DOCSLIB.ORG

Characterisation of the Role of Hsp70 in Prion Propagation In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterisation of the Role of Hsp70 in Prion Propagation In Assessing the role of Hsp70 in prion propagation in Saccharomyces cerevisiae Sarah Cusack BSc Volume 1/1 This thesis is submitted to the National University of Ireland for the degree of Doctor of Philosophy October 2010 Supervisors: Head of Department: Dr. Gary Jones Professor Kay Ohlendieck Yeast Genetics, National University of Ireland Maynooth, Co. Kildare Declaration of Authorship This thesis has not previously been submitted in whole or in part to this or any other University for any other degree. This thesis is the sole work of the author, with the exception of the generation of the Ssa1 mutant library, which was carried out by Dr. Harriet Loovers. __________________________ Sarah Cusack B.Sc. Acknowledgements I would first and fore-most like to thank my supervisor Dr. Gary Jones for all the support, advice, encouragement and ideas I have received throughout this PhD. I would also like thank my colleagues past and present in the Yeast Genetics; in particular, Dr. Harriet Loovers, who generated the mutants used in this study, Dr. Emma Guinan for answering all my questions and helping me get my project started! I would also like to extend a sincere thanks to our collaborator Dr. Sarah Perrett whom allowed me to work in her group in Beijing. I would especially like to thank all members of Dr. Sarah Perrett’s lab whom I would not have been able to complete the work without and for making me feel extremely welcome in Beijing, especially Xu Liqiong. I would further like to thank Dr. Gemma Kinsella for carrying out structural analysis on our mutants and Dr. David Fitzpatrick for assisting us with analysis of genome sequencing data. I would also like to that SFI for funding this project. I would like to thank all my friends at NUI Maynooth, past and present. I would especially like to thank Ciara, Jen, Emma and Naushaba for making me laugh inside and outside the lab, I’m so grateful I got to work and make bezies with all of you! I would also like to thank my friends from other labs, Karen, Karen T, John and Carol for many laughs over the past few years. I would also like to thanks my closest and oldest friends at home for being patient with me for the past few months, especially to Jemma, Fearghal, Aoife and Brian, don’t know what I would have done without you (especially in China!!). I would like to thank my parents and family for all the constant support and encouragement I have received throughout all my education, especially theses last few months when I know I may have been difficult to live with! I really appreciate everything you do for me. Finally, I would like to thank my boyfriend Mark, who has been with me and supported me since the start of this PhD , thanks for all those times you helped me with my computer, you’re the most patient person I know (you probably need to be!) and I couldn’t have done this without you. Presentations Oral presentations Assessing the role of Hsp70 in prion propagation. Presentation at the British Yeast Group meeting, Cardiff, Wales, 2009. Hsp70 Peptide binding domain mutants: affects Prion propagation and other cellular function. Presentation at NUI Maynooth, Departmental Seminar, 18th June 2009. Isolation of Hsp70 mutants that impair prion propagation in yeast. Presentation at NUI Maynooth Departmental Seminar, June 2008. Poster presentations Assessing the role of Hsp70 in prion propagation and other cellular functions. Poster presentation at the British Yeast Group meeting, Oxford, Oxfordshire, 2010. Affects of Hsp70 PBD mutations on prion propagation in yeast. Royal Academy of Medicine in Ireland Annual Meeting, NUI Maynooth ,2009. Assessing the role of Hsp70 in prion propagation. Poster presented at the Society general microbiology annual meeting, University College Cork, Cork 2009. Assessing