Activation of the Omega-3 Fatty Acid Receptor GPR120 Protects Against Focal Cerebral Ischemic Injury by Preventing Inflammation

Activation of the Omega-3 Fatty Acid Receptor GPR120 Protects against Focal Cerebral Ischemic Injury by Preventing Inflammation and Apoptosis in Mice This information is current as of September 25, 2021. Zhiping Ren, Lin Chen, Yimeng Wang, Xinbing Wei, Shenglan Zeng, Yi Zheng, Chengjiang Gao and Huiqing Liu J Immunol 2019; 202:747-759; Prepublished online 31 December 2018; doi: 10.4049/jimmunol.1800637 Downloaded from http://www.jimmunol.org/content/202/3/747

Supplementary http://www.jimmunol.org/content/suppl/2018/12/28/jimmunol.180063 http://www.jimmunol.org/ Material 7.DCSupplemental References This article cites 50 articles, 8 of which you can access for free at: http://www.jimmunol.org/content/202/3/747.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Activation of the Omega-3 Fatty Acid Receptor GPR120 Protects against Focal Cerebral Ischemic Injury by Preventing Inﬂammation and Apoptosis in Mice

Zhiping Ren,* Lin Chen,* Yimeng Wang,* Xinbing Wei,* Shenglan Zeng,* Yi Zheng,†,‡,x Chengjiang Gao,†,‡,x and Huiqing Liu*

G protein–coupled receptor 120 (GPR120) has been shown to negatively regulate inﬂammation and apoptosis, but its role in cerebral ischemic injury remains unclear. Using an in vivo model of middle cerebral artery occlusion (MCAO) and an in vitro model of oxygen-glucose deprivation (OGD), we investigated the potential role and molecular mechanisms of GPR120 in focal cerebral ischemic injury. Increased GPR120 expression was observed in microglia and neurons following MCAO-induced ische-

mia in wild type C57BL/6 mice. Treatment with docosahexaenoic acid (DHA) inhibited OGD-induced inflammatory response in Downloaded from primary microglia and murine microglial BV2 cells, whereas silencing of GPR120 strongly exacerbated the inflammation induced by OGD and abolished the anti-inflammatory effects of DHA. Mechanistically, DHA inhibited OGD-induced inflammation through GPR120 interacting with b-arrestin2. In addition to its anti-inflammatory function, GPR120 also played a role in apoptosis as its knockdown impaired the antiapoptotic effect of DHA in OGD-induced rat pheochromocytoma (PC12) cells. Finally, using MCAO mouse model, we demonstrated that GPR120 activation protected against focal cerebral ischemic injury by preventing inflammation and apoptosis. Our study indicated that pharmacological targeting of GPR120 may provide a novel http://www.jimmunol.org/ approach for the treatment of patients with ischemic stroke. The Journal of Immunology, 2019, 202: 747–759.

