Dynamic Regulation of FGF23 by Fam20c Phosphorylation, Galnac-T3 Glycosylation, and Furin Proteolysis

Dynamic regulation of FGF23 by Fam20C phosphorylation, GalNAc-T3 glycosylation, and furin proteolysis

Vincent S. Tagliabraccia, James L. Engela,1, Sandra E. Wileya, Junyu Xiaoa, David J. Gonzaleza,b, Hitesh Nidumanda Appaiahc, Antonius Kollerd, Victor Nizetb,e, Kenneth E. Whitec, and Jack E. Dixona,f,g,2

Departments of aPharmacology, bPediatrics, fCellular and Molecular Medicine, and gChemistry and Biochemistry and eSkaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, La Jolla, CA 92093; cDepartment of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202; and dStony Brook University Proteomics Center, School of Medicine, Stony Brook University, Stony Brook, NY 11794

Contributed by Jack E. Dixon, February 8, 2014 (sent for review January 23, 2014)

The family with sequence similarity 20, member C (Fam20C) has life. Nonlethal cases have also been reported, and these patients recently been identified as the Golgi casein kinase. Fam20C phosphor- develop hypophosphatemia as a result of elevated levels of the ylates secreted proteins on Ser-x-Glu/pSer motifs and loss-of-function phosphate-regulating hormone fibroblast growth factor 23 (FGF23) mutations in the kinase cause Raine syndrome, an often-fatal osteo- (12). Additionally, Fam20C knockout (KO) mice develop renal sclerotic bone dysplasia. Fam20C is potentially an upstream regulator phosphate wasting due to an increase in circulating bioactive of the phosphate-regulating hormone fibroblast growth factor 23 FGF23 as well as severe hypophosphatemic rickets (13, 14). (FGF23), because humans with FAM20C mutations and Fam20C KO Thus, Fam20C has been proposed to be a regulator of FGF23; mice develop hypophosphatemia due to an increase in full-length, bi- however, the molecular mechanisms underlying the control of ologically active FGF23. However, the mechanism by which Fam20C this hormone by Fam20C are unclear. FGF23 is secreted from osteoblasts and osteocytes, and targets regulates FGF23 is unknown. Here we show that Fam20C directly 180 176 179 180 the kidney to regulate the reabsorption of phosphate and ca- phosphorylates FGF23 on Ser , within the FGF23 R XXR /S AE tabolism of 1,25-dihydroxyvitamin D (15, 16). FGF23 inhibits subtilisin-like proprotein convertase motif. This phosphorylation event 3 renal phosphate transport by activating FGF receptors (FGFRs) BIOCHEMISTRY N inhibits O-glycosylation of FGF23 by polypeptide -acetylgalactosami- in a manner that requires binding the coreceptor α-klotho (α-KL) nyltransferase 3 (GalNAc-T3), and promotes FGF23 cleavage and inac- (17). Binding of FGF23 to FGFRs/α-KL induces urinary excretion tivation by the subtilisin-like proprotein convertase furin. Collectively, of phosphate by decreasing the abundance of the type II sodium- our results provide a molecular mechanism by which FGF23 is dynam- dependent phosphate cotransporters NPT2a and NPT2c (15, 16). ically regulated by phosphorylation, glycosylation, and proteolysis. Several genetic disorders of renal phosphate wasting are associated Furthermore, our findings suggest that cross-talk between phosphor- with alterations in FGF23 (18). X-linked hypophosphatemia is the ylation and O-glycosylation of proteins in the secretory pathway may most prevalent form of hypophosphatemic rickets (1:20,000), and is be an important mechanism by which secreted proteins are regulated. caused by loss-of-function mutations in the gene encoding the phosphate-regulating endopeptidase homolog X-linked, which is phosphate homeostasis | rickets | Fam20 | familial tumoral calcinosis | associated with elevated FGF23 expression (19, 20). A similar chronic kidney disease situation exists in patients with an autosomal recessive form of hypophosphatemic rickets caused by mutations in the ectonucleotide pyrophosphatase ENPP1 (21) and the Fam20C substrate dentin rotein kinases are evolutionarily conserved enzymes that Pregulate numerous cellular processes by transferring a molecule of phosphate from ATP to target substrates (1, 2). The vast Significance majority of theses enzymes function within the nucleus and cy- tosol. In contrast, there are several examples of phosphorylated The family with sequence similarity 20, member C (Fam20C) is proteins that are secreted from the cell, which raises the ques- a secretory pathway-specific kinase that phosphorylates se- tion: What are the kinases that phosphorylate these secreted creted proteins on Ser-x-Glu/pSer motifs. Mutations in human phosphoproteins? We recently identified a small family of se- FAM20C cause a devastating childhood disorder known as cretory pathway kinases that phosphorylate secreted proteins Raine syndrome. Some patients with FAM20C mutations as and proteoglycans (3). These enzymes have N-terminal signal well as Fam20C KO mice develop hypophosphatemia due to sequences that direct them to the lumen of the endoplasmic elevated levels of the phosphate-regulating hormone FGF23. reticulum, where they encounter the proteins or proteoglycans In this paper, we show that Fam20C phosphorylates FGF23 on that they phosphorylate. One member of this atypical kinase a Ser-x-Glu motif that lies within a critical region of the hor- family is the family with sequence similarity 20, member C mone. The phosphorylation promotes FGF23 proteolysis by furin N (Fam20C), which phosphorylates secreted proteins on Ser(S)-x- by blocking O-glycosylation by polypeptide -acetylgalactosami- Glu(E)/pSer(pS) (S-x-E/pS) motifs (3, 4). Because Fam20C nyltransferase 3. Our results have important implications for localizes within the secretory pathway and the vast majority of patients with abnormalities in phosphate homeostasis. secreted phosphoproteins are phosphorylated on S-x-E/pS Author contributions: V.S.T., J.L.E., S.E.W., J.X., and J.E.D. designed research; V.S.T., J.L.E., motifs, Fam20C