the role of Hsp70 in prion propagation. Conway Institute, University College Dublin, 25th June 2009. List of abbreviations ABC: ATP binding cassette ADP: Adenosine triphosphate AMP: Ampicillin AOX: Alcohol oxidase APS: Ammonium persulfate ATP: Adenosine triphosphate BSE: Bovine spongiform encephalopathy CD: Circular dichroism CHL: Chloramphenicol CJD: Creutzfeldt–Jakob disease CNS: Central nervous system CTD: C-terminal domain CWI: Cell wall integrity signaling DNA: Deoxyribonucleic acid DNTPs: Deoxynucleotide triphosphates DTT: Dithiothreitol EDTA: Ethylenediaminetetraacetic acid ER: Endoplasmic reticulum 5-FOA: 5-Fluoro-orotic Acid GdnHCL: Guanidine Hydrochloride GPI: Glycosyl phosphatidylinositol HSE: Heat shock element HSF: Heat shock factor HSP: Heat shock protein ISCMs: Inactivating stop codon mutations KCL: Potassium chloride LB: Luria- bertani LDH: Lactate dehydrogenase LiAC: Lithium acetate MAP: Mitogen activated protein MCAC: Metal chelate affinity chromatography MGT: Mean generation time NEF: Nucleotide exchange factor NTD: Amino-terminal domain OD: Optical density ONPG: Ortho-Nitrophenyl-β-galactoside OR: Oligopeptide repeat PBD: Peptide binding domain PCR: Polymerase chain reaction PDR: Pleiotropic drug resistance PEG: Polyethylene glycol PEP: Phosphoenolpyruvate PIC: Protease inhibitor cocktail PK: Pyruvate kinase PMSF: Phenylmethanesulfonylfluoride PrD: Prion domain PVDF: Polyvinylidene Fluoride RF: Release factors RNA: Ribonucleic acid RPM: Rotations per minute RT-PCR: Reverse transcript- Polymerase chain reaction SBF: Swi4/6 cell cycle box-binding factor SC: Synthetic complex SDM: Site-directed mutagenesis SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis SGD: Saccharomyces genome database SNPS: Single-nucleotide polymorphisms SSA: Stress-seventy superfamily stH20: Sterile water T.S: Thermosensitive TAE: Tris base, acetic acid and EDTA TBS: Tris buffered saline TeMED: Tetramethylethylenediamine TF: Transcription factor TPR: Tetratricopeptide domain TSE: Transmissible spongioform encephalopathy UPR: Unfolded protein response UPRE: Unfolded protein response element UPS: Ubiquitin proteosome system YPD: Yeast dextrose medium YPG: Yeast peptone glycerol YPGAL: Yeast peptone galactose List of figures Figure 1.1 Spontaneous formation of [PSI+] Figure 1.2 Schematic diagram showing the Hsp70 binding cycle Figure 1.3 Mechanistic model of Hsp104 Figure 1.4 Involvement of protein chaperones in prion propagation Figure 3.1 Proposed Strategy for isolating SSA1 mutations Figure 3.2 Strategy for isolation of PBD mutants Figure 3.3 Phenotypes of yeast cells expressing Ssa1 mutants in G402 Figure 3.4 Temperature sensitivity of PBD mutants Figure 3.5 - Comparison of growth and morphology between Ssa1 and Ssa1F475S Figure 3.6 Basal levels of Hsp70 and Hsp104 Figure 3.7- Refolding activity of Ssa1F475S Figure 3.8 Substrate binding domain (380-570) of yeast Figure 3.9 Phenotypes of PBD mutants with second site suppressors Figure 3.10 Temperature sensitivity assay of Ssa1F+P636S Figure 3.11 Strategy for isolating second site suppressor mutations of Ssa1F475S T.S phenotype Figure 3.12 Confirmation of restored T.S phenotype by second-site suppressors Figure3.13 [PSI] status of second-site suppressors Figure 3.14. Abundance of Hsp70 in Ssa1F475S second-site suppressors Figure 3.15 Substrate binding domain (380-570) of yeast Hsp70 modelled from the 3C7N template (chain B). Figure 3.16 Viability of His tagged Ssa1F475S Figure 3.17 Methodology for protein purification in E.coli Figure 3.18 Size- exclusion chromatography chromatogram Figure 3.19 Determination of purity of Ssa1 and Ssa1F475S by SDS-page Figure 3.20 Detection of Hsp70 and His6X tag by western blotting. Figure 3.21 Measuring ATPase activity of Hsp70 Figure 3.22 Investigation of ATPase activity Ssa1F475S Figure 3.23 Purified Ydj1 Figure 3.24 Stimulation of Ssa1 ATPase by Hsp40 Figure 3.25 Example of CD spectroscopy Figure 3.26- CD spectroscopy