Signaling by Dual Specificity Kinases

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Oncogene (1998) 17, 1447 ± 1455 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Signaling by dual speci®city kinases N Dhanasekaran and E Premkumar Reddy Fels Institute for Cancer Research and Molecular Biology and Department of Biochemistry Temple University School of Medicine Philadelphia, Pennsylvania 19140, USA Dual speci®city kinases that phosphorylate the Thr- and residues in their amino acid sequences rather than Tyr-residues within the TXY motif of MAP-kinases of those of the exogenous substrates initially identi®ed play a central role in the regulation of various processes most of the dual speci®city kinases. An earlier of cell growth. These dual speci®city kinases also known classi®cation of these kinases was based on their as MAP kinase kinases are constituents of the sequential ability to dual-phosphorylate the exogenous substrates kinase signaling modules. Seven distinct mammalian (Lindberg et al., 1992) and it divided these kinases into MAP kinases kinases have been identi®ed. Some of the three groups: (1) kinases that show `true' dual unique signaling properties of these kinases are discussed speci®city by phosphorylating Tyr- and Thr-residues here. of exogenous substrates; (2) kinases that exhibit dual speci®city only through autophosphorylation; and (3) Keywords: oncogene; apoptosis; cell transformation; kinases that possess the structural motif characteristic MAP kinase; MEKK; MEK; MKK; ERK; JNK; of dual speci®city kinases. However, it has been signal transduction observed that as the kinases belonging to group two and three get fully characterized, they turn out to be the `true dual speci®city kinases' of group one. Of the dierent dual speci®city kinases that have been Introduction identi®ed to date, the kinases that phosphorylate the family of proline directed protein kinases are of great Regulation of cell growth is mediated by a complex interest. In a prototypical kinase-signaling module, the array of signaling pathways precisely coordinated by kinase-core consists of a minimum of three kinases, an dierent families of cell surface receptors. These upstream Ser/Thr kinase, middle dual speci®city signaling pathways regulate all the critical phases of kinases and a downstream Ser/Thr kinase. An cell growth including cell proliferation, dierentiation, activated receptor stimulates a Ser/Thr kinase via Ras and apoptosis. In many instances, the signal coupling or Rho family of GTPases. The upstream kinases, in between the receptors to the nucleus is mediated by a turn stimulate the dual speci®city kinase through series of sequentially activating protein kinases. phosphorylation. Consequently, the phosphorylated Protein kinases add a phosphate group to speci®c DSK activates the downstream Ser/Thr kinase, which amino acid residues. The alcoholic group of serine and contain the TXY motif by dual phosphorylation at the threonine as well as the phenolic group of tyrosine Thr- and Tyr-residues (Figure 1). Such dual speci®city provide the major phosphorylation-sites for many of kinase kinase-dual speci®city kinase-TXY kinase these kinases. Depending on the speci®city of the (DSKK-DSK-TXY) signaling module appears to be substrate amino acids, the protein kinases are either well-conserved in eukaryotes ranging from yeast to known as serine/threonine (Ser/Thr) kinases or mammalian cells (Davis, 1994; Johnson and Vaillan- tyrosine kinases (Tyr). However, a third group of court, 1994; Cano and Mahadevan, 1995; Fanger et al., protein kinases that can phosphorylate both Ser/Thr- 1997). To date, seven such signaling modules have been as well as Tyr-residues has been identi®ed and the identi®ed in mammalian cells (Figure 1). Based on the kinases that belong to this group are known as dual number of newly discovered kinases that can speci®city kinases. Such dual-speci®city kinases play a `communicate' to these kinase-modules, it is likely central role in the `kinase cascade' that regulate cell that many more such `modules' are remaining to be proliferation, dierentiation, and apoptosis. The focus identi®ed in mammalian cells. of the review is to summarize the present state of Since a considerable degree of confusion persists knowledge of the signaling modules regulated by these regarding the nomenclature of these dual speci®city dual speci®c kinases. kinases, a clari®cation of the nomenclature is in order. The dual speci®city kinase that phosphorylates ERK is known as either MEK (Mitogen/Extracellular-signal Superfamily of dual-speci®city kinases regulated kinase kinase) or simply MAP kinase kinase The dual speci®city kinases (DSK) are unique in that (MKK). Thus MEK1/MKK1 and MEK2/MKK2 they share the consensus kinases motifs of both Ser/ denotes the dual speci®city kinase that phosphorylate Thr and Tyr-kinases (Lindberg et al., 1992). Their ERK1 and ERK2 respectively (Ahn et al., 1991; ability to autophosphorylate Ser/Thr- as well as Tyr- Crews et al., 