schemic stroke remains the leading cause of mortality and anti-inflammatory and antiapoptotic properties will be potentially adult disabilities in both developed and developing countries beneficial for patients with cerebral ischemia. I (1, 2). Middle cerebral artery occlusion (MCAO) is the most G protein–coupled receptors (GPCRs) are members of the common cause of ischemic stroke, resulting in high mortality rates largest and most diverse family of cell membrane protein recep- of 40–80% (3). Although thrombolytic therapy has been approved tors, which regulate a variety of physiological processes and are to treat ischemic stroke by the Food and Drug Administration of targets of 40% of drugs. Approximately 100 GPCRs remain by guest on September 25, 2021 the United States, it can only be used in acute conditions, and classified as “orphan” receptors without identified ligands (8). contraindications are present in many patients. Thus, exploring Among the orphan GPCRs, GPR40 and GPR120 were found to be novel therapeutic methods is needed. Inflammatory response and activated by long-chain fatty acids: in particular, omega-3 fatty neuronal apoptosis have been indicated to play a role in the acids (v-3 FAs) (9, 10). v-3 FAs, mainly including docosahex- pathogenesis of cerebral ischemia (4–7). If so, agents that exhibit aenoic acid (DHA) and eicosapentaenoic acid, are rich in fish oil and significantly improve the health of patients suffering from chronic inflammatory diseases (11, 12). A recent study has dem- *Department of Pharmacology, School of Basic Medical Sciences, Shandong Uni- onstrated that eicosapentaenoic acid can prevent arterial calcifi- † versity, Jinan, Shandong 250012, China; State Key Laboratory of Microbial Tech- cation via GPR120 in klotho mutant mice (13). In addition, some nology, School of Basic Medical Sciences, Shandong University, Jinan, Shandong 250012, China; ‡Key Laboratory of Infection and Immunity of Shandong Province, small molecules have been found to activate the GPR120 receptor School of Basic Medical Sciences, Shandong University, Jinan, Shandong 250012, with an excellent activity (14). China; and xDepartment of Immunology, School of Basic Medical Sciences, Shan- dong University, Jinan, Shandong 250012, China Increasing evidence suggests that stimulation of GPR120 by v-3 FAs exerts anti-inflammatory effects in a broad type of cells, in- Received for publication May 4, 2018. Accepted for publication November 22, 2018. cluding macrophages, mature adipocytes, Kupffer cells, and hypo- This work was supported by National Natural Science Foundation of China Grants 81571171 and 81200904, Shandong Province Key Research and Development Plan thalamic neurons (15–17). The coupling of ligand-stimulated Grant 2017GSF218030, and Shandong Provincial Natural Science Foundation Grant GPR120 to b-arrestin2 induces receptor endocytosis with subse- ZR2017MH010. quent inactivation of TGF-b–activated kinase 1 (TAK1), which in Address correspondence and reprint requests to Dr. Huiqing Liu or Prof. Chengjiang turn provides an inhibitory mechanism on inflammatory signaling Gao, Department of Pharmacology, School of Basic Medical Sciences, Shandong University, Wenhua West Road 44, Jinan, Shandong 250012, People’s Republic of pathways (15). GPR120 activation also suppressed inflammation China (H.L.) or Department of Immunology, School of Basic Medical Sciences, and metabolic disorder by inhibiting inflammasome activation in Shandong University, Jinan, Shandong 250012, People’s Republic of China (C.G.). macrophages (18). In addition to its anti-inflammatory effect, E-mail addresses: [email protected] (H.L.) or [email protected] (C.G.) GPR120 signaling also regulates ERK and PI3K-AKT pathways The online version of this article contains supplemental material. and leads to an antiapoptotic effect in a murine enteroendocrine cell Abbreviations used in this article: AAV, adeno-associated virus; CBA, cytometric bead array; CCK-8, cell counting kit-8; DHA, docosahexaenoic acid; v-3 FA, line (19); another study showed that it counteracted dexamethasone- omega-3 fatty acid; GPCR, G protein–coupled receptor; MCAO, middle cerebral induced cell apoptosis in mesenchymal stem cells (20). artery occlusion; OGD, oxygen-glucose deprivation; qPCR, quantitative real-time A recent study showed that fish oil supplements in a daily diet PCR; shRNA, short hairpin RNA; siRNA, small interfering RNA; WT, wild-type. improved the prognosis of patients with ischemic stroke (21). Copyright Ó 2019 by The American Association of Immunologists, Inc. 0022-1767/19/$37.50 GPR120 in the hypothalamus and anterior pituitary gland has www.jimmunol.org/cgi/doi/10.4049/jimmunol.1800637 748 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY been shown to control their function (16, 22–24). Given the Experimental design anti-inflammatory and antiapoptotic functions of GPR120, we Four experiments were conducted in our study (Fig. 1). The first experiment hypothesize that GPR120 activation may protect against cerebral examined the temporal profile and cellular localization of GPR120 ex- ischemic injury by modulating the inflammatory and apoptotic pression in cortex after focal ischemic brain injury in mice (Fig. 1A). response in the ischemic regions. In this study, we tested this Assessment methods included quantitative real-time PCR (qPCR), Western hypothesis by using an in vivo MCAO model in mice and an blot, and double immunofluorescence staining. The second experiment used qPCR and Western blot to measure the expression of GPR120 in in vitro model of oxygen-glucose deprivation (OGD) in cultured microglia and neurons subjected to OGD (Fig. 1B). The third experiment cells. investigated the function and mechanism of GPR120 in microglia and neurons subjected to OGD (Fig. 1C). Endogenous GPR120 in BV2 and PC12 cells was knocked down using small interfering RNA (siRNA). DHA Materials and Methods (80 mM) was used to activate GPR120 before the OGD injury. To assess Chemicals and reagents the anti-inflammatory effect of GPR120 in BV2 cells, qPCR, Western blot, ELISA, and coimmunoprecipitation were performed. For evaluation of the DHA (D2534) and LY294002 (L9908) were purchased from Sigma-Aldrich (St. role and mechanism of GPR120 in PC12 cells in the condition of OGD, Louis, MO). U0126 (S1901) was purchased from Beyotime (Haimen, China). 10 mM U0126 (inhibitor of ERK1/2) or 10 mM LY294002 (inhibitor of Experimental animals PI3K) was used prior to DHA pretreatment (Fig. 1D). Assessments included quantitative qPCR, Western blot, cell counting kit-8 (CCK-8) assay, Eight-week-old male wild-type (WT) C57BL/6 mice were purchased from and flow cytometry. The fourth experiment was performed to evaluate the the Experimental Animal Center of Shandong University. Mice were role of GPR120 in MCAO mice model (Fig. 1E). Adeno-associated virus maintained under specific pathogen-free conditions in individual cages at (AAV)–Gfp or AAV containing short hairpin RNA (shRNA) targeting 6 21 3˚C with 12 h light/dark cycle and free access to food and water. GPR120 (AAV-shGPR120) was injected into the left cortex of mice using a Downloaded from All studies were approved by the Institutional Animal Care and Use stereotaxic apparatus; 3 w after the AAV virus injection, DHA (200 mg/kg, Committee of Shandong University. once a day) was administered orally for 2 w; mice were subsequently http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 1. A diagram of the experimental design. (A) Experimental design for evaluation of GPR120 expression in cortex after focal ischemic brain injury in mice. (B) Experimental design for evaluation of GPR120 expression in microglia and neuron cells subjected to OGD in vitro. (C and D) Ex- perimental design to explore the role and mechanism of GPR120 in microglia and neuron subjected to OGD in vitro. (E) Experimental design for evaluating the role of GPR120 in cerebral ischemic injury in vivo. The Journal of Immunology 749 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. The expression of GPR120 was increased after focal ischemic brain injury in WT mice. (A) The mRNA and (B) protein levels of GPR120 were increased in ischemic penumbral cortex after MCAO. (C–F) Representative images and quantification of double immunostaining for GPR120 (green) in microglia cells (CD11b, myeloid cell marker) (C and D), neurons (NeuN, neuron marker) (E and F), and astrocytes (GFAP, astrocyte marker) (G and H) 24 h after MCAO. Scale bar, 50 mm. Data are expressed as mean 6 SEM, n = 6 mice per group. *p , 0.05, versus sham group. 750 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY subjected to the model of MCAO. Evaluation was performed as follows: 1) neurologic score, 2) infract volume by TTC staining, 3) qPCR, 4) Western blot, and 5) cytometric bead array (CBA) analysis. Model for focal cerebral ischemia The model of cerebral focal ischemia was established by intraluminal occlusion of the left middle cerebral artery using a silicone rubber-coated nylon mono- filament (25). A successful occlusion was confirmed by a marked reduction in the regional cerebral blood flow to ,20% of the baseline using a laser Doppler blood flow monitor (Moor, England) with a probe attached to the skull in the area of cerebral cortex supplied by the middle cerebral artery. DHA (200 mg/kg) was orally administered for 2 w before MCAO. Immunofluorescence staining For histological analysis, brain sections were prepared in coronal section (10 mm). Samples were double-labeled with anti-GPR120 Ab and one of the following Abs: anti–glial fibrillary acidic protein (clone GA5, 1:200 dilution; Millipore) for astrocytes, anti-NeuN (clone A60, 1:200 dilution; Millipore) for neurons, or anti-CD11b (1:200 dilution; Millipore) for microglia. After 4˚C overnight incubation, secondary Abs including Alexa Fluor 488 donkey anti-rabbit IgG Ab (1:200 dilution; Invitrogen,

Gaithersburg, MD) or 594 rabbit anti-Mouse IgG Ab (1:200 dilution; Downloaded from Invitrogen) were added for 2 h at room temperature. After washing three times, the sections were incubated with a solution containing 200 mg/ml of DAPI (Beyotime) for nuclear staining. Immunofluorescence staining was performed to determine the cell distribution of GPR120 in the cortex of the mice. Cell culture and treatment http://www.jimmunol.org/ The microglial cell line BV2 cells from China Center for Type Culture Collection (Wuhan, China) and neuronal cell line PC12 cells from the Cell Center of Chinese Academy of Sciences (Shanghai, China) were cultivated to 80% confluence in DMEM (Hyclone) supplemented with 10% FBS (Gibicol). Primary microglia was isolated and cultured as described previously by Butovsky et al. (26). The cells were subjected to the model of OGD for 2 h, followed by reperfusion for different time points. To establish OGD conditions, cells were incubated with glucose- free Earle’s balanced salt solution for 2 h in a hypoxic chamber that was continuously flushed with 95% N2 and 5% CO2 at 37˚C to obtain ,0.5% by guest on September 25, 2021 O2. Reoxygenation was obtained by exposing cells at normal culture conditions (37˚C, 95% air, 5% CO2) in regular medium. Cells were pretreated with DHA (80 mM) for 2 h prior to OGD (Fig. 1C). The proper doses of DHA were selected following a dose response experiment (Supplemental Fig. 1A–C). For experiments with ERK1/2 and PI3K inhibitors, PC12 cells were treated with 10 mM U0126 (inhibitors ofERK1/2)or10mM LY294002 (inhibitors of PI3K) for 1 h prior to DHA pretreatment (Fig. 1D). Cell transfection Specific siRNAs against GPR120 and the siRNA control were purchased from Sigma-Aldrich. GPR120 siRNA sequences were as follows: no. 1, sense: 59-GCGAAAUGACUUGUCUGUUdTdT-39 and antisense: 59-AACA- GACAAGUCAUUUCGCdTdT-39, no. 2, sense: 59-CUUACGCUGAGCUU- GGCAUdTdT-39 and antisense 59-AUGCCAAGCUCAGCGUAAGdTdT-39, no. 3, sense: 59-CUGCUCUUCUACGUGAUGAdTdT-39 and antisense 59-UCAUCACGUAGAAGAGCAGdTdT-39. b-Arrestin2–specific shRNA and scrambled shRNA were kind gifts from Dr. D. Yin. Transfection was performed using Lipofectamine 3000 (Invitrogen). Western blot Western blot was performed as described previously (27). Briefly, total proteins were isolated from mouse penumbral cortex and cultured cells with RIPA buffer (Beyotime). Protein concentrations were determined using a BCA protein assay reagent kit (Beyotime). The primary Abs used in this study included anti-GPR120 (SAB4501490) and anti-ERK (M5670) FIGURE 3. GPR120 expression was increased in microglia BV2 cells from Sigma Aldrich; anti–b-arrestin2 (sc-13140) from Santa Cruz Bio- and PC12 cells after OGD in vitro. (A) The mRNA and (B) protein levels technology (Dallas, TX); anti–phospho-JNK (9251), anti–phospho-p38 of GPR120 were determined by real-time PCR and Western blot in (9216), anti–phospho-ERK (4370S), anti–phospho-AKT (4058S), microglia cells subjected to OGD and reoxygenation. (C) Real-time PCR anti-COX2 (4842), and anti–Bcl-2 (2870) from Cell Signaling Technology and (D) Western blot analysis of GPR120 in PC12 cells subjected to OGD (Beverly, MA); anti-p38 (14064-1-AP), anti-JNK (24164-1-AP), anti-AKT 6 (60203-I-Ig), and anti-Bax (50599-2-Ig) from Proteintech (Wuhan, China). and reoxygenation. Data are expressed as the mean SEM of four in- The signals were quantified by scanning densitometry and data within a dependent experiments. *p , 0.05, versus control group. linear range were quantified using Image Quant software (GE Amersham, Piscataway, NJ). The Journal of Immunology 751

