and protein kinase C. Journal of Biological Chemistry, 268(3), 1960-1964. Niederau, C., Strohmeyer, G., Heintges, T., Peter, K., & Göpfert, E. (1998). Polyunsaturated phosphatidyl-choline and interferon alpha for treatment of chronic hepatitis B and C: a

118 multi-center, randomized, double-blind, placebo-controlled trial. Leich Study Group. Hepato-gastroenterology, 45(21), 797-804. Nilsson, Å., & Duan, R.-D. (2006). Absorption and lipoprotein transport of sphingomyelin. Journal of lipid research, 47(1), 154-171. Noh, S. K., & Koo, S. I. (2004). Milk sphingomyelin is more effective than egg sphingomyelin in inhibiting intestinal absorption of cholesterol and fat in rats. The Journal of nutrition, 134(10), 2611-2616. Nunzi, M. G., Milan, F., Guidolin, D., & Toffano, G. (1987). Dendritic spine loss in hippocampus of aged rats. Effect of brain phosphatidylserine administration. Neurobiology of aging, 8(6), 501-510. Nyberg, L., Duan, R.-D., & Nilsson, Å. (2000). A mutual inhibitory effect on absorption of sphingomyelin and cholesterol. The Journal of nutritional biochemistry, 11(5), 244-249. Oelschlaeger, T. A. (2010). Mechanisms of probiotic actions–a review. International Journal of Medical Microbiology, 300(1), 57-62. Okudaira, M., Inoue, A., Shuto, A., Nakanaga, K., Kano, K., Makide, K., . . . Aoki, J. (2014). Separation and quantification of 2-acyl-1-lysophospholipids and 1-acyl-2- lysophospholipids in biological samples by LC-MS/MS. Journal of lipid research, 55(10), 2178-2192. Oshida, K., Shimizu, T., Takase, M., Tamura, Y., Shimizu, T., & Yamashiro, Y. (2003). Effects of dietary sphingomyelin on central nervous system myelination in developing rats. Pediatric research, 53(4), 589. Papadimitriou, K., Pot, B., & Tsakalidou, E. (2015). How microbes adapt to a diversity of food niches. Current Opinion in Food Science, 2, 29-35. Parada, J. L., de Caire, G. Z., de Mule, M. C. Z., & de Cano, M. M. S. (1998). Lactic acid bacteria growth promoters from Spirulina platensis. International journal of food microbiology, 45(3), 225-228. Patel, P. J., Singh, S. K., Panaich, S., & Cardozo, L. (2014). The aging gut and the role of prebiotics, probiotics, and synbiotics: A review. Journal of Clinical Gerontology and Geriatrics, 5(1), 3-6. Patton, S., & Keenan, T. (1975). The milk fat globule membrane. Biochimica et Biophysica Acta (BBA)-Reviews on Biomembranes, 415(3), 273-309. Patton, S., Long, C., & Sooka, T. (1980). Effect of storing milk on cholesterol and phospholipid of skim milk. Journal of Dairy Science, 63(5), 697-700. Peña-Montes, C., Mondragón-Tintor, M. E., Castro-Rodríguez, J. A., Bustos-Jaimes, I., Navarro- Ocaña, A., & Farrés, A. (2013). Immobilization and biochemical properties of the enantioselective recombinant NStcI esterase of Aspergillus nidulans. Enzyme research, 2013. Pérez-Martín, F., Seseña, S., Izquierdo, P. M., & Palop, M. L. (2013). Esterase activity of lactic acid bacteria isolated from malolactic fermentation of red wines. International journal of food microbiology, 163(2-3), 153-158. Pinto, M. G. V., Franz, C. M., Schillinger, U., & Holzapfel, W. H. (2006). Lactobacillus spp. with in vitro probiotic properties from human faeces and traditional fermented products. International journal of food microbiology, 109(3), 205-214. Richter, Y., Herzog, Y., Lifshitz, Y., Hayun, R., & Zchut, S. (2013). The effect of soybean-derived phosphatidylserine on cognitive performance in elderly with subjective memory complaints: a pilot study. Clinical interventions in aging, 8, 557.