1992; Zheng and Guan, 1993). In some instances, as in the case of a Xenopus homolog, MAP kinase kinase (MAPKK) also refers to the kinase that activates ERKs (Matsuda et al., 1992). MKK3 has been used to denote the dual speci®city kinase that Correspondence: N Dhanasekaran phosphorylate and activate p38MAPK (Derijard et al., Dual Specificity Kinases N Dhanasekaran and EP Reddy 1448 Figure 1 The mammalian kinase signaling modules. The seven known mammalian signaling modules involving the dual speci®city kinases are compared. The question marks denote the signaling components that remain to be established 1995). MKK4 refers to the dual speci®city kinase that MAP kinase kinase-1 and MAP kinase kinase-2 phosphorylates JNK (Derijard et al., 1995), and it is also known as JNK kinase I or abbreviated as In a typical signaling pathway involving tyrosine kinase JNKK1 (Lin et al., 1995). Since JNK is also known receptors, the ligand binding to the receptor leads to as stress activated protein kinase (SAPK), a mouse receptor-dimerization and subsequent autophosphory- homolog of MKK4/JNKK is known as SAPK/ERK lation. The phosphorylated tyrosine residues of the kinase-1 or SEK1 (Sanchez et al., 1994). The dual receptor act as a docking bay for various signaling speci®city kinase that phosphorylate ERK5 is known proteins that get activated by phosphorylation. One as MEK5 or MKK5 (Zhou et al., 1995; Tournier et such eector molecule that link the activated EGFR to al., 1997). The recently identi®ed dual speci®city Ras-signaling pathway is Shc. Phosphorylation of Shc kinase that speci®cally involved in the regulation of leads to its interaction with GRB2 through the SH2 p38MAPK is known as MKK6 (Raingeaud et al., domains. The EGFR-Shc-GRB2 complex recruits a 1996; Moriguchi et al., 1996; Han et al., 1996; Stein et guanine nucleotide exchange factor SOS which al., 1996). Likewise, newly characterized dual specifi- catalyzes the exchange of guanine nucleotides in Ras. city kinase that speci®cally activates JNK through The GTP-bound Ras facilitates the translocation of the phosphorylation is named MKK7 (Moriguchi et al., Ser/Thr kinase Raf-1 to the plasma membrane for 1997; Yao et al., 1997; Tournier et al., 1997; Wu et activation through phosphorylation. The activated al., 1997). It has been also referred as JNKK2 (Wu et Raf-1 stimulates the dual speci®city kinase MKK1 al., 1997). For the sake of clarity and conformity, only and MKK2 through the phosphorylation of Ser-217/ the MKK-nomenclature is being used here. 218 and Ser-221. MKK1 and MKK2 in turn activate It has been identi®ed that both the Thr- as well their respective ERKs through phosphorylation of as Tyr- phosphorylating activities of the dual speci®c Thr- and Tyr-residues within the characteristic speci®city kinases are required for the signaling of TPY motif. The phosphorylated ERKs activate other the respective signaling modules. The structure and signaling proteins such as cPLA2 (Nemeno et al., function relationship of these kinases has been 1993; Lin et al., 1993) as well as other kinases (Boulton widely studied using MKK1 and MKK2 as et al., 1991; Sturgill et al., 1988; Stokoe et al., 1992). In prototypic kinases (Wu et al., 1993; Brott et al., addition, the phosphorylated ERKs translocate to 1993; Pages et al., 1994). Selective mutations nucleus (Chen et al., 1992; Seth et al., 1992; Sanghera inhibiting either of the kinase activities have been et al., 1992; Lenormand et al., 1993) where they shown to disrupt the signaling function of the activate transcription factors such as TCFs through respective signaling module (Brott et al., 1993; phosphorylation (Alvarez et al., 1991; Pulverer et al., Pages et al., 1994; Huang et al., 1995). Of the 1991; Baker et al., 1992; Gille et al., 1992) which leads known kinase signaling modules, only those involved to the activation of speci®c genes involved in cell in the activation of the extracellular-signal regulated proliferation (Davis, 1992; Johnson and Vaillancourt, kinases 1 and 2 (ERK1 and ERK2) are more 1994). thoroughly characterized. However, the kinase MKK1 and MKK2 are of 43 ± 46 kDa proteins modules leading to the activation of c-Jun N- encoded by two distinct genes located at dierent terminal kinase (JNK) and p38-mitogen activated chromosomes (Brott et al., 1993). An analysis of the protein kinase (p38MAPK) are beginning to be primary sequence of MKK indicate that the N- understood. terminus (®rst 30 amino acids) show a low sequence Dual Specificity Kinases N Dhanasekaran and EP Reddy 1449 homology in comparison with other DSKs and this addition, the ®ndings that MAPKK and MAPK exist region has been speculated to be involved in the as a high molecular weight complex in Xenopus oocyte dierential interaction of speci®c MKKs with its (Matsuda et al., 1993) lend credence to the view that a substrates or activators.
Recommended publications
  • Regulation of Calcium/Calmodulin-Dependent Protein Kinase II Activation by Intramolecular and Intermolecular Interactions