has been proposed to play a major role in the S.E.W., J.X., D.J.G., and A.K. performed research; H.N.A., A.K., V.N., and K.E.W. contrib- generation of the secreted phosphoproteome (5–7). For exam- uted new reagents/analytic tools; V.S.T., J.L.E., S.E.W., J.X., D.J.G., H.N.A., A.K., V.N., K.E.W., ple, ∼75% of human serum and cerebrospinal fluid phospho- and J.E.D. analyzed data; and V.S.T., K.E.W., and J.E.D. wrote the paper. proteins are phosphorylated on S-x-E/pS motifs (8, 9). This The authors declare no conflict of interest. includes proteins important for tooth and bone formation, as Freely available online through the PNAS open access option. well as numerous hormones. In most cases, the functional im- 1Present address: Molecular, Cellular & Integrative Physiology Graduate Program, Depart- portance of these phosphorylation events is unknown. ment of Medicine, University of California, Los Angeles, CA 90095. Loss-of-function mutations in the human FAM20C gene cause 2To whom correspondence should be addressed. E-mail: [email protected]. Raine syndrome, an often-fatal osteosclerotic bone dysplasia This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. (10, 11). Most Raine patients die within the first few weeks of 1073/pnas.1402218111/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1402218111 PNAS Early Edition | 1of6 matrix protein 1 (DMP1) (22). These disorders share the com- Fam20C leads to elevated levels of intact, biologically active FGF23 mon denominator of elevated FGF23. and subsequent hypophosphatemia. Furthermore, our results sug- Other Mendelian disorders of renal phosphate handling have gest that cross-talk between phosphorylation and O-glycosylation of provided important insight into the regulation of FGF23 protein proteins in the secretory pathway may be an important mechanism processing. FGF23 is inactivated in the Golgi by proteolysis within by which secreted proteins are dynamically regulated. a highly conserved subtilisin-like proprotein convertase (SPC) site, 176RHTR179/S180AE182, generating inactive N- and C-terminal Results fragments (23). Gain-of-function missense mutations in FGF23 FGF23 Is Phosphorylated by Fam20C in Vitro and in Cells. Contem- cause autosomal dominant hypophosphatemic rickets (ADHR) poraneous with our finding that Fam20C is a protein kinase, Wang (24). These mutations substitute the Arg (R) residues within the et al. (13) characterized Fam20C KO mice and demonstrated that SPC cleavage site and render the protein resistant to proteolysis these animals develop hypophosphatemic rickets as a result of (25). Conversely, loss-of-function mutations in FGF23 cause fa- elevated serum intact, bioactive FGF23. Furthermore, a recent milial tumoral calcinosis (FTC), a hyperphosphatemic disorder report identified compound heterozygous mutations in FAM20C characterized by often severe ectopic and vascular calcifications in two siblings referred for hypophosphatemia and severe dental (26). FTC is also caused by loss-of-function mutations in demineralization disease (12). Biochemical analysis of the patients’ polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc- sera identified elevated intact FGF23. Because FGF23 is expressed T3), a glycosyltransferase that O-glycosylates FGF23 at in tissues that show high levels of Fam20C expression (30) and Thr178 within the SPC cleavage site (27, 28). These inactivating contains Fam20C consensus S-x-E/pS motifs (Fig. 1A), we hy- GalNAc-T3 mutations prevent O-glycosylation of FGF23, which pothesized that Fam20C may directly regulate FGF23 by phos- produces a hormone more susceptible to SPC proteolysis (28, phorylation. To determine whether FGF23 is a phosphoprotein, 29). Collectively, these studies suggest that FGF23 processing is we generated a HEK293T cell line stably expressing a protease- a highly regulated and physiologically important process. resistant mutant of FGF23 (FGF23 R176Q) (25). This con- Here we demonstrate that Fam20C regulates FGF23 by struct contained a C-terminal Flag tag that allowed us to phosphorylation of Ser180, a residue that neighbors the SPC affinity-purify it from conditioned medium. We then digested site (R176H177T178R179/S180). We show that Ser180 phosphory- FGF23 R176Q with trypsin or chymotrypsin, separated the lation inhibits GalNAc-T3 O-glycosylation of Thr178, thereby pro- peptides by liquid chromatography, and analyzed the pep- moting furin (PCSK3)-dependent FGF23 proteolysis. Our results tides by mass spectrometry (MS). Tandem mass spectrometry provide a plausible molecular mechanism by which loss of (MS/MS) analysis identified 180pSAEDDSERDPLNVLKPR196 and 178TRpSAEDDSERDPL190 in the trypsin and chymotrypsin digests, respectively (Fig. 1 B and C and Fig. S1). These results suggest that FGF23 is phosphorylated in HEK293T cells on Ser180. 180 A D DA Notably, Ser lies within a Fam20C S-x-E recognition motif and ADHR (min) 015103060120120 Mutations 176Q/W-H-T-Q/W-S-A-E182 neighbors the SPC recognition site (Fig. 1A). To test whether SPC site 176R-H-T-R S-A-E182 Coomassie Fam20C phosphorylates FGF23, we performed in vitro kinase 1 24 251 FGF23 R176Q reactions with recombinant Fam20C and FGF23 R176Q. Fam20C SP nFGF23 cFGF23 Autorad phosphorylated FGF23 R176Q in a time-dependent manner, iFGF23 whereas the catalytically inactive Fam20C D478A failed to in- b b b b b corporate phosphate (Fig. 1D). Furthermore, treatment of pu- B 9 12 13 14 15 180 196 rified FGF23 R176Q with recombinant Fam20C increased the S A E D D S E R D P L N V L K P R 180 y y y y y y relative abundance of Ser phosphorylation (Fig. S2). By cal- 14 13 12 y 10 9 8 8 culating the area under the selected ion species, we estimated 100 936.5435 y +2 that treatment with Fam20C increased the relative abundance of 12 b 180 80 9 ∼ 712.6581 1005.3077 FGF23 R176Q Ser phosphorylation 10-fold. y +2 60 13 770.1674 To determine whether Fam20C phosphorylates FGF23 in