119 Rolfe, R. D. (2000). The role of probiotic cultures in the control of gastrointestinal health. The Journal of nutrition, 130(2), 396S-402S. Rouser, G., Fleischer, S., & Yamamoto, A. (1970). Two dimensional thin layer chromatographic separation of polar lipids and determination of phospholipids by phosphorus analysis of spots. Lipids, 5(5), 494-496. Rueda, R. (2007). The role of dietary gangliosides on immunity and the prevention of infection. British Journal of Nutrition, 98(S1), S68-S73. Rütters, H., Sass, H., Cypionka, H., & Rullkötter, J. (2002). Phospholipid analysis as a tool to study complex microbial communities in marine sediments. Journal of microbiological methods, 48(2-3), 149-160. Saffon, M., Jiménez-Flores, R., Britten, M., & Pouliot, Y. (2015). Effect of heating whey proteins in the presence of milk fat globule membrane extract or phospholipids from buttermilk. International Dairy Journal, 48, 60-65. Schagger, H., Cramer, W., & Vonjagow, G. (1994). Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Analytical biochemistry, 217(2), 220-230. Schall, J. I., Mascarenhas, M. R., Maqbool, A., Dougherty, K. A., Elci, O., Wang, D.-J., . . . Moore, J. (2016). Choline supplementation with a structured lipid in children with cystic fibrosis: a randomized placebo-controlled trial. Journal of pediatric gastroenterology and nutrition, 62(4), 618. Schmelz, E. M., Dillehay, D. L., Webb, S. K., Reiter, A., Adams, J., & Merrill, A. H. (1996). Sphingomyelin consumption suppresses aberrant colonic crypt foci and increases the proportion of adenomas versus adenocarcinomas in CF1 mice treated with 1, 2- dimethylhydrazine: implications for dietary sphingolipids and colon carcinogenesis. Cancer research, 56(21), 4936-4941. Shahani, K. M., & Chandan, R. C. (1979). Nutritional and healthful aspects of cultured and culture- containing dairy foods. Journal of Dairy Science, 62(10), 1685-1694. Shaw, G. M., Carmichael, S. L., Yang, W., Selvin, S., & Schaffer, D. M. (2004). Periconceptional dietary intake of choline and betaine and neural tube defects in offspring. American journal of epidemiology, 160(2), 102-109. Singh, H. (2006). The milk fat globule membrane—A biophysical system for food applications. Current Opinion in Colloid & Interface Science, 11(2-3), 154-163. Singh, H., & Gallier, S. (2017). Nature's complex emulsion: The fat globules of milk. Food Hydrocolloids, 68, 81-89. Sirichokchatchawan, W., Pupa, P., Praechansri, P., Am-in, N., Tanasupawat, S., Sonthayanon, P., & Prapasarakul, N. (2018). Autochthonous lactic acid bacteria isolated from pig faeces in Thailand show probiotic properties and antibacterial activity against enteric pathogenic bacteria. Microbial pathogenesis, 119, 208-215. Soydan, A., Tavares, I., Weech, P., Tremblay, N., & Bennett, A. (1996). High molecular weight phospholipase A2 and fatty acids in human colon tumours and associated normal tissue. European Journal of Cancer, 32(10), 1781-1787. Spitsberg, V. (2005). Invited review: Bovine milk fat globule membrane as a potential nutraceutical. Journal of Dairy Science, 88(7), 2289-2294.