Table I. List of primers used for qPCR

Target Gene Sequence of Forward Primer (59-39) Sequence of Reverse Primer (59-39) b-actin AGGGCTATGCTCTCCCTCAC CTCTCAGCTGTGGTGGTGAA GAPDH TGCATCCTGCACCACCAACTGC ACAGCCTTGGCAGCACCAGTGG GPR120 AGAGGCTTACGCTGAGCTTG TGGATCAAGATGAGGAGG IL-1b ACCTTCCAGGATGAGGACATGA AACGTCACACACCAGCAGGTTA IL-6 ACAACCACGGCCTTCCCTAC CATTTCCACGATTTCCCAGA TNF-a GTGAAGGGAATGGGTGTT GGTCACTGTCCCAGCATC

RNA extraction and qPCR by one-way ANOVA followed by LSD post hoc test using the SPSS statistical software. When equal variances were not assumed, a Dunnett Total RNA was extracted using acid-phenol reagent TRIzol (Sangon multiple comparisons test was used to compare the differences between Biotech). The cDNA was synthesized using Takara reverse transcriptase groups. A value of p , 0.05 was considered statistically signiﬁcant. (Bio-Rad, Hercules, CA). Real-time PCR analysis was performed using SYBR Green reagents (Invitrogen Applied Biosystems, Carlsbad, CA) and a Bio-Rad iCycler system (Bio-Rad). The mRNA levels were calibrated using Results b-actin or GAPDH as controls. The primers for target genes in this study were synthesized by Generay Biotechnology (Beijing, China) and are GPR120 expression was upregulated in brain after focal listed in Table I. ischemic cerebral injury Downloaded from ELISA We measured the protein and mRNA expression of GPR120 in a well-established mouse model of cerebral ischemia induced by Supernatants from BV2 cell were assayed for mouse IL-1b (DRKEWE, MCAO (Fig. 1). As shown in Fig. 2A, 2B, GPR120 expression DKW12-2012-096) according to manufacturer’s instruction. was upregulated in ischemic penumbra of cortex with a peak CBA assay expression at 24 h and last until 48 h after ischemia. Double

