US 2016003 1973A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0031973 A1 Nunez et al. (43) Pub. Date: Feb. 4, 2016
(54) TREATMENT OF STAPHYLOCOCCAL Publication Classification DSORDERS (51) Int. Cl. (71) Applicants: Gabriel NUNEZ. (US); Yumi C07K 6/2 (2006.01) NAKAMURA, Ann Arbor, MI (US); A 6LX39/085 (2006.01) Jon OSCHERWITZ, Ann Arbor, MI A613 L/713 (2006.01) (US); Kemp CEASE, Ann Arbor, MI CI2N IS/II3 (2006.01) (US); Tyler NYGAARD, (US): THE A639/40 (2006.01) REGENTS OF THE UNIVERSITY A613 L/18 (2006.01) OF MICHIGAN, Ann Arbor, MI (US) A613 L/47 (2006.01) A 6LX3L/277 (2006.01) (72) Inventors: Gabriel Nunez, Ann Arbor, MI (US); A63L/366 (2006.01) Jon Oscherwitz, Ann Arbor, MI (US); A63L/92 (2006.01) Kemp Cease, Ann Arbor, MI (US); A63L/96 (2006.01) Yumi Nakamura, Ann Arbor, MI (US); A63L/235 (2006.01) Tyler Nygaard, Bozeman, MT (US) A6II 45/06 (2006.01) A63L/05 (2006.01) Assignee: The Regents of the University of (52) U.S. Cl. (73) CPC ...... C07K 16/1271 (2013.01); A61K 45/06 Michigan, Ann Arbor, MI (US) (2013.01); A61 K39/085 (2013.01); A61 K (21) Appl. No.: 14/774,589 31/713 (2013.01); C12N 15/113 (2013.01); A61K 39/40 (2013.01); A61 K3I/05 (2013.01); (22) PCT Fled: Mar. 14, 2014 A61 K3I/47 (2013.01); A61 K3I/277 (2013.01); A61 K3I/366 (2013.01); A61 K (86) PCT NO.: PCT/US2O14/O29768 31/192 (2013.01); A61K 31/196 (2013.01); A61 K3I/235 (2013.01); A61K 31/18 S371 (c)(1), (2013.01); C12N 23 10/11 (2013.01); C07K (2) Date: Sep. 10, 2015 2317/76 (2013.01); A61K 2039/505 (2013.01) (57) ABSTRACT Related U.S. Application Data Materials and methods are provided for treatment and/or (60) Provisional application No. 61/784,476, filed on Mar. prevention of Staphylococcal diseases and disorders such as 14, 2013. infection and dermal inflammation. Patent Application Publication Feb. 4, 2016 Sheet 1 of 45 US 2016/0031973 A1
20
S.a Sup (%)
F.G. 1A
FIG. 1B Patent Application Publication Feb. 4, 2016 Sheet 2 of 45 US 2016/0031973 A1
120 100
8O
60
4.O
2O O 5 X 9 aO O Z. 5 ?h top s n Z f as FIG. 1C
Control S-tOXin ionomycin
2 S. aureuS S. g& c S-toXin s s SSSc isS $2 is s SSR. R. S3S. SSS. S. 5 99- 5 SSe s (vici (; c. (i.
i 8-toxin D FIG. 1E Patent Application Publication Feb. 4, 2016 Sheet 3 of 45 US 2016/0031973 A1
PBS 8-toxin PBS 8-toxin PBS 8-toxin WT Kit W-sh/W-sh Kit W-sh/W-sh +BMCMCS FIG. 1G Patent Application Publication Feb. 4, 2016 Sheet 4 of 45 US 2016/0031973 A1
70 lonomycin ODNP-ICE + DNP S. --- :*: P 40 30
a 0 50 100 150 0 50 100 150 r O 2 L
15 is 10 - 6 - a -g- Time (sec) F.G. 2A 26 s o 3 16 9. . 12 9. D c. 8 O Ctrl ionomycin O-toxin EGTA - + - + F.G. 2B 20 -
1 5
10
5
O S&N SSSSS cySYS cy Ly294.002 . . . . FIG. 2C Patent Application Publication Feb. 4, 2016 Sheet 5 of 45 US 2016/0031973 A1
2 O WT Š 16 OSykt CD 12 E
X3. 8 92 4
O SN & S. QN N S NSy CS & S O-toxin sŠ SS cyS FIG. 2D Patent Application Publication Feb. 4, 2016 Sheet 6 of 45 US 2016/0031973 A1
ke 40 DoDNP-lgE 30 20 kikk 10
S asS C2 5 SE 9 asS C2
O-toxin 2 O-toxin WT Syk+ FIG. 3A
PBS O-toxin PBS O-toxin oDNP-lgE FIG. 3B Patent Application Publication Feb. 4, 2016 Sheet 7 of 45 US 2016/0031973 A1
Blood and O Skin Blood Blood C2
Sa(108) "t OVA Or PBS FIG. 4A
1 O
FIG. 4C Patent Application Publication Feb. 4, 2016 Sheet 8 of 45 US 2016/0031973 A1
as 300 -- o 200 O D 9 100 S E O PBS Sawt S.a Ahld FIG. 4D
100
10 PBS Sawt Sa Ahld PBS Sawt Sa Ahld 1 Wk 3 Wk FIG. 4E
0.15 6. O) S. O010 s OP S005 we O O PBS Sawt S.a Ahld FIG. 4F Patent Application Publication Feb. 4, 2016 Sheet 9 of 45 US 2016/0031973 A1
o B6 O Kitw-sh/W-sh
PBS Sa S.a PBS S.a S.a wt Ahld wt Ahld FIG. 4G
H O B6 W-Sh o KitW-sh/W-sh
PBS Sa Sa PBS S.a S.a wt Ahld wt Ahld FIG. 4H. Patent Application Publication Feb. 4, 2016 Sheet 10 of 45 US 2016/0031973 A1
3
:
:::
& 8
s
is is S
S.a. Sup (%)
F.G. 5A
Eis
siss's Patent Application Publication Feb. 4, 2016 Sheet 11 of 45 US 2016/0031973 A1
Satiss News & S.88iS New888 &g Satires 8338 S. 88s 8335-sex:y S&sirests S&S S$838gyi's Sepiderinidis S.xyists
S.S. ixiiis S.8 iss Sigis &f
FIG. 5C Patent Application Publication Feb. 4, 2016 Sheet 12 of 45 US 2016/0031973 A1
- it 30 20
is
cs Patent Application Publication Feb. 4, 2016 Sheet 13 of 45 US 2016/0031973 A1
C-degratiatic activity S& Bij sup {acteria peset BH sup Nashed bacteria eitet Sonicated acteria feet
SB sup SS oteinica editin Sup 3.
{&fias Sesii - 8&Years Extract sug going {{0°C 30m in 7. {1}{C over night acid {p}-3 83 acate pH2) s theroichistoform s otease K {
Chatterary
EAE-ceiliose inding Yes CN-ceiliose aiding Yes ge itration pii V.4 y is is acti: isoelectric pit pî) - 88
FIG. 6A Patent Application Publication Feb. 4, 2016 Sheet 14 of 45 US 2016/0031973 A1
800 in culture supernatant (8% Yeast Exts act testical exits
CN-cetitiose purification
fix: it a Centrifuga iter
superdex 20.
As it a Certifuga iter
{-3 scies S
FIG. 6B Patent Application Publication Feb. 4, 2016 Sheet 15 of 45 US 2016/0031973 A1
cysteiise $888Se. see: SEs,
stei SAO, SCOO87 i&ise sees St. yxiativa picteis S&CSC{}{38. Patent Application Publication Feb. 4, 2016 Sheet 16 of 45 US 2016/0031973 A1
COnt OfPSMC2 fSMC3 Ef 6-toxin I 6-toxin
4.68OOO 2 O
FIG. 7A
fpSM02 fRSMC3 FIG. 7B Patent Application Publication Feb. 4, 2016 Sheet 17 of 45 US 2016/0031973 A1
2O
5 20 10 One 5 o Ctrl O.1 03 3 10 30 O.1 03 3 10 30 ston C 8-toxin fö-toxin peptide FIG. 7C
1,200 1,000 800 600 400 200
Ctrl
FIG. 7D Patent Application Publication Feb. 4, 2016 Sheet 18 of 45 US 2016/0031973 A1
G S. S s
N4 D
PBS Sawt S.a Ahld FIG. 8A
NS, NS 7 I PBS a. Sawt S.a Ahld 53 P 2 O ND O total bacteria S. aureuS FIG. 8B Patent Application Publication Feb. 4, 2016 Sheet 19 of 45 US 2016/0031973 A1
edium only
S. aureus supernatant (Sa sup) Sa sup + anti-8 toxin antibody Sa sup + control antibody Patent Application Publication Feb. 4, 2016 Sheet 20 of 45 US 2016/0031973 A1
140
120
100
8O
6O
4O
2O
1:12.5.125 1501;1001:200 14001:6001800:12.5 1251:50 1001:2001:4001:6001800 1:1251.25:12.5 1:25 A1 A2 One A. A2 One delta-toxin (g/ml) PSMalpha3 (pigml)
FIG. 10
Patent Application Publication Feb. 4, 2016 Sheet 22 of 45 US 2016/0031973 A1
120
100
80
60
40
20
-200bntrolAb12.5 antidelta toxin (Ab(NOV20011)
FIG. 12 Patent Application Publication Feb. 4, 2016 Sheet 23 of 45 US 2016/0031973 A1
Rabbit anti-Reitat and Delta N inhibit mast ceil degranulation
|||||||||||||||||| ~~~~??;*******~*~*~*~~~~~~~~~~~~~
· syss&S SSSSS },±% ?--· s Sssssssssssssss
systis S&rk:
FIG. 13 Patent Application Publication Feb. 4, 2016 Sheet 24 of 45 US 2016/0031973 A1
eia xi Casti Nitetiis. As
-- Extensi ress is $$$. 8 8 $3.
8 s ^ 8 N ^ 8 Y. S. sts8 W. --a 8 w 8
FIG. 14 Patent Application Publication Feb. 4, 2016 Sheet 25 of 45 US 2016/0031973 A1
Stirriation of last Celegratiation
s see see 700 600 see 400 38 S
| 8 &a. sea&x. Utill sta-N SAR Seta- A costs: A as eit texts
etitie
FIG. 15 Patent Application Publication Feb. 4, 2016 Sheet 26 of 45 US 2016/0031973 A1 |(5,-5,5,-5,5,5 NS ÞAgoW#-GZC8 F.G. 16A
ND SA113 LAC 8325-4 F.G. 16B
( pTXA16) LACAhld (pTXAhld) ---- LAC Ahld (pTXA16)
A 8-toxin (N-form.) 8-toxin (N-deform.) F.G. 16C Patent Application Publication Feb. 4, 2016 Sheet 27 of 45 US 2016/0031973 A1
BMCMCs BMMp
Neutrophil Keratinocyte Patent Application Publication Feb. 4, 2016 Sheet 28 of 45 US 2016/0031973 A1
S. aureus S. epidermis 8-toxin (ng) MW2 LAC 1457 100 50 10 1 wt Ahld wt Ahld wt Ahld 8-toxin)
F.G. 18A
f 8:8:8 Wt
1 O
Saureus LAC sepidemis 1457
F.G. 18B Patent Application Publication Feb. 4, 2016 Sheet 29 of 45 US 2016/0031973 A1
Medium
LAC Wt LACAhld
SA113
F.G. 19A
0.20. r...... ww. S
0.15:
0.10s
SSSSSSSSSSS 0.05 awaysS. & & s Medium LACwt LACAhld SA113 FIG. 19B Patent Application Publication Feb. 4, 2016 Sheet 30 of 45 US 2016/0031973 A1
BMCMCs
1000
1 O O
FIG. 20 Patent Application Publication Feb. 4, 2016 Sheet 31 of 45 US 2016/0031973 A1
35 SS SCD 30 S 25 E 20 S; as3 15 FIG. 21A 10 5
0.20 NS 3 0.15. smay. S s 5O 0.10 S www.SwNY FIG. 21B
Medium LAC wt LAC wt LACAhld +WRW4
FIG. 21C Patent Application Publication Feb. 4, 2016 Sheet 32 of 45 US 2016/0031973 A1 25 SS 20 (S 9. 15 - .
O 10 FIG.22A
cis 5
O s X s & ESS -K- Ctrl 0.1 1 1 10 MMK1 LipOxin A4 i (uM) (nM)
s CD O . E S; FIG. 22B 9. CD C ch Ctrl 0.1 1 1 10 MMK1 Lipoxin A4 (uM) (nM) d 30 25 S. 20 15 9.O 10 FIG. 22C p ch, 5 s
O 8-toxin (ug/ml) Patent Application Publication Feb. 4, 2016 Sheet 33 of 45 US 2016/0031973 A1
1 2 3 4 5 6 7 8 9 10 11 12 13
NO. Of S. aureuS strains 20 21 22 23 24 25 26 from AD XXXXXXXXXXX-XXXXXXXX
S S xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxS&xxxxxxxxxxxxxxxxxxxxxxxxx...SSSXxxxxxxxxxxxxxxxxxxx S. aureus synthetic 8-toxin (ng) S Strains 100 50 10 5 1 0.5 S. is 10 11 12 FIG. 23A
all FIG. 23B
NDE 12 NDE4
1000
100 FIG. 23C
10 Patent Application Publication Feb. 4, 2016 Sheet 34 of 45 US 2016/0031973 A1
3000 2.00 more P3-lux 180 2500 wox OD 600 Y N. 160 2000 120 1500 1.00 1000 0.60 0.40 500 0.20 to 0.00 Time (hrs) FIG. 24A
LAC LAC P3 lux
FIG. 24B
Bacteria number no Luminescence
5.E+07 1.E+08 5.E+06 1.E+07 1.E+06 5. E O 5 1.E+05
day1 day4 day7 FIG. 24C Patent Application Publication Feb. 4, 2016 Sheet 35 of 45 US 2016/0031973 A1
PBS LACpTXA16 LACAhldpTXA16 LAC Ahld ptXAhld & m S
FIG. 25A
KY &y K CS s &S y s S. s
FIG. 25B Patent Application Publication Feb. 4, 2016 Sheet 36 of 45 US 2016/0031973 A1
Se 6 I S.a. Wit 3. 5 S.a. Ahld GN53 4 2
O Total bacteria S. aureuS FIG. 26A
NS NS, - 8 O PBS S 7 I S.a. Wit 36 S.a. Ahld S3 52 d ND ND Surface NonSurface FIG. 26B
PBS S.a. Wit S.a. Ahld FIG. 26C Patent Application Publication Feb. 4, 2016 Sheet 37 of 45 US 2016/0031973 A1
PEs Sa sa PBS sa, s.a. Wit Ahld Wit Ahld
FIG. 27A
as NS - s: 1000 “. . S: ...its 8. SS s ss.
& 8 * &
FIG. 27B Patent Application Publication Feb. 4, 2016 Sheet 38 of 45 US 2016/0031973 A1