    Regulation of Calcium/Calmodulin-Dependent Protein Kinase II Activation by Intramolecular and Intermolecular Interactions

    8394 • The Journal of Neuroscience, September 29, 2004 • 24(39):8394–8398 Mini-Review Regulation of Calcium/Calmodulin-Dependent Protein Kinase II Activation by Intramolecular and Intermolecular Interactions Leslie C. Griffith Department of Biology and Volen Center for Complex Systems, Brandeis University, Waltham, Massachusetts 02454-9110 Key words: calcium; calmodulin; learning; localization; NMDA; phosphatase; protein kinase As its name implies, calcium/calmodulin-dependent protein ki- The overlap of these subdomains is no accident. Binding of nase II (CaMKII) is calcium dependent. In its basal state, the Ca 2ϩ/CaM is the primary signal for release of autoinhibition. activity of CaMKII is extremely low. Regulation of intracellular Current models of activation posit that the binding of Ca 2ϩ/CaM calcium levels allows the neuron to link activity with phosphor- serves to disrupt the interactions of specific residues within the ylation by CaMKII. This review will briefly summarize our cur- autoinhibitory domain with the catalytic domain (Smith et al., rent understanding of the intramolecular mechanisms of activity 1992). Because there is no crystal structure for the catalytic and regulation and their modulation by Ca 2ϩ/CaM and will then regulatory parts of CaMKII, the interaction face of these two focus on the growing number of other modes of intermolecular domains has been inferred using the effects of charge-reversal regulation of CaMKII activity by substrate and scaffolding mutagenesis on activity and molecular modeling (Yang and molecules. Schulman, 1999). This study confirmed the role of Arg 297 at the P-3 position of the pseudosubstrate ligand (Mukherji and Soder- Regulation of CaMKII by its autoinhibitory domain ling, 1995) and identified residues in the catalytic domain that All members of the CaMKII family (␣, ␤, ␥, and ␦ isozymes) share may have direct interactions with the regulatory region.
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage

    Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage

    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
  • Regulation of Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase (PDE1): Review

    Regulation of Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase (PDE1): Review