analysis of Ssa1F475S Figure 3.27 Analysis of F475S mutation in Ssa1-4. Figure 3.28 Cell wall integrity signaling pathway Figure 3.29 Recovery of 37oC t.s phenotype by 1M sorbitol Figure 3.30- Effect of 1M sorbitol on abundance of Hsp70 and Hsp104. Figure 3.31 Recovery of Ssa1F475S 37oC t.s phenotype by components of CWI signaling pathway Figure 3.32 Strategy for performing ß-galactosidase assays in yeast Figure 3.33 Effect of Ssa1F475S on PDR5 expression Figure 3.34 Effect of Ssa1F475S on SSA1 expression Figure 4.1 Effect of elevated temperatures on ATPase mutants Figure 4.2- Yeast HSP70 ATPase domain model developed from the 37CN crystal structure (chain B). Figure 4.3 Binding of Sse1 to Hsp70 Figure 4.4 Basal levels of Hsp70 and Hsp104 in cells expressing ATPase mutants Figure 4.5- Refolding activity of ATPase mutants Figure 4.6- Conservation of ATPase mutants across Ssa family Figure 4.7 -Viability of His(6X) tagged ATPase mutants Figure 4.8 Size- exclusion chromatography chromatogram Figure 4.9 Determination of purity of Ssa1p and ATPase mutants by SDS-page Figure 4.10 Detection of Hsp70 and His6X tag by western blotting Figure 4.11 Investigation of ATPase activity Figure 4.12 Stimulation of Ssa1 ATPase by Hsp40 Figure 4.13 CD spectroscopy analysis of ATPase mutants Figure 4.14- Effect of ATPase mutants on PDR5 expression Figure 4.15 Effect of ATPase mutants on Ssa1 expression Figure 4.16 -The effect of ATPase on the unfolded protein response Figure 4.17- Ssa1 protein sequence exhibiting CTD truncations Figures 4.18- Strategy employed for creating CTD truncations of Ssa1 Figure 4.19 Viability of truncated CTD mutants in [PSI+] G402 Figure 4.20 Viability of truncated CTD mutants in [psi-] G402 Figure 4.21 Confirmation of expression of CTD truncated proteins Figure 4.22 Hsp70
Load more

Recommended publications
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Loss of Amino-Terminal Acetylation Suppresses a Prion Phenotype by Modulating Global Protein Folding
    ARTICLE Received 3 Apr 2014 | Accepted 13 Jun 2014 | Published 15 Jul 2014 DOI: 10.1038/ncomms5383 Loss of amino-terminal acetylation suppresses a prion phenotype by modulating global protein folding William M. Holmes1,w, Brian K. Mannakee2, Ryan N. Gutenkunst3 & Tricia R. Serio1,w Amino-terminal acetylation is among the most ubiquitous of protein modifications in eukaryotes. Although loss of N-terminal acetylation is associated with many abnormalities, the molecular basis of these effects is known for only a few cases, where acetylation of single factors has been linked to binding avidity or metabolic stability. In contrast, the impact of N-terminal acetylation for the majority of the proteome, and its combinatorial contributions to phenotypes, are unknown. Here, by studying the yeast prion [PSI þ ], an amyloid of the Sup35 protein, we show that loss of N-terminal acetylation promotes general protein misfolding, a redeployment of chaperones to these substrates, and a corresponding stress response. These proteostasis changes, combined with the decreased stability of unacetylated Sup35 amyloid, reduce the size of prion aggregates and reverse their phenotypic consequences. Thus, loss of N-terminal acetylation, and its previously unanticipated role in protein biogenesis, globally resculpts the proteome to create a unique phenotype. 1 Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, 185 Meeting Street, Providence, Rhode Island 02912, USA. 2 Graduate Interdisciplinary Program in Statistics, University of Arizona, 1548 East Drachman Street, Tucson, Arizona 85721, USA. 3 Department of Molecular and Cellular Biology, University of Arizona, 1007 East Lowell Street, Tucson, Arizona 85721, USA. w Present addresses: Biology Department, College of the Holy Cross, 1 College Street, Worcester, Massachusetts 01610, USA (W.M.H.); Department of Molecular and Cellular Biology, University of Arizona, 1007 East Lowell Street, Tucson, Arizona 85721, USA (T.R.S.).