8 - as 7 6 S 5 GS53 4 P 2 C ND O infected Uninfected FIG. 28A
92 O 3 c 8 3: ?
infected Uninfected FIG. 28B
100 --
e O d S 10 O CD Patent Application Publication Feb. 4, 2016 Sheet 39 of 45 US 2016/0031973 A1
1 Week 0.15 as SR S 0.10 CP s O 0.05
w Ahid FIG. 29A
3Week 0.15 3. SR S 0.10 CD s O 0.05
w Ahid FIG. 29B Patent Application Publication Feb. 4, 2016 Sheet 40 of 45 US 2016/0031973 A1
O Blood Blood skin 1 d
O 1 Wk 3 Wk 4 Wk
OVA OVA H H 8-toxin 8-toxin FIG. 30A
1 Wk 4 Wk FIG. 30C Patent Application Publication Feb. 4, 2016 Sheet 41 of 45 US 2016/0031973 A1
0. 4
0. 3 FIG. 30D 0. 2
0. 4
0. 3 FIG. 30E
0. 2
0. 3 O
0. 2 5 0. 20 FIG. 30F Patent Application Publication Feb. 4, 2016 Sheet 42 of 45 US 2016/0031973 A1
FIG. 31A Patent Application Publication Feb. 4, 2016 Sheet 43 of 45 US 2016/0031973 A1
HE TB TB (hpf)
FIG. 31B Patent Application Publication Feb. 4, 2016 Sheet 44 of 45 US 2016/0031973 A1
Surface B6 Surface Kit W-sh/W-sh INon-surface B6 E. Non-surface Kit W-Sh/W-Sh
Total bacteria S. aureuS
FIG. 31C Patent Application Publication Feb. 4, 2016 Sheet 45 of 45 US 2016/0031973 A1
Kit W-sh/W-sh
Kit W-sh/W-sh +BMCMCS
FIG. 32A
15
as 10 O. O. S O. O. O 3 : 2 5 O :::
B6 Kit W-sh/W-sh KW-sh/W-sh +BMCMCS FIG. 32B US 2016/003 1973 A1 Feb. 4, 2016
TREATMENT OF STAPHYLOCOCCAL mation comprising the step of administering to an individual DISORDERS a therapeutically or prophylactically effective amount of a compound that inhibits Staphylococcus delta toxin. The dis CROSS REFERENCE TO RELATED closure also provides a method for preventing or treating a APPLICATIONS Staphylococcal infection comprising administering a pro phylactically or therapeutically effective amount of a com 0001. This application claims the benefit of Provisional pound effective in inhibiting the activity or expression of U.S. Patent Application No. 61/784,476, filed on Mar. 14, delta toxin. In various aspects, the Staphylococcus delta toxin 2013, incorporated herein by reference in its entirety. is a S. aureus, S. epidermidis, S. saprophyticus, S. epidermi STATEMENT OF GOVERNMENT SUPPORT dis, S. warneri, S. intermedius, or S. pseudointermedius delta toxin. 0002 This invention was made with government support 0006. In various aspects, the dermal inflammation arises under R01 AR059688 awarded by the National Institutes of from mast cell-mediated cytokine release, or from mast cell Health. The government has certain rights in the invention. degranulation. 0007 Invarious aspects, the inflammation is dermatitis. In INCORPORATION OF SEQUENCE LISTING various embodiments, the dermatitis is atopic dermatitis. 0003. The sequence listing that is contained in the file 0008. In various aspects, the compound inhibits delta named “46671A SeqListing..txt, which is 7.17 kilobytes as toxin activity, the compound binds the delta toxin, the com measured in Microsoft Windows operating system and was pound inhibits delta toxin interaction with mast cells, the created on Mar. 14, 2014, is filed electronically herewith and compound inhibits delta toxinsecretion, the compound inhib incorporated herein by reference. its delta toxin expression, the compound inhibits delta toxin transcription, or the compound inhibits delta toxin transla BACKGROUND tion. 0009. In various aspects, the compound is a polypeptide, 0004 Staphylococci constitute a genus of gram-positive the compound is an antibody, the compound is an antibody bacteria responsible for a number of disorders afflicting isolated from a polyclonal Sera, the compound is a mono humans and other mammals, including infection (e.g. MRSA clonal antibody, the compound is a humanized antibody, the infections) and skin inflammation (e.g., atopic dermatitis). compound is a chimeric antibody, the compound is a single Atopic dermatitis (AD) is a chronic inflammatory skin dis chain antibody, the compound is a single chain Fv antibody, ease that affects 15 to 30% of children and approximately 5% the compound is an Fab antibody, the compound is an Fab' of adults in industrialized countries (Williams, et al., JAllergy antibody, the compound is an (Fab') or the compound is an Clin Immunol 118, 209-213 (2006)). Although the pathogen antigen-binding fragment of a monoclonal antibody. In vari esis of AD is not fully understood, the disease is mediated by ous aspects, the compound is a delta toxin binding peptide. an abnormal immunoglobulin E (IgE) immune response in 0010 Invarious aspects the delta toxin is set out in any one the setting of skin barrier dysfunction (Elias, et al., J Invest of SEQID NOs: 1,2,3,4, 5, 6, 7, or 8. In various aspects, the Dermatol 128, 1067-1070 (2008)). Mast cells (MCs) are key delta toxin is 90% or more identical, 91% or more identical, effector cells in IgE-mediated allergic disorders including 92% or more identical, 93% or more identical, 94% or more AD. Stimulation with antigen and specific IgE initiates the identical, 96% or more identical, 97% or more identical, 98% activation of MCs by promoting the aggregation of FceRI or more identical, 99% or more identical to any one of the (Kawakami, et al., Nat Rev Immunol 2, 773-786 (2002)). 8-toxin proteins set out in SEQID NOs: 1, 2, 3, 4, 5, 6, 7, or Upon activation, MCs release their membrane-bound cytoso 8. In various aspects, the compound specifically binds a car lic granules leading to the release of multiple molecules that boxy terminal fragment of a delta toxin or the compound are important in the pathogenesis of AD and host defense specifically binds an amino terminal fragment of the delta (Galli, et al., Nat Med 18, 693-704 (2012); Galli, et al., Nat toxin. Immunol 12, 1035-1044 (2011)). More than 90% of AD 0011. In various aspects, the compound is a polynucle patients are colonized with Staphylococcus aureus in the otide. In various aspects, the polynucleotide is an antisense lesional skin whereas most healthy individuals do not harbor oligonucleotide, an inhibitory RNA (RNAi), an antisense the pathogen (Rudikoff, et al., Lancet 351, 1715-1721 (1998)). Staphylococcal exotoxins (SEs), particularly SEA, RNA, a short hairpin RNA (shRNA), a small interfering RNA SEB and TSST-1, can act as Superantigens and/or antigens in (siRNA), a microRNA (miRNA), or a ribozyme. models of AD (Leung, et al., J. Invest Dermatol 100, 225-228 0012. In various aspects the method is carried out with the (1993); Neuber, et al., Immunology 75, 23-28 (1992)). How compound administered with a second therapeutic agent. In ever, the role of SES in disease pathogenesis remains unclear various aspects, the compounds and the second therapeutic and controversial (Kozman, A. et al. Br J Dermatol 163, agent are administered concurrently, and in the various 1308-1311 (2010)). Furthermore, a large percentage of AD aspects, compounds and the second therapeutic agent are patients are colonized with S. aureus that do not produce administered consecutively. In various aspects, the second identifiable SEs (Leung, et al., J Clin Invest 92, 1374-1380 therapeutic agent is selected from the group consisting of a (1993)). Accordingly, a need continues to exist for materials therapeutic protein, an antibiotic agent, an anti-inflammatory and methods for treating, or ameliorating a symptom of agent and a immunosuppressive agent. 0013 Consistent with the foregoing, one aspect of the chronic inflammatory skin diseases such as atopic dermatitis. disclosure provides a method for treating or preventing skin inflammation comprising the step of administering to an indi SUMMARY OF THE INVENTION vidual a prophylactically or therapeutically effective amount 0005. The disclosure provides a method for treating or of a compound that inhibits Staphylococcus delta toxin. In preventing Staphylococcal disorders such as dermal inflam Some embodiments, the Staphylococcus delta toxin is a S. US 2016/003 1973 A1 Feb. 4, 2016
aureus, S. epidermidis, S. saprophyticus, S. epidermidis, S. dimethyl-5-(1-methylethyl)-CAS: CPD000466395 warneri, S. intermedius or S. pseudintermedius delta toxin. RITONAVIR, AMINOETHOXYDIPHENYLBORANE; 0014. In some embodiments, the skin inflammation arises PYRETHRINSIDRIONE: Galangine; METHYL DEOXY from mast cell-mediated cytokine release. In some embodi CHOLATE: DANTRON: DIACERIN PHENAZOPYRI ments, the skin inflammation arises from mast cell degranu DINEHYDROCHLORIDE: SMILAGENIN;361549, GSK lation. An exemplary skin inflammation amenable to the 3b Inhibitor VIII; PHENOLPHTHALEIN; Sulindac Sulfide: methods of the disclosure is dermatitis, Such as atopic derma 2',4-DIHYDROXYCHALCONE: Lonidamine; titis. CPD000469176 TIAGABINE HC1; CLOPIDOGRELSUL 00.15 Embodiments of this aspect of the disclosure are FATE: FLUNIXIN MEGLUMINEIBANAMINE; TEST contemplated wherein the compound inhibits delta toxin OSTERONE PROPIONATE: CPD000449318 Benzeneace activity, expression, or both activity and expression. For tic acid, 2-(2,6-dichlorophenyl)amino-, monosodium salt example, activity inhibition is achieved wherein the com CAS; ZOMEPIRAC SODIUM: APIGENIN DIMETHYL pound binds delta toxin, and/or inhibits delta toxin interaction ETHER NIFURSOL: HAEMATOXYLIN; URSOCH with mast cells. Delta toxin expression is inhibited by inhib OLANIC ACID: GIBBERELLIC ACID: iting delta toxin secretion, and/or by inhibiting transcription LUMIRACOXIB PREXIGE: CPD000466283 Altanserin: and/or translation of RNA producing delta toxin. MOXIDECTINCYDECTIN: 4Br-AHX; 0016. In some embodiments of this aspect of the disclo LUFENURONIPROGRAM; 3-DESHYDROXYSAP Sure, compounds that inhibit RNA producing delta toxin (e.g., PANOLTRIMETHYLETHER: XAV939; CPD000466374 RNAIII) also inhibit expression of the regulatory RNAIII ORMETOPRIM; PANTOPRAZOLEIPROTONIX: NORE and, thus, the multiple virulence factors regulated by RNAIII. THINDRONE: DIHYDROERGOTAMINE MESYLATE; 0017. In some embodiments of this aspect of the disclo ERGOCALCIFEROL: DIBENZOTHIOPHENE: Sure, the compound is a polypeptide. An exemplary polypep NCI16221; CPD000466305 REPAGLINIDE; tide contemplated by the disclosure is an anti-delta toxin CPD000058555 LY 171883:5-CHLOROINDOLE-2-CAR antibody or antigen binding fragment thereof. In some BOXYLIC ACID: CHLORANIL; DANAZOL: embodiments, the antibody or antigen binding fragment CHRYSOPHANOL: MEGESTROL ACETATE; and SP thereof is isolated from a polyclonal Sera., and in some 600 125. In some embodiments, the compound is selected embodiments, the antibody or antigen binding fragment from the group consisting of HEXESTROL: SR 2640; thereof is a monoclonal antibody, or fragment thereof. The OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: CAR disclosure comprehends any known form of antibody or frag NOSIC ACID; SODIUM MECLOFENAMATE: DIENES ment thereof, including but not limited to a humanized anti TROL, DICHLOROEVERNIC ACID; and TPCK. body, a chimeric antibody, a trifunctional or hybrid antibody, 0021. Other embodiments according to this aspect of the a single-chain antibody, a single chain Fv antibody, an Fab disclosure include any of the above-described methods antibody, an Fab' antibody, an (Fab'), a diabody, or an anti wherein the compound is administered with a second thera gen-binding fragment of a monoclonal antibody. Also con peutic agent. In some embodiments, the compound and the templated as polypeptides for use in the methods of the dis second therapeutic agent are administered concurrently, or closure are delta toxin binding peptides. As set out in greater consecutively. The second therapeutic may be any of a variety detail below, the disclosure also contemplates a compound of compounds, including but not limited to, a therapeutic that is a polynucleotide or a small molecule. protein, an antibiotic agent, an anti-inflammatory agent and 0018. In some embodiments, the delta toxin sequence is an immunosuppressive agent. set out in SEQID NO: 1 (S. aureus), or in SEQID NO: 5 (S. 0022. Another aspect according to the disclosure is a epidermidis). The methods of the disclosure include embodi method of preventing or treating a Staphylococcal infection ments wherein the compound specifically binds a carboxy comprising administering a prophylactically or therapeuti terminal region of the delta toxin, such as wherein the car cally effective amount of a compound that inhibits Staphylo boxy terminal region consists essentially of SEQID NO. 3. In coccus delta toxin activity or expression. In some embodi Some embodiments, the compound specifically binds an ments, the Staphylococcus delta toxin to be inhibited is a S. amino terminal region of delta toxin, such as wherein the aureus, S. epidermidis, S. saprophyticus, S. epidermidis, S. amino terminal region is set out in SEQID NO: 2. warneri, S. intermedius, or S. pseudintermedius delta toxin. 0019. In some embodiments of the methods according to In some embodiments, the Staphylococcus delta toxin is the disclosure, the compound is a polynucleotide. Exemplary derived from a methicillin-resistant S. aureus. polynucleotides include a delta toxin antisense oligonucle 0023 Invarious embodiments of the method of preventing otide and a a delta toxin inhibitory RNA (RNAi). Examples of or treating infection, the compound inhibits delta toxin activ delta toxin RNAi include, but are not limited to, a delta toxin ity or expression. In some embodiments, the compound is an antisense RNA, a delta toxin short hairpin RNA (shRNA), a anti-delta toxin antibody orantigenbinding fragment thereof. delta toxin small interfering RNA (siRNA), a delta toxin Embodiments are contemplated wherein the antibody or anti microRNA (miRNA), or a ribozyme that interacts with a delta gen binding fragment thereof is a humanized antibody, a toxin transcript. chimeric antibody, a trifunctional or hybrid antibody, a 0020. The disclosure comprehends embodiments of the single-chain antibody, a single chain FV antibody, an Fab methods wherein the compound is selected from the group antibody, an Fab' antibody, an (Fab'), a diabody, or an anti consisting of HEXESTROL: SR 2640; gen-binding fragment of a monoclonal antibody. In some OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: CAR embodiments, the antibody or antigen binding fragment NOSIC ACID; SODIUM MECLOFENAMATE: DIENES thereof binds a carboxy-terminal region or an N-terminal TROL: DICHLOROEVERNIC ACID: TPCK; region of delta toxin, such as wherein the antibody orantigen CPD000466278 1H-Indole-2-propanoic acid, 1-(4-chlo binding fragment thereof binds a carboxy terminal region of rophenyl)methyl-3-(1,1-dimethylethyl)thio-Alpha-Alpha delta toxin that consists essentially of SEQID NO:3 or binds US 2016/003 1973 A1 Feb. 4, 2016 an N-terminal region of delta toxin that consists essentially of minal and C-terminal fragments of Staphylococcal delta SEQ ID NO:2. In some embodiments, the compound is a toxin have reduced or non-existent toxicity relative to wild polynucleotide, Such as a delta toxin antisense oligonucle type full-length Staphylococcal delta toxin. otide, a delta toxin inhibitory RNA (RNAi), a delta toxin short 0026. A related aspect of the disclosure provides a method hairpin RNA (shRNA), a delta toxin small interfering RNA of vaccinating a Subject at risk of developing a Staphylococ (siRNA), a delta toxin microRNA (miRNA), or a ribozyme cal disorder comprising administering a prophylactically that interacts with a delta toxin transcript. effective amount of an antibody or fragment thereof that 0024. The disclosure contemplates methods of preventing specifically binds to an N-terminal fragment of delta toxin as or treating a Staphylococcal infection wherein the compound set forth in SEQID NO:2 or specifically binds to a C-terminal is selected from the group consisting of HEXESTROL: SR fragment of delta toxin as set forth in SEQ ID NO:3. In 2640; OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: various embodiments, the antibody or fragment thereof is CARNOSIC ACID; SODIUM MECLOFENAMATE; ultimately isolated from the species to be treated or is modi DIENESTROL, DICHLOROEVERNIC ACID: TPCK; fied to resemble antibodies (fragments) of that species. For CPD000466278 1H-Indole-2-propanoic acid, 1-(4-chlo example, vaccinating human Subjects by passive immuniza rophenyl)methyl-3-(1,1-dimethylethyl)thio-Alpha-Alpha tion may be performed by administering human antibodies or dimethyl-5-(1-methylethyl)-CAS: CPD000466395 fragments thereof, or by administering humanized antibodies RITONAVIR, AMINOETHOXYDIPHENYLBORANE; or fragments thereof. PYRETHRINSIDRIONE: Galangine; METHYL DEOXY 0027. Another aspect of the disclosure, related to the CHOLATE: DANTRON: DIACERIN PHENAZOPYRI methods disclosed herein, are uses of the compounds dis DINEHYDROCHLORIDE: SMILAGENIN: 361549, GSK closed herein to prevent or treat Staphylococcal disorders. 3b Inhibitor VIII; PHENOLPHTHALEIN; Sulindac Sulfide: More particularly, the disclosure comprehends a use of the 2',4-DIHYDROXYCHALCONE: Lonidamine; compound (any compound) disclosed herein in preventing or CPD000469176 TIAGABINE HC1; CLOPIDOGRELSUL treating skin inflammation. The disclosure also contemplates FATE: FLUNIXIN MEGLUMINEIBANAMINE; TEST use of the compound (any compound) disclosed herein in OSTERONE PROPIONATE: CPD000449318 Benzeneace preventing or treating a Staphylococcal infection. The disclo tic acid, 2-(2,6-dichlorophenyl)amino-, monosodium salt Sure also provides a use of the compound (any compound) CAS; ZOMEPIRAC SODIUM: APIGENIN DIMETHYL disclosed herein in vaccinating a subject at risk of developing ETHER NIFURSOL: HAEMATOXYLIN; URSOCH a Staphylococcal disorder. For each of the methods disclosed OLANIC ACID; GIBBERELLIC ACID; herein, the disclosure contemplates a use of the therapeutic or LUMIRACOXIB PREXIGE: CPD000466283 Altanserin: prophylactic recited in that method in preventing or treating a MOXIDECTINCYDECTIN: 4Br-AHX; Staphylococcal disorder Such as infection or inflammation, LUFENURONIPROGRAM; 3-DESHYDROXYSAP e.g., skin inflammation, or a use of Such a therapeutic or PANOLTRIMETHYLETHER: XAV939; CPD000466374 prophylactic in the preparation of a medicament for Such ORMETOPRIM; PANTOPRAZOLEIPROTONIX: NORE prevention or treatment of a Staphylococcal disorder Such as THINDRONE: DIHYDROERGOTAMINE MESYLATE; infection or inflammation (e.g., skin inflammation). ERGOCALCIFEROL: DIBENZOTHIOPHENE: 0028. Other features and advantages of the disclosure will NCI16221; CPD000466305 REPAGLINIDE; become apparent from the following detailed description, CPD000058555 LY 171883:5-CHLOROINDOLE-2-CAR including the drawing. It should be understood, however, that BOXYLIC ACID: CHLORANIL; DANAZOL: the detailed description and the specific examples, while indi CHRYSOPHANOL: MEGESTROL ACETATE; and SP cating embodiments, are provided for illustration only, 600 125. In some embodiments, the compound is selected because various changes and modifications within the spirit from the group consisting of HEXESTROL: SR 2640; and scope of the disclosure will become apparent to those OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: CAR skilled in the art from the detailed description. NOSIC ACID; SODIUM MECLOFENAMATE: DIENES TROL, DICHLOROEVERNIC ACID; and TPCK. BRIEF DESCRIPTION OF THE DRAWING 0025. Another aspect of the disclosure is a method of 0029 FIG.1. 8-toxin from S. aureus induces MC degranu vaccinating a subject at risk of developing a Staphylococcal lation in vitro and in vivo. a, MC degranulation activity of disorder comprising administering an immunologically supernatants of BMCMCs stimulated with medium alone effective amount of an immunogen selected from the group (Control) or indicated stimuli including different concentra consisting of an inactivated Staphylococcal delta toxin, an tions of culture supernatant of S. aureus 8325-4 (S.a sup). b. N-terminal fragment of Staphylococcal delta toxin and a MC degranulation activity of supernatants of MC/9 cells C-terminal fragment of Staphylococcal delta toxin. All or part stimulated with 10% of culture supernatant from LAC S. of the Staphylococcal delta toxin sequence can be modified or aureus wild-type (LAC wt) or isogenic mutants deficient in enlarged by adding antigenic amino acids by chemical Syn PSMC. peptides (LAC Apsmo.), PSM3 peptides (LAC thesis or techniques known in the art, including the applica ApSimB), 6-toxin (LACAhld), LAC wild-type expressing vec tion of heat or the use of mutagenesis, such as site-directed toralone (LACpTXA16), LAC deficient in 8-toxin expressing mutagenesis. The N-terminal and C-terminal fragments of vector alone (LACAhld pTXA16) and strain complemented Staphylococcal delta toxin have a majority of amino acid with 8-toxin plasmid (LACAhld pTXAhld). Control repre residues corresponding to the N-terminal or C-terminal half sents 10% TSB medium. c. Histamine concentrations in cul of full-length Staphylococcal delta toxin. In some embodi ture supernatant of fetal skin-derived MCs (FSMCs) after ments, N-terminal or C-terminal delta toxin fragments have at stimulation with indicated stimuli including synthetic 6-toxin least 60%, 70%, 75%, 80%, 90%, or 95% of the amino acid at 30 g ml for 15 min. Data represent meansits.d. of trip residues corresponding to the N-terminal or C-terminal half licate cultures. Results are representative of at least 3 inde of full-length Staphylococcal delta toxin, respectively. N-ter pendent experiments (a-c). P value refers to comparisons US 2016/003 1973 A1 Feb. 4, 2016