    95-105 5/6/06 13:44 Page 95 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 95-105, 2006 95 Regulation of calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1): Review RAJENDRA K. SHARMA, SHANKAR B. DAS, ASHAKUMARY LAKSHMIKUTTYAMMA, PONNIAH SELVAKUMAR and ANURAAG SHRIVASTAV Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Cancer Research Division, Saskatchewan Cancer Agency, 20 Campus Drive, Saskatoon SK S7N 4H4, Canada Received January 16, 2006; Accepted March 13, 2006 Abstract. The response of living cells to change in cell 6. Differential inhibition of PDE1 isozymes and its environment depends on the action of second messenger therapeutic applications molecules. The two second messenger molecules cAMP and 7. Role of proteolysis in regulating PDE1A2 Ca2+ regulate a large number of eukaryotic cellular events. 8. Role of PDE1A1 in ischemic-reperfused heart Calmodulin-stimulated cyclic nucleotide phosphodiesterase 9. Conclusion (PDE1) is one of the key enzymes involved in the complex interaction between cAMP and Ca2+ second messenger systems. Some PDE1 isozymes have similar kinetic and 1. Introduction immunological properties but are differentially regulated by Ca2+ and calmodulin. Accumulating evidence suggests that the A variety of cellular activities are regulated through mech- activity of PDE1 is selectively regulated by cross-talk between anisms controlling the level of cyclic nucleotides. These Ca2+ and cAMP signalling pathways. These isozymes are mechanisms include synthesis, degradation, efflux and seque- also further distinguished by various pharmacological agents. stration of cyclic adenosine 3':5'-monophosphate (cAMP) and We have demonstrated a potentially novel regulation of PDE1 cyclic guanosine 3':5'- monophosphate (cGMP) within the by calpain.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re

    Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re

    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS

    Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS

    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers

    Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers

    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
  • Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute

    Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute

    Integrative Cancer Science and Therapeutics Review Article ISSN: 2056-4546 Targeting the phosphatidylinositol 3-kinase signaling pathway in acute myeloid leukemia Ota Fuchs* Institute of Hematology and Blood Transfusion, Prague, Czech Republic Abstract The phosphatidylinositol-3-kinase-Akt (protein kinase B) - mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is often dysregulated in cancer, including hematological malignancies. Primary acute myeloid leukemia (AML) cell populations may include various subclones at the time of diagnosis. A relapse can occur due to regrowth of the originally dominating clone, a subclone detectable at the time of first diagnosis, or a new clone derived either from the original clone or from remaining preleukemic stem cells. Inhibition of mTOR signaling has in general modest growth-inhibitory effects in preclinical AML models and clinical trials. Therefore, combination of allosteric mTOR inhibitors with standard chemotherapy or targeted agents has a greater anti-leukemia efficacy. Dual mTORC1/2 inhibitors, and dual PI3K/mTOR inhibitors show greater activity in pre-clinical AML models. Understanding the role of mTOR signaling in leukemia stem cells is important because AML stem cells may become chemoresistant by displaying aberrant signaling molecules, modifying epigenetic mechanisms, and altering the components of the bone marrow microenvironment. The PI3K/Akt/mTOR signaling pathway is promising target in the treatment of hematological malignancies, including AML, especially by using of combinations of mTOR inhibitors with conventional cytotoxic agents. Introduction syndromes, chronic myelogenous leukemia (CML), multiple myeloma and lymphoid leukemias and lymphomas [42-54]. Below, I discuss the The mammalian target of rapamycin (mTOR) is a serine/threonine PI3K/Akt/mTOR pathway and its role in AML.
  • Calcium/Calmodulin-Dependent Protein Kinase II: an Unforgettable Kinase