    [Show full text]
  • HUMAN ARYLAMINE N-ACETYLTRANSFERASE 1: PURSUIT of an ENDOGENOUS ROLE Katey Leah Witham
    HUMAN ARYLAMINE N-ACETYLTRANSFERASE 1: PURSUIT OF AN ENDOGENOUS ROLE Katey Leah Witham BSc Hons A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2015 School of Biomedical Sciences 1 ABSTRACT It has been hypothesized that the ubiquitously expressed Phase II drug metabolizing enzyme human arylamine N-acetyltransferase 1 (NAT1) has a role in cell biology other than the metabolism of xenobiotics. The identification of p-aminobenzoylglutamate (pABG) as an endogenous substrate for NAT1 led to speculation that the enzyme might be involved in folate regulation. NAT1 is overexpressed in human luminal breast cancers and is a proposed biomarker for estrogen receptor positive breast cancers in women as well as luminal M2 breast cancers in men. Moreover, NAT1 has been shown to support human cancer cell growth, survival and invasion both in vitro and in vivo . Overall, the aim of this work was to identify possible endogenous roles for NAT1 that might explain its wide tissue expression. Initially, mouse Nat2 (homologue to human NAT1) was considered, and the levels of pABG and 5-methyltetrahydrofolate, the predominant circulating folate, were measured in wild-type and Nat2 -deleted ( Nat2 -/-) mice. Both metabolites were unaltered in Nat2 -/- mice suggesting the enzyme did not regulate either of these folate products in vivo under normal conditions. Therefore, the effect of human NAT1 on pABG and 5- methyltetrahydrofolate in the human colon adenocarcinoma cell line, HT-29, was investigated to determine if NAT1 regulated folate in cancer cells. As with the mouse study, pABG and 5-methyltetrahydrofolate were unaltered when NAT1 was knocked down in these cells.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • Discovery of a Molecular Glue That Enhances Uprmt to Restore
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Discovery of a molecular glue that enhances UPRmt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis Authors: Li-Feng-Rong Qi1, 2 †, Cheng Qian1, †, Shuai Liu1, 2†, Chao Peng3, 4, Mu Zhang1, Peng Yang1, Ping Wu3, 4, Ping Li1 and Xiaojun Xu1, 2 * † These authors share joint first authorship Running title: Ginsenoside Rg3 reverses Parkinson’s disease model by enhancing mitochondrial UPR Affiliations: 1 State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 2 Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 3. National Facility for Protein Science in Shanghai, Zhangjiang Lab, Shanghai Advanced Research Institute, Chinese Academy of Science, Shanghai 201210, China 4. Shanghai Science Research Center, Chinese Academy of Sciences, Shanghai, 201204, China. Corresponding author: Ping Li, State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Email: [email protected], Xiaojun Xu, State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Telephone number: +86-2583271203, E-mail: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Loss of Tubedown Expression As a Contributing Factor in the Development of Age-Related Retinopathy
    Retina Loss of Tubedown Expression as a Contributing Factor in the Development of Age-Related Retinopathy Robert L. Gendron,*,1 Nora V. Laver,2 William V. Good,3 Hans E. Grossniklaus,4 Ewa Miskiewicz,1 Maria A. Whelan,1 Jacqueline Walker,1 and He´le`ne Paradis*,1 PURPOSE. Tubedown (Tbdn), a cortactin-binding acetyltrans- CONCLUSIONS. This work provides evidence that the marked ferase subunit, regulates retinal vascular permeability and ho- decrease in the level of expression of Tbdn in the retinal and meostasis in adulthood. Here the authors explore whether choroidal vasculature during aging contributes to the multifac- Tbdn loss during aging might contribute to the mechanisms torial process that leads to the development of age-related underlying age-related neovascular retinopathy. retinopathy and choroidopathy. (Invest Ophthalmol Vis Sci. METHODS. A conditional endothelial-specific transgenic 2010;51:5267–5277) DOI:10.1167/iovs.09-4527 model of Tbdn loss was compared with aged mouse and human specimens from 5- to 93-year-old individuals. Speci- uring aging, vision loss greatly affects quality of life and mens were analyzed by morphometric measurements and Dfunctional autonomy. Age-related macular degeneration for functional markers using immunohistochemistry and (AMD) is one of the leading causes of blindness in people older Western blot analysis. than 60.1,2 The prevalence of AMD increases dramatically with age, one important risk factor. Because of aging demographics, RESULTS. An age-dependent decrease in Tbdn expression in by the year 2020, the number of people affected with blind- endothelial cells of the posterior pole of the eye correlated 3 with pathologic changes in choroidal and retinal tissues of ness or low vision is projected to increase substantially.