between experimental and control groups (a-c). d, Represen inflammation. d. Number of inflammatory cells in skin of tative electromicroscopic images of FSMCs stimulated with BALB/c mice colonized with S. aureus or treated with PBS. synthetic 8-toxin (30 ugml") for 15 min. Images of unstimu Results depicted as number of inflammatory cells per high lated (Cont) and ionomycin-treated FSMCs are also shown.e. power field (hpf). e. Serum levels of IgE in BALB/c mice Ö-toxin expression in Staphylococcus culture Supernatants colonized with S. aureus or treated with PBS at 1 and 3 weeks (0.5 ul per well). Loading of lanes with synthetic 6-toxin (10 post colonization with S. aureus. f. Serum levels of OVA ng, 100 ng) is shown as reference. f. C57BL6 (WT) and specific IgE after OVA sensitization in BALB/c mice colo MC-deficient (Kit""") mice were injected intradermally nized with S. aureus or treated with PBS.g., Skin disease score into the left and right ears with 8-toxin (100 lug) or PBS, in C57BL/6 (B6), MC-deficient (Kit'''') and MC-defi respectively. One representative mouse for each group is cient (Kit''') mice reconstituted with MCs at 1 week shown. g. Quantification of Evans blue extracted from skin after the inoculation with S. aureus. h, Serum levels of total tissue of WT. Kit'''', Kit"''' reconstituted with IgE 1 week after colonization of B6, Kit'''' and Kit' BMCMCs is shown. Dots represent individual ear samples sh/W-sh, mice reconstituted with MCs with wild-type and from 2 independent experiments. NS: no significant: *P<0. Ö-toxin mutant (Ahld) S. aureus or treated with PBS. Dots 05: **P<0.01: ***P<0.001, 2-tailed t test. represent individual mice pooled from two independent 0030 FIG.2. 6-toxin-induced MC degranulation depends experiments. *P<0.05: **P<0.01: ***P<0.001, one-way on Ca" influx/PI3K pathway, but is independent of Syk.a. ANOVA with Tukey post-hoc test for multiple comparisons FSMCs loaded with the fluorescent Ca" indicator Fluo-4AM (d-h). with or without EGTA were stimulated for 50 sec. Baseline 0033 FIG. 5. Culture supernatant from S. aureus induces fluorescence (red) was measured, and then the MCs were MC degranulation. (a)(3-hexosaminidase activity from Super stimulated with indicated stimuli and fluorescence shift natants offetal skin-derived MC (FSMC) cultures stimulated (green) was measured. RFU, relative fluorescence units. b. c. with medium alone (Control), CDNP-IgE alone, a NP-IgE MC degranulation activity (3-hexosaminidase assay) of plus DNP ionomycin, ATP and indicated concentrations of supernatants of FSMCs pretreated with EGTA (b) or culture supernatant from S. aureus (8325-4). (b) f-hex LY294.002 (c) stimulated with medium alone (Crtl), ionomy osaminidase activity from supernatants of MC/9 cell cultures cin, DNP-HSA (DNP) plus anti DNP-IgE or 8-toxin (10 ug stimulated with indicated Stimuli. (c) 3-hexosaminidase ml"). d, MC degranulation activity in FSMCs derived from activity from supernatants of MC/9 cells stimulated with 10% Syk and wild-type (WT) mice stimulated with indicated culture Supernatant of indicated Staphylococcus species. concentration of 8-toxin (ug ml). Data represent meansits. Data represent meansits.d. of triplicate cultures. *P<0.05: d. of triplicates cultures and representative of at least 3 inde ***P<0.001, two-tailed Student's t-test. (d) MC/9 cells were pendent experiments (b-d). NS: no significant; *P<0.05; incubated 60 minutes in medium (Control), 10% S. aureus **P<0.01: ***P<0.001, 2-tailed t test. culture Supernatant (8325-4) or medium containing Nigericin 0031 FIG. 3. Antigen-independent IgE signaling (10 uM, used as a positive control). Percentage of propidium enhances 6-toxin-induced MC activation. a, MC degranula iodide (PI)-positive cells were measured by flow cytometry. tion activity in supernatants of FSMCs with or without anti Data are representative of at least two independent experi DNP-IgE or TNP-IgE and then stimulated with 8-toxin (0.01 mentS. ug ml), DNP-HSA (DNP) or TNP-HSA (TNP). b. MC 0034 FIG. 6. Characterization, purification and mass degranulation activity in supernatants of FSMCs derived spectrometry identification of 6-toxin. (a) B-hexosaminidase from Syk and wild-type mice (WT) pretreated with or activity compared with that of BHI culture supernatant (sup) without anti DNP-IgE, and then stimulated with indicated and bacterial pellet (100%). (b) Purification scheme for iden concentration of 6-toxin (ug ml). Representative of at least tification of 6-toxin. (c) Proteins identified in the purified 3 independent experiments. **P<0.01: ***P<0.001, 2-tailed sample. The summarized “total independent spectra' is ttest (a,b).c, Quantification of Evans blue extracted from skin indicative of the relative abundance of a specific protein in the tissue of C57BL6 mice injected intradermally into the left and purified sample. Full length of mature form 6-toxin sequence right ears with 8-toxin (5 g) or PBS, respectively. Data were detected (MAQDIISTIGDLVKWIIDTVNKFTKK; represent meansits.d. of triplicate cultures and representative SEQID NO: 1). (BHI: brain heart infusion, TSB; tryptic soy of at least 3 independent experiments (a,b). Dots represent broth, DEAE; Diethylaminoethyl, CM; Carboxymethyl. individual ear samples. Representative of 2 independent 0035 FIG.7. MC degranulation activity of 6-toxin is inde experiments (c). NS: no significant; *P<0.05, one-way pendent of formylation. (a) '% LDH released from MC/9 cells ANOVA with Tukey post-hoc test for multiple comparisons. stimulated by medium alone (Ctrl) and indicated concentra 0032 FIG. 4. Staphyloccocus 6-toxin promotes IgE pro tions (ug ml–1) of PSMs for 15 or 60 minutes. (b) f-hex duction and inflammatory skin disease via mast cells. a, S. osaminidase assay from Supernatants of MC/9 cells stimu aureus colonization and OVA sensitization protocol. Mice lated with indicated concentrations (ug ml-1) of formylated were colonized epicutaneously with 10 CFU.S. aureus using PSMC.S. (c) 3-hexosaminidase assay from Supernatants of a gauze patch for 1 week. For OVA sensitization, a patch MC/9 cells stimulated with indicated concentrations (ug containing OVA or PBS was applied to the same skin site 2 ml-1) of unformylated 8-toxin (Ö-toxin) or formylated weeks after S. aureus inoculation. b. Skin disease score 1 Ö-toxin (fö-toxin) (left panel). B-hexosaminidase assay from week post colonization with wild-type and 6-toxin mutant supernatants of MC/9 cells stimulated with indicated concen (Ahld)S. aureus or treated with PBS.**P<0.01: ***P<0.001, trations (ug ml–1) of unformylated 6-toxin (Ö-toxin) or con Kruskal-Wallis test with post-hoc Dunn's test for multiple trol peptide (right panel). (d) IL-8 secretion in cultured Super comparisons. c. Representative skin phenotype and histopa natant of human neutrophils stimulated by indicated thology of BALB/c mice colonized with S. aureus or treated concentrations (ug ml–1) of phenol-soluble modulins with PBS. Skin Sections were stained with H&E. Bar=100 (PSMs). Data represent meansits.d. of triplicate cultures. um. Inset shows high power image with neutrophil-rich Data are representative of three independent experiments. US 2016/003 1973 A1 Feb. 4, 2016
0036 FIG.8. a Stimulation of primary mouse macroph 0046 FIG. 18. MC degranulation activity of 6-toxin in ages and keratinocytes with PSMC2, but not 8-toxin, trig Supernatant from S. aureus and S. epidermidis. (a) Immuno gered robust cell death; b—mice colonized with wild-type S. blot analysis of culture Supernatants of S. aureus wild-type aureus developed greater amounts of serum IgE and the (LAC), 6-toxin deletion (LAC Ahld), S. epidermidis wild cytokine IL-4 than mice inoculated with the 6-toxin mutant type (1457) and 8-toxin deletion (1457 Ahld)(0.25 ul per bacterium. well). (b) f-hexosaminidase from MC/9 cells stimulated by 0037 FIG. 9. Supernatant from S. epidermidis, a bacte medium alone (Control), culture Supernatants of S. aureus rium present in normal skin, possessed weak MC degranula wild-type (LAC), 8-toxin deletion (LAC Ahld), S. epidermi tion, which correlated with smaller amounts of 6-toxin, when dis wild-type (1457) and 8-toxin deletion (1457 Ahld). Data compared to that from S. aureus Strains, but the deficiency of represent meansits.d of triplicate cultures. *P<0.05, *P<0. Ö-toxin had a larger effect on MC degranulation in S. aureus 01, ***P<0.001, two-tailed Student's t-test. Data are repre than in S. epidermidis. sentative of three independent experiments. 0038 FIG. 10. the culture supernatant from the 6-toxin 0047 FIG. 19. 6-toxin in S. aureus culture supernatant positive LAC strain induced leaking of Evans blue dye induces MC degranulation in vivo. (a) C57BL6 mice were whereas that from 8-toxin-negative LACAhld and SA113 injected intradermally into the left and right ears with 40% S. strains did not. aureus culture supernatant from LAC wt, LAC Ahld and 0039 FIG. 11. a, Delta-C antibody has an EC50 of SA113 or 40% TSB (as control). Culture supernatants were approximately 86, meaning that at a dilution of 1:86, the diluted by PBS. Three representative mice for each group are affinity purified antibody inhibits 50% of the hexosaminidase shown. (b) Quantification of Evans blue extracted from skin production, as determined by plotting using 4-parameterlin tissue of C57BL6 mice is shown. Dots represent individual ear regression. b. Data characterizing the graph is presented. ear Samples pooled from three independent experiments. 0040 FIG. 12. a, b pre-treatment of MCs with WRW4, a **P<0.01, ***P<0.001, Kruskal-Wallis test. Bars represent selective peptide antagonist of formyl peptide receptor-like 1 the means. (FPRL1) that blocks human neutrophil activation induced by 0048 FIG. 20. Mouse Fpr gene expression. Expression of 6-toxin in vitro, inhibited MC degranulation induced by mouse Fpr genes in BMCMCs, MC/9 and bone marrow neu 6-toxin both in vitro and in vivo; c. Cyclosporin H, an trophils. Expression is normalized to that of Gapdh. Data antagonist of human FPR1, also partially inhibited mouse represent meansits.d. of triplicate cultures. Data are represen MC degranulation induced by 8-toxin. tative of two independent experiments. 0049 FIG. 21. MC degranulation activity induced by 0041 FIG.13. a S. aureus isolates from the lesional skin Ö-toxin is inhibited by FPRantagonists. (a)MC degranulation of AD patients were assayed for 6-toxin expression, and all activity (B-hexosaminidase assay) of supernatants of MC/9 Supernatants from 26 S. aureus strains isolated from the cells pretreated with WRW4 peptide and then stimulated with lesional skin of AD patients produced 8-toxin; b, c RNAIII Ö-toxin (10 ug ml–1). (b) Quantification of Evans blue expression was detected in lesional skin colonized with S. extracted from skin tissue of C57BL6 mice is shown. Mice aureus, but not normal skin, of AD patients. were pretreated with or without WRW4 peptides (100 uM). 0042 FIG. 14. Expression of hld was detected in the skin One hour later, mice were injected intradermally into the ears on day 4 after wild-type S. aureus colonization using a biolu with 40% culture supernatant from S. aureus. Dots represent minescent reporter S. aureus strain. individual ear Samples. (c) B-hexosaminidase assay of Super 0043 FIG. 15. Complementation of the Ahld mutant with natants of MC/9 cells pretreated with FPR1 antagonist (Cy a plasmid producing 6-toxin restored the disease score to closporin H) and then stimulated with 8-toxin (10 ug ml–1). levels comparable to the wild-type bacterium. Data represent meansits.d. of triplicate cultures. In a,c, 0044 FIG.16. Amount of 6-toxin in S. aureus supernatant. **P<0.01, ***P<0.001, two-tailed Student's t-test. In b, NS: (a) MC degranulation activity of supernatants of MC/9 cells not significant, **P<0.01, Kruskal-Wallis test. Bars represent stimulated with 2% of culture Supernatant of S. aureus Strains. the means. Data are representative of three independent Data represent meansitS.d. of triplicate cultures. NS: not sig experiments. nificant, *P<0.05: ***P<0.001, two-tailed Student's t-test. 0050 FIG. 22. Fpr2 is dispensable for MC degranulation (b) Ö-toxin expressions offiltered Supernatants from S. aureus activity induced by 8-toxin. (a) MC degranulation activity strains (SA113, LAC and 8325-4) detected by RP-HPLC/ (3-hexosaminidase assay) in Supernatants of MC/9 cells ESI-MS. ND; not detected. Bars represent the means. (c) treated with indicated concentration of FPR2 agonists Ö-toxin expression in Supernatants from S. aureus wild-type (MMK1, Lipoxin.A4). (b) MC degranulation activity of (LAC (pTx A 16)), 6-toxin deletion (LAC Ahld (pTx A 16)) supernatants of MC/9 cells pretreated with pertussis toxin and complemented strain (LAC Ahld (pTx Ahld)), detected (PTX; 100 ng ml-1 and 200 ng ml–1) overnight and then by extracted ion chromatograms. Chromatography was per stimulated with indicated concentrations of 6-toxin (ug formed as described previously". Data are representative of ml-1). (c) 3-hexosaminidase assay of Supernatants of BMC three independent experiments. MCs from WT and Fpr2 mice stimulated with 8-toxin (10 0045 FIG. 17. Cell toxicity of 8-toxin. BMCMCs, BMMp ug ml–1). Data represent meansitS.d. of triplicate cultures. In (bone marrow derived macrophages), bone marrow neutro b. *P<0.05, **P<0.01, two-tailed Student's t-test. Data are phils and primary keratinocytes isolated from mice were representative of three independent experiments. stimulated with PSMC. (10 ug ml–1) or 6-toxin (10 or 100 ug 0051 FIG. 23. S. aureus RNAIII is expressed in the ml-1) for indicated times. Cell toxicity was measured by lesional skin of human atopic dermatitis patients. (a) Immu LDH assay. Data represent meansitS.d. of triplicate cultures. noblot analysis of culture Supernatants of 26 S. aureus strains NS: not significant, ***P<0.001, one-way ANOVA with (0.25 ul per well) that were isolated from the skin of atopic Tukey's post-hoc test for multiple comparisons. Data are dermatitis skin lesions. Indicated amounts of synthetic representative of two independent experiments. Ö-toxin were also loaded as controls. All isolates were methi US 2016/003 1973 A1 Feb. 4, 2016