    Calcium/Calmodulin-Dependent Protein Kinase II: an Unforgettable Kinase

    The Journal of Neuroscience, September 29, 2004 • 24(39):8391–8393 • 8391 Mini-Review Calcium/Calmodulin-Dependent Protein Kinase II: An Unforgettable Kinase Leslie C. Griffith Department of Biology and Volen Center for Complex Systems, Brandeis University, Waltham, Massachusetts 02454-9110 Key words: calcium; calmodulin; learning; localization; LTP; NMDA; phosphatase; protein kinase; knock-out mice The search for “memory molecules” and why CaMKII is an mers of different isozymes are able to coassemble, allowing for a appealing candidate large number of possible holoenzyme compositions. Measure- Since the time neuroscientists first recognized that biochemical ment of the Stoke’s radii and sedimentation coefficients of rat events inside neurons could influence the function of the brain, brain and Drosophila CaMKIIs suggested a holoenzyme of 8–12 there have been people looking for “memory molecules.” This subunits (Bennett et al., 1983; Kuret and Schulman, 1984; elusive ion, small molecule, protein, or nucleic acid would be the GuptaRoy and Griffith, 1996). Early electron microscopic studies keystone on which memory was built; understanding the mem- of CaMKII purified from rat brain found some heterogeneity in ory molecule would allow us to unlock the mysteries of cognition. holoenzyme size, reporting both 8 and 10 subunit particles (Ka- Models of how this molecule could work abounded, but the idea naseki et al., 1991). More recent single-particle studies, using of a memory molecule as a kinase/phosphatase-based molecular recombinant rat CaMKII, have provided much higher-resolution switch emerged as an important contender (Lisman, 1985). The (21–25 Å) images (Kolodziej et al., 2000; Gaertner et al., 2004).
  • Juvenile Hormone-Activated Phospholipase C Pathway PNAS PLUS Enhances Transcriptional Activation by the Methoprene-Tolerant Protein

    Juvenile Hormone-Activated Phospholipase C Pathway PNAS PLUS Enhances Transcriptional Activation by the Methoprene-Tolerant Protein

    Juvenile hormone-activated phospholipase C pathway PNAS PLUS enhances transcriptional activation by the methoprene-tolerant protein Pengcheng Liua, Hong-Juan Pengb, and Jinsong Zhua,1 aDepartment of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061; and bDepartment of Pathogen Biology, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou, Guangdong, 510515, China Edited by Lynn M. Riddiford, Howard Hughes Medical Institute Janelia Farm Research Campus, Ashburn, VA, and approved March 11, 2015 (received for review December 4, 2014) Juvenile hormone (JH) is a key regulator of a wide diversity of in the regulatory regions of JH-responsive genes, leading to developmental and physiological events in insects. Although the the transcriptional activation of these genes (12). This function intracellular JH receptor methoprene-tolerant protein (MET) func- of MET–TAI in the JH-induced gene expression seems to be tions in the nucleus as a transcriptional activator for specific JH- evolutionarily conserved in Ae. aegypti, D. melanogaster, the red regulated genes, some JH responses are mediated by signaling flour beetle Tribolium castaneum, the silkworm Bombyx mori,and pathways that are initiated by proteins associated with plasma the cockroach Bombyx mori (9, 13–16). membrane. It is unknown whether the JH-regulated gene expres- The mechanisms by which JH exerts pleiotropic functions are sion depends on the membrane-mediated signal transduction. In manifold in insects. Several studies suggest that JH can act via a Aedes aegypti mosquitoes, we found that JH activated the phos- receptor on plasma membrane (3, 17). For example, develop- pholipase C (PLC) pathway and quickly increased the levels of ino- ment of ovarian patency during vitellogenesis is stimulated by JH sitol 1,4,5-trisphosphate, diacylglycerol, and intracellular calcium, in some insects via transmembrane signaling cascades that in- leading to activation and autophosphorylation of calcium/calmod- volve second messengers (18, 19).
  • A-Kinase Anchoring Protein–Calcineurin Signaling in Long-Term Depression of Gabaergic Synapses

    A-Kinase Anchoring Protein–Calcineurin Signaling in Long-Term Depression of Gabaergic Synapses