40 y +2 cells, we used clustered regularly interspaced short palindromic 10 y +2 604.6067 14 20 y repeats (CRISPR/Cas9) genome-editing technology to delete the 827.6633 9 b b b b 919.5739 12 13 14 15 488.2676 1051.5223 400.3679 513.4383 1152.5686 1329.3741 1428.43561541.4951 1669.5883 1865.6 FAM20C gene from the osteoblast-like cell line U2OS (31, 32) 0 1784.6434 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 (Fig. S3A). We generated U6-driven expression cassettes to ex- b b b 9 12 15 press single-guide RNAs targeting exon 1 of the human FAM20C C 180Sp A E D D S E R D P L N V L K P R196 gene for expression in U2OS cells (Fig. S3 B and D). Two clones y y y y y y 14 13 12 10 9 8 were detected to have insertions/deletions (indels) that resulted +2 (MH-H 3PO4) 25 962.1870 in frameshift mutations resulting in premature stop codons (Fig. S3 C and E). Protein immunoblotting with a polyclonal antibody 20 raised against full-length Fam20C detected Fam20C protein in 15 the conditioned medium of native U2OS cells but not the cells y 10 8 +2 y +2 y 13 936.5340 that were subjected to genome editing (Fig. 2A). To confirm loss Relative Abundance 12 +2 b +phos y 770.1452 9 5 10 712.6048 y +2 b +phos b +phos of Fam20C activity, the phosphorylation status of the Fam20C 14 1085.2113 12 15 437.3246 695.0972 827.6276 1164.4706 1410.4676 1749.4931 322.2546 547.3577 604.5301 1279.0575 1473.0205 1651.5757 0 1847.4840 substrate osteopontin (OPN) was analyzed in control and 32 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 Fam20C KO cells that were metabolically labeled with [ P]ortho- m/z phosphate. V5-tagged OPN was immunoprecipitated from con-