cillin-sensitive S. aureus except No. 23, which was commu meants.e.m. (b) Skin disease score in C57BL6 mice at 1 nity-associated methicillin-resistant S. aureus. Data are rep week. (c) Serum levels of IgE in C57BL6 mice at 1 week. resentative of at least two independent experiments. (b) S. *P<0.05, Mann-Whitney test. Bars represent the means. Dots aureus RNAIII expression in AD skin obtained from lesional represent individual mice. Data are representative of at least and non-lesional skin. Expression was normalized to the S. two independent experiments. aureus housekeeping gene, gyrB. LAC wt and LAC Aagr 0057 FIG. 29. S. aureus colonization after OVA adminis cultured 24 hours are shown as reference controls. (c) Expres tration does not induce OVA-IgE. (a) BALB/c mice were sion of S. aureus gyrB was normalized to bacterial 16S rRNA. exposed epicutaneously with 10 CFU.S. aureus (LAC wt and Samples that were negative for gyrB expression were also LAC Ahld) and 100 ug OVA at the same time using a gauze negative for RNAIII. ND; not detected. NS: not significant, patch for 1 week. Sera were collected at 1 week. (b) 100 g **P<0.01, Wilcoxon test. Dots represent individual patient OVA was given epicutaneously using a gauze patch for 1 samples. Bars represent the means. Data are representative of week. After 1 week interval, BALB/c mice were exposed to three independent experiments. 10 CFU.S. aureus (LAC wt and LAC Ahld) for 1 week. Sera 0052 FIG. 24.8-toxin gene expression in vivo. (a) 8-toxin were collected at 3 weeks. Serum IgE levels were measured gene expression of LAC P3-lux strain in TSB culture. P3-lux by ELISA. NS: no significant, Kruskal-Wallis test. Bars rep expression and bacterial concentration (Optical Density 600; resent the means. Data are representative of two independent OD600) were measured by LMax luminometer (Molecular experiments. Device). (b) Representative expression of S. aureus 6-toxin 0.058 FIG. 30. Synthetic 6-toxin enhances allergic skin RNA 4 days after S. aureus colonization. Expression was disease. (a) OVA sensitization protocol with or without detected by bioluminescence of S. aureus LAC wt and LAC Ö-toxin. BALB/c mice were sensitized epicutaneously with P3-lux strains on a color Scale overlaid on top of a grayscale OVA (100 ug) with or without synthetic 6-toxin (100 g) for image of mice. (c) Luminescence expression and the number 1 week. After 2 week interval, mice were challenged with of S. aureus in the skin of infected mice. Dot line represents OVA (100 g) with or without synthetic 6-toxin (100 g) at the background level of luminescence. Data represent the same skin site. (b) Representative skin phenotype (top means--S.e.m. (day 1, n=5 mice, day 4 and 7; 4 mice pooled panels) and histopathology (bottom panels) of mice. Notice from 3 independent experiments.). white scaly areas as well as thickened epidermis and dermal 0053 FIG. 25. 6-toxin-complemented S. aureus strain inflammatory infiltrate in the skin of mice challenged with induces skin inflammation. (a) Representative skin pheno OVA plus 6-toxin. Skin sections were stained with H&E type and histopathology of BALB/c mice colonized with S. (HE). Bar 200 um. (c) Skin disease score at 1 week and 4 aureus wild-type (LACpTx A 16), 6-toxin mutant (LACAhld weeks. Kruskal-Wallis test. (d-f) Serum levels of OVA spe pTx A 16), 6-toxin-complemented strain (LACAhld pTx A cific IgE (d), IgG1(e) and IgG2a (f) in BALB/c sensitized hild), or treated with PBS. (b) Skin disease score at 1 week with OVA with or without 6-toxin at 1 week and 3 weeks. post-colonization with S. aureus or treated with PBS. Dots Dots represent individual mice. NS: no significant, *P<0.05, represent individual mice pooled from two independent **P<0.01, ***P<0.001, Kruskal-Wallis test. Bars represent experiments. *P<0.05: ***P<0.001, Kruskal-Wallis test. the means. Data are representative of two independent experi 0054 FIG. 26. The number of bacteria and IL-4 levels in mentS. skin colonized with S. aureus. (a and b) Number of culturable 0059 FIG. 31. Staphyloccocus 8-toxin promotes IgE pro bacteria and S. aureus in the skin of BALB/c mice 1 week duction and inflammatory skin disease via mast cells. (a) The post-inoculation with S. aureus. Results are meants.e.m. number of cutaneous MCs detected by toluidine blue stain (n=5). (a) Swabbed samples were plated on TSB and Baird ing. Five low power fields (lpf) were counted. A dot repre Parker agar plates, and colonies were counted 48 hours later. sents the average of MCs per lpf from one mouse. Bars (b) Swabbed (surface) and skin homogenized (nonsurface) represent the means. The results were derived from two of the samples were plated on Baird-Parker agar plates, and colo pooled experiments. NS: no significant, *P<0.05, ***P<0. nies were counted 48 hours later. (c) IL-4 levels in skin of 001, Kruskal-Wallis test. (b) Representative skin histopathol Balb/c mice inoculated with or without S. aureus (S.a. wt or ogy of C57BL6 (B6), Kit'''' and MC-reconstituted S.a. Ahld) for 1 week. Dots represent individual mice. Ina, b, Kit'''' mice colonized with wild-type S. aureus (S.a. NS not significant, two-tailed Student's t-test. ND; not wt), 6-toxin deficient S. aureus (S.a. Ahld) or treated with detected. In c. NS not significant: *P<0.05, **P<0.01, PBS. Skin sections were stained with H&E (HE) and tolui Kruskal-Wallis test. Data are representative of at least two dine blue (TB). Left 2 files, Bar-100 um. Right 2 files shows independent experiments. high power images of degranulated MCs (yellow arrow heads 0055 FIG. 27. IgG production in BALB/c mice colonized indicate toluidine-positive granules outside MCs only found with S. aureus. Serum levels of IgG1 (a) and IgG2a (b) in in S.a. wtinoculated skin but not in S.a. Ahld). Bar=10um. (c) BALB/c mice colonized with S. aureus or treated with PBS at Number of culturable bacteria and S. aureus in skin of B6 and 1 week and 3 weeks post-colonization with S. aureus. Dots Kit''' mice 1 week post inoculation with S. aureus. represent individual mice. NS: not significant; *P<0.05, Results are meants.e.m (B6; n=8, Kit''': n=7). NS: no **P<0.01.***P<0.001, Kruskal-Wallis test. Bars represent significant, **P<0.01, ***P<0.001, two-tailed Student’s the means. Dots represent individual mice pooled from two t-test. Data are representative of at least two independent independent experiments. experiments. 0056 FIG. 28. Colonization of S. aureus without skin tape 0060 FIG. 32. The number of cutaneous MCs in the ear stripping induces inflammatory disease and IgE production. pina detected by toluidine blue staining. (a) Representative (a) Number of S. aureus in the total skin of C57BL6 mice ear histopathology of C57BL6 (B6), Kit'''' and MC colonized with S. aureus or treated with PBS at 1 week. reconstituted Kit''' mice. Skin sections were stained Samples were homogenized and plated on Baird-Parker agar with toluidine blue. Red arrow heads indicate toluidine-posi plates, and colonies were counted 48 hours later. Results are tive MCs. Bar 200 um. (b) Number of cutaneous MCs US 2016/003 1973 A1 Feb. 4, 2016 detected by toluidine blue staining. Dots represent different 0065. A compound of the disclosure specifically binds to high power fields (hpf) from 5 mice. Bars represent the Ö-toxin expressed by a Staphylococcus species. In various means. *P<0.05, ***P<0.001, Kruskal-Wallis test. Data are aspects the 6-toxin is expressed by S. aureus. S. aureus representative of three independent experiments. Ö-toxin is also known in the art as Ö-hemolysin and is a protein of 26 amino acids that contains 14 hydrophobic residues and DETAILED DESCRIPTION OF THE INVENTION a high percentage of nonionizable side chain amino acids. Full-length S. aureus 6-toxin is set out in SEQID NO: 1. 0061 The present disclosure demonstrates that culture Supernatants of Staphylococcus contain potent mast cell (MC) degranulation activity. Accordingly, the disclosure pro (SEQ ID NO: 1) vides materials and method for treating and/or preventing MAODIISTIGDLVKWIIDTVNKFTKK skin (or dermal) inflammation comprising the step of admin 0.066 Invarious aspects, compounds of the disclosure spe istering to an individual in need thereof a compound that cifically bind to fragments of the full length S. aureus 6-toxin, neutralizes Staphylococcal 8 toxin in an amount effective to Such as, amino terminal (N terminal) or carboxy terminal neutralize 6 toxin. (C-terminal) fragments. Examples, without limitation, of N 0062. As described herein, biochemical purification and terminal and C terminal peptide fragments are set out in SEQ mass spectrometry analysis identified 8-toxin as the MC ID NO: 2 and 3 respectively. degranulation-inducing factor produced by S. aureus. MC degranulation induced by Ö-toxin depended on phosphoi nositide 3-kinase (PI3K) and calcium (Ca2+) influx, but N terminal peptide Delta N unlike that mediated by IgE crosslinking, it did not require the (SEQ ID NO: 2) spleen tyrosine kinase (Syk). In addition, Ö-toxin promoted MAODIISTIGDLVKWIIDT antigen-independent IgE-induced MC degranulation. S. C terminal peptide Delta C aureus isolates recovered from lesional skin of AD patients (SEQ ID NO; 3) produce high amounts of 6-toxin. Importantly, skin coloniza IGDLWKWIIDTVNKFTKK tion with S. aureus, but not a mutant deficient in Ö-toxin, 0067 Binding to other S. aureus 8-toxin peptide frag promoted IgE and IL-4 production, as well as inflammatory ments is also contemplated, including internal peptide frag skin disease. Furthermore, enhancement of IgE production ments. As an example, but without limitation, an exemplary and dermatitis by 8-toxin was abrogated in Kit''''- internal S. aureus 6-toxin fragment is set out in SEQID NO: deficient mice, indicating that Ö-toxin promotes skin disease 4. through MCs. These studies identify 8-toxin as a potent inducer of MC degranulation and provide a mechanistic link between S. aureus colonization and allergic skin disease. The Internal peptide results disclosed herein are consistent with the host sensing S. (SEQ ID NO : 4) aureus through the detection of 6-toxin, leading to the pro IGDLWKWIIDT motion of innate and adaptive Th2 immune responses via MC 0068. In various embodiments, a compound of the disclo degranulation. The results presented herein using mouse Sure specifically binds to S. epidermidis Ö-toxin as set out in models indicate genetically that Ö-toxin promotes allergic SEQID NO; 5. immune responses and that strategies to inhibit 6-toxin are expected to be beneficial for the treatment of AD. 0063 As used herein, the terms “treating, and “treat (SEO ID NO; 5) ment' and the like generally mean obtaining a desired phar MAADIISTIGDLWKWIIDTWNKFKK macological or physiological effect. The effect may be pro 0069. In various embodiments, a compound of the disclo phylactic in terms of “preventing or “partially preventing a sure specifically binds S. epidermidis 8-toxin (SEQ ID NO: disease, symptom or condition thereof and/or may be thera 6), S. warneri (SEQ ID NO: 7), or S. intermedius (SEQ ID peutic in terms of a partial or complete cure of a disease, NO:8). condition, symptom or adverse effect attributed to the disor der. The term “treatment’ as used herein covers any treatment of a disorder in a mammal, particularly a human, and (SEQ ID NO : 6) includes: (a) preventing the disorder from occurring in a MAADIISTIGDLWKWIIDTWNKFKK subject which may be predisposed to the disorder but has not (SEO ID NO: 7) yet been diagnosed as having it; (b) inhibiting the disorder, MTADISTIGDFWKWILDTWKKETK i.e., arresting its development; or (c) relieving the disorder, i.e., causing regression of the disorder and/or its symptoms or (SEQ ID NO: 8) conditions. MAADIISTIWEFWKLIAETWAKFIK 0064. As used herein, the terms “peptide.” “polypeptide' 0070 Those of skill in the art will appreciate that the above and “protein each refers to a molecule comprising two or described full length sequences represent processed form of more amino acid residues joined to each other by peptide the proteins. Accordingly, the disclosure contemplate com bonds. These terms encompass, e.g., native and artificial pro pounds that will bind to and inhibit activity of unprocessed teins, protein fragments and polypeptide analogs (such as forms of each of these full length proteins. mutants, variants, and fusion proteins) of a protein sequence 0071 Those of ordinary skill will also appreciate that as well as post-translationally, or otherwise covalently or other Ö-toxin proteins are known in the art, and it is contem non-covalently, modified proteins. A peptide, polypeptide, or plated that compounds of the disclosure will bind and inhibit protein may be monomeric or polymeric. these protein as well. In particular, it is well understood that US 2016/003 1973 A1 Feb. 4, 2016
different strains of the same species of bacteria can express mining regions or CDRs. From N-terminus to C-terminus, the same 6-toxin protein albeit with one or more amino acid both light and heavy chains comprise the domains FR1, variations. Thus, in still other aspects, compounds of the CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of disclosure bind a peptide that is 85% or more identical, 86% amino acids to each domain is in accordance with the defini or more identical, 87% or more identical, 88% or more iden tions of Kabat et al. in Sequences of Proteins of Immunologi tical, 89% or more identical, 90% or more identical, 91% or cal Interest, 5" Ed., US Dept. of Health and Human Services, more identical, 92% or more identical, 93% or more identical, PHS, NIH, NIH Publication no. 91-3242, 1991. Other num 94% or more identical, 96% or more identical, 97% or more bering systems for the amino acids in immunoglobulin chains identical, 98% or more identical, 99% or more identical to any include IMGTR) (the international ImMunoGeneTics infor one of the 6-toxin proteins set out in SEQID NOs: 1, 2, 3, 4, mation system; Lefranc et al. Dev. Comp. Immunol. 29:185 5, 6, 7, or 8. 203; 2005) and AHo (Honegger and Pluckthun, J. Mol. Biol. 3.09(3):657-670; 2001). Compounds of the Disclosure 0077. An antibody “specifically binds' to an antigen if it 0072 Compounds for use in methods of the disclosure are binds to the antigen with a dissociation constant of 1 nano selected for the ability to specifically inhibit activity of molar or less. In various embodiments, the antibody is a 6-toxin. Compounds therefore neutralize the ability of monoclonal antibody. In various embodiments, the antibody Ö-toxin to stimulate mast cell de-granulation. Compounds is part of a mixture of antibodies in polyclonal antisera. In provided neutralize 6-toxin by specifically binding 8-toxin, various embodiments, the antibody is selected from poly specifically binding to mast cell receptors through which clonal antisera. Selection of an antibody from polyclonal Ö-toxin acts on mast cells, inhibit transcription of 6-toxin, antisera is routinely practiced in the art through, for example, inhibit translation of 6-toxin or inhibit cell surface expression immobilization of the antigen and selectively washing the of 6-toxin. Compounds neutralize 8-toxin either directly or antibody from the antigen. indirectly. Examples of compounds of the disclosure include, (0078 Binding Peptides but are not limited to, antibodies, binding peptides, and 0079 Binding peptides are compounds that, like antibod inhibitory polynucleotides. ies, specifically bind to a 6-toxin antigen. A binding peptide 0073 Antibodies “specifically binds' to an antigen if it binds to the target with 0074 An “antibody” refers to an intact immunoglobulin a dissociation constant of 1 nanomolar or less. or to an antigen binding portion thereof that competes with 0080 Binding peptides are available from a number of the intact antibody for specific binding, unless otherwise sources or can be generated, as described below. specified. Antigen binding portions are, in various embodi I0081 Libraries of peptides are commercially available ments, produced by recombinant DNA techniques or by from, for example and without limitation, PolyPeptide Labo enzymatic or chemical cleavage of intact antibodies. Antigen ratories SAS (Strasbourg, France) and JPT Peptide Technolo binding portions include, inter alia, Fab, Fab', F(ab'). Fv, gies GmbH (Berlin, Germany)). Binding peptides are also domain antibodies (dAbs), and complementarity determining amenable to chemical synthesis. Selected peptides are Sub region (CDR) fragments, variable region fragments, single jected to peptide optimization using a microarray-based chain antibodies (scFv), chimeric antibodies, diabodies, tria analysis to identify peptides retaining 6-toxin affinity. Pep bodies, tetrabodies, and polypeptides that contain at least a tides include those comprising all naturally occurring amino portion of an immunoglobulin that is sufficient to confer acids, all non-naturally occurring (non-conventional) amino specific antigen binding to the polypeptide. acids or mixtures of naturally occurring and non-naturally 0075 An “immunoglobulin' is a multimeric molecule. In occurring amino acids. a naturally occurring immunoglobulin, each multimeriscom I0082) Non-naturally occurring amino acids include posed of two identical pairs of polypeptide chains, each pair 2-aminobutyric acid (Abu); 2-Amino-isobutyric acid (Aib); having one “light” (about 25 kDa) and one “heavy chain B-Alanine (Bal); B-Homoglutamatic acid (Bhe); B-Ho (about 50-70 kDa). The amino-terminal portion of each chain mophenylalanine (Bhf); B-Homolysine (Bhk); B-Homoleu includes a variable region of about 100 to 110 or more amino cine (BM); B-Homoasparagine (Bhn); B-Homoglutamine acids primarily responsible for antigen recognition. The car (Bhq); B-Homoarginine (Bhr); B-Homoserine (Bhs); B-Ho boxy-terminal portion of each chain defines a constant region motyrosine (Bhy); B-Homoaspartic acid (Bhd); B-Homova primarily responsible for effector function. Human light line (Bhv, Btl); B-Homoasparagin (Bhn, Btd): (S)-Cyclo chains are classified as kappa or lambda light chains. Heavy hexylalanine (Cha): (S)-Citrullin (Cit): (S)-2,4- chains are classified as mu, delta, gamma, alpha, or epsilon, Diaminobutyric acid (Dab); (S)-Diaminopropionic acid and define the antibody's isotype as IgM, Ig|D, IgG, IgA, and (Dap), (S)-2-Propargylglycine (Eag): (S)-N(omega)-nitro IgE, respectively. Within light and heavy chains, the variable arginine (Eew); L-homophenylalanine (Hfe): (S)-Homo and constant regions are joined by a “J” region of about 12 or arginine (Har): (S)-Homo-citrulline (Hei): (S)-Homo-cys more amino acids, with the heavy chain also including a "D" teine (Hey): (S)-2-Amino-5-methyl-hexanoic acid (Hle): (S)- region of about 10 more amino acids. See generally, Funda Homo-lysine (Hly): (S)-Norleucine (Nle): (S)-N- mental Immunology Ch. 7 (Paul, W., ed., 2nded. Raven Press, Methylalanine (Nma): (S)-N-Methyl-Aspartic acid (Nmd); N.Y. (1989)) (incorporated by reference in its entirety for all (S)-N-Methyl-glutamic acid (Nme): (S)-N-Methyl-phenyla purposes). The variable regions of each light/heavy chain pair lanine (Nmf); N-Methyl-glycine (Nmg): (S)-N-Methyl form the antibody binding site Such that an intact immuno lysine (Nmk): (S)-N-Methyl-leucine (Nml): (S)-N-Methyl globulin has two binding sites. arginine (Nimr): (S)-N-Methyl-serine (Nms): (S)-N-Methyl 0076. The variable regions of naturally occurring immu valine (Nmv): (S)-N-Methyl-tyrosine (Nmy): (S)-2-Amino noglobulin chains exhibit the same general structure of rela pentanoic acid (Nva): (S)-2-Pyridyl-alanine (Opa): (S)- tively conserved framework regions (FR) joined by three Ornithine (Orn); L-phenylglycin (Phg): 4-Phenyl-butyric hyperVariable regions, also called complementarity deter acid (PhPrCO); Polyethylene glycol (PEG); Selenomethion US 2016/003 1973 A1 Feb. 4, 2016