120 Spitsberg, V. L., Matitashvili, E., & Gorewit, R. C. (1995). Association and coexpression of fatty‐ acid‐binding protein and glycoprotein CD36 in the bovine mammary gland. European journal of biochemistry, 230(3), 872-878. Sprong, R., Hulstein, M., & Van der Meer, R. (2002). Bovine milk fat components inhibit food- borne pathogens. International Dairy Journal, 12(2-3), 209-215. Stamatova, I., & Meurman, J. H. (2009). Probiotics: health benefits in the mouth. American Journal of Dentistry, 22(6), 329. Steele, J., Broadbent, J., & Kok, J. (2013). Perspectives on the contribution of lactic acid bacteria to cheese flavor development. Current opinion in biotechnology, 24(2), 135-141. Stratton, J. E., Hutkins, R. W., & Taylor, S. L. (1991). Biogenic amines in cheese and other fermented foods: a review. Journal of food protection, 54(6), 460-470. Šušković, J., Kos, B., Beganović, J., Leboš Pavunc, A., Habjanič, K., & Matošić, S. (2010). Antimicrobial activity–the most important property of probiotic and starter lactic acid bacteria. Food Technology and Biotechnology, 48(3), 296-307. Sutton, S. (2011). Measurement of microbial cells by optical density. Journal of Validation technology, 17(1), 46-49. Tan, C.-H., Ghazali, H. M., Kuntom, A., Tan, C.-P., & Ariffin, A. A. (2009). Extraction and physicochemical properties of low free fatty acid crude palm oil. Food Chemistry, 113(2), 645-650. Tanaka, K., Hosozawa, M., Kudo, N., Yoshikawa, N., Hisata, K., Shoji, H., . . . Shimizu, T. (2013). The pilot study: sphingomyelin-fortified milk has a positive association with the neurobehavioural development of very low birth weight infants during infancy, randomized control trial. Brain and Development, 35(1), 45-52. Timby, N., Hernell, O., Vaarala, O., Melin, M., Lönnerdal, B., & Domellöf, M. (2015). Infections in infants fed formula supplemented with bovine milk fat globule membranes. Journal of pediatric gastroenterology and nutrition, 60(3), 384-389. Tischfield, J. A. (1997). A reassessment of the low molecular weight phospholipase A2 gene family in mammals. Journal of Biological Chemistry, 272(28), 17247-17250. Todorov, S. D. (2008). Bacteriocin production by Lactobacillus plantarum AMA-K isolated from Amasi, a Zimbabwean fermented milk product and study of the adsorption of bacteriocin AMA-K to Listeria sp. Brazilian Journal of microbiology, 39(1), 178-187. Todorov, S. D., Furtado, D. N., Saad, S. M. I., Tome, E., & Franco, B. D. G. d. M. (2011). Potential beneficial properties of bacteriocin‐producing lactic acid bacteria isolated from smoked salmon. Journal of Applied Microbiology, 110(4), 971-986. Trunk, T., Salah Khalil, H., & Leo, J. C. (2018). Bacterial autoaggregation. Aims Microbiology, 4(1), 140-164. van Meer, G., & Lisman, Q. (2002). Sphingolipid transport: rafts and translocators. Journal of Biological Chemistry, 277(29), 25855-25858. Vandenplas, Y., Huys, G., & Daube, G. (2015). Probiotics: an update. Jornal de Pediatria (Versão em Português), 91(1), 6-21. Vanderghem, C., Bodson, P., Danthine, S., Paquot, M., Deroanne, C., & Blecker, C. (2010). Milk fat globule membrane and buttermilks: from composition to valorization. Base. Veereman-Wauters, G., Staelens, S., Rombaut, R., Dewettinck, K., Deboutte, D., Brummer, R.- J., . . . Le Ruyet, P. (2012). Milk fat globule membrane (INPULSE) enriched formula milk decreases febrile episodes and may improve behavioral regulation in young children. Nutrition, 28(7-8), 749-752.