180 ditioned medium, and OPN protein and phosphorylation levels Fig. 1. Fam20C phosphorylates FGF23 on Ser .(A) Schematic representation were analyzed by autoradiography. OPN was phosphorylated in of human FGF23 indicating the signal peptide (SP), intact FGF23 (iFGF23), N- control cells, and no detectable phosphorylation was observed terminal fragment (nFGF23), and C-terminal fragment (cFGF23). The residues surrounding the SPC cleavage site (downward arrow) are shown. Mutations in Fam20C KO cells (Fig. 2B). that replace the Arg in patients with autosomal dominant hypophosphatemic In U2OS cells, ectopically expressed, C-terminal V5-tagged rickets (ADHR) are also shown. A potential Fam20C phosphorylation site is in FGF23 is O-glycosylated, and we can detect the full-length red. (B and C) Representative MS/MS fragmentation spectra of a tryptic peptide hormone and the C-terminal fragments in the conditioned (FGF23 180–196) depicting Ser180 phosphorylation of FGF23 R176Q purified medium by protein immunoblotting of V5-immunoprecipitates from conditioned medium of HEK293T cells. (D) Time-dependent incorporation (Fig. 2C). We transiently transfected V5-tagged FGF23 in con- of 32Pfrom[γ-32P]ATP into FGF23 R176Q by Fam20C or Fam20C D478A (DA). trol and Fam20C KO cells that we metabolically labeled with 32 Reaction products were analyzed by SDS/PAGE and autoradiography. [ P]orthophosphate and analyzed V5-immunoprecipitates from

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1402218111 Tagliabracci et al. conditioned medium. FGF23 was phosphorylated in control but A C PNGase F not in Fam20C-deficient cells, and phosphorylation was more + O-glycosidase + prevalent within the C-terminal fragment (Fig. 2D). Thus, C5 C9 Fam20C phosphorylates FGF23 in vitro and in cells. WT KO KO α-Neuraminidase + 250 KDa 35 KDa 180 glycosylated iFGF23 Phosphorylation of FGF23 at Ser Prevents O-Glycosylation by GalNAc-T3. non-glycosylated 130 KDa iFGF23 The physiological significance of FGF23 O-glycosylation was 25 KDa Medium underscored when inactivating mutations in the gene encod- 100 KDa IP: V5 IB: V5

ing GalNAc-T3 (GALNT3) were found in patients with FTC Medium 70 KDa (27). Patients with FTC develop hyperphosphatemia and se- α-Fam20C cFGF23 vere ectopic calcifications, symptoms of which are the metabolic 55 KDa 15 KDa “mirror image” of the hypophosphatemic disorders (26). Sub- Extracts sequent studies identified inactivating mutations in FGF23 in 35 KDa α-GAPDH FTC patients without mutations in GALNT3, suggesting that

FGF23 and GalNAc-T3 operate in a common pathway to reg- C9 35 KDa D C5 ulate phosphate homeostasis (26). The polypeptide N-acetylga- Extracts WT KO KO 35 KDa lactosaminyltransferase (GalNAc-transferase) family consists of 35 KDa α-GAPDH iFGF23 20 enzymes that catalyze the initial step of mucin-type O-glycosyl- 25 KDa Medium ation by transferring GalNAc from UDP-GalNAc to Ser and Thr IP: V5 residues in secretory pathway proteins (33). GalNAc-T3 O-glyco- IB: V5 sylates FGF23 on Thr178 within the R176H177T178R179/S180 SPC site, B C5 C9 cFGF23 and has been shown to protect FGF23 from proteolytic cleavage 15 KDa and thus inactivation (28). Because Fam20C phosphorylates FGF23 WT KO KO 180 35 KDa at Ser , and this residue is located immediately adjacent to IP: V5 iFGF23 the SPC site (Fig. 1A), we hypothesized that phosphorylation may (OPN) 25 KDa Medium regulate FGF23 O-glycosylation and/or proteolytic processing. In IP: V5 Medium 32P Fam20C-deficient U2OS cells, we did not observe changes in 32P O-glycosylation or proteolytic processing of ectopically expressed (OPN)