immunofluorescence staining showed GPR120 was present in http://www.jimmunol.org/ IL-6, IL-12p70, MCP-1, TNF-a, and IL-10 in mice cortex were captured by CBA (552364; BD Biosciences) according to the manufacturer’s microglia, neurons, and astrocytes. We further quantified the manual. Cytokine levels were then quantified by flow cytometry (Beckman numbers of microglia, neurons, and astrocytes that expressed Coulter). GPR120. Quantification of the fluorescent images in the cortex showed that 31% of microglia in sham group were immuno- Coimmunoprecipitation positive for GPR120, whereas the number was increased in Lysates of BV2 cells (600 mg protein content) were incubated with 1 mg of MCAO group (91%) (Fig. 2C, 2D). In addition to microglia, anti-GPR120 Ab at 4˚C for 6 h. Forty microliters of Protein A+G was then GPR120 immunoreactivity was much higher in neurons in MCAO added into immune complexes for shaking at 4˚C for overnight. Immune complex elutes were separated by SDS-PAGE, and membranes were in- group (34%) when compared with neurons in sham group (8%) cubated with either b-arrestin2 or GPR120 Abs. (Fig. 2E, 2F). In contrast, similar numbers of GPR120-positive by guest on September 25, 2021 astrocytes were observed in sham and MCAO group (Fig. 2G, Cell viability assessment 2H). Because GPR120 was upregulated in microglia and neurons Cell viability was assessed by CCK-8 (Beyotime). but not in astrocytes, we then focused on microglia and neurons in our in vitro studies to explore the role and mechanisms of GPR120 Flow cytometry in ischemic stroke. Consistent with the findings in mouse MCAO The number of apoptotic cells was determined by flow cytometry (Beckman model, GPR120 was also upregulated in microglia BV2 cells Coulter) using annexin V–FITC/propidium iodide apoptosis detection kit (Fig. 3A, 3B) and PC12 cells (Fig. 3C, 3D) when subjected to (4A Biotech, Beijing, China). OGD and reperfusion. The results suggested that GPR120 is in- Cortex AAV delivery volved in the pathological process of cerebral ischemia. AAV-Gfp and AAV-shGPR120 were designed and purchased from the Shanghai GPR120 mediated the anti-inflammatory effect in microglia Hanbio. Eight-week-old male WT C57BL/6 mice were anesthetized and placed subjected to OGD on a stereotaxic apparatus for left cortical injection of 4 ml of AAV-Gfp or AAV- shGPR120 suspension (2 3 1012 mg/ml) at a rate of 0.2 ml/min. The coordinates To further investigate the role of GPR120 in the process of (Supplemental Fig. 4A) were adjusted according to the previous report (28) as cerebral ischemia, siRNA was transfected to reduce the en- follows: point 1, 0.3 mm anterior to the bregma, 3 mm lateral, 2 mm deep; point dogenous level of GPR120 in BV2 cells. Among three siRNAs 2, 1.9 mm posterior to the bregma, 3 mm lateral, 2 mm deep. Three weeks after targeting GPR120, siGPR120 no. 1 showed the highest effi- the AAV virus injection, DHA (200 mg/kg) was administered orally. After ∼ another 2 w, mice were subjected to model of MCAO. ciency, with 71% reduction in GPR120 mRNA (Fig. 4A) and 75% reduction at protein level (Fig. 4B). Therefore, it was used Neurological function and infract volume assessment toknockdownGPR120inthefollowingexperiments.Inthe Twenty-four hours after MCAO, a four-tiered neurologic scoring system absence of DHA and GRP120 knockdown, cells subjected and infarct volume were used to determine the outcome by a blinded to OGD showed increased JNK and p38 phosphorylation observer as described previously (27, 29). (Fig. 4C), increased COX2 protein expression (Fig. 4D), in- TUNEL staining creased mRNA expression of IL-6, TNF-a, and IL-1b (Fig. 4E–G), and increased secretion of IL-1b (Fig. 4H). All TUNEL assay was performed to measure apoptotic cells. Using the In-Situ Cell Death Detection Kit, TMR red (catalog no. 18173100; Roche), brain sections these changes was significantly repressed by DHA pretreatment were treated following the procedures illustrated by the manufacturer. (Fig. 4C–H, comparison between columns no. 3 and columns no. 2). However, the effects of DHA were completely abolished Statistical analysis by GPR120 knockdown (Fig. 4C–H, comparison between col- Data were expressed as means 6 SEM. The significance of the differ- umns no. 6 and columns no. 3). In addition, the knockdown of ences in mean values between and within multiple groups was examined GPR120 strongly exacerbated the inflammation induced by 752 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. GPR120 mediated the anti-inﬂammatory effect in microglia subjected to OGD. Knockdown efﬁciency of three siRNA sequences targeting GPR120 (siGPR120) was evaluated by (A) real-time PCR and (B) Western blot in microglia cells. Cells transfected with negative control (NC) or siGPR120 were treated with 80 mM of DHA for 2 h prior to OGD treatment. (C) p-JNK and p-p38 as well as (D) COX2 protein levels in microglia were evaluated by Western blot 12 h after reperfusion. The mRNA levels of (E) IL-6, (F) TNF-a, and (G) IL-1b were measured by real-time PCR in microglia subjected to OGD. (H) IL-1b level in medium was measured by ELISA. Data are expressed as the mean 6 SEM of four independent experiments. *p , 0.05, versus indicated group. The Journal of Immunology 753 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 5. GPR120 interacted with b-arrestin2 to mediate anti-inflammatory effects in microglia subjected to OGD. (A) Coimmunoprecipitation between GPR120 and b-arrestin2 in BV2 cells subjected to OGD and reoxygenation. (B) DHA promoted the interaction between GPR120 and b-arrestin2 in microglia subjected to OGD. BV2 cells was treated with DHA prior to OGD, then the cell lysates were immunoprecipitated with anti-GPR120 Ab followed by the analysis by Western blot. (C) The knockdown of b-arrestin2 suppressed the anti-inflammatory effects induced by DHA in microglia subjected to OGD. BV2 cells were transfected with either specific b-arrestin2 shRNA or scrambled shRNA. Western blot were used to analyze for COX-2 protein level in BV2 cells after treated with DHA prior to OGD. (D) IL-1b level in medium was measured by ELISA. Data are expressed as the mean 6 SEM of four independent experiments. *p , 0.05, versus indicated group.

OGD in the absence of DHA (Fig. 4C–H, comparison between strongly suggested that GPR120 played an anti-inflammatory role columns no. 5 and columns no. 2). As Butovsky et al. (26) in microglia subjected to OGD. recently reported that monocytes recruited to the CNS as well as microglia cell lines behaved differently from in vivo GPR120 mediated anti-inflammatory effects by interacting b microglia, we next cultured primary mouse microglia and with -arrestin2 in microglia subjected to OGD tested the expression and the effect of GPR120 on the inflam- It is known that b-arrestin2 interacts with activated GPR120 to mation induced by OGD. As shown in Supplemental Fig. 2, inhibit the inflammatory response. However, whether this in- OGD also significantly induced the expression of GPR120, teraction is affected by cerebral ischemic injury remains un- and GPR120 activation by DHA negatively regulated the in- known. As shown in Fig. 5A, the binding between GPR120 and flammation induced by OGD in primary microglia. These are b-arrestin2 was reduced after OGD and reperfusion and consistent with the phenomenon observed in BV2 cells. The data reached its lowest level at 12 h. The decreased interaction 754 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 6. GPR120 knockdown exacerbated cell apoptosis in PC12 cells. PC12 cells transfected with negative control (NC) or siGPR120 were treated with 80 mm of DHA for 2 h prior to OGD. (A) Flow cytometry analysis, (B) quantification of apoptotic PC12 cells, and (C) cell viability was determined by CCK-8 assay. (D) The impact of DHA and GPR120 knockdown on Bcl-2 and Bax evaluated by Western blot. (E) p-AKT and p-ERK protein levels in PC12 cells were evaluated by Western blot in the presence or absence of DHA and GPR120 shRNA. (F) DHA inhibited apoptosis through PI3K/AKT signaling. PC12 Cells were treated with 80 mM DHA in the presence or absence of 10 mM Erk1/2 inhibitor (U126) or 10 mM AKT inhibitor (LY294002). The protein levels of Bcl-2 and Bax were examined by Western blot. Data were expressed as the mean 6 SEM. *p , 0.05 compared with indicated group. The Journal of Immunology 755 between GPR120 and b-arrestin2 might explain the persis- tent inflammation even though the GPR120 expression was significantly increased in microglia subjected to OGD (Fig. 3A, 3B). DHA pretreatment markedly increased the binding be- tweenGPR120andb-arrestin2 (Fig. 5B). Moreover, the knockdown of b-arrestin2 abolished the anti-inflammation function of DHA (Fig. 5C, 5D). These results indicated that activated GPR120 inhibited OGD-induced inflammation by interacting with b-arrestin2. GPR120 mediated the antiapoptotic effect in PC12 cells subjected to OGD As GPR120 expression was increased in neurons after cerebral ischemia, it is of interest to investigate the direct role of GPR120 in neurons. The knockdown efficacy of siGPR120 no. 1 in PC12 cells was confirmed by Western blot analysis (Supplemental Fig. 3A). Interestingly, different from microglia, neither GPR120 activation nor GPR120 knockdown affected the inflammatory response induced by OGD in PC12 cells (Supplemental