    [Show full text]
  • Genome-Wide Investigation of Cellular Functions for Trna Nucleus
    Genome-wide Investigation of Cellular Functions for tRNA Nucleus- Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Yi Chu Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Kurt Fredrick Jane Jackman Copyright by Hui-Yi Chu 2012 Abstract In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent. This newly discovered tRNA retrograde process is conserved from yeast to vertebrates. Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions.
    [Show full text]
  • Supplementary Data.Xlsx
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2016 Average Average spectral spectral Fold UniProt IDGene Protein Name counts- counts- enrichm negative positive ent sample sample P12821 ACE HUMAN - ACE Angiotensin-converting enzyme 0 79.75 #DIV/0! Q71U36 TBA1A HUMAN - TUBA1A Tubulin alpha-1A chain 0 59.5 #DIV/0! P17812 PYRG1 HUMAN - CTPS1 CTP synthase 1 0 43.5 #DIV/0! P23921 RIR1 HUMAN - RRM1 Ribonucleoside-diphosphate reductase large subunit 0 35 #DIV/0! P49915GUAA HUMAN - GMPS GMP synthase 0 30.5 #DIV/0! P30153 2AAA HUMAN - PPP2R1A Serine/threonine-protein phosphatase 2A 65 kDa0 regulatory subunit29 A#DIV/0! alpha isoform P55786 PSA HUMAN - NPEPPS Puromycin-sensitive aminopeptidase 0 28.75 #DIV/0! O43143 DHX15 HUMAN - DHX15 Putative pre-mRNA-splicing factor ATP-dependent RNA0 helicase28.25 DHX15#DIV/0! P15170 ERF3A HUMAN - GSPT1 Eukaryotic peptide chain release factor GTP-binding0 subunit ERF3A24.75 #DIV/0! P09874PARP1HUMAN - PARP1 Poly 0 23.5 #DIV/0! Q9BXJ9 NAA15 HUMAN - NAA15 N-alpha-acetyltransferase 15, NatA auxiliary subunit0 23 #DIV/0! B0V043 B0V043 HUMAN - VARS Valyl-tRNA synthetase 0 20 #DIV/0! Q86VP6 CAND1 HUMAN - CAND1 Cullin-associated NEDD8-dissociated protein 1 0 19.5 #DIV/0! P04080CYTB HUMAN - CSTB Cystatin-B 0 19 #DIV/0! Q93009 UBP7 HUMAN - USP7 Ubiquitin carboxyl-terminal hydrolase 7 0 18 #DIV/0! Q9Y2L1 RRP44 HUMAN - DIS3 Exosome complex exonuclease RRP44 0 18 #DIV/0! Q13748 TBA3C HUMAN - TUBA3D Tubulin alpha-3C/D chain 0 18 #DIV/0! P29144 TPP2 HUMAN
    [Show full text]
  • Amyloid-Associated Activity Contributes to the Severity and Toxicity of a Prion Phenotype
    ARTICLE Received 2 Apr 2014 | Accepted 13 Jun 2014 | Published 15 Jul 2014 DOI: 10.1038/ncomms5384 Amyloid-associated activity contributes to the severity and toxicity of a prion phenotype John A. Pezza1,w, Janice Villali1,w, Suzanne S. Sindi2 & Tricia R. Serio1,w The self-assembly of alternative conformations of normal proteins into amyloid aggregates has been implicated in both the acquisition of new functions and in the appearance and progression of disease. However, while these amyloidogenic pathways are linked to the emergence of new phenotypes, numerous studies have uncoupled the accumulation of aggregates from their biological consequences, revealing currently underappreciated complexity in the determination of these traits. Here, to explore the molecular basis of protein-only phenotypes, we focused on the Saccharomyces cerevisiae Sup35/[PSI þ ] prion, which confers a translation termination defect and expression level-dependent toxicity in its amyloid form. Our studies reveal that aggregated Sup35 retains its normal function as a translation release factor. However, fluctuations in the composition and size of these complexes specifically alter the level of this aggregate-associated activity and thereby the severity and toxicity of the amyloid state. Thus, amyloid heterogeneity is a crucial contributor to protein-only phenotypes. 1 Department of Molecular Biology, Brown University, Cell Biology and Biochemistry, 185 Meeting St., Providence, Rhode Island 02912, USA. 2 Merced Applied Mathematics, School of Natural Sciences, University of California, 5200 Lake Road, Merced, California 95343, USA. w Present addresses: New England Biolabs, 240 County Road, Ipswich, Massachusetts, 01938, USA (J.A.P.); Department of Biochemistry, Brandeis University, 415 South Street, Waltham, Massachusetts 02454, USA (J.V.); Department of Molecular and Cellular Biology, The University of Arizona, 1007 E.