cFGF23 BIOCHEMISTRY FGF23. However, it is likely that endogenous Fam20C levels and/ 15 KDa or activity are much lower than the glycosyltransferases and/or Extracts α-Fam20C proteases that modify FGF23 in these cells (i.e., Fam20C is lim- α-Fam20C iting with respect to the glycosyltransferases and/or proteases). 70KDa Deletion of Fam20C therefore would have no effect on O-glyco- Fig. 2. Fam20C phosphorylates FGF23 in mammalian cells (A) Protein im- sylation and/or processing. To explore the effect of phosphoryla- munoblotting of trichloroacetic acid precipitates from conditioned medium tion of FGF23 on O-glycosylation and proteolytic processing, we of control and Fam20C KO cells (C5, clone 5; C9, clone 9) using an affinity- coexpressed Flag-tagged Fam20C or the catalytically inactive purified rabbit anti-Fam20C polyclonal antibody. GAPDH from cell extracts is Fam20C D478A mutant with V5-tagged FGF23 in U2OS cells shown as loading control (Lower). (B) Control and Fam20C KO cells were 32 3− and analyzed immunoprecipitates from conditioned medium. metabolically labeled with PO4 and transfected with V5-tagged OPN. Wild-type Fam20C, but not the inactive D478A mutant, decreased Protein immunoblotting of V5-immunoprecipitates from conditioned me- the mobility of the C-terminal fragments of FGF23 that was re- dium (Top) and autoradiography depicting 32P incorporation into OPN versed by λ-phosphatase treatment, suggesting a phosphorylation (Middle). Fam20C protein levels in conditioned medium are also shown event (Fig. 3A, Lower, first, second, and third lanes). Interestingly, (Bottom). (C) Protein immunoblotting of V5-immunoprecipitates from the the doublet in full-length, intact FGF23 (iFGF23) was absent conditioned medium of U2OS cells expressing V5-tagged FGF23. V5-immuno- when active Fam20C, but not the inactive Fam20C D478A mutant, precipitates were treated with O-glycosidase and α-(2→3,6,8,9)-neuraminidase was expressed (Fig. 3A, Upper, first and second lanes). Given the to remove O-linked glycosylation or PNGase F to remove N-linked glycosyla- 180 32 3− close proximity of Ser to the SPC site, we reasoned that phos- tion. (D) Control and Fam20C KO cells were metabolically labeled with PO4 phorylation of FGF23 at Ser180 would prevent O-glycosylation at and transfected with V5-tagged FGF23. Protein immunoblotting of V5- 178 immunoprecipitates from conditioned medium (Top) and autoradiography Thr and therefore explain the loss of the doublet observed in 32 iFGF23 induced by Fam20C (Fig. 3A, second lane). Indeed, muta- depicting P incorporation into FGF23 (Middle). Intact FGF23 and C-terminal tion of Ser180 to Ala prevented the loss of the doublet in iFGF23 fragments are shown. Fam20C protein levels in conditioned medium are also shown (Bottom). IB, immunoblotting; IP, immunoprecipitation. when Fam20C was expressed (Fig. 3A, fourth lane). Consistently, mutation of Thr178 to Ala (a nonglycosylated mutant) or Ser180 to Asp (a phosphomimetic) resulted in a species that migrated similar observed upon extended incubation (Fig. 3C and Fig. S5B). Col- to the phosphorylated WT iFGF23 (Fig. 3A, fifth and sixth lanes). lectively, our data support that Fam20C phosphorylates These results support that Fam20C phosphorylation of FGF23 at 180 180 178 FGF23 at Ser and inhibits O-glycosylation by GalNAc-T3 at Ser prevents O-glycosylation at Thr . 178 180 Thr . Importantly, these results provide a molecular mecha- To determine whether phosphorylation of FGF23 Ser directly affects O-glycosylation of FGF23 at Thr178 by GalNAc-T3, nism that could account for the increase in serum full-length we produced a HEK293T cell line stably expressing a secreted FGF23 in Fam20C KO mice and in humans with FAM20C form of GalNAc-T3 lacking the first 37 residues encompassing mutations, namely reduced Fam20C phosphorylation allowing O- the transmembrane domain and immunopurified the enzyme glycosylation and stabilization of FGF23. from conditioned medium (sGalNAc-T3; residues 38–633; Fig. Phosphorylated FGF23 Is Cleaved by the SPC Furin. S4). We then performed in vitro glycosylation experiments with The importance sGalNAc-T3 and a peptide substrate surrounding the SPC of FGF23 cleavage is underscored in patients with ADHR who cleavage site of FGF23 [residues 172–190 of human FGF23; have mutations that substitute the Arg residues within the SPC hereafter referred to as FGF23(172–190)]. MALDI-TOF MS cleavage site and render the protein resistant to proteolysis analysis of the reaction products demonstrated that sGalNAc-T3 (Fig. 1A) (24, 25). As our above results support, phosphorylation catalyzed the transfer of GalNAc from UDP-GalNAc to Thr178 of FGF23 at Ser180 inhibits O-glycosylation and would therefore of FGF23(172–190) as expected (Fig. 3B and Figs. S5A and S6). promote hormone proteolysis and thus inactivation. The specific However, when sGalNAc-T3 was assayed against Ser180-phosphor- protease that inactivates FGF23 has yet to be conclusively ylated FGF23(172–190), no detectable glycosylation was identified, but is likely a member of the SPC family based upon