Fig. 3B, 3C). Next, we tested the role of GPR120 in OGD-induced Downloaded from apoptosis. GPR120 knockdown impaired the antiapoptotic effect of DHA, demonstrated as the increased percentage of apoptotic cells and the decreased ratio of Bcl-2/Bax (Fig. 6A, 6B, 6D). Moreover, GPR120 knockdown also reduced the cell viability in PC12 cells subjected to OGD (Fig. 6C). It has been known that the

downstream targets of GPR120 that are involved in modulating http://www.jimmunol.org/ cell apoptosis include two signaling pathways: Ras-Erk1/2 (30) and PI3K-AKT (19). In PC12 cells, we found that OGD promoted the phosphorylation of ERK and inhibited AKT phosphorylation (Fig. 6E). DHA pretreatment significantly inhibited the ERK phosphorylation and enhanced AKT phosphorylation, whereas these effects were abolished by GPR120 knockdown (Fig. 6E, comparison between columns no. 6 and columns no. 3). To determine whether both or one of these two pathways are involved in apoptosis, we next used inhibitors targeting by guest on September 25, 2021 these two pathways. We found that the ratio of Bcl-2/Bax was reduced by LY294002 (the inhibitors of AKT) treatment, whereas U0126 (the inhibitors of Erk1/2) treatment did not affect DHA-induced the antiapoptotic effect (Fig. 6F). These results indicated that antiapoptotic effect of GPR120 in PC12 cells subjected to OGD was at least partially AKT dependent. FIGURE 7. DHA improved while GPR120 knockdown exacerbated The role of GPR120 in MCAO mouse model stroke outcomes. AAV containing shRNA targeting GPR120 (shGPR120) was injected into the left cortex of WT mice. Three weeks after the AAV Because our in vitro studies demonstrated that GPR120 played virus injection, DHA (200 mg/kg) was administered orally for 2 w, then an important role in inhibiting inflammation and apoptosis, we mice were subjected to model of MCAO. (A) Neurological deficit scores. next aimed to confirm the role of GPR120 in MCAO mouse (B) Representative photographs of coronal brain sections after MCAO, model. AAV harboring shGPR120 was used to inhibit GPR120 stained with 2, 3, 5-triphenyltetrazolium chloride. Red tissue is healthy; expression. Unilateral injections of the shGPR120 virus into white tissue is infarcted. (C) Summary of cerebral infarct volume in brains. brain resulted in ∼50% reduction of GPR120 expression as The infarct volume was expressed as the percentage of the contralateral showninSupplementalFig.4B–E. DHA pretreatment resulted hemispheric area. Data are expressed as the mean 6 SEM, n = 6 mice per , in a significant decrease in neurologic scores and an obviously group. *p 0.05, versus indicated group. smaller infarct volume when compared with control mice at 24 h after MCAO (Fig. 7A–C). Similar to in vitro results, these effects (Fig. 8A–H, comparison between column no. 3 to GPR120 knockdown also abolished DHA’s effect (Fig. 7A–C). column no. 2). GPR120 knockdown completely abolished DHA’s In addition, mice with GPR120 knockdown showed worse effects (Fig. 8A–H, comparison between column no. 6 to column neurologic dysfunctions (Fig. 7A) and larger infarction no. 3). Furthermore, MCAO-induced inflammation was remark- volumes when compared with WT mice at 24 h after MCAO (Fig. ably exacerbated in GPR120 knockdown mice (Fig. 8A–H, 7B, 7C, comparison between column no. 4 and column no. 1). comparison between column no. 5 to column no. 2). In this study, Next we examined the impact of DHA and GPR120 shRNA on we also measured the level of TNF-a and IFN-g in MCAO model. MCAO-induced inflammation in vivo. Similar to the in vitro As shown in Fig. 8G, 8H, their levels were not changed signifi- findings, MCAO induced phosphorylation of JNK and p38 cantly. In addition to their roles in inflammation, we also observed (Fig. 8A), enhanced COX2 protein expression (Fig. 8B), and in- that DHA treatment significantly increased the ratio of Bcl-2 and creased the secretion of various cytokines including MCP-1, IL-6, Bax (Fig. 9A) and inhibited the apoptosis (Fig. 9B, 9C). GPR120 IL-12, and IL-10 (Fig. 8C–F). Pretreatment with DHA reversed knockdown reversed the DHA’s effect (Fig. 9A–C). These results 756 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 8. The role of GPR120 in inﬂammatory response in mice with MCAO. AAV containing shRNA targeting GPR120 was injected into the left cortex of WT mice. Three weeks after the AAV virus injection, DHA (200 mg/kg) was administered orally for 2 w, then mice were subjected to model of MCAO. (A) p-p38, p-JNK, and (B) COX2 protein in extracts from the penumbral cortex of the mice after 24 h MCAO were determined by Western blot. Scale bars, 50 mm. (C) MCP-1, (D) IL-6, (E) IL-12P70, (F) IL-10, (G) TNF-a, and (H) IFN-g in ischemic brain were evaluated by CBA. Data are expressed as the mean 6 SEM, n = 6 mice per group. *p , 0.05, versus indicated group. The Journal of Immunology 757 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 9. The role of GPR120 on the apoptosis in mice with the MCAO. AAV containing shRNA targeting GPR120 was injected into the left cortex of WT mice. Three weeks after the AAV virus injection, DHA (200 mg/kg) was administered orally for 2 w, then mice were subjected to model of MCAO. (A) The protein levels of Bcl-2 and Bax in the penumbral cortex after 24 h MCAO were determined by Western blot analysis. (B) Representative images and quantification of apoptosis based on TUNEL assay in the cortical ischemic penumbra 24 h after MCAO. Data are expressed as the mean 6 SEM, n = 6 mice per group. *p , 0.05, versus indicated group. indicated that activation of GPR120 protected against focal cere- upregulated in the subgranular zone and promoted hippocam- bral ischemic injury in mice by preventing inflammation and ap- pal neurogenesis after transient global brain ischemia (36). optosis in MCAO mice model. GPR120 is another important receptor for v-3 FAs (15, 18, 37), and its role in cerebral ischemic injury remains unclear. A Discussion previous study has demonstrated that the expression level of Previous studies have demonstrated that v-3 FAs, especially GPR120 in the brain, including cortex, was much lower than DHA, exerted protective effects in ischemic stroke (31–34). that in peripheral tissues (22). In our study, we found that the GPR40, a receptor for v-3 FAs, is expressed in a wide variety expression of GPR120 was remarkably increased in the penumbra of of cells in the CNS and b cells in the pancreas (35). Recently, cortex after ischemic injury. Consistent with a previous report studies have showed that GPR40 expression was significantly (22), the immunofluorescence results demonstrated that GPR120 758 GPR120 SIGNALING PROTECTS AGAINST CEREBRAL ISCHEMIC INJURY is predominantly expressed in microglia in the sham group. aggravated the stroke outcomes. GPR120 activation signifi- However, the expression of GPR120 was significantly upregulated cantly inhibited MCAO-induced phosphorylation of JNK, p38, in both microglia and neurons after MCAO. These data suggested as well as the expression of COX2 and promoted AKT phosphory- a potential role of GPR120 in microglia and neurons after ische- lation, thereby exhibiting anti-inflammatory and antiapoptotic effects. mic stroke. Thus, it is valuable to investigate the role and un- Knockdown of GPR120 significantly suppressed the anti- derlying mechanisms of v-3 FA receptor GPR120 in cerebral inflammatory and antiapoptotic effects induced by DHA. These re- ischemic stroke. sults demonstrated that activation of GPR120 protected against focal We further found that GPR120 agonist DHA inhibited OGD- cerebral ischemic injury by preventing inflammation and apoptosis. induced inflammatory response in microglia, whereas knockdown To the best of our knowledge, this is the first study that illustrated of GPR120 exacerbated the inflammation induced by OGD and the function of GPR120 in cerebral ischemia. abolished the anti-inflammatory effects of DHA. These data Of note, DHA, a GPR120 agonist, may also play its role via other strongly suggested that GPR120 is a critical regulator of inflam- mechanisms. Recent studies have indicated that metabolic products mation. It is known that b-arrestins serve as important adaptor derived from v-3 FAs, such as resolvins, protectins, and maresins, molecules to mediate the functions of various GPCRs, as well as may play a role in the resolution of inflammation (48, 49). other receptor subtypes (38). The C-terminal region of GPR120 D-series resolvins, the bioactive metabolite of DHA, displayed contains several putative b-arrestin2 binding motifs, and the anti- potent anti-inflammatory actions in microglia (50), which could inflammation function mediated by GPR120 are b-arrestin2 provide another possible mechanism for DHA-induced anti- dependent (15, 38, 39). DHA inhibits both TLR and TNF-a inflammatory response. inflammatory signaling by affecting TAK1 activation through In summary, we concluded that the v-3 FA receptor Downloaded from GPR120/b-arrestin2/TAB1 interaction (15). GPR120 has also GPR120 protected against cerebral ischemic injury through been indicated to scaffold to nucleotide-binding domain and dual mechanisms: inhibiting the inflammatory responses via leucine-rich repeat containing protein through b-arrestin2 to GPR120/b-arrestin2 signaling pathway in microglia and prevent the formation of the NLRP3 inflammasome (18). In our inhibiting the apoptosis via PI3K/AKT signaling pathway in study, we demonstrated that the association between GPR120 neurons. Our results strongly suggested pharmacological targeting