    2650 • The Journal of Neuroscience, February 6, 2013 • 33(6):2650–2660 Cellular/Molecular A-Kinase Anchoring Protein–Calcineurin Signaling in Long-Term Depression of GABAergic Synapses Matthieu Dacher, Shawn Gouty, Steven Dash, Brian M. Cox, and Fereshteh S. Nugent Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814 The postsynaptic scaffolding A-kinase anchoring protein 79/150 (AKAP79/150) signaling complex regulates excitatory synaptic trans- mission and strength through tethering protein kinase A (PKA), PKC, and calcineurin (CaN) to the postsynaptic densities of neurons (Sanderson and Dell’Acqua, 2011), but its role in inhibitory synaptic transmission and plasticity is unknown. Using immunofluorescence and whole-cell patch-clamp recording in rat midbrain slices, we show that activation of postsynaptic D2-like family of dopamine (DA) receptor in the ventral tegmental area (VTA) induces long-term depression (LTD) of GABAergic synapses on DA neurons through an inositol triphosphate receptor-mediated local rise in postsynaptic Ca 2ϩ and CaN activation accompanied by PKA inhibition, which requires AKAP150 as a bridging signaling molecule. Our data also illuminate a requirement for a clathrin-mediated internalization of GABAA receptors in expression of LTDGABA. Moreover, disruption of AKAP–PKA anchoring does not affect glutamatergic synapses onto DA neurons, suggesting that the PKA–AKAP–CaN complex is uniquely situated at GABAA receptor synapses in VTA DA neurons to regulate plasticity associated with GABAA receptors. Drug-induced modulation of GABAergic plasticity in the VTA through such novel signaling mechanisms has the potential to persistently alter the output of individual DA neurons and of the VTA, which may contribute to the reinforcing or addictive properties of drugs of abuse.
  • The Calcium/Calmodulin-Dependent Kinases II and IV As Therapeutic Targets in Neurodegenerative and Neuropsychiatric Disorders

    The Calcium/Calmodulin-Dependent Kinases II and IV As Therapeutic Targets in Neurodegenerative and Neuropsychiatric Disorders

    International Journal of Molecular Sciences Review The Calcium/Calmodulin-Dependent Kinases II and IV as Therapeutic Targets in Neurodegenerative and Neuropsychiatric Disorders Kinga Sałaciak 1, Aleksandra Koszałka 1, Elzbieta˙ Zmudzka˙ 2 and Karolina Pytka 1,* 1 Department of Pharmacodynamics, Faculty of Pharmacy, Jagiellonian University Medical College, Medyczna 9, 30-688 Krakow, Poland; [email protected] (K.S.); [email protected] (A.K.) 2 Department of Social Pharmacy, Faculty of Pharmacy, Jagiellonian University Medical College, Medyczna 9, 30-688 Kraków, Poland; [email protected] * Correspondence: [email protected] Abstract: CaMKII and CaMKIV are calcium/calmodulin-dependent kinases playing a rudimentary role in many regulatory processes in the organism. These kinases attract increasing interest due to their involvement primarily in memory and plasticity and various cellular functions. Although CaMKII and CaMKIV are mostly recognized as the important cogs in a memory machine, little is known about their effect on mood and role in neuropsychiatric diseases etiology. Here, we aimed to review the structure and functions of CaMKII and CaMKIV, as well as how these kinases modulate the animals’ behavior to promote antidepressant-like, anxiolytic-like, and procognitive effects. The review will help in the understanding of the roles of the above kinases in the selected neurodegenerative and neuropsychiatric disorders, and this knowledge can be used in future drug design. Citation: Sałaciak, K.; Koszałka, A.; Zmudzka,˙ E.; Pytka, K. The Keywords: CaMKII; CaMKIV; memory; depression; anxiety; animal studies Calcium/Calmodulin-Dependent Kinases II and IV as Therapeutic Targets in Neurodegenerative and Neuropsychiatric Disorders. Int. J. 1.