121 Vesper, H., Schmelz, E.-M., Nikolova-Karakashian, M. N., Dillehay, D. L., Lynch, D. V., & Merrill Jr, A. H. (1999). Sphingolipids in food and the emerging importance of sphingolipids to nutrition. The Journal of nutrition, 129(7), 1239-1250. Vissac, C., Lémery, D., Le Corre, L., Fustier, P., Déchelotte, P., Maurizis, J.-C., . . . Bernard- Gallon, D. J. (2002). Presence of BRCA1 and BRCA2 proteins in human milk fat globules after delivery. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 1586(1), 50-56. Wang, C.-Y., Lin, P.-R., Ng, C.-C., & Shyu, Y.-T. (2010). Probiotic properties of Lactobacillus strains isolated from the feces of breast-fed infants and Taiwanese pickled cabbage. Anaerobe, 16(6), 578-585. Wang, W.-Q., & Gustafson, A. (1992). One-dimensional thin-layer chromatographic separation of phospholipids and lysophospholipids from tissue lipid extracts. Journal of Chromatography B: Biomedical Sciences and Applications, 581(1), 139-142. Wang, X., Hirmo, S., Willen, R., & Wadström, T. (2001). Inhibition of Helicobacter pylori infection by bovine milk glycoconjugates in a BALB/cA mouse model. Journal of medical microbiology, 50(5), 430-435. Wat, E., Tandy, S., Kapera, E., Kamili, A., Chung, R. W., Brown, A., . . . Cohn, J. S. (2009). Dietary phospholipid-rich dairy milk extract reduces hepatomegaly, hepatic steatosis and hyperlipidemia in mice fed a high-fat diet. Atherosclerosis, 205(1), 144-150. Weisburg, W. G., Barns, S. M., Pelletier, D. A., & Lane, D. J. (1991). 16S ribosomal DNA amplification for phylogenetic study. Journal of bacteriology, 173(2), 697-703. Whitlock, J. E., Jones, D. T., & Harwood, V. J. (2002). Identification of the sources of fecal coliforms in an urban watershed using antibiotic resistance analysis. Water Research, 36(17), 4273-4282. Wong, P., & Kitts, D. (2003). A comparison of the buttermilk solids functional properties to nonfat dried milk, soy protein isolate, dried egg white, and egg yolk powders. Journal of Dairy Science, 86(3), 746-754. Wu, B. T., Dyer, R. A., King, D. J., Richardson, K. J., & Innis, S. M. (2012). Early second trimester maternal plasma choline and betaine are related to measures of early cognitive development in term infants. PloS one, 7(8), e43448. Wu, S. S., Richards, J., El Khoury, D., & Walsh, K. R. (2016). New Insights Into Pediatric Nutrition: Milk Fat Globule Membrane. Wymann, M. P., & Schneiter, R. (2008). Lipid signalling in disease. Nature reviews Molecular cell biology, 9(2), 162. Xu, J., Anderson, V., & Schwarz, S. M. (2013). Dietary GD3 ganglioside reduces the incidence and severity of necrotizing enterocolitis by sustaining regulatory immune responses. Journal of pediatric gastroenterology and nutrition, 57(5), 550-556. Yokomizo, T., & Murakami, M. (2015). Bioactive Lipid Mediators: Springer. Zanotti, A., Valzelli, L., & Toffano, G. (1989). Chronic phosphatidylserine treatment improves spatial memory and passive avoidance in aged rats. Psychopharmacology, 99(3), 316-321. Zavaleta, N., Kvistgaard, A. S., Graverholt, G., Respicio, G., Guija, H., Valencia, N., & Lönnerdal, B. (2011). Efficacy of an MFGM-enriched complementary food in diarrhea, anemia, and micronutrient status in infants. Journal of pediatric gastroenterology and nutrition, 53(5), 561-568. Zeisel, S. H. (2006). Choline: critical role during fetal development and dietary requirements in adults. Annu. Rev. Nutr., 26, 229-250.

122 Zhang, Y., Yang, L., & Guo, L. (2015). Effect of phosphatidylserine on memory in patients and rats with Alzheimer’s disease. Genet Mol Res, 14(3), 9325-9333. Zheng, Y., Li, Y., Rimm, E. B., Hu, F. B., Albert, C. M., Rexrode, K. M., . . . Qi, L. (2016). Dietary phosphatidylcholine and risk of all-cause and cardiovascular-specific mortality among US women and men. The American journal of clinical nutrition, 104(1), 173-180. Zou, X., Guo, Z., Jin, Q., Huang, J., Cheong, L., Xu, X., & Wang, X. (2015). Composition and microstructure of colostrum and mature bovine milk fat globule membrane. Food Chemistry, 185, 362-370.

123 Appendix

A. Protocols for buffers

1. MRS broth (1Liter)

55g of MRS broth powder was mixed with 1L of distill water in 2L flask and stirred until dissolved completely. Solution was transferred into glass bottles and sent to autoclave at 121°C for 15 minutes. Autoclaved MRS broth was cooled and stored in 4°C fridge.