and b-arrestin2 was reduced after OGD, whereas DHA treat- of GPR120 may provide a novel approach for the treatment of http://www.jimmunol.org/ ment led to the anti-inflammatory effects by promoting the patients with ischemic stroke. interaction between GPR120 and b-arrestin2 in microglia. These results suggested that GPR120 activation inhibited Acknowledgments the inflammation in ischemic stroke via its interaction with We thank Dr. Deling Yin for providing specific shRNA targeting b-arrestin2. ARRB2. We thank Dr. Wei Wang (Assistant Professor, Department Because GPR120 was markedly upregulated in neurons after of Hematopathology, The University of Texas MD Anderson Cancer ischemic injury, we further explored the potential role of Center) and Dr. Haitao Wen (Assistant Professor, Department of Micro- GPR120 in neurons subjected to OGD. Interestingly, in contrast bial Infection and Immunity, Ohio State University College of Medi- to its anti-inflammatory effect in microglia, GPR120 did not cine) for polishing the language. We also thank the Animal Facility by guest on September 25, 2021 affecttheinflammationinducedbyOGDinneuronPC12cells. of our Institute for mouse care. However, pretreatment of DHA inhibited OGD-induced apoptosis and improved cell viability in neurons, which were Disclosures abolished by knockdown of endogenous GPR120. The ERK The authors have no financial conflicts of interest. pathway has been linked to cell proliferation and growth (40). PI3K translocates to the plasma membrane and subsequently References phosphorylates AKT. As a key effector of PI3K, AKT also 1. Donnan, G. A., M. Fisher, M. Macleod, and S. M. Davis. 2008. Stroke. Lancet regulates various cellular responses, including cell prolifera- 371: 1612–1623. tion and cell survival (41–43), and can sustain Bcl-2 expression 2. Wang, P., T. Y. Xu, K. Wei, Y. F. Guan, X. Wang, H. Xu, D. F. Su, G. Pei, and in certain diseases (44, 45). Previous studies have shown that C. Y. Miao. 2014. ARRB1/b-arrestin-1 mediates neuroprotection through co- ordination of BECN1-dependent autophagy in cerebral ischemia. Autophagy 10: v-3 FAs promoted the activation of ERK and PI3K/AKT 1535–1548. pathways mainly via GPR120, exerting the antiapoptotic ef- 3. Rahme, R., R. Curry, D. Kleindorfer, J. C. Khoury, A. J. Ringer, B. M. Kissela, K. Alwell, C. J. Moomaw, M. L. Flaherty, P. Khatri, et al. 2012. How often are fect in certain cell lines (19, 30, 46, 47). Thus, we examined patients with ischemic stroke eligible for decompressive hemicraniectomy? PI3K/AKT and ERK pathways to investigate the antiapoptotic Stroke 43: 550–552. mechanism of GPR120 in brain ischemia. PC12 cells were 4. Muir, K. W., P. Tyrrell, N. Sattar, and E. Warburton. 2007. Inflammation and ischaemic stroke. Curr. Opin. Neurol. 20: 334–342. treated with inhibitors of the above two signaling pathways in 5. Amantea, D., G. Nappi, G. Bernardi, G. Bagetta, and M. T. Corasaniti. 2009. the presence of DHA. Only LY294002, a PI3K inhibitor, had Post-ischemic brain damage: pathophysiology and role of inflammatory medi- the ability to partially inhibit the antiapoptotic effect of DHA, ators. FEBS J. 276: 13–26. 6. Broughton, B. R., D. C. Reutens, and C. G. Sobey. 2009. Apoptotic mechanisms which demonstrated that the PI3K/AKT pathway is involved in after cerebral ischemia. Stroke 40: e331–e339. the antiapoptotic activity of GPR120 in brain ischemia. Of 7. Niizuma, K., H. Yoshioka, H. Chen, G. S. Kim, J. E. Jung, M. Katsu, N. Okami, and P. H. Chan. 2010. Mitochondrial and apoptotic neuronal note, besides the PI3K/AKT pathway, other pathways may also death signaling pathways in cerebral ischemia. Biochim. Biophys. Acta be involved in antiapoptotic effects mediated by GPR120. 1802: 92–99. Further studies are necessary to fully understand the mecha- 8. Civelli, O., R. K. Reinscheid, Y. Zhang, Z. Wang, R. Fredriksson, and H. B. Schio¨th. 2013. G protein-coupled receptor deorphanizations. Annu. Rev. nisms underlying the antiapoptotic activity of GPR120 and to Pharmacol. Toxicol. 53: 127–146. investigate how the PI3K/AKT pathway participates in the 9. Davenport, A. P., S. P. Alexander, J. L. Sharman, A. J. Pawson, H. E. Benson, antiapoptosis action mediated by GPR120 in neurons in brain A. E. Monaghan, W. C. Liew, C. P. Mpamhanga, T. I. Bonner, R. R. Neubig, et al. 2013. International union of basic and clinical pharmacology. LXXXVIII. ischemic injury. G protein-coupled receptor list: recommendations for new pairings with cognate We further confirmed the above observations in mice. Using ligands. Pharmacol. Rev. 65: 967–986. 10. Mobraten, K., T. M. Haug, C. R. Kleiveland, and T. Lea. 2013. Omega-3 and an in vivo model of MCAO, stimulation of GPR120 by DHA omega-6 PUFAs induce the same GPR120-mediated signalling events, but with ameliorated the stroke outcomes, whereas GPR120 knockdown different kinetics and intensity in Caco-2 cells. Lipids Health Dis. 12: 101. The Journal of Immunology 759