Tagliabracci et al. PNAS Early Edition | 3of6 A B C p’tase λ

FGF23(172-190) pSer180 FGF23(172-190) PIPRRHTRSAEDDSERDPL PIPRRHTRpSAEDDSERDPL Fig. 3. Phosphorylation of FGF23 at Ser180 inhibits 20C D478A20C WT 20C WT + 20C WT 20C D478A20C D478A FGF23 WT S180AT178A S180D O-glycosylation by GalNAc-T3. (A) Protein immunoblotting of V5-immunoprecipitates from the condi- 35 KDa glycosylated iFGF23 non-glycosylated tioned medium of U2OS cells expressing V5-tagged iFGF23 25 KDa Medium FGF23 or mutants (S180A, T178A, S180D) with either IP: V5 WT (20C) or catalytically inactive D478A (20C D478A) IB: V5 FLAG-tagged Fam20C. V5-immunoprecipitates were λ λ ’ 15 KDa cFGF23 treated with -phosphatase ( p tase) (Upper). Extracts were analyzed for Fam20C, Fam20C D478A, FGF23, 35 KDa α-V5 and GAPDH (Lower). (B and C) sGalNAc-T3 was

Extracts (iFGF23) α-Flag incubated overnight (o/n) with FGF23(172–190) (Fam20C) 180 70 KDa (B)orSer -phosphorylated FGF23(172–190) (C) α 35 KDa -GAPDH and UDP-GalNAc. The products were analyzed by MALDI-TOF MS. the RXXR sequence comprising the cleavage site. With re- to induce a mobility change in OPN (Fig. 5C) and the secreted, spect to our model, the protease must cleave FGF23 between C-terminal fragment of FGF23 (Fig. 5D). Importantly, expression Arg179 and a phosphorylated Ser180 (176RHTR↓pSAE182). To of Fam20C T268M did not completely prevent O-glycosylation of explore the proteolytic processing of phosphorylated FGF23, intact FGF23, whereas WT Fam20C achieved complete inhibition we coexpressed Flag-tagged PCSK1, PCSK2, and PCSK3 (furin) of FGF23 O-glycosylation (Fig. 5D). Taken together, these findings with V5-tagged FGF23 in U2OS cells. Coexpression of the support that the elevated intact FGF23 and hypophosphatemia proteases and FGF23 had no detectable effect on the relative observed in patients with the Fam20C T268M mutation are a result levels of full-length secreted WT FGF23 (Fig. 4A). However, of the inability of Fam20C to efficiently phosphorylate FGF23 when FGF23 S180D (a phosphomimetic residue) or T178A (an to inhibit O-glycosylation. As a consequence, elevated biologically O-glycosylation–defective mutant) was coexpressed with the pro- active, O-linked glycosylated FGF23 is secreted, ultimately resulting teases, the SPC furin completely abolished the iFGF23 but did in hypophosphatemia. not concurrently increase the levels of the C-terminal fragments (Fig. 4A). We reasoned that this could potentially be due to the Discussion presence of additional furin-specific RXXR recognition motifs The results of this study expand our understanding of the com- within the C terminus of FGF23 that are cleaved by overex- plex control of mammalian phosphate homeostasis. Our model pressed furin. Therefore, to resolve this experimental possibility, for the regulation of FGF23 envisions a highly dynamic interplay we deleted furin in U2OS cells using CRISPR/Cas9 genome between O-glycosylation by GalNAc-T3 (or other members of editing (Fig. S7). When WT FGF23 was expressed in furin KO the GalNAc-transferase family) and phosphorylation by Fam20C cells, only intact FGF23 was detected, suggesting that furin as a means by which to balance the processing of FGF23 as in- cleaves FGF23 (Fig. 4B). Moreover, we analyzed the ability of tact, biologically active protein (glycosylated > phosphorylated) recombinant furin to cleave the Ser180-phosphorylated FGF23 or N- and C-terminal fragments (phosphorylated > glycosylated) (172–190) peptide by MALDI-TOF MS. Incubation of the non- (Fig. S9). This model is consistent with the marked elevation of phosphorylated or phosphorylated peptide with furin resulted intact, biologically active FGF23 observed in humans with the in the time-dependent cleavage of both substrates (Fig. 4 C and D Fam20C T268M mutation (12) and in Fam20C KO mice (13, 14). and Fig. S8). Thus, phosphorylation of FGF23 at Ser180 prevents Sensing the need to adapt phosphate balance in vivo is a Thr178 O-glycosylation by GalNAc-T3, which then allows furin- complex process, and our data support that the production of bio- dependent proteolysis. active FGF23 will depend upon, in addition to the levels of FGF23 transcription, the relative expression and activities of osteoblast/ Incomplete Inhibition of FGF23 O-Glycosylation by Fam20C T268M. osteocyte Fam20C, GalNAc-T3, and furin. The mechanisms Raine syndrome was originally described in 1989 as an aggres- by which Fam20C is functionally or expressionally regulated are sive, neonatal osteosclerotic bone dysplasia that results in death unknown. Recent studies examining the production of intact and/ within the first few weeks of life (11). Subsequently, mutations in or C-terminal fragments of FGF23 in fibrous dysplasia and during the FAM20C gene were found to be responsible for this disorder physiological situations of low iron, such as in ADHR (36, 37), (10), and recent reports suggest a broader phenotypic spectrum support that GalNAc-T3 and furin are likely controlled by for individuals with FAM20C mutations because some patients multiple factors including 3′,5′-cyclic adenosine monophosphate survive infancy (12, 34). Notably, Rafaelsen et al. (12) identified (38), iron or iron deficiency (39), and inorganic phosphate (40). a novel missense mutation in Fam20C that substituted Thr268 Site-specific O-glycosylation within, or neighboring, SPC sites with a Met in two compound heterozygous brothers who had is emerging as an important regulatory mechanism to control elevated serum intact FGF23 and hypophosphatemia. Threonine SPC-dependent processing of secreted proteins (41). Our results 268 (Thr175 in Caenorhabditis elegans) is highly conserved within are in accord with the concept that phosphorylation of hormones the Fam20C subfamily, and the C. elegans Fam20 crystal struc- may promote proteolysis by SPCs (or other proteases) by in- ture revealed that this Thr is located in the glycine-rich loop terfering with O-glycosylation by members of the GalNAc- (β1-β2), a region important for nucleotide binding (35) (Fig. 5 A transferase family. Our observation of competition between and B). To test the impact of this mutation on FGF23 phos- phosphorylation and O-glycosylation in the secretory pathway phorylation and O-glycosylation, we generated Flag-tagged reflects prior observations on the cross-talk between phosphor- Fam20C with Thr268 mutated to Met (Fam20C T268M) and ana- ylation and O-glycosylation by O-linked N-acetylglucosamine lyzed its activity as well as the ability to be secreted from U2OS (O-GlcNAc) transferase, which transfers GlcNAc from UDP- cells. In contrast to other nonlethal Fam20C mutations (3), sub- GlcNActoSerandThrresiduesinnuclearandcytosolic stitution of Thr268 with Met did not affect Fam20C secretion (Fig. 5 proteins (42). Interplay between O-glycosylation and phosphor- C and D). Fam20C T268M phosphorylated OPN and FGF23 ylation of the tumor suppressor p53 has been shown to co- much less efficiently than WT Fam20C, as judged by its ability ordinately regulate p53 stability and activity (43). Analogous