2. MRS agar plate (1 Liter)

55g of MRS broth powder, 1.5% (w/v) of agar and 0.0025% (w/v) of bromocresol green was mixed with 1 L of distill water in 2L flask and stirred thoroughly. Mixture was sent to autoclave at 121°C for 15 minutes and cooled down in RT for 10 minutes. Warm autoclaved mixture was poured into sterile plates and waited until it solidifies. Plates were stored in 4°C fridge for future use.

3. 10X PBS solution (1Liter)

80g of NaCl, 2g of KCl, 14.4g of Na2HPO4 and 2.4g of KH2PO4 was mixed with 800mL of distilled water in 1L beaker and stirred until dissolved completely. Solution p.H. was adjusted to 7.4 with and 1M NaOH. Solution was transferred into 1L volumetric flask and distilled water was added up to 1L. Solution was transferred to glass bottle and stored at RT.

124 4. Native Protein Electrophoresis Gel Preparation

A 10% native gel was made by preparing separating gel mixture and stacking gel solution with Mini-Protein Tetra Cell (Bio-Rad, USA). Separating gel mixture was prepared by mixing

3.66 mL of distilled water with 1.91 mL of separating gel buffer (Tris-HCl 2 M pH 8.8), 2.83mL of 40% acrylamide/bisacrylamide, 4.3 μL of Tetramethylethylenediamine (TEMED) and 43 μL of

10% ammonium persulfate (APS). After separating gel mixture was poured into chamber, distilled water was added carefully on the top of the mixture without mixing to generate a flat top to the gel. The gel was sat for an h to fully polymerize the acrylamide. Stacking gel solution was prepared by mixing 1.81 mL of distilled water with 250 μL of stacking gel buffer (Tris-HCl 2 M pH 6.8),

415 μL of 40% acrylamide/bisacrylamide solution, 1.75 μL of TEMED and 17.5 μL of 10% APS.

Distilled water was poured out, stacking gel solution was poured into the chamber, and comb was inserted. The complete gel was again sat for an h to fully polymerize the acrylamide. The gel was covered with distilled water and stored in 4°C fridge for immediate use or future use (2-3 days).

5. Native Protein Electrophoresis Buffer Preparation

a. Separating gel buffer (2M Tris-HCl p.H 8.8) (100mL)

24.2g of Tris was dissolved in 80mL of distilled water and stirred until dissolved completely, the p.H was adjusted with concentrated HCl to p.H 8.8, poured into 100 mL volumetric flask and distilled water was added up to 100 mL. Solution (separating gel buffer) was transferred to glass bottle and stored at RT.

125 b. Stacking gel buffer (1M Tris-HCl p.H 6.8) (100mL)

12.1g of Tris was dissolved in 80 mL of distilled water and stirred until dissolved completely.

Solution p.H was adjusted with concentrated HCl to p.H 6.8, poured into 100 mL volumetric flask and distilled water was added up to 100 mL. Solution (separating gel buffer) was transferred to glass bottle and stored at RT.

c. 40% acrylamide/ bisacrylamide solution (37.5:1) (250mL)

100g of acrylamide and 2.65g of Bis-acrylamide was added into 500mL beaker and dissolved completely with 150mL of distilled water. Solution was poured into 250mL volumetric flask and distilled water was added up to 250 mL. Solution was transferred to brown glass bottle and stored in 4°C fridge.

d. Coomassie blue staining solution (500mL)

0.5g of Coomassie Brilliant Blue R250 was mixed with 250mL of methanol and stirred until dissolved completely. Solution was poured into 500mL volumetric flask, added with 50mL of glacial acetic acid and distilled water was added up to 500mL. Solution was transferred to brown glass bottle and stored at RT.

e. Destaining solution (500mL)

50mL of Methanol and 50 mL of glacial acetic acid was added into 500mL volumetric flask and distilled water was added up to 500 mL. Solution was transferred to glass bottle and stored at RT.