11. Kiecolt-Glaser, J. K., M. A. Belury, R. Andridge, W. B. Malarkey, B. S. Hwang, Complement component C3 mediates inflammatory injury following focal ce- and R. Glaser. 2012. Omega-3 supplementation lowers inflammation in healthy rebral ischemia. Circ. Res. 99: 209–217. middle-aged and older adults: a randomized controlled trial. Brain Behav. 30. Gao, B., Q. Huang, Q. Jie, W. G. Lu, L. Wang, X. J. Li, Z. Sun, Y. Q. Hu, Immun. 26: 988–995. L. Chen, B. H. Liu, et al. 2015. GPR120: a bi-potential mediator to modulate 12. Zhang, M. J., and M. Spite. 2012. Resolvins: anti-inflammatory and proresolving the osteogenic and adipogenic differentiation of BMMSCs. Sci. Rep. 5: mediators derived from omega-3 polyunsaturated fatty acids. Annu. Rev. Nutr. 14080. 32: 203–227. 31. Saber, H., M. Y. Yakoob, P. Shi, W. T. Longstreth, Jr., R. N. Lemaitre, 13. Nakamura, K., D. Miura, Y. Saito, K. Yunoki, Y. Koyama, M. Satoh, D. Siscovick, K. M. Rexrode, W. C. Willett, and D. Mozaffarian. 2017. Omega-3 M. Kondo, K. Osawa, O. F. Hatipoglu, T. Miyoshi, et al. 2017. Eicosa- fatty acids and incident ischemic stroke and its atherothrombotic and car- pentaenoic acid prevents arterial calcification in klotho mutant mice. PLoS dioembolic subtypes in 3 US cohorts. Stroke 48: 2678–2685. One 12: e0181009. 32. Arteaga, O., M. Revuelta, L. Uriguen, L. Martinez-Millan, E. Hilario, and 14. Li, A., D. Yang, M. Zhu, K. C. Tsai, K. H. Xiao, X. Yu, J. Sun, and L. Du. 2015. A. Alvarez. 2017. Docosahexaenoic acid reduces cerebral damage and amelio- Discovery of novel FFA4 (GPR120) receptor agonists with b-arrestin2-biased rates long-term cognitive impairments caused by neonatal hypoxia-ischemia in characteristics. Future Med. Chem. 7: 2429–2437. rats. Mol. Neurobiol. 54: 7137–7155. 15. Oh, D. Y., S. Talukdar, E. J. Bae, T. Imamura, H. Morinaga, W. Fan, P. Li, 33. Shi, Z., H. Ren, C. Luo, X. Yao, P. Li, C. He, J. X. Kang, J. B. Wan, T. F. Yuan, W. J. Lu, S. M. Watkins, and J. M. Olefsky. 2010. GPR120 is an omega-3 fatty and H. Su. 2016. Enriched endogenous omega-3 polyunsaturated fatty acids acid receptor mediating potent anti-inflammatory and insulin-sensitizing effects. protect cortical neurons from experimental ischemic injury. Mol. Neurobiol. 53: Cell 142: 687–698. 6482–6488. 16. Wellhauser, L., and D. D. Belsham. 2014. Activation of the omega-3 fatty acid 34. Cai, M., W. Zhang, Z. Weng, R. A. Stetler, X. Jiang, Y. Shi, Y. Gao, and J. Chen. receptor GPR120 mediates anti-inflammatory actions in immortalized hypotha- 2017. Promoting neurovascular recovery in aged mice after ischemic stroke - lamic neurons. J. Neuroinflammation 11: 60. prophylactic effect of omega-3 polyunsaturated fatty acids. Aging Dis. 8: 17.Raptis,D.A.,P.Limani,J.H.Jang,U.Ungethu¨m, C. Tschuor, R. Graf, 531–545. B. Humar, and P. A. Clavien. 2014. GPR120 on Kupffer cells mediates 35. Yamashima, T. 2015. Dual effects of the non-esterified fatty acid receptor hepatoprotective effects of v3-fatty acids. J. Hepatol. 60: 625–632. ‘GPR40’ for human health. Prog. Lipid Res. 58: 40–50. 18. Yan, Y., W. Jiang, T. Spinetti, A. Tardivel, R. Castillo, C. Bourquin, G. Guarda, 36. Yamashima, T. 2012. ‘PUFA-GPR40-CREB signaling’ hypothesis for the adult Downloaded from Z. Tian, J. Tschopp, and R. Zhou. 2013. Omega-3 fatty acids prevent inflam- primate neurogenesis. Prog. Lipid Res. 51: 221–231. mation and metabolic disorder through inhibition of NLRP3 inflammasome 37. Im, D. S. 2016. Functions of omega-3 fatty acids and FFA4 (GPR120) in activation. Immunity 38: 1154–1163. macrophages. Eur. J. Pharmacol. 785: 36–43. 19. Katsuma, S., N. Hatae, T. Yano, Y. Ruike, M. Kimura, A. Hirasawa, and 38. Miller, W. E., and R. J. Lefkowitz. 2001. Expanding roles for beta-arrestins as G. Tsujimoto. 2005. Free fatty acids inhibit serum deprivation-induced apoptosis scaffolds and adapters in GPCR signaling and trafficking. Curr. Opin. Cell Biol. through GPR120 in a murine enteroendocrine cell line STC-1. J. Biol. Chem. 13: 139–145. 280: 19507–19515. 39. Yin, J., H. Li, C. Meng, D. Chen, Z. Chen, Y. Wang, Z. Wang, and G. Chen. 20. Gao, B., Y. H. Han, L. Wang, Y. J. Lin, Z. Sun, W. G. Lu, Y. Q. Hu, J. Q. Li, 2016. Inhibitory effects of omega-3 fatty acids on early brain injury after sub- X. S. Lin, B. H. Liu, et al. 2016. Eicosapentaenoic acid attenuates arachnoid hemorrhage in rats: possible involvement of G protein-coupled re- http://www.jimmunol.org/ dexamethasome-induced apoptosis by inducing adaptive autophagy via GPR120 ceptor 120/b-arrestin2/TGF-b activated kinase-1 binding protein-1 signaling in murine bone marrow-derived mesenchymal stem cells. Cell Death Dis. 7: pathway. Int. J. Biochem. Cell Biol. 75: 11–22. e2235. 40.Faust,D.,C.Schmitt,F.Oesch,B.Oesch-Bartlomowicz, I. Schreck, C. Weiss, 21. Mishina, M., K. Kim, S. Kominami, T. Mizunari, S. Kobayashi, and and C. Dietrich. 2012. Differential p38-dependent signalling in response to Y. Katayama. 2013. Impact of polyunsaturated fatty acid consumption prior to cellular stress and mitogenic stimulation in fibroblasts. Cell Commun. Signal. ischemic stroke. Acta Neurol. Scand. 127: 181–185. 10: 6. 22. Dragano, N. R. V., C. Solon, A. F. Ramalho, R. F. de Moura, D. S. Razolli, 41. Simpson, D. R., L. K. Mell, and E. E. Cohen. 2015. Targeting the PI3K/AKT/ E. Christiansen, C. Azevedo, T. Ulven, and L. A. Velloso. 2017. Polyun- mTOR pathway in squamous cell carcinoma of the head and neck. Oral Oncol. saturated fatty acid receptors, GPR40 and GPR120, are expressed in 51: 291–298. the hypothalamus and control energy homeostasis and inflammation. J. 42. Liu, P., H. Cheng, T. M. Roberts, and J. J. Zhao. 2009. Targeting the phos- Neuroinflammation 14: 91. phoinositide 3-kinase pathway in cancer. Nat. Rev. Drug Discov. 8: 627–644. by guest on September 25, 2021 23. Garrel, G., V. Simon, C. Denoyelle, C. Cruciani-Guglielmacci, S. Migrenne, 43. Rogers, S. J., C. Box, K. J. Harrington, C. Nutting, P. Rhys-Evans, and R. Counis, C. Magnan, and J. Cohen-Tannoudji. 2011. Unsaturated fatty S. A. Eccles. 2005. The phosphoinositide 3-kinase signalling pathway as a acids stimulate LH secretion via novel PKCepsilon and -theta in gonado- therapeutic target in squamous cell carcinoma of the head and neck. Expert Opin. trope cells and inhibit GnRH-induced LH release. Endocrinology 152: Ther. Targets 9: 769–790. 3905–3916. 44. Vidimar, V., D. Chakravarti, S. E. Bulun, P. Yin, R. Nowak, J. J. Wei, and 24. Moriyama, R., C. Deura, S. Imoto, K. Nose, and N. Fukushima. 2015. Expres- J. J. Kim. 2018. The AKT/BCL-2 axis mediates survival of uterine leiomyoma in sion of the long-chain fatty acid receptor GPR120 in the gonadotropes of the a novel 3D spheroid model. Endocrinology 159: 1453–1462. mouse anterior pituitary gland. Histochem. Cell Biol. 143: 21–27. 45. Liu, B., C. Wang, P. Chen, B. Cheng, and Y. Cheng. 2018. RACKI 25. Kuraoka, M., T. Furuta, T. Matsuwaki, T. Omatsu, Y. Ishii, S. Kyuwa, and induces chemotherapy resistance in esophageal carcinoma by upregulating the Y. Yoshikawa. 2009. Direct experimental occlusion of the distal middle cerebral PI3K/AKT pathway and Bcl-2 expression. OncoTargets Ther. 11: 211–220. artery induces high reproducibility of brain ischemia in mice. Exp. Anim. 58: 46. Kim, N., J. O. Lee, H. J. Lee, H. I. Kim, J. K. Kim, Y. W. Lee, S. K. Lee, 19–29. S. J. Kim, S. H. Park, and H. S. Kim. 2015. Endogenous ligand for GPR120, 26. Butovsky, O., M. P. Jedrychowski, C. S. Moore, R. Cialic, A. J. Lanser, docosahexaenoic acid, exerts benign metabolic effects on the skeletal muscles G. Gabriely, T. Koeglsperger, B. Dake, P. M. Wu, C. E. Doykan, et al. 2014. via AMP-activated protein kinase pathway. J. Biol. Chem. 290: 20438–20447. Identification of a unique TGF-b-dependent molecular and functional signature 47. Li, X., Y. Yu, and C. D. Funk. 2013. Cyclooxygenase-2 induction in macro- in microglia. [Published erratum appears in 2014 Nat. Neurosci. 17: 1286.] Nat. phages is modulated by docosahexaenoic acid via interactions with free fatty Neurosci. 17: 131–143. acid receptor 4 (FFA4). FASEB J. 27: 4987–4997. 27. Liu, H., X. Wei, L. Kong, X. Liu, L. Cheng, S. Yan, X. Zhang, and L. Chen. 48. Serhan, C. N., N. Chiang, and T. E. Van Dyke. 2008. Resolving inflammation: 2015. NOD2 is involved in the inflammatory response after cerebral ischemia- dual anti-inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 8: reperfusion injury and triggers NADPH oxidase 2-derived reactive oxygen 349–361. species. Int. J. Biol. Sci. 11: 525–535. 49. Serhan, C. N., and B. D. Levy. 2018. Resolvins in inflammation: emergence 28. Zhou, L., F. Li, H. B. Xu, C. X. Luo, H. Y. Wu, M. M. Zhu, W. Lu, X. Ji, of the pro-resolving superfamily of mediators. J. Clin. Invest. 128: Q. G. Zhou, and D. Y. Zhu. 2010. Treatment of cerebral ischemia by disrupting 2657–2669. ischemia-induced interaction of nNOS with PSD-95. [Published erratum appears 50. Serhan, C. N., S. Hong, K. Gronert, S. P. Colgan, P. R. Devchand, G. Mirick, and in 2011 Nat. Med. 17: 1153.] Nat. Med. 16: 1439–1443. R. L. Moussignac. 2002. Resolvins: a family of bioactive products of omega-3 29. Mocco, J., W. J. Mack, A. F. Ducruet, S. A. Sosunov, M. E. Sughrue, fatty acid transformation circuits initiated by aspirin treatment that counter B. G. Hassid, M. N. Nair, I. Laufer, R. J. Komotar, M. Claire, et al. 2006. proinflammation signals. J. Exp. Med. 196: 1025–1037.