ine (Sem); 1.2.3,4-L-tetrahydroisoquinolinecarboxylic acid in length, about 5 to about 31 nucleotides in length, about 5 to (Tic); (13-Amino-4,7,10-trioxa-tridecayl)-succinamic acid about 29 nucleotides in length, about 5 to about 28 nucle (Ttds) and Carboxyfluorescein (FAM). otides in length, about 5 to about 27 nucleotides in length, 0083 Inhibitory Oligonucleotides about 5 to about 26 nucleotides in length, about 5 to about 25 0084. Inhibitory oligonucleotides neutralize 6-toxin gen nucleotides in length, about 5 to about 24 nucleotides in erally by inhibiting expression of the peptide in the host. length about 5 to about 23 nucleotides in length, about 5 to Given that the amino acid sequences for 6-toxins are known in about 22 nucleotides in length, about 5 to about 21 nucle the art, the worker of ordinary skill will appreciate that every otides in length, about 5 to about 20 nucleotides in length, possible inhibitory oligonucleotide can readily be envisioned, about 5 to about 19 nucleotides in length, about 5 to about 18 produced and utilized. Oligonucleotides contemplated by the nucleotides in length, about 5 to about 17 nucleotides in present disclosure include DNA, RNA and modified forms length, about 5 to about 16 nucleotides in length about 5 to thereof, as defined herein. An "oligonucleotide' is under about 15 nucleotides in length, about 5 to about 14 nucle stood in the art to be an oligomer comprising individual otides in length, about 5 to about 13 nucleotides in length, nucleotide subunits. Oligonucleotides include those com about 5 to about 12 nucleotides in length, about 5 to about 11 prised of all naturally occurring nucleotides, those with modi nucleotides in length, about 5 to about 10 nucleotides in fied nucleotides, and those with a combination of both. As is length, about 5 to about 9 nucleotides in length, about 5 to known in the art, the naturally occurring nucleobases are about 8 nucleotides in length about 5 to about 7 nucleotides in adenine (A), guanine (G), cytosine (C), thymine (T) and length, or about 5 to about 6 nucleotides in length. Accord uracil (U). Non-naturally occurring nucleotides are also ingly, oligonucleotides of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, known in the art. See, Benner et al., U.S. Pat. No. 5,432,272 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, and Freier et al., Nucleic Acids Research, Vol. 25: pp. 4429 33,34,35,36, 37,38, 39, 40, 41, 42, 43,44, 45,46, 47, 48,49, 4443 (1997), EP 1 072 679, WO 97/12896, U.S. Pat. No. 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, 3.687,808, The Concise Encyclopedia Of Polymer Science 67, 68, 69, 70, 71, 72,73, 74, 75, 76, 77, or 78 nucleotides in And Engineering, pages 858-859, Kroschwitz, J. I., ed. John length are contemplated. Wiley & Sons, 1990; Englisch et al., 1991, Angewandte Che mie, International Edition, 30: 613, and Sanghvi, Y. S., Chap Pharmaceutical Compositions ter 15, Antisense Research and Applications, pages 289-302, I0086. In another aspect, the disclosure provides a pharma Crooke, S.T. and Lebleu, B., ed., CRC Press, 1993. ceutical composition comprising the compound as described I0085 Oligonucleotides that specifically hybridize to a herein and one or more substances selected from the group Ö-toxin-encoding polynucleotide are generally from about 5 consisting of a buffer, an antioxidant Such as ascorbic acid, a nucleotides to about 78 nucleotides in length. More specifi low molecular weight polypeptide (such as those having cally, oligonucleotides that are about 5 to about 77 nucle fewer than 10 amino acids), a protein, an amino acid, a car otides in length, about 5 to about 76 nucleotides in length, bohydrate such as glucose, Sucrose or a dextrin, a chelating about 5 to about 75 nucleotides in length, about 5 to about 74 agent Such as EDTA, glutathione, a stabilizer, and an excipi nucleotides in length, about 5 to about 73 nucleotides in ent. In accordance with appropriate industry standards, pre length about 5 to about 72 nucleotides in length, about 5 to servatives are also added. In various aspects, the formulation about 71 nucleotides in length, about 5 to about 70 nucle of the pharmaceutical composition includes any Suitable otides in length, about 5 to about 69 nucleotides in length, components that are non-toxic to recipients at the dosages and about 5 to about 68 nucleotides in length, about 5 to about 67 concentrations employed. Accordingly, the composition is, in nucleotides in length, about 5 to about 66 nucleotides in various aspects, formulated with appropriate excipient solu length, about 5 to about 65 nucleotides in length about 5 to tions as diluents, and/or vehicles such as cocoa butter, carbo about 64 nucleotides in length, about 5 to about 63 nucle waxes and polyethylene glycols. Additionally, the compound otides in length, about 5 to about 62 nucleotides in length, is formulated, in various aspects, as powders, granules, oint about 5 to about 61 nucleotides in length, about 5 to about 60 ments, solutions, Suspensions, gels, microspheres, and aero nucleotides in length, about 5 to about 59 nucleotides in Sols. Further examples of components that may be employed length, about 5 to about 58 nucleotides in length, about 5 to in pharmaceutical formulations are presented in Remington's about 57 nucleotides in length about 5 to about 56 nucleotides Pharmaceutical Sciences, 16" Ed. (1980) and 20" Ed. (2000), in length, about 5 to about 55 nucleotides in length, about 5 to Mack Publishing Company, Easton, Pa. about 54 nucleotides in length, about 5 to about 53 nucle I0087. The pharmaceutical compositions is generally otides in length, about 5 to about 52 nucleotides in length, administered topically. Localized administration, e.g., at a about 5 to about 51 nucleotides in length, about 5 to about 50 site of inflammation, is contemplated, including transdermal nucleotides in length, about 5 to about 49 nucleotides in delivery and Sustained-release compositions. In various length about 5 to about 48 nucleotides in length, about 5 to embodiments, the compounds are formulated for topical about 47 nucleotides in length, about 5 to about 46 nucle administration by a variety of methods. An example of such a otides in length, about 5 to about 45 nucleotides in length, method includes encapsulating an appropriate amount of a about 5 to about 44 nucleotides in length, about 5 to about 43 compound in a vector selected from the group consisting of nucleotides in length, about 5 to about 42 nucleotides in macro-capsules, micro-capsules, nano-capsules, liposomes, length, about 5 to about 41 nucleotides in length about 5 to chylomicrons and microSponges. Another example of Such a about 40 nucleotides in length, about 5 to about 39 nucle method includes absorbing a compound on a material otides in length, about 5 to about 38 nucleotides in length, selected from the group consisting of powdered organic poly about 5 to about 37 nucleotides in length, about 5 to about 36 mers, talcs, bentonites, and other mineral Supports. Another nucleotides in length, about 5 to about 35 nucleotides in example includes mixing the compound with other ingredi length, about 5 to about 34 nucleotides in length, about 5 to ents selected from a group comprising extracted lipids, Veg about 33 nucleotides in length about 5 to about 32 nucleotides etable extracts, liposoluble active principles, hydrosoluble US 2016/003 1973 A1 Feb. 4, 2016 active principles, anhydrous gels, emulsifying polymers, ten dermatitis (AD, a type of eczema) is an inflammatory, relaps Sioactive polymers, synthetic lipids, gelling polymers, tissue ing, non-contagious and pruritic (itchy) skin disorder. It has extracts, marine extracts, Vitamin A, Vitamin C, Vitamin D, been given names like “prurigo Besnier.” “neurodermitis.” Vitamin E, solar filters, and antioxidants. Other examples of “endogenous eczema,” “flexural eczema,” “infantile suitable compositions are described, for example, in U.S. eczema,” and “prurigo diathésique.” De Benedetto, et al., The Patent Application Publication Number 2005/0249720. In Journal of Investigative Dermatology 129 (1): 14-30 (2009); various embodiments, the compounds are incorporated into a Abels, et al., Zeitschrift fur Dermatologie, Venerologie, and gelanic form, Such as oil/water emulsions and waterfoil emul verwandte Gebiete 57 (8): 711-725 (2006). Sions, milks, lotions, gelling agents and thickening agents, 0091. In various aspects, inflammation arises from, or is tensioactive and emulsifying polymers, pomades, lotions, perpetuated by, a defective dermal barrier. Decreased ceram capillaries, shampoos, Soaps, powders, Sticks and pencils, ides, the major water-retaining lipids of the stratum corneum, sprays, and body oils. Colloidal dispersion systems are also leads to increased trans-epidermal water loss (TEWL) and contemplated in various aspects as a delivery vehicle to contributes to dry cracked skin, predisposing to bacterial enhance the in vivo Stability of the compound and/or to target colonization. Alternatively, the pH of the skin surface in cer the compound to a particular location. Colloidal dispersion tain inflammatory indications is high or alkaline, creating a systems include, but are not limited to, macromolecule com Suitable environment for colonization. plexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions, micelles, mixed Combination Therapy micelles, liposomes and lipidipeptide complexes. An 0092 Methods of the disclosure include a combination example of a colloidal dispersion system is a plurality of therapy wherein a compound of the disclosure is adminis liposomes (see, generally, Chonnet al., Current Op. Biotech. tered with one or more additional therapeutic agents. Thera 6, 698-708 (1995)). Sustained-release dosage forms of the peutic agents include proteins that are expressed at lower than compounds are also contemplated. normal levels in instances of dermal inflammation, antibiot ics, anti-inflammatory agents and immunosuppressive Dosing and Administration agents. Each of these types of compounds are contemplated 0088. The precise amount of the compound administered for use with a compound of the disclosure along with com to a subject is not critical, except that it should be a sufficient binations of these agents with a compound of the disclosure. amount to effect improvement of the inflammatory condition. (0093. Therapeutic Proteins Dosing is dependent on a number of factors, including sever 0094. In various embodiments, the additional therapeutic ity and responsiveness of the condition to be treated, and with compound is a protein that is involved in maintenance of the the course of treatment lasting from several days to several skin barrier (filaggrin-2, corneodesmosin, desmoglein-1, des months, or until improvement of a condition is effected or a mocollin-1, and transglutaminase-3) and generation of natu diminution of a symptom is achieved. By way of example, in ral moisturizing factor (arginase-1, caspase-14, and gamma various embodiments compounds are administered to achieve glutamylcyclotransferase) which is expressed at lower levels from about 0.01 micrograms per milliliter (ug/mL) to about in dermal inflammation. Lower expression of skin barrier 10 milligrams per milliliter, from about 0.1 g/mL to about proteins and enzymes involved in the generation of the natural 500 ug/mL, from about 0.1 g/mL to about 1500 ug/mL, from moisturizing factor could further exacerbate barrier defects about 1 g/mL to about 2000 ug/mL, and from about 0.1 and perpetuate water loss from the skin. ug/mL to about 5000 ug/mL, including any range within these 0.095 Antibiotics ranges, final concentrations at a target site. Compositions that 0096 Methods of the disclosure contemplate combination include the peptide or analog in a concentration in one or therapy with a compound of the disclosure with one or more more of these ranges are appropriate. Similarly, appropriate antibiotics. Antibiotics contemplated for combination dosage values can be estimated based on the experimental therapy include the general classes of beta-lactams, carbap data provided herein. enems, penicillins, cephalosporins, macrollides, fluoroquino 0089 Guidance as to particular dosages and methods of lones, Sulfonamides, tetracyclines, aminoglycosides, quino delivery is provided in the literature and generally available to lones, oxazolidinones, ansamycins, glycopeptides, practitioners in the art. Those skilled in the art will employ lincosamides, lipopeptide, monobactams, nitrofurans, different formulations for nucleotides than for proteins or polypeptides, cyclic lipopeptides, glycylcyclines, and lipiar their inhibitors. Persons of ordinary skill in the art can easily mycins. More generally, these compounds are described by estimate repetition rates for dosing based on measured resi their mode of action, including those that target the bacterial dence times and concentrations of the drug in bodily fluids or cell wall (penicillins and cephalosporins), or those that target tissues. Following Successful treatment, it can be desirable to the cell membrane (polymixins). Those compounds that have the patient undergo maintenance therapy to prevent the interfere with essential bacterial enzymes (rifamycins, lipiar recurrence of the disease state, wherein a selected compound mycins, quinolones, and Sulfonamides) are generally bacte is administered in maintenance doses. ricidal, those that target protein synthesis (aminoglycosides, macrollides, and tetracyclines) are usually bacteriostatic. Dermal Inflammation 0097 Specific antibiotic compounds contemplated include penicillin, amoxicillin, cephalexin, clarithromycin, 0090. In various aspects, dermal inflammation targeted by erythromycin, clarithromycin, azithromycin, ciprofloxacin, methods of the disclosure arises from Ö-toxin interaction with levofloxacin, ofloxacin, co-trimoxazole, trimethoprim, tetra mast cells. The action of 6-toxin is director indirect. Interac cycline, doxycycline, gentamicin amplicillin, rifampin, nor tion with mast cells generally leads to degranulation of the floxacin, furazolidone, silver Sulfadiazine, tigecycline, dap cells and an inflammatory response. In various aspects, the Sone, cefoperaZone, prontosil, gemifloxacin, hydrocortisone/ inflammatory response manifests as atopic dermatitis. Atopic acetic acid, enoxacin, Sulfisoxazole, Sulfadimidine, US 2016/003 1973 A1 Feb. 4, 2016
Sulfapyridine, Sulfamerazine, grepafloxacin, Sulfalene, Sul Infect Immun 67, 1045-1049 (1999). S. aureus strains SA113 famethoxypyridazine, Sulfaphenazole, Sulfabenzamide, Sul and Newman, and isogenic mutants deficient in lipoprotein famoxole, Sulfametrole, Sulfametoxydiazine, Sulfaperin, Sul diacylglyceryl transferase (Algt) have also been previously fathiourea, Sulfametomidine, daptomycin, tigecycline, described in Stoll, et al., Infect Immun 73,2411-2423 (2005). lineZolid, fidaxomicin, dicloxacillin, oxacillin, metronida S. aureus strains LAC and MW2, their isogenic 8-toxin Zole, mupirocin, or fusidic acid. mutants (Ahld), the psm gene deleted mutants (ApSimC. 0098 Anti-Inflammatories ApSimB), and LAC agr mutant (Aagr) have been described in 0099 Combination therapy according to the disclosure Wang et al., Nat Med 13, 1510-1514 (2007). The Agrquorum also contemplates use of a compound of the disclosure in combination with one or more anti-inflammatory agents, sensing system of S. aureus controls the expression of Viru including steroids, non-steroidal anti-inflammatory drugs lence factors in response to autoinducing peptides (AIPs). (NSAIDS) and immune selective anti-inflammatory deriva The isogenic Ahld mutant of S. epidermidis 1457, a clinical tives (ImSAIDs). Specific anti-inflammatory compounds isolate” was produced by an allelic replacement procedure'. include hydrocortisone, methylprednisolone, nimeSulide, This was done in a way analogous to the S. aureus Ahld naproxen, rilonacept, diclofenac-i-misoprostol, Sulfasalazine, mutants used herein, abolishing translation by exchanging the betamethasone, Valdecoxib, aspirin, diclofenac, mesalamine, third base in the hld start codon from ATG to ATA (to avoid Sulindac, balsalazide, cortisone, oxaprozin, prednisone, dex interfering with the function of RNAIII). LAC P3-lux was amethasone, olSalazine, magnesium salicylate, diflunisal, constructed by integration of the S. aureus LAC agr P3 pro budesonide, diclofenac epolamine, balsalazide disodium, moter fused to the luxABCDE genes with codon usage opti canakinumab, mesalamine, etodolac, loteprednol, nime mized for staphylococci’ into the d11 attB site of the S. Sulide, fenoprofen, diclofenac sodium, meclofenamate, aureus genome, using a procedure described by Luong and mefenamic acid, lumiracoxib, triamcinolone acetonide, Lee’. Plasmid pTXAhld was constructed by cloning the hld acetonide, rimexolone, diclofenac potassium, aspirin, ibupro coding sequence containing the ribosomal binding site region fen, naproxen, corticosteroids, and acetaminophen. in the BamH1/Mlul sites of plasmid pTXA'. The hld gene 0100 Immunosuppressives was amplified from the genomic DNA of the respective strain, 0101 Combination therapy also contemplates use of a because the 6-toxin sequence differs in one amino acid in compound of the disclosure with one or more immunosup position 10 (serine or glycine) in these two strains. The pressive agents. Immunosuppressive agents include, for Ö-toxin is constitutively expressed in these plasmids. See example and without limitation, azathioprine, 6-mercaptopu Table 1 for all oligonucleotides used in generation of the rine, methotrexate, tacrolimus, cyclosporine, antistaphylo strains. Clinical isolates of S. aureus from children diagnosed coccal, macrollide antibiotics (and clarithromycin), and peni with AD were obtained originally from the Department of cillinase-resistant penicillin. Laboratory Medicine and Pathobiology at University of Tor 0102 The following examples are given merely to illus onto, as described in Yeung, et al., Microbes Infect 13, 189 trate aspects of the disclosure and not in any way to limit its 197 (2011). S. epidermidis (NI335), S. cohnii (NI446), S. Scope. saprophyticus (NI488), S, xylosus (NI987), S. sciuri (NI981), S. succinus (NI534), S. lentus (NI487) and S. fleuretti (NI533) Example 1 were isolated by plating on BHI after culturing at 37° C. for 0103 Materials and methods utilized in experiments two days under aerobic conditions. Identification of bacterial described herein include the following. species was verified by 16S rRNA gene sequencing as described in Hasegawa, et al., J Biol Chem 281,29054-29063 Bacterial Strains (2006). Bacterial supernatants were produced by overnight 0104 S. aureus strain 8325-4 and its isogenic toxin mutant culture with shaking in tryptic soy broth (TSB) followed by (AC. BY) have been previously described in Nilsson, et al., filtration through a 0.2 um filter. TABL E 1.
Name Sequence (5'-3") ; Sequence Identifier Construction of pTXAhld
Delta Barn CTAGATCACAGAGATGTGATGGATCCTAGTTGATGAGTTG, SEQ ID NO : 16
Delta Mlul GTTGGGATGGCTTAATAACGCGTACTTTTAGTACTATACG, SEO ID NO : 17
Construction of S. epidermidis hld mutant
HLIDATT1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGTACTTCTGGTTC GTCAAAGTAAGAGGCACA; SEQ ID NO: 18
HLIDATT2 GGGGACCACTTTGTACAAGAAAGCTGGGTGGCACTTCTGGTTCG TCAAAGTAAGAAGCACA; SEQ ID NO: 19
CGAAAGGAGTGAAGTTATAATAGCAGCAGATATC; SEQ ID NO: 2O
GATATCTGCTGCTATTATAACTTCACTCCTTTCG, SEQ ID NO: 21 US 2016/003 1973 A1 Feb. 4, 2016
TABLE 1 - continued Name Sequence (5'-3") ; Sequence Identifier Integration of P3-lux in the S. aureus genome P3prEco CAATTTTACACCACTCTCCTCACTGGAATTCCATTATACG, SEQ ID NO: 22
P3prBam ATGCGGATCCCTCATCAACTATTTTCCATCACATCTCTGT SEO ID NO: 23
luxBamHI ATGCGGATCCTGCAGATGAAGCAAGAGGAG; SEQ ID NO: 24 luxSall ATGCGTCGACGCAGCGGTATTTTTCGATCA; SEO ID NO : 25 luxArvised AAGGCGCGACTGTTATTCAT, SEO ID NO: 26