    [Show full text]
  • Reviews/0006.1
    http://genomebiology.com/2002/3/5/reviews/0006.1 Review The diversity of acetylated proteins comment Bogdan Polevoda and Fred Sherman Address: Department of Biochemistry and Biophysics, University of Rochester School of Medicine and Dentistry, Rochester, New York 14642, USA. Correspondence: Fred Sherman. E-mail: [email protected] reviews Published: 30 April 2002 Genome Biology 2002, 3(5):reviews0006.1–0006 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2002/3/5/reviews/0006 © BioMed Central Ltd (Print ISSN 1465-6906; Online ISSN 1465-6914) Abstract reports Acetylation of proteins, either on various amino-terminal residues or on the 0-amino group of lysine residues, is catalyzed by a wide range of acetyltransferases. Amino-terminal acetylation occurs on the bulk of eukaryotic proteins and on regulatory peptides, whereas lysine acetylation occurs at different positions on a variety of proteins, including histones, transcription factors, nuclear import factors, and ,-tubulin. deposited research Modification of proteins extends the range of possible mole- Amino-terminal acetylation cular structures beyond the limits imposed by the 20 Cotranslational amino-terminal acetylation of encoded amino acids and, if reversible, gives a means of eukaryotic proteins control and signaling. Many proteins are acetylated, both co- Studies in vitro indicate that amino-terminal acetylation of and post-translationally, and at least for eukaryotic proteins, eukaryotic proteins takes place when there are between 20 acetylation is the most common covalent modification out of and 50 residues protruding from the ribosome [1,11]. Proteins refereed research over 200 types that have been reported.
    [Show full text]
  • Review Article Arrest-Defective-1 Protein (ARD1): Tumor Suppressor Or Oncoprotein?
    Am J Transl Res 2010; 2(1): 56-64 www.ajtr.org /AJTR912003 Review Article Arrest-defective-1 protein (ARD1): tumor suppressor or oncoprotein? Hsu-Ping Kuo 1,2, Mien-Chie Hung 1,2,3,4 1Department of Molecular and Cellular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA, 2Graduate School of Biomedical Sciences, The University of Texas Health Science Center, Houston, TX 77030, USA, 3Center for Molecular Medicine and Graduate Institute of Cancer Biology, China Medical University and Hospital, Taichung 404, Taiwan, 4Asia University, Taichung 413, Taiwan Received December 10, 2009, accepted December 18, 2009, available online January 1, 2010 Abstract: Arrest-defect-1 protein (ARD1), an acetyltransferase, catalyzes N—α-acetylation in yeast. In mammalian cells, both N-α-acetylation and ε-acetylation induced by ARD1 have been reported. Emerging evidence has revealed that ARD1 is involved in a variety of cellular functions, including proliferation, apoptosis, autophagy, and differentia- tion and that dysregulation of ARD1 is associated with tumorigenesis and neurodegenerative disorder. This review will discuss recent discoveries regarding variations among the different ARD1 isoforms, the associated biological functions of ARD1, and ARD1 localization in different cells. We will also discuss the potential upstream regulators and downstream targets of ARD1 to provide new avenues for resolving its controversial roles in cancer development. Keywords: ARD1, acetyltransferase, acetylation, tumorigenesis Introduction Although the most frequently acetylated resi- dues are Ser, Ala, and Met, other residues may Arrest-defect-1 protein (ARD1) was first identi- also be substrates for this type of modification fied in yeast and is responsible for the N- [5].
    [Show full text]