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1402218111 Tagliabracci et al. mechanisms, as our results suggest, but also through emerging, A B C17 C82 C17 C82 indirect pathways. In this regard, we have shown that DMP1, PCSK1 PCSK2 Furin PCSK1 PCSK2 Furin PCSK1 PCSK2 Furin FURIN WT KO KO WT KO KO FGF23 WT S180D T178A 35 KDa iFGF23 a highly phosphorylated extracellular matrix protein critical for 35 KDa proper mineralization of bone (46), is a substrate for Fam20C (3, iFGF23 25 KDa Medium Medium 25 KDa IP: V5 4). Inactivating mutations in DMP1 result in autosomal recessive IP: V5 IB: V5 IB: V5 hypophosphatemic rickets, and Dmp1 KO mice share many cFGF23 15 KDa cFGF23 phenotypic similarities with those of Fam20C-deficient animals, 15 KDa 35 KDa α-V5 α-V5 including elevated FGF23 (13, 22). DMP1 appears to regulate Extracts (iFGF23) 35 KDa (iFGF23) α Extracts FGF23 expression indirectly, as loss of Dmp1 in vivo impairs the 100 KDa -Flag (Proteases) maturation of osteoblasts to osteocytes through unknown mech- 70 KDa α-Furin 100 KDa anisms and results in highly elevated FGF23 mRNA as well as 35 KDa α-GAPDH α 35 KDa -GAPDH circulating protein (22). Thus, loss of DMP1 phosphorylation in a state of Fam20C deficiency could also contribute to an increase in FGF23 in vivo. Certainly additional studies will be required to CD understand these new interactions. In addition to Ser180, three Fam20C consensus S-x-E/pS sites are present in the C-terminal fragment of FGF23 (residues 180– 250). We were unable to detect FGF23 peptides surrounding the predicted sites by MS, and therefore at this time we cannot rule out Fam20C-dependent phosphorylation of these residues. By quantitating the incorporated radioactivity in Fig. 1D,wecalcu- lated a stoichiometry of about 1.5–2 mol of phosphate per mol FGF23 R176Q, suggesting that other sites may be phosphorylated. In conclusion, we have demonstrated that Fam20C regulates FGF23 by phosphorylation of Ser180. Phosphorylation of FGF23 inhibits GalNAc-T3 O-glycosylation, which then allows proteolysis by furin. Collectively, our results provide a mechanism by which loss of Fam20C leads to aberrations in phosphate homeostasis due