Mice RNA. Isolation from Human Skin Samples 0.109 Wash fluid derived from lesional and normal skin of 0105 C57BL/6, C57BL/6-Kit W-sh/Kit W-sh (B6.CG AD patients was collected using a 2.5-cm-diameter polypro Kit W-sh/HNihrJaeBsm.J), and BALB/c mice were purchased pylene chamber as described in Travers et al., J. Allergy Clin. from Jackson Laboratories (Bar Harbor, Me...). Syk+/- mice Immunol. 125, 146-152e141-142 (2010). 100 ul of the of breeding age can be obtained by one of ordinary skill in the samples were mixed with an equal volume of RNAprotect art using conventional breeding techniques and/or recombi Bacteria Reagent (QIAGENR) and RNA extracted with Bac nant technology. For the experiments described herein, terial RNA Kit (OMEGAR). The human studies were Syk+/- mouse breeders were a gift of Dr. Steven Teitelbaum approved by the Indiana University Institutional Review (Washington University School of Medicine, St. Louis, Mo.) and Syk -/- embryos were generated by intercrossing. All Committee. Informed consent was obtained from all subjects. mouse strains were housed under pathogen-free conditions. Quantitative RealTime RT-PCR The animal studies were conducted under approved protocols 0110 cDNA was synthesized using High Capacity RNA by the University of Michigan Committee on Use and Care of to-cDNA Kit (Applied Biosystems), according to the manu Animals. facturer's instructions. Quantitative real time RT-PCR (qPCR) was performed using a SYBR green PCR master mix Synthetic Peptides (Applied Biosystems) and StepOne Real-time PCR system 0106. The synthetic peptides fBSMcc2 (fMGIIAGIIK (Applied Biosystems). Primers to amplify mouse Fpr genes VIKSLIEQFTGK: SEQ ID NO: 9), fPSMcc3 (fMGIIAGI (Riviere et al., Nature 459, 574-577 (2009) and bacterial IKFIKGLIEKFTGK: SEQID NO: 10), fö-toxin (fMAQDI genes (RNAIII, gyrB, 16S rRNA) (Seidl et al., Antimicrob. ISTIGDLVKWIIDTVNKFTKK; SEQ ID NO: 11), Agents Chemother. 55, 5631-5639 (2011) and Barman et al., (WRWWWW-CONH2: SEQ ID NO: 12) and MMK-1 Infect. Immun. 76, 907-915 (2008) have been described. (LESIFRSLLFRVM: SEQID NO: 13) were purchased from Expression of mouse Fpr genes was normalized to that of American Peptide. Unformylated 8-toxin (MAQDIIS Gapdh (F; 5-CCTCGTCCCGTAGACAAAATG-3 (SEQ ID TIGDLVKWIIDTVNKFTKK; SEQ ID NO: 1) was synthe NO:14), R;5-TCTCCACTTTGCCACCTGCAA-3 (SEQID sized at The University of Michigan Protein Structure Facil NO: 15)) and expression was analyzed by the 2^^ method. ity. Polyclonal anti-Ö-toxin antibody was produced in rabbits RNAIII expression in human skin Samples was normalized to by immunization with a synthetic multiple antigenic peptide that of S. aureus gyrB and that of gyrB to universal bacterial displaying an 18-amino-acid peptide (IGDLVKWIIDTVNK 16S rRNA and relative expression calculated by the 2^ FTKK; SEQIDNO:3) (Sigma-Genosys) from the full-length method. RNAIII and gyrB expression in some human skin 6-toxin sequence. Rabbit IgG was purified from rabbit serum samples were below the detection limit and were arbitrarily on Protein A (Pierce) according to the manufacturer's proto given a value of Zero for statistical analysis. LAC wt and LAC col. Aagricultured for 24 hours were used as reference controls. Measurement of P3-Lux Expression Skin Disease Score 0111 For determination of the levels of P3-lux expression 0107 The severity of skin lesions was scored according to in culture, 10 ml LACP3-lux strain was suspended in TSB defined macroscopic diagnostic criteria in a blind fashion’. and luminescence emitted from P3-lux-expressing bacteria Inbrief, the total clinical score of skin lesions was designated was measured using a LMax luminometer (Molecular as the sum of individual scores, graded as 0 (none), 1 (mild), Devices). For in vivo bioluminescence imaging (BLI), mice 2 (moderate), and 3 (severe) for thickness, erythema, edema, were sacrificed, the skin dressing removed and immediately erosion, and Scaling. placed into the light-tight chamber of the CCD camera system (IVIS200, Xenogen). Luminescence emitted from lux-ex Immunoglobulin Levels pressing bacteria in the tissue was quantified using the Soft ware program living image (Xenogen). 0108 Serum IgG1 and IgG2a were measured with an ELISAkit (Cayman chemical). Serum IgE was also measured Statistical Analysis with an ELISA kit (Bethyl Laboratories). An ELISA for 0112 All analyses were performed using GraphPad OVA-IgE was described in Nakajima et al., J. Allergy Clin. Prism. Differences were considered significant when p values Immunol. 129, 1048-1055 (2012). were less than 0.05. US 2016/003 1973 A1 Feb. 4, 2016
Example 2 Example 3 0113. In a first series of experiments, degranulation of I0121. In view of the results above, a process to purify a mast cells was measured in response to contact with various factor from S. aureus culture Supernatant that induced Staphylococcus strains. Degranulation was measured in cell degranulation was designed (FIG. 6b). culture as follows. 0.122 S. aureus was cultured in 700 ml chemical defined medium supplemented with 2% yeast extract (see Miller, R. 0114 Preparations of BMCMCs and fetal skin-derived D. & Fung, D.Y. Amino acid requirements for the production mast cells (FSMCs) were previously described in Yamada, et of enterotoxin B by Staphylococcus aureus S-6 in a chemi al., J Invest Dermatol 121, 1425-1432 (2003). The purity of cally defined medium, Miller et al., Appl Microbiol 25, 800 MCs was confirmed by surface expression of CD45 and 806 (1973).) Filtered culture supernatant was incubated with CD117 (eBioscience). carboxymethyl cellulose equilibrated with 10 mM sodium 0115 Degranulation of MCs was assessed by B-hex citrate (pH 5.5), and eluted with a linear gradient of 0-1 M osaminidase assay as previously described in Yamada, et al., NaCl. Fractions containing B-hexosaminidase activity were J Invest Dermatol 121, 1425-1432, (2003). Briefly, MCs collected and adjusted to pH 7.4, 100 mM HEPES. The (2x10 ml) were preloaded with or without anti-DNP IgE sample was concentrated using Amicon Ultra-15, 5 kDa filter (0.3 ug ml) in RPMI with IL-3 for 15 hours. The cells were (Millipore). The concentrated sample was further fraction resuspended in Tyrode's buffer (Sigma) at 2x10 cells per 100 ated with a Superdex 200 10/300 GL column (GE). Final ul for FSMCs or 1x10 cells per 100 ul for BMCMCs and positive fractions were pooled and concentrated using an MC/9 cells, aliquoted in triplicate into a 96-well U-bottom Amicon Ultra-15 filter (FIG.2c). plate and incubated with EGTA (1 mM, Sigma), LY294.002 0123 Liquid chromatography-mass spectrometry analy (100 uM, Sigma) and WRW4 (Trp-Arg-Trp-Trp-Trp-Trp sis was then utilized to more fully characterize the isolated CONH2 (SEQ ID NO: 12, 10 mM, American peptide) and protein. The purified sample was denatured in 8 M urea, Cyclosporine H (10 uM, Alexis Biochemicals) for 30 min, reduced by incubation with 10 mMDTT at 37° C. for 30 mM and then stimulated with DNP-HSA (30 ng ml) TNP-HSA and alkylated using 50 mMiodoacetamide at room tempera (30 nM) for 30 min, followed by exposure to lonomycin (1 ture for 30 minutes. The protein sample was digested with uM, Sigma) 8-toxin (indicated concentrations), PSMCs (indi sequencing grade trypsin (Promega) overnight at 37°C. The cated concentrations) or FPR2 ligands for 15 min. Results of reaction was terminated by acidification with trifluoroacetic various stimuli are given as a relative percentage, where acid (0.1% V/v) and peptides were purified using a SepPak freeze and thaw of total cell culture represents 100%. C18 cartridge following the manufacturer's protocol (Waters Corporation). Eluted peptides were directly introduced into 0116. A first experiment was designed to determine an ion-trap mass spectrometer (LTQ-XL. ThermoFisher) whether S. aureus can release factors that induce MC equipped with a nano-spray source. The mass spectrometer degranulation. Results showed that the culture Supernatant of was operated in data-dependent MS/MS mode to acquire a S. aureus induced rapid and robust degranulation of MCs in a full MS scan (400-2000 m/z) followed by MS/MS on the top dose-dependent manner (FIG. 1a, FIG. 5a and b). 6 ions from the full MS scan. Dynamic exclusion was set to 0117 Analysis of a panel of Staphylococcus isolates collect 2 MS/MS spectra on each ion and exclude it for a revealed that the culture supernatant of several S. aureus further 2 mM. Raw files were converted to m2XML format strains as well as of that from S. epidermidis and S. and searched against the S. aureus NCTC 8325 database Saprophyticus, but not of S. xylosus, S. Sciuri, S. cohnii, S. Supplemented with a decoy (reverse) database using X Tan succinus, S. lentus or S. fleuretti, elicited MC degranulation dem with k-score plug-in using an open-source search engine (FIG. 5c). developed by the Global Proteome Machine. The search 0118 TLR2 stimulation via lipopeptides has been shown parameters included a precursor peptide mass tolerance win by some studies, but not others, to induce MC degranulation. dow of 1 Da and fragment mass tolerance of 0.5 Da. Oxida See Supajatura, et al., J Clin Invest 109, 1351-1359 (2002); tion of methionine (+16 Da), and carbamidomethylation of Selander, et al., J. Immunol 182,4208-4216 (2009). However, cysteines (+57 Da) were considered as variable modifica neither the culture Supernatants of S. aureus deficient in lipo tions. The search was restricted to tryptic peptides with one proteins (Algt), which lacks TLR2-stimulating activity missed cleavage. Results of the X Tandem search were then (Schmaler, et al., JImmunol 182,7110-7118 (2009)), nor that subjected to Trans-Proteomic Pipeline (TPP) analysis, a suite from bacteria deficient in C-, 3-, and Y-hemolysins (ACBY) of software including PeptideProphet and ProteinProphet. All were impaired in MC degranulation activity (FIG. 1b, FIG. proteins with a ProteinProphet probability of >0.9 were con 5c, and FIG. 7c). sidered positive and verified manually. 0.124. The purified material revealed that 6-toxin (also 0119 Analysis revealed that MC degranulation activity called 8-hemolysin or Phenol-Soluble Modulin gamma was enriched in the culture supernatant of S. aureus (FIG. 6a) (PSMY)), a 2.9 kDa peptide secreted by S. aureus, was the and was present in the Supernatant of S. aureus grown in most abundant and significant protein identified in the puri defined chemical medium supplemented with 2% yeast fied sample (FIG. 6c). extract (FIG. 6a). 0.125 To confirm this result, the ability of the S. aureus 0120. The MC degranulation-inducing factor was sensi strains LAC and MW2 that express 8-toxin, and their isogenic tive to heat, phenol/chloroform extraction and protease K Ö-toxin-deficient strains (Ahld), to induce MC degranulation treatment, indicating that it was a protein (FIG. 6a). Further was assessed. Results showed that MC degranulation induced more, the MC degranulation-inducing factor bound to both by S. aureus culture Supernatant was completely dependent diethylaminoethyl and carboxymethyl cellulose matrices and on the expression of 6-toxin (FIG. 1b and FIG. 7a). was present in the void fraction on gel filtration at neutral pH 0.126 Mutant analyses in two S. aureus strains revealed (FIG. 6b). that MC degranulation induced by S. aureus culture Superna US 2016/003 1973 A1 Feb. 4, 2016 tant required expression of Ö-toxin whereas deficiency of keratinocytes with PSMC2, but not 8-toxin, triggered robust related PSMC. or PSMR peptides had minimal or no effect on cell death (FIG. 17). Thus, the MC degranulation activity MC degranulation (FIG. 1b and FIG. 16a). Importantly, induced by 8-toxin is not associated with cell death and is complementation of the Ahld mutant strain with 8-toxin pro different from other activities triggered by PSMC2 and ducing plasmid, but not control plasmid, restored the ability PSMC3 of the culture supernatant to induce MC degranulation (FIG. I0134. Immunoblotting antibody confirmed that the pres 1b and FIG. 16a). ence of 6-toxin in S. aureus supernatants correlated with MC degranulation activity (FIG.1e). Notably, supernatant from S. Example 4 epidermidis, a bacterium that is present in normal skin, pos sessed weak MC degranulation, which correlated with 0127. After 8-toxin stimulation, rapid release of hista smaller amounts of 6-toxin when compared to that from S. mine, another feature of MC degranulation, was observed aureus strains (FIG.1e and FIG. 18). Furthermore, deficiency (FIG.1c). Histamine concentration was measured in a culture of 6-toxin had a larger effect on MC degranulation in S. supernatant of fetal skin-derived MCs (FSMCs) after stimu aureus than in S. epidermidis (FIG. 18). lation with synthetic 8-toxin at 30 ug ml for 15 minutes. I0135) To assess whether 8-toxin induces MC degranula 0128. Furthermore, transmission electron microscopy tion in Vivo, Synthetic 6-toxin was injected into the skin of revealed classical features of MC degranulation without loss mouse ears and MC degranulation was monitored by the of plasma membrane integrity upon Ö-toxin stimulation (FIG. vascular leakage of Evan's blue dye into the extravascular 1d). These results indicated that 6-toxin is the MC degranu space using the passive cutaneous anaphylaxis (PCA) assay. lation-inducing factor released by S. aureus. 0.136 PCA assay was performed as previously described Example 5 with minor modifications in Wershil, et al., J. Clin Invest 87, 446-453 (1991). For bone marrow-derived cultured mast cell 0129. The gene for 8-toxin is embedded in the gene for the (BMCMC) reconstitution experiments, 10 BMCMCs in 40 regulatory RNA, i.e., RNAIII (Novick, R. P. etal. Synthesis of ul of PBS were injected into the ear skin of Kit'''' mice, staphylococcal virulence factors is controlled by a regulatory as described in Grimbaldeston et al., Am. J. Pathol. 167, RNA molecule. Novik, et al., EMBO J 12, 3967-3975 835-848 (2005). Four to six weeks later, the mice were sub (1993)). The RNAIII and PSM genes are regulated by AgrA jected to experimental PCA or epicutaneous S. aureus sensi (Queck, et al., Mol Cell 32, 150-158, (2008)). Because the tization. The reconstitution rate of cutaneous MCs was quan function of RNAIII and expression of PSMs are not affected tified blindly by an independent observer and scored as in the 6-toxin S. aureus mutants used in these studies (Wang, number of MCs per low power field in toluidine blue-stained et al., Nat Med 13, 1510-1514 (2007)), the results indicate that tissue slides by microscope. The average rate of reconstituted Ö-toxin is the major MC degranulation-inducing factor MCs was about 40% in the earpina and about 50% in the back released by S. aureus. skin (FIGS. 31 and 32). PCA assay was performed as 0130 PSMs, especially PSMC2 and PSMC3 induce cell described, with minor modifications. Ears of mice were death and IL-8 release in human neutrophils. (Wang et al., Nat injected intradermally with or without CDNP-IgE (clone Med 13, 1510-1514 (2007); Kretschmer, et al., Cell Host SPE-7, Sigma) in 40 ul saline and 15 hours later, mice were Microbe 7, 463-473 (2010)). Because 8-toxin is highly challenged with 20 ul saline with or without synthetic 6-toxin related to PSMC2 and PSMC3, the viability of MCs after (100 lug or 5 lug). After inoculation, 0.1 ml of 5 mg ml -1 stimulation with synthetic PSMC2, PSMC3, or 8-toxin, was Evans blue dye was injected intravenously. Extravasation of assessed. In accord with results in neutrophils (Wang, R. etal. Evans blue dye was monitored for 30 minutes, and 4 mm of Identification of novel cytolytic peptides as key virulence punched-out biopsies were incubated at 63° C. overnight in determinants for community-associated MRSA. Wang et al., 200 ul formamide. Quantitative analysis of extracts was Nat Med 13, 1510-1514 (2007)), PSMC2 and PSMC3 determined by measuring the absorbance at 600 nm. induced robust loss of cell viability in MCs (FIG. 7a). 0.137 Intradermal administration of 6-toxin induced 0131 Chemokines and cytokines released from cells were Evan's blue dye leaking at the site of injection in the ears of measured with enzyme-linked immunosorbent assay wild-type mice, but not in MC-deficient Kit''' mice (ELISA) kits (R&D Systems). For tissue cytokines, skin tis (FIGS. 1f and 1g). sue (5x10 mm area) was removed and homogenized. The 0.138. Importantly, reconstitution of the skin of Kit'' skin homogenates were centrifuged and Supernatants were sh mice with bone marrow-derived MCs (BMDMCs) restored collected for cytokine measurements by ELISA. leaking of the dye upon intradermal administration of 8-toxin 0132 Stimulation with 6-toxin did not induce detectable (FIG. 1g). Moreover, the culture supernatant from the 6-toxin cell death in MCs (FIG. 16a). Notably, formylation of the positive LAC strain induced leaking of Evans blue dye N-terminus of the 6-toxin peptide was not required for MC whereas that from 8-toxin-negative LACAhld and SA113 degranulation activity whereas it was essential for the ability strains did not (FIG. 19). These results indicate that 6-toxin of 6-toxin to induce the release of IL-8 from human neutro induces MC degranulation in vitro and in vivo. phils (FIGS. 16b and 16c). Non-toxic concentrations of I0139 8-toxin triggers Ca" influx through N-formyl pep PSMCs did not possess any MC-degranulation activity (FIG. tide receptor 2 (FPR2) in human neutrophils (Kretschmer, D. 7b). In contrast, stimulation with a concentration of 6-toxin et al. Human formyl peptide receptor 2 senses highly patho that induces robust MC degranulation did not induce detect genic Staphylococcus aureus. Kretschmer, et al., Cell Host able cell death in MCs (FIGS. 7a and 7c). Microbe 7,463-473 (2010)). Because Ca" influx is an essen 0.133 Consistent with previous results, stimulation of tial step in MC degranulation, the ability of 6-toxin to induce human neutrophils with formylated PSMC2, PSMC3 or Ca" influx in MCs was assessed. 6-toxin induced robust IL-8 release (FIG.16c and FIG. 7d). 0140. In brief, FSMCs (2x10 ml) were preloaded with Moreover, stimulation of primary mouse macrophages and or without anti-DNP-IgE (0.3 ug ml) in RPMI with IL-3 for US 2016/003 1973 A1 Feb. 4, 2016