Supplemental Fig. 1 DHA dose-dependently inhibited oxygen-glucose deprivation (OGD) - induced inflammatory response in BV2 cells. The mRNA levels of IL-6 (A) IL-1β (B) and TNFα (C) in BV2 cells treated with DHA for 2 h prior to 2 h OGD and 12 h reperfusion were measured by real-time PCR. Data are expressed as the mean ± SEM of 4 independent experiments; *p < 0.05, vs. Control indicated groupˈ#p < 0.05, vs. OGD group.

Supplemental Fig. 2 GPR120 mediated the anti-inflammatory effect in primary microglia subjected to oxygen-glucose deprivation (OGD) in vitro. (A) Representative micrographs of double immunofluorescence staining of GPR120 (red) with microglia (Iba1; green), scale bars: 50 μm. (B) Quantification of GPR120 immunoreactivity in microglia. The results indicated that GPR120 was enhanced in primary microglia subjected to OGD and reperfusion. Microglia transfected with negative control (NC) or siGPR120 were treated with 80 μM of DHA for 2 h prior to OGD and reoxygenation treatment. (C) IL-1β level in medium was measured by ELISA. Data are presented as the mean ± SEM from 3 independent experiments. *P < 0.05 vs. Control group.

Supplemental Fig. 3 The effect of GPR120 on the inflammatory effect in PC12 cells subjected to oxygen-glucose deprivation (OGD). (A) Efficiency of siGPR120 in PC12 cells by western blot. PC12 cells transfected with negative control (NC) or siGPR120 were treated with 80 μm of DHA for 2 h prior to OGD and reoxygenation. The effects of GPR120 on (B) IL-6 and (C) IL-1β in PC12 cells were measured by real-time PCR. Data are presented as the mean ± SEM from 3 independent experiments. *P < 0.05 vs. indicated group.

Supplemental Fig. 4 Cortex adeno-associated virus (AAV) injection in wild type mice. (A) AAV containing shRNA targeting GPR120 was injected into the left cortex. The red points were the injection sites. (B) Schematic diagram of AAV-ShGPR120 (GFP tag) spread area after 3 w. (C) 3 w after AAV injection, cortex was stripped and used for mRNA extraction to evaluate the efficiency. (D) Diffusion range of AAV-ShGPR120 (GFP tag) after injection in wild type (WT) mice at different time points. (E) AAV-ShGPR120 (GFP tag) infected brain sections from WT mice subjected to 2 h MCAO and 24 h reperfusion stained with NeuN antibody (neuron marker) or Iba-1(microglial marker) at 3 w after stereotaxic injection.