126 B. Wizard® genomic DNA purification kit (DNA Extraction)

Ten-μL of preserved LABs were inoculated in 5mL of MRS broth at 37°C overnight. Clean cell pellets were obtained by centrifuging at 15,000 rpm for 5 minutes and supernatant was decanted. 480μL of 50mM EDTA was added into the pellets and was resuspended thoroughly.

60μL of 10mg/mL lysozyme was added into the mixture and incubated at 37°C for 30 minutes

(invert the tube 2-5 times between the 30min). Pellets was obtained by centrifuging at 15,000 rpm for 5 minutes and supernatant was decanted. 600μL of nuclei lysis was added and resuspended gently by pipetting. The mixture was incubated at 80°C for 5 minutes to lyse the cell then cooled down to RT. 10μL of RNase solution was added and resuspended gently by pipetting. The mixture was incubated at 37°C for 30 minutes (invert the tube 2-5 times between the 30min) then cooled down to RT. 200μL of protein precipitation solution was added to the RNase-treated mixture, vortexed 20 seconds to mix thoroughly and incubate on ice for 5 minutes. The mixture was centrifuging at 15,000 rpm for 5 minutes. Supernatant containing DNA was transferred to a clean

1.5mL Eppendorf tube and isopropanol was added up to the top of Eppendorf tube. The mixture was gently mixed by inversion until DNA appeared and the pellets was obtained by centrifuging at 15,000 rpm for 10 minutes and supernatant was decanted. 600μL of 70% ethanol was added, mixed gently with inversion, centrifuging at 15,000 rpm for 5 minutes and supernatant was decanted. Repeat the ethanol steps one more time then incubate the pellets in the tube at 37°C to get rid of the ethanol completely. 100μL of DNA rehydration solution was added into the DNA pellets, incubated at 65°C for 30 minutes (tap the tube 2-5 times between the 30min to mix gently).

The mixture was centrifuge at 4000 for a few seconds and incubated at 65°C for another 5 minutes.

The DNA extraction was ready and stored at -20°C fridge.

127 C. Wizard®SV gel and PCR clean-up system (PCR Product Purification)

1. Agarose Gel Electrophoresis

Agarose gel was prepared with 0.8% (w/v) of agarose powder mixed with 50mL of 1X

Tris/ Acetic acid/ EDTA (TAE) buffer and 1-2 μL of Sybr Safe DNA gel Stain. The mixture was heated and stirred at 100-120°C until the agarose was dissolved completely. The dissolved gel was poured into Mini-Gel caster on Sub-Cell GT UV-Transparent Mini-Gel Tray and fixed-height comb was inserted (Bio-Rad, USA).

50 μL of PCR products were mixed thoroughly with 5 μL of 6X TriTrack DNA Loading

Dye. 1μL of GeneRuler 1 kb DNA Ladder (0.5 μg/μL) was mixed with 1μL of loading dye (Bio-

Rad, USA). 55 μL of the stained sample and 2μL of stained ruler were loaded into the solidify agarose gel. The gel was run at 90V for 70 minutes. The image was read with ChemiDoc™ Touch

Imaging System and the DNA bands were excised.

128 2. PCR Product Purification

Excised DNA gel was put into Eppendorf tube and weight was recorded. Different volume of membrane binding solution was added into the tubes according to the weight of the gel (0.573g of gel=573μL of binding solution). The mixture was incubated at 65°C until the gel melts completely (tap the tube every 5 minutes between the incubation to mix). Mini-column was inserted into collection tube and the melted gel was transferred into mini-column. The mixture was incubated at RT for 2-3 minutes, centrifuged at 7,000rpm for 1 minute and the flow through was poured out. 700μL of membrane solution (added with ethanol) was added, centrifuged at 7,000rpm for 1 minute and the flow through was poured out. Repeat the “membrane solution “steps with

500μL of membrane solution and 5 minutes of centrifuge time. The mixture was continued to centrifuge for another 1 minute and the flow through was poured out. The mini-column was transferred to the top of Eppendorf tube and 50μL of 65°C nuclease-free water was added to the mini-column. The mixture was incubated at RT for 2 minutes, centrifuged at 15,000rpm for 1 minute. Mini-column was discarded and the purified PCR product in the Eppendorf tube was stored at -20°C fridge.

129