15 hours. Cells were washed and loaded with Fluo-4AM (5 lation was monitored in vivo with the PCA assay. At these low uM, Life Technologies) for 30 minutes. Cells were washed concentrations, 6-toxin induced Evans blue dye leaking at the again and further incubated in Tyrode's buffer with or without site of injection in mice pretreated with anti DNP IgE (FIG. EGTA (1 mM) for 30 minutes. DNP-HSA (30 ng ml), 3b). Ionomycin (1 uM) or 8-toxin (30 ugml") were used to induce 0.148. These results indicate that IgE increases the MC calcium flux in these cells. Ca" flux was measured using a degranulation activity of 6-toxin in the absence of antigen. flow cytometer (FACSCalibur, BD Biosciences) to monitor RFU (relative fluorescence units) as described in Vig, et al. Example 6 Nat Immunol 9, 89-96 (2008). 0149. In view of the results above, an assay was designed 0141 Results showed that stimulation of MCs with iono to determine whether S. aureus isolates from the lesional skin mycin or DNP plus anti-DNPIgE induced rapid Ca2+ influx of AD patients express 6-toxin. Notably, all supernatants from (FIG. 2a). 26 S. aureus strains isolated from the lesional skin of AD I0142. Likewise, 8-toxin triggered Ca" influx and this was patients produced 8-toxin (FIG. 23a). Moreover, RNAIII abrogated by treatment with the Cachelator ethylene glycol expression was detected in lesional skin colonized with S. tetraacetic acid (EGTA) (FIG. 2a). EGTA also blocked MC aureus, but not normal skin, of AD patients (FIGS. 23b and degranulation induced by ionomycin, DNP plus anti-DNP 23c). IgE or Ö-toxin, indicating that MC degranulation induced by 0150. To test whether 8-toxin plays a role in allergic skin Ö-toxin is mediated through Ca" influx (FIG.2b). disease, a modified epicutaneous disease model was used in 0143 Similarly, MC degranulation induced by DNP plus which the skin of BALB/c mice previously colonized with anti-DNP IgE or 6-toxin was inhibited by the PI3 kinase wild-type or 6-toxin-deficient S. aureus was challenged once inhibitor, LY294.002, indicating that MC degranulation trig with ovalbumin (OVA) to assess antigen-specific IgE produc gered by Ö-toxin shares signaling events with those that are tion (FIG. 4a). This epicutaneous OVA sensitization model in elicited by IgE crosslinking (FIG. 2c). However, unlike the mice was carried out as previously described, with modifica MC degranulation triggered by antigen plus IgE, MC tions in Spergel, et al., J. Clin Invest 101, 1614-1622 (1998). degranulation induced by 8-toxin did not require Syk (FIG. 0151 Briefly, the dorsal skin of 6- to 8-week-old female 2d). Fprl, Fpr2 and related family members were expressed mice was shaved and stripped, three times, using a transparent in mouse MCs, although their expression was higher in neu bio-occlusive dressing (Tegaderm(R); 3M). After overnight trophils (FIG. 20). Notably, pre-treatment of MCs with culture at 37° C. with shaking, S. aureus were cultured in WRW4, a selective peptide antagonist of formyl peptide fresh TSB medium for 4 hours at 37°C. with shaking, washed receptor-like 1 (FPRL1) that blocks human neutrophil acti and resuspended in PBS at 10 CFU of S. aureus LAC or LAC vation induced by 8-toxin in vitro (Nielsen et al., Infect. (Ahld) Strains. 100 ul of the S. aureus Suspension was placed Immun. 67: 1045-1049 (1999)), inhibited MC degranulation onapatchofsterile gauze (1 cmx1 cm) and attached to shaved induced by 8-toxin both in vitro and in vivo (FIGS. 21a and skin with a transparent bio-occlusive dressing. Each mouse 21b). Cyclosporin H (CsH), an antagonist of human FPR1, was exposed to S. aureus for 1 week through the patch. One also partially inhibited mouse MC degranulation induced by week after colonization with wild-type S. aureus, the mice 8-toxin (FIG. 21c). However, human FPR2 ligands, MMK1 developed severely inflamed reddened skin at the site of and Lipoxin A4, did not induce mouse MC degranulation application (FIGS. 4b and 4c). Expression of hld was detected (FIG. 22a). Furthermore, treatment with pertussis toxin in the skin on day 4 after wild-type S. aureus colonization (PTX), an inhibitor of G-protein coupled receptors, partially using a bioluminescent reporter S. aureus strain (FIG. 24). reduced MC degranulation induced by 8-toxin (FIG. 22b). After a 2-week interval, each mouse was challenged once However, MCs from wild-type and Fpr2 mice exhibited with 100 lug ovalbumin (OVA, Grade V. Sigma) epicutane comparable MC degranulation induced by 8-toxin (FIG. ously for 1 week and the animals were sacrificed for analyses. 22c). For the OVA sensitization model, BALB/c mice were sensi 0144 Collectively, these results indicate that 8-toxin tized epicutaneously with OVA (100 g) with or without induces MC degranulation via a signaling pathway that is synthetic 6-toxin (100 g) at the same skin site. different from that used by antigen and IgE. 0152 For histological analysis, skin tissue was formalin 0145 Crosslinking of IgE Fc receptors by IgE and antigen, fixed, paraffin-embedded and sectioned for H&E and Tolui but not monomeric IgE, induces robust MC degranulation dine blue staining. (Leung, et al., Lancet 361, 151-160, doi:SO140-6736(03) 0153. Histological analysis revealed spongiosis and par 12 193-9 (2003)). However, stimulation with monomeric IgE akeratosis in the epidermis and marked neutrophil-rich can increase MC degranulation induced by certain molecules inflammatory infiltrates in the dermis of mice colonized with including compound 48/80 and substance P (Yamada, et al., J wild-type S. aureus (FIGS. 4c and 4d). In contrast, mice Invest Dermatol 121, 1425-1432, (2003)). Therefore, the colonized with S. aureus lacking 6-toxin exhibited a signifi ability of monomeric IgE to enhance the ability of 6-toxin to cantly reduced skin inflammatory cell infiltrate and disease induce MC degranulation was tested. score (FIGS. 4c., 4b and 4d). Complementation of the Ahld 0146 Pre-incubation of MCs with anti-DNP IgE or anti mutant with a plasmid producing 6-toxin restored the disease TNP IgE alone dramatically increased the degranulation score to levels comparable to the wild-type bacterium (FIG. activity of 6-toxin (FIG.3a). Notably, the synergistic effect of 25). The differential ability of wild-type and mutant S. aureus monomeric al NP-IgE and 8-toxin was abrogated in MCs to promote inflammatory disease was not explained by dif deficient in Syk (FIG. 3b). ferences in skin colonization (FIGS. 17a, 26a and 26b). Fur 0147 To test whether the synergism between monomeric thermore, mice colonized with wild-type S. aureus developed IgE and 8-toxin could be observed in vivo, monomeric IgE greater amounts of total serum IgE and IgG1, but not IgG2a, and 6-toxin were injected into the skin of mice at concentra as well as IL-4 in the skin than mice inoculated with the tions that do not induce MC degranulation and MC degranu Ö-toxin mutant bacterium (FIGS. 4e, 26c, and 27). At three US 2016/003 1973 A1 Feb. 4, 2016 weeks, there was a slight increase in IgG1 production in mice 0157. The inhibition data from the dose-response data colonized with the 6-toxin mutant bacterium compared to using the Delta-C rabbit antibody was plotted in a manner to PBS control (FIG. 27), providing evidence of the existence of allow determination, using 4-parameter linear regression, of a minor S. aureus-dependent, but Ö-toxin-independent path the effective reciprocal dilution at which the production of way for IgG1 production. In addition, pre-colonization with hexosaminidase is at 50% of maximum (EC50). As shown in wild-type, but not the 8-toxin-deficient, S. aureus enhanced FIG. 2, the delta-Cantibody has an EC50 of approximately the production of OVA-specific IgE (FIG. 4f). Colonization 86. This value means that at a dilution of 1:86, the affinity with S. aureus without disrupting the skin barrier by stripping purified antibody inhibits 50% of the hexosaminidase pro also induced inflammatory disease and enhanced IgE duction. responses (FIG. 28). Pre-colonization with 8-toxin-produc 0158. A repeat of the hexosaminidase assay using the ing S. aureus was important to elicit antigen-specific IgE affinity-purified rabbits antisera specific for the Delta-C because administration of OVA prior to, or concurrent with, S. immunogen demonstrated slightly more potent inhibition of aureus colonization did not enhance OVA-specific IgE pro hexosaminidase production compared to the first assay, as duction (FIG. 29). To test whether 8-toxin is sufficient to shown in FIGS. 3 and 12. triggerallergic skin disease, we epicutaneously sensitized the 0159 Antisera was also generated against a synthetic skin of mice with OVA in the presence and absence of 6-toxin MAP that expressed sequence from the N-terminus of and challenged the mice with OVA alone or OVA plus 6-toxin 8-toxin, MAQDIISTIGDLVKWIIDT (SEQID NO: 2) colin 3 weeks later. We found that 8-toxin triggered inflammatory early synthesized with an identical helper T cell epitope as the skin disease including OVA-specific IgE and IgG1 produc Delta-C immunogen. After affinity purification of the rabbit tion whereas challenge with OVA alone did not (FIG. 30). immunoglobulin, the antibody specific for the N-terminus of 0154 C57BL/6 mice colonized with wild-type S. aureus also developed higher serum IgE levels and more severe Ö-toxin was evaluated side-by-side with the Delta-Cantibody inflammatory skin disease than mice inoculated with S. in the hexosaminidase assay. Both antibody preparations aureus deficient in 8-toxin (FIGS. 4g and 4h). Importantly, were adjusted to have the same antibody titer by ELISA MC-deficient Kit''' mice inoculated with wild-type S. before testing in the functional assay. aureus showed reduced IgE serum levels and skin inflamma 0160 Data showed that rabbit antisera against the N-ter tion when compared to wild-type mice (FIGS. 4g and 4 h). minal-focused immunogen demonstrated efficacy to inhibit Adoptive transfer of MCs into the skin of Kit'''' mice mast cell degranulation stimulated by delta toxin. FIG. 13. restored skin disease and increase IgE production in mice However, the N-terminal-focused antibody was found to be colonized with wild-type, but not 8-toxin-deficient, S. aureus less potent than the Delta-C specific antibody. See FIG. 10, (FIGS. 4g, 4h, and 31). There were increased numbers of S. which shows the % beta hexosaminidase production pro aureus and total bacteria in the skin of Kit''' mice (FIG. duced by the mast cell line, MC/9, when stimulated with 1 31), indicating that mast cells can regulate bacterial coloni ug/ml of synthetic delta toxin either in the absence of anti Zation under these experimental conditions. Microscopic body or in the presence of control, affinity-purified rabbit analysis showed that the dermal MC densities in the skin of antibody (Abl) or affinity purified rabbitantibody specific for Kit''' recipient mice were about 50% of those found in the Delta-C immunogen. Also shown is the production of age-matched C57BL/6 mice (FIG. 31). Furthermore, tolui hexosaminidase in response to a control peptide (PSMal dine-positive granules associated with MC degranulation pha3). As is clear from the data, the delta-C-specificantibody were present in the skin of mice colonized with wild-type, but is capable of inhibiting the production of hexosaminidase in a not 6-toxin-deficient, S. aureus (FIG. 31). Taken together, dose-dependent fashion, while the control Ab does not have these results indicate that Ö-toxin from S. aureus promotes an inhibitory effect at any concentration. allergic skin disease via activation of MCs. 0.161 The inhibition data from the dose-response study using the Delta-C rabbit antibody can be plotted in a manner Example 7 to allow determination, using 4-parameter linear regression, 0155. In order to generate antibodies immunospecific for of the effective reciprocal dilution at which the production of 6-toxin, rabbits were immunized with a synthetic multiple hexosaminidase is at 50% of maximum (EC50). As shown in antigenic peptide (MAP) immunogen containing sequence FIG. 11A, the delta-C antibody has an EC50 of approxi from the C-terminus of the S. aureus 8-toxin gene (IGDLVK mately 86. This means that at a dilution of 1:86, the affinity WIIDTVNKFTKK; (SEQ ID NO:3)), linked to a helper T purified antibody inhibits 50% of the hexosaminidase pro cell epitope from Plasmodium falciparum, referred to as T (T duction. star), which has the sequence: EYLNKIQNSLSTEWSPCS 0162. A repeat of the hexosaminidase assay using the VT(SEQID NO:9). Immune rabbits were bled and the serum affinity-purified rabbit antisera specific for the Delta-C was evaluated by ELISA for the presence of antibody specific immunogen demonstrated slightly more potent inhibition of for delta toxin. After confirmation that the serum contained hexosaminidase production compared to the first assay, as the desired antibody, rabbit immunoglobulin was purified shown in FIG. 12 (shown along the x-axis are dilutions of from the rabbit serum using Protein A. After performing a affinity-purified Delta-Cantibody). buffer exchange to replace the Tris buffer with PBS, the 0163 Antisera was also generated against a synthetic affinity-purified antibody was evaluated in an in vitro assay MAP that expressed sequence from the N-terminus of delta designed to assess the efficacy of the antibody to inhibit mast toxin, MAQDIISTIGDLVKWIIDT (SEQID NO: 2), colin cell degranulation stimulated by full-length delta toxin. early synthesized with an identical helper T cell epitope as the 0156 Results showed that the delta-C-specific antibody is Delta-C immunogen. After affinity purification of the rabbit capable of inhibiting the production of hexosaminidase in a immunoglobulin, the antibody specific for the N-terminus of dose dependent fashion, while the control Ab does not have an delta toxin was evaluated side-by-side with the Delta-Canti inhibitory effect at any concentration. body in the hexosaminidase assay. Both antibody prepara US 2016/003 1973 A1 Feb. 4, 2016
tions were adjusted to have the same antibody titer by ELISA minimal effect on the development of the blue ear, while before testing in the functional assay. administration of medium only (negative control) does not 0164. As shown in FIG. 13, rabbit antisera raised against cause dye extravasation or the development of the blue ear. the N-terminal-focused immunogen demonstrates efficacy in inhibiting mast cell degranulation stimulated by delta toxin. Example 9 However, the N-terminal-focused antibody appears less potent than the Delta-C specific antibody. An alternative 0169 Staphylococcus aureus pulse-field gel electrophore expression of the data is shown in FIG. 14. sis (PFGE) type USA300 transformed with a plasmid con 0.165. Each of the developed immunogens is capable of taining the P3 promoter followed by the luciferase gene stimulating mast cell degranulation in vitro, with the Delta-C (USA300-P3-Luc) was grown in tryptic soy broth (TSB) to immunogen approximately 4x more potent at stimulating mid-exponential stationary phase (5x10 CFU/mL), as deter degranulation than the Delta-N immunogen. See FIG. 15. mined by optical density at 600 nm, from overnight cultured This increased ability of the Delta-Cimmunogen to stimulate bacteria and harvested via centrifugation (4,000xg, 4°C., 5 mast cell degranulation is consistent with the observed minutes). Supernatant was removed and the bacterial pellet was washed twice with an equal volume of PBS. Bacteria increase in potency of antibodies to the Delta-C immunogen were suspended in PBS at 5x10 CFU/mL, as confirmed by to inhibit hexosaminidase production and, hence, mast cell plating serial dilutions onto TSB. 2x10 CFU washed degranulation from MC/9 mast cells in vitro. USA300-P3-Luc was incubated with wt USA3008-hour fil Example 8 tered Supernatant containing stimulatory auto-inducing pep tide (AIP) at a final dilution of 1:10 and 40 uM each com 0166 In order to determine whether localized treatment pound in a total of 40 uL/well of TSB on a 384-well plate. The with a 6-toxin antibody could mitigate mast cell degranula S. aureus two-component agr System induces delta-toxin tion in Vivo, the following experiments were carried out. expression via expression of AIP at stationary growth phase 0167 One hour before culture supernatant challenge, 40 and was used to stimulate activation of the P3 promoter. ul of either Delta-C Antibody, Control Antibody or PBS were Alternatively, AIP produced by a different S. aureus strain, injected into the ear (i.d.). One hour later, 40% Tryptic soy PFGE type USA400, acts to inhibit delta-toxin expression in broth/PBS, or 40%. S. aureus supernatant/PBS from overnight USA300. As a positive control, samples were incubated with cultures of S. aureus were injected into the ear (i.d.). Mice USA400 8-hour filtered supernatant containing inhibitory were subsequently injected i.v. with 0.1 ml of saline contain AIP at a final dilution of 1:10 instead of test compound. ing 5 mg/ml Evans blue dye. Extravasation of Evans Blue dye Samples were incubated at 37° C. for 2 hours, then analyzed was monitored for 15 minutes before photographs were for luminescence and optical density at 600 nm. Percent acquired. Inhibition was determined by the following formula: 0168 Results showed that local administration in the ears of C57BL/6 mice of S. aureus supernatant, which possesses Percent inhibition=100x(Lumiya -Lum high levels of mast cell degranulating activity in the form of Pound) (Lumne inhibitor-LUMPsitive control). delta toxin, develop blue ears as a result of the extravasation Inhibitory compounds suitable for use in methods of inhibit of Evans blue dye from capillaries. FIG.9. Local treatment of ing skin inflammation according to the disclosure were iden the mice with the Delta-C antibody one hour prior to chal tified (Table 2) based on at least a 40% inhibition relative to lenge with S. aureus Supernatant completely mitigated the the positive control, minimal reduction in growth as deter development of the blue ear, likely as a consequence of the mined by optical density at 600 nm, and relatively low pro antibody neutralization of delta toxin within the S. aureus miscuity (<10%) in relation to other high-throughput assays supernatant. Control antibody can be observed to have a performed using these compounds. TABLE 2 % Inhibition StDev Compounds that Inhibit RNAIII Induction CCG Number 99.9 3.1 HEXESTROL CCG-3963O 98.7 3.5 SR 2640 CCG-2051.56 97.9 2.9 OCTOCRYLENE EUSOLEX CCG-213635 96.9 2.7 ROBUSTIC ACID CCG-39045 95.8 3.4 CARNOSIC ACID CCG-214849 90.9 2 SODIUMMECLOFENAMATE CCG-4O117 90.8 2 DIENESTROL CCG-4O189 89.5 2.2 DICEHLOROEVERNICACID CCG-214058 87.8 4.1 TPCK CCG-213449 86.3 2.6 CPD000466278 1H-Indole-2-propanoic acid, CCG-101053 -(4-chlorophenyl)methyl-3-(1,1-dimethylethyl)thio Alpha Alpha-dimethyl-5-(1-methylethyl)- CAS 85.7 2.6 CPDOOO466395 RITONAVIR CCG-101007 82.1 2 AMINOETHOXYDIPHENYLBORANE CCG-214123 81.6 16 PYRETHRINSIDRIONE CCG-212466 79.5 1.9 Galangine CCG-2O8629 78.9 1.9 METHYLDEOXYCHOLATE CCG-2142OO 76.1 14 DANTRON CCG-3S470 76 2.1 DIACERIN CCG-40287 75.5 14 PHENAZOPYRIDINEHYDROCHLORIDE CCG-3993S 75.3 1.8 SMILAGENIN CCG-386SO 73.7 3.4 361549, GSK-3b Inhibitor VIII CCG-2O6843 US 2016/003 1973 A1 Feb. 4, 2016 18
TABLE 2-continued % Inhibition StDev Compounds that Inhibit RNAIII Induction CCG Number 724 3 PHENOLPHTHALEIN CCG-39112 724 3.3 Sulindac Sulfide CCG-2O8108 71.9 .8 2',4-DIHYDROXYCHALCONE CCG-214400 71.3 2 Lonidamine CCG-2O4803 69.7 .9 CPDOOO469176 TIAGABINEHCI CCG-100885 694 4 CLOPIDOGREL SULFATE CCG-39568 692 4 FLUNIXIN MEGLUMINE BANAMINE CCG-213338 65.7 1 TESTOSTERONE PROPIONATE CCG-391.07 65.1 .7 CPDOOO449318 Benzeneacetic acid, 2 CCG-10076S (2,6-dichlorophenyl)amino-, monosodium salt CAS 64.8 4 ZOMEPIRACSODIUM CCG-390S6 64.5 4 APIGENINDIMETHYLETHER CCG-214O72 63.9 3 NIFURSOL CCG-213027 62.9 3 HAEMATOXYLIN CCG-38519 61.3 .8 URSOCHOLANIC ACID CCG-38540 6O.S 3 GIBBERELLIC ACID CCG-38588 60 2 LUMIRACOXIB | PREXIGE CCG-213068 59 4 CPD000466283 Altanserin CCG-101.056 S8.9 3 MOXIDECTINCYDECTIN CCG-213416 55.8 2.5 4Br-AHX CCG-2O8771 55.8 4 LUFENURON PROGRAM CCG-213976 55.7 1 3-DESHYDROXYSAPPANOLTRIMETHYLETHER CCG-387SO 53.4 2.4 XAV939 CCG-2O81OS 53.2 2 CPDOOO466374 ORMETOPRIM CCG-100900 52.8 1 PANTOPRAZOLE PROTONIX CCG-213558 52.4 O.6 NORETHINDRONE CCG-4O102 52.2 O.6 DIHYDROERGOTAMINE MESYLATE CCG-39S48 51.9 O.6 ERGOCALCIFEROL CCG-38.933 50.7 O.6 DIBENZOTHIOPHENE CCG-40229 49.9 2.2 NCI16221 CCG-208147 49 1 CPDOOO466305 REPAGLINIDE CCG-101013 48.7 1 CPDOOOO58555 LY 171883 CCG-10O826 47.8 O.8 S-CHLOROINDOLE-2-CARBOXYLIC ACID CCG-39S74 47.7 O.8 CHLORANIL CCG-39987 47.4 O.S DANAZOL CCG-40338 47.2 O.8 CHRYSOPHANOL CCG-38348 46.5 O.4 MEGESTROLACETATE CCG-4OO73 45.3 1.8 SP 6OO12S CCG-1 OO672
StDew = standard deviation
Example 10 0171 All references, including publications, patent appli cations, and patents, cited herein are hereby incorporated by 0170 Several S. aureus virulence factors are regulated by reference to the same extent as if each reference were indi the global regulon agr--. The agr System is composed of two vidually and specifically indicated to be incorporated by ref divergent operons designated P2 and P3. The P2 operon com erence and were set forth in its entirety herein. bines a density-sensing cassette (agrD and B) and a sensory 0172. The use of the terms “a” and “an and “the and transduction system composed of agrA and agrC. Agra and similar referents in the context of describing the claimed agrCare required for autocatalytic activation of the promoter subject matter are to be construed to cover both the singular P2; they are also required for transcription from the divergent and the plural, unless otherwise indicated herein or clearly promoter P3. The S. aureus agr System ultimately acts contradicted by context. The terms “comprising.” “having.” through RNAIII, a 514-nucleotide transcript of the P3 operon. “including, and “containing are to be construed as open RNAIII encodes 6-toxin (hld), a 26-amino-acid peptide (SEQ ended terms (i.e., meaning “including, but not limited to.) ID NO:1). Delta-toxin and RNAIII stimulate the expression unless otherwise noted. Recitation of ranges of values herein of post-exponentially expressed Staphylococcal extracellular are merely intended to serve as a shorthand method of refer toxins and enzymes. The inhibitory data disclosed in ring individually to each separate value falling within the Example 9, coupled with the knowledge that the coding range, unless otherwise indicated herein, and each separate regions of 6-toxin and RNAIII overlap, and that 8-toxin and value is incorporated into the specification as if it were indi RNAIII have a regulatory influence over the deleterious exo vidually recited herein. All methods described herein can be toxins and enzymes that Staphylococcal species can elabo performed in any suitable order unless otherwise indicated rate, led to the realization that the inhibitors identified herein herein or otherwise clearly contradicted by context. The use are useful not only in treating dermal inflammation, but in of any and all examples, or exemplary language (e.g., “such treating Staphylococcal colonization and, in particular, Sta as') provided herein, is intended merely to better illuminate phylococcal infection. In an exemplary embodiment, a thera the claimed Subject matter and does not place a limitation on peutically effective amount of an inhibitory therapeutic iden claim scope unless otherwise expressly indicated. No lan tified in Table 2 is administered to a patient infected with S. guage in the specification should be construed as indicating aureus, such as a patient infected with MRSA (methicillin any non-claimed element as essential to the practice of the resistant S. aureus). invention. US 2016/003 1973 A1 Feb. 4, 2016
0173 Certain embodiments of this invention are described cifically described herein. Accordingly, this disclosure herein, including the best mode known to the inventors for includes all modifications and equivalents of the Subject mat carrying out the claimed Subject matter. Variations of those preferred embodiments may become apparent to those of ter recited in the claims appended hereto as permitted by ordinary skill in the art upon reading the foregoing descrip applicable law. Moreover, any combination of the above tion. The inventors expect skilled artisans to employ Such described elements in all possible variations thereof is variations as appropriate, and the inventors intend for the encompassed by the claimed Subject matter unless otherwise claimed Subject matter to be practiced otherwise than as spe indicated herein or otherwise clearly contradicted by context.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 26
<21 Os SEQ ID NO 1 &211s LENGTH: 26 212s. TYPE: PRT <213> ORGANISM: Staphylococcus aureus
<4 OOs SEQUENCE: 1 Met Ala Glin Asp Ile Ile Ser Thir Ile Gly Asp Lieu Val Llys Trp Ile 1. 5 1O 15 Ile Asp Thr Val Asn Llys Phe Thr Llys Llys 2O 25
<21 Os SEQ ID NO 2 &211s LENGTH: 19 212s. TYPE: PRT <213> ORGANISM: Staphylococcus aureus
<4 OOs SEQUENCE: 2 Met Ala Glin Asp Ile Ile Ser Thir Ile Gly Asp Lieu Val Llys Trp Ile 1. 5 1O 15 Ile Asp Thr
<21 Os SEQ ID NO 3 &211s LENGTH: 18 212s. TYPE: PRT <213> ORGANISM: Staphylococcus aureus
<4 OOs SEQUENCE: 3 Ile Gly Asp Lieu Val Lys Trp Ile Ile Asp Thr Val Asn Llys Phe Thr 1. 5 1O 15 Llys Llys
<21 Os SEQ ID NO 4 &211s LENGTH: 11 212s. TYPE: PRT <213> ORGANISM: Staphylococcus aureus
<4 OOs SEQUENCE: 4 Ile Gly Asp Lieu Val Lys Trp Ile Ile Asp Thr 1. 5 1O
<21 Os SEQ ID NO 5 &211s LENGTH: 25 212s. TYPE: PRT <213> ORGANISM: Staphylococcus epidermidis
<4 OOs SEQUENCE: 5 Met Ala Ala Asp Ile Ile Ser Thir Ile Gly Asp Lieu Val Llys Trp Ile 1. 5 1O 15
Ile Asp Thr Val Asn Llys Phe Llys Llys US 2016/003 1973 A1 Feb. 4, 2016 20
- Continued
2O 25
<210s, SEQ ID NO 6 &211s LENGTH: 25 212. TYPE: PRT <213> ORGANISM: Staphylococcus epidermidis
<4 OOs, SEQUENCE: 6 Met Ala Ala Asp Ile Ile Ser Thir Ile Gly Asp Lieu Val Lys Trp Ile 1. 5 1O 15 Ile Asp Thr Val Asn Llys Phe Llys Llys 2O 25
<210s, SEQ ID NO 7 &211s LENGTH: 25 212. TYPE: PRT <213> ORGANISM: Staphylococcus warneri <4 OO > SEQUENCE: 7 Met Thr Ala Asp Ile Ile Ser Thr Ile Gly Asp Phe Val Lys Trp Ile 1. 5 1O 15 Lieu. Asp Thr Val Llys Llys Phe Thir Lys 2O 25
<210s, SEQ ID NO 8 &211s LENGTH: 25 212. TYPE PRT <213> ORGANISM: Staphylococcus intermedius
<4 OOs, SEQUENCE: 8 Met Ala Ala Asp Ile Ile Ser Thir Ile Val Glu Phe Wall Lys Lieu. Ile 1. 5 1O 15 Ala Glu Thr Val Ala Lys Phe Ile Llys 2O 25
<210s, SEQ ID NO 9 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide -- fPSM alpha 2 22 Os. FEATURE: <221s NAME/KEY: MISC FEATURE <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: N-terminal formyl-methionine <4 OOs, SEQUENCE: 9 Met Gly Ile Ile Ala Gly Ile Ile Llys Val Ile Llys Ser Lieu. Ile Glu 1. 5 1O 15 Glin Phe Thr Gly Lys 2O
<210s, SEQ ID NO 10 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide fPSM alpha-3 22 Os. FEATURE: <221s NAME/KEY: MISC FEATURE <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: N-terminal formyl-methionine US 2016/003 1973 A1 Feb. 4, 2016 21
- Continued
<4 OOs, SEQUENCE: 10 Met Gly Ile Ile Ala Gly Ile Ile Llys Phe Ile Lys Gly Lieu. Ile Glu 1. 5 1O 15 Llys Phe Thr Gly Lys 2O
<210s, SEQ ID NO 11 &211s LENGTH: 26 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide -- f delta-toxin - - Staphylococcus aureus 22 Os. FEATURE: <221s NAME/KEY: MISC FEATURE <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: N-terminal formyl-methionine
<4 OOs, SEQUENCE: 11 Met Ala Glin Asp Ile Ile Ser Thir Ile Gly Asp Lieu Val Lys Trp Ile 1. 5 1O 15 Ile Asp Thr Val Asn Llys Phe Thir Lys Llys 2O 25
<210s, SEQ ID NO 12 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide -- WRWWWW-CONH2 22 Os. FEATURE: <221s NAME/KEY: MISC FEATURE <222s. LOCATION: (6) . . (6) <223> OTHER INFORMATION: C-terminal tryptophan amide <4 OOs, SEQUENCE: 12 Trp Arg Trp Trp Trp Trp 1. 5
<210s, SEQ ID NO 13 &211s LENGTH: 13 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide -- MMK-1
<4 OOs, SEQUENCE: 13 Lieu. Glu Ser Ile Phe Arg Ser Lieu. Lieu. Phe Arg Val Met 1. 5 1O
<210s, SEQ ID NO 14 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer -- Gapdh forward primer -- Mus musculus
<4 OOs, SEQUENCE: 14 cct cqtcc.cg tag acaaaat g
<210s, SEQ ID NO 15 &211s LENGTH: 21 &212s. TYPE: DNA US 2016/003 1973 A1 Feb. 4, 2016 22
- Continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic primer -- Gapdh reverse primer - - Mus musculus
SEQUENCE: 15 tctic cactitt gccacctgca a 21
SEQ ID NO 16 LENGTH: 4 O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic polynucleotide -- Delta Barn. -- Bordetella pertus sis
SEQUENCE: 16
Ctagat caca gagatgtgat ggat.cctagt tatgagttg 4 O
SEQ ID NO 17 LENGTH: 4 O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic polynucleotide -- Delta Milu - - Bordetella pertus sis
SEQUENCE: 17 gttgggatgg Cttaataacg C9tacttitta gtact at acg 4 O
SEQ ID NO 18 LENGTH: 62 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic polynucleotide -- HLDATT1 - - Staphylococcus epidermidis
SEQUENCE: 18 ggggacaagt ttgtacaaaa aag caggctt gg tacttctg gttcgtcaaa gtaagaggca 6 O
Ca 62
SEQ ID NO 19 LENGTH: 61 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic polynucleotide -- HLDATT2 -- Staphylococcus epidermidis
SEQUENCE: 19 ggggaccact ttgtacaaga aagctgggtg gCact tctgg ttcgtcaaag taagaag cac 6 O a. 61
SEQ ID NO LENGTH: 34 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Sytnthetic polynucleotide -- HLD1 - - Staphylococcus epidermidis
SEQUENCE: US 2016/003 1973 A1 Feb. 4, 2016 23
- Continued cgaaaggagt gaagttataa tag cagoaga t at C 34
<210s, SEQ ID NO 21 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- HLD2 - - Staphylococcus epidermidis
<4 OOs, SEQUENCE: 21 gatatctgct gct attataa citt cactic ct titcg 34
<210s, SEQ ID NO 22 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- P3prEco - - Staphylococcus aureus
<4 OOs, SEQUENCE: 22 caattittaca ccact citcct cactggaatt coattatacg 4 O
<210s, SEQ ID NO 23 &211s LENGTH: 4 O & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- P3prBam - - Staphylococcus aureus
<4 OOs, SEQUENCE: 23 atgcggat.cc ct catcaact attitt coat c acatctotgt 4 O
<210s, SEQ ID NO 24 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- luxBamHI - - Staphylococcus aureus
<4 OOs, SEQUENCE: 24 atgcggat.cc to agatgaa gCaagaggag 3 O
<210s, SEQ ID NO 25 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- luxSalI - - Staphylococcus aureus
<4 OOs, SEQUENCE: 25 atgcgt.cgac gcagoggt at tttitcgat.ca 3 O
<210s, SEQ ID NO 26 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 2016/003 1973 A1 Feb. 4, 2016 24
- Continued
22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide -- luxArvised - - Staphylococcus aureus
<4 OOs, SEQUENCE: 26 aaggcgcgac tittatt cat
What is claimed is: 22. The method of any one of claims 1-9 or 14-21, wherein 1. A method for treating or preventing skin inflammation the compound specifically binds a carboxy terminal region of comprising the step of administering to an individual a pro the delta toxin. phylactically or therapeutically effective amount of a com 23. The method of claim 22, wherein the carboxy terminal pound that inhibits Staphylococcus delta toxin. region consists essentially of SEQID NO. 3. 2. The method of claim 1 wherein the Staphylococcus delta 24. The method of any one of claims 1-9 or 14-21, wherein toxin is a S. aureus, S. epidermidis, S. saprophyticus, S epi the compound specifically binds an amino terminal region of dermidis, S. warneri, or S. intermedius delta toxin. delta toxin. 3. The method of claim 1, wherein the skin inflammation 25. The method of claim 24, wherein the amino terminal arises from mast cell-mediated cytokine release. region is set out in SEQID NO: 2. 4. The method of claim 1, wherein the skin inflammation 26. The method of any one of claims 1-7 or 10-21, wherein arises from mast cell degranulation. the compound is a polynucleotide. 5. The method of any one of claim 1, 2, 3 or 4 wherein the 27. The method of claim 26, wherein the polynucleotide is inflammation is dermatitis. a delta toxin antisense oligonucleotide. 6. The method of claim 5 wherein dermatitis is atopic 28. The method of claim 26, wherein the polynucleotide is dermatitis. a delta toxin inhibitory RNA (RNAi). 7. The method of any one of claims 1-6 wherein the com 29. The method of claim 28 wherein the RNAi is an anti pound inhibits delta toxin activity. sense RNA, a short hairpin RNA (shRNA), a small interfering 8. The method of claim 7 wherein the compound binds RNA (siRNA), a microRNA (miRNA), or a ribozyme. delta toxin. 30. The method of claim 1 wherein the compound is 9. The method of claim 7 wherein the compound inhibits selected from the group consisting of HEXESTROL: SR delta toxin interaction with mast cells. 2640; OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: CARNOSIC ACID; SODIUM MECLOFENAMATE; 10. The method of claim 7 wherein the compound inhibits DIENESTROL, DICHLOROEVERNIC ACID: TPCK; delta toxin secretion. CPD000466278 1H-Indole-2-propanoic acid, 1-(4-chlo 11. The method of claim 7 wherein the compound inhibits rophenyl)methyl-3-(1,1-dimethylethyl)thio-Alpha, Alpha delta toxin expression. dimethyl-5-(1-methylethyl)-CAS: CPD000466395 12. The method of claim 11 wherein the compound inhibits RITONAVIR, AMINOETHOXYDIPHENYLBORANE; delta toxin transcription. PYRETHRINSIDRIONE: Galangine; METHYL DEOXY 13. The method of claim 11 wherein the compound inhibits CHOLATE: DANTRON: DIACERIN PHENAZOPYRI delta toxin translation. DINEHYDROCHLORIDE: SMILAGENIN;361549, GSK 14. The method of any one of claims 1-9, wherein the 3b Inhibitor VIII; PHENOLPHTHALEIN; Sulindac Sulfide: compound is a polypeptide. 2',4-DIHYDROXYCHALCONE: Lonidamine; 15. The method of claim 14, wherein the compound is an CPD000469176 TIAGABINE HC1; CLOPIDOGRELSUL antibody or antigen binding fragment thereof. FATE: FLUNIXIN MEGLUMINEIBANAMINE; TEST 16. The method of claim 15 wherein the antibody or anti OSTERONE PROPIONATE: CPD000449318 Benzeneace gen binding fragment thereof is isolated from a polyclonal tic acid, 2-(2,6-dichlorophenyl)amino-, monosodium salt Sea. CAS; ZOMEPIRAC SODIUM: APIGENIN DIMETHYL ETHER NIFURSOL: HAEMATOXYLIN; URSOCH 17. The method of claim 15 wherein the antibody or anti OLANIC ACID: GIBBERELLIC ACID: gen binding fragment thereof is a monoclonal antibody, or LUMIRACOXIB PREXIGE: CPD000466283 Altanserin: fragment thereof. MOXIDECTINCYDECTIN: 4Br-AHX; 18. The method of claim 15, wherein the antibody or anti LUFENURONIPROGRAM; 3-DESHYDROXYSAP gen binding fragment thereof is a humanized antibody, a PANOLTRIMETHYLETHER: XAV939; CPD000466374 chimericantibody, a hybrid antibody, a single-chainantibody, ORMETOPRIM; PANTOPRAZOLEIPROTONIX: NORE a single chain Fv antibody, an Fab antibody, an Fab'antibody, THINDRONE: DIHYDROERGOTAMINE MESYLATE; an (Fab'), a diabody, or an antigen-binding fragment of a ERGOCALCIFEROL: DIBENZOTHIOPHENE: monoclonal antibody. NCI16221; CPD000466305 REPAGLINIDE; 19. The method of claim 14 wherein the compound is a CPD000058555 LY 171883:5-CHLOROINDOLE-2-CAR delta toxin binding peptide. BOXYLIC ACID: CHLORANIL; DANAZOL: 20. The method of any of the claims above wherein the CHRYSOPHANOL: MEGESTROL ACETATE; and SP delta toxin is set out in SEQID NO: 1 (S. aureus). 6OO125. 21. The method of any of the claims above wherein the 31. The method of claim 30 wherein the compound is delta toxin is set out in SEQID NO: 5 (S. epidermidis) selected from the group consisting of HEXESTROL: SR US 2016/003 1973 A1 Feb. 4, 2016
2640; OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: rophenyl)methyl-3-(1,1-dimethylethyl)thio-Alpha, Alpha CARNOSIC ACID; SODIUM MECLOFENAMATE; dimethyl-5-(1-methylethyl)-CAS: CPD000466395 DIENESTROL, DICHLOROEVERNICACID; and TPCK. RITONAVIR, AMINOETHOXYDIPHENYLBORANE; 32. The method of any one of claims 1-31 wherein the PYRETHRINSIDRIONE: Galangine; METHYL DEOXY compound is administered with a second therapeutic agent. CHOLATE: DANTRON: DIACERIN PHENAZOPYRI 33. The method of claim 32 wherein the compound and the DINEHYDROCHLORIDE: SMILAGENIN;361549, GSK second therapeutic agent are administered concurrently. 3b Inhibitor VIII; PHENOLPHTHALEIN; Sulindac Sulfide: 34. The method of claim 32 wherein the compound and the 2',4-DIHYDROXYCHALCONE: Lonidamine; second therapeutic agent are administered consecutively. CPD000469176 TIAGABINE HC1; CLOPIDOGRELSUL 35. The method of any one of claims 32-34 wherein the FATE: FLUNIXIN MEGLUMINEIBANAMINE; TEST second therapeutic agent is selected from the group consist OSTERONE PROPIONATE: CPD000449318 Benzeneace ing of a therapeutic protein, an antibiotic agent, an anti tic acid, 2-(2,6-dichlorophenyl)amino-, monosodium salt inflammatory agent and an immunosuppressive agent. CAS; ZOMEPIRAC SODIUM: APIGENIN DIMETHYL 36. A method of preventing or treating a Staphylococcal ETHER NIFURSOL: HAEMATOXYLIN; URSOCH infection comprising administering a prophylactically or OLANIC ACID: GIBBERELLIC ACID: therapeutically effective amount of a compound that inhibits LUMIRACOXIB PREXIGE: CPD000466283 Altanserin: Staphylococcus delta toxin activity or expression. MOXIDECTINCYDECTIN: 4Br-AHX; 37. The method of claim 36 wherein the Staphylococcus LUFENURONIPROGRAM; 3-DESHYDROXYSAP delta toxin is a S. aureus, S. epidermidis, S. saprophyticus, S PANOLTRIMETHYLETHER: XAV939; CPD000466374 epidermidis, S. warneri, S. intermedius, or S. pseudinterme ORMETOPRIM; PANTOPRAZOLEIPROTONIX: NORE dius delta toxin. THINDRONE: DIHYDROERGOTAMINE MESYLATE; 38. The method of claim 37 wherein the S. aureus is a ERGOCALCIFEROL: DIBENZOTHIOPHENE: methicillin-resistant S. aureus (MRSA). NCI16221; CPD000466305 REPAGLINIDE; 39. The method of claim 36 wherein the compound inhibits CPD000058555 LY 171883:5-CHLOROINDOLE-2-CAR delta toxin activity. BOXYLIC ACID: CHLORANIL; DANAZOL: 40. The method of claim 39 wherein the compound is an CHRYSOPHANOL: MEGESTROL ACETATE; and SP anti-delta toxin antibody orantigenbinding fragment thereof. 6OO125. 41. The method of claim 40 wherein the antibody or anti 47. The method of claim 46 wherein the compound is gen binding fragment thereof is a humanized antibody, a selected from the group consisting of HEXESTROL: SR chimericantibody, a hybrid antibody, a single-chainantibody, 2640; OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: a single chain Fv antibody, an Fab antibody, an Fab'antibody, CARNOSIC ACID; SODIUM MECLOFENAMATE; an (Fab'), a diabody, or an antigen-binding fragment of a DIENESTROL, DICHLOROEVERNICACID; and TPCK. monoclonal antibody. 48. A method of vaccinating a subject at risk of developing 42. The method of claim 40 wherein the antibody or anti a Staphylococcal disorder comprising administering an gen binding fragment thereof binds a carboxy-terminal immunologically effective amount of an immunogen selected region or an N-terminal region of delta toxin. from the group consisting of an inactivated Staphylococcal 43. The method of claim 42 wherein the antibody or anti delta toxin, an N-terminal fragment of Staphylococcal delta gen-binding fragment thereof binds a carboxy terminal toxin and a C-terminal fragment of Staphylococcal delta region of delta toxin that consists essentially of SEQID NO:3 toxin. or binds an N-terminal region of delta toxin that consists 49. A method of vaccinating a subject at risk of developing essentially of SEQID NO:2. a Staphylococcal disorder comprising administering a pro 44. The method of claim 36 wherein the compound is a phylactically effective amount of an antibody or fragment polynucleotide. thereof that specifically binds to an N-terminal fragment of 45. The method of claim 44 wherein the polynucleotide is delta toxin as set forth in SEQID NO:2 or specifically binds a delta toxin antisense oligonucleotide, a delta toxin inhibi to a C-terminal fragment of delta toxin as set forth in SEQID tory RNA (RNAi), a delta toxin short hairpin RNA (shRNA), NO:3. a delta toxin small interfering RNA (siRNA), a delta toxin microRNA (miRNA), or a ribozyme interacting with a delta 50. Use of the compound of any one of claims 7-19 and toxin transcript. 22-31 in preventing or treating skin inflammation. 46. The method of claim 36 wherein the compound is 51. Use of the compound of any one of claims 39-47 in selected from the group consisting of HEXESTROL: SR preventing or treating a Staphylococcal infection. 2640; OCTOCRYLENEEUSOLEX; ROBUSTIC ACID: 52. Use of the compound of any one of claims 50-51 in CARNOSIC ACID; SODIUM MECLOFENAMATE; vaccinating a subject at risk of developing a Staphylococcal DIENESTROL, DICHLOROEVERNIC ACID: TPCK; disorder. CPD000466278 1H-Indole-2-propanoic acid, 1-(4-chlo