to a cellular shift toward increased O-glycosylation and thus ele- BIOCHEMISTRY vated levels of intact, biologically active FGF23 and, conversely, increased Fam20C activity shifts the FGF23 processing balance toward increased furin proteolysis and hormone inactivation. Furthermore, our data suggest that interplay between phosphorylation and O-glycosylation of proteins in the secretory

AB glycine H.sapiens MKSGGTQLK M.musculus MKSGGTQLK rich Thr175 loop R.norvegicus MKSGGTQLK D.melanogaster QKEGGTQLK Fig. 4. Furin cleaves phosphorylated FGF23. (A) Protein immunoblotting C.elegans IMDGGTQVK of V5-immunoprecipitates from the conditioned medium of U2OS cells expressing V5-tagged FGF23 or mutants (S180D and T178A) with FLAG-tagged PCSK1, PCSK2, or PCSK3 (furin) (Upper). Extracts were analyzed for PCSK1–3, FGF23, and GAPDH expression (Lower). (B) Protein immunoblotting of V5- D immunoprecipitates from the conditioned medium of control or FURIN KO 20C D478A 20C WT 20C T268M 35 KDa glycosylated iFGF23 U2OS cells (C17, clone 17; C82, clone 82) (Upper). Extracts were analyzed for non-glycosylated iFGF23 FGF23 and GAPDH expression (Lower). (C and D) Time-dependent cleavage C 25 KDa Medium of FGF23(172–190) (C)orSer180-phosphorylated FGF23(172–190) (D). The 20C D478A 20C WT 20C T268M IP: V5 products were analyzed by MALDI-TOF MS. IB: V5 100 KDa IP: V5 IB: V5

Medium cFGF23 15 KDa 70 KDa (OPN) Medium to what we observed in this work, phosphorylation of p53 IP: Flag IP: Flag IB: Flag promotes its degradation by the ubiquitin system by inhibiting IB: Flag 70 KDa (Fam20C) O-GlcNAcylation. Currently, it is unknown whether the interplay 70 KDa (Fam20C)

Extracts α between O-glycosylation by members of the GalNAc-transferase -Flag Extracts α-Flag 70 KDa (Fam20C) (Fam20C) family and phosphorylation by secretory pathway kinases is 70 KDa 35 KDa α-GAPDH α a common mechanism within the secretory pathway or whether 35 KDa -GAPDH FGF23 is a unique example. However, it is worth noting that bone morphogenetic protein 15 (BMP15), a secreted maternal Fig. 5. Deficient inhibition of FGF23 O-glycosylation by Fam20C T268M. (A) hormone essential for mammalian reproduction, is phosphory- Structural representation of the active site of Fam20 from C. elegans high- lated by Fam20C on an S-x-E motif (44). This phosphorylation lighting the position of Thr175 (human Thr268). The glycine-rich loop and nu- site (Ser6)islocatedclosetoanO-glycosylatedThr(Thr10). cleotide (ADP) are shown. (B) Sequence alignment of Fam20C from human When BMP15 is expressed in HEK293 cells, phosphorylation and (Homo sapiens), mouse (Mus musculus), rat (Rattus norvegicus), fly (Drosophila melanogaster), and worm (Caenorhabditis elegans) depicting the conservation O-glycosylation appear to be mutually exclusive (45). of the Thr. (C and D) Protein immunoblotting of V5 and Flag-immunopreci- The physiological scenario for the regulated control of circu- pitates from conditioned medium of U2OS cells expressing V5-tagged OPN (C) lating FGF23 is likely far more complicated than direct in- or FGF23 (D) with Flag-tagged D478A (20C D478A), WT (20C WT), or mutant teractions between FGF23, Fam20C, GalNAc-T3, and furin. It Fam20C found in patients with FGF23-related hypophosphatemia (20C T268M) is possible that Fam20C regulates FGF23 not only through direct (Upper). Extracts were analyzed for Fam20C and GAPDH expression (Lower).

Tagliabracci et al. PNAS Early Edition | 5of6 pathway may be a critical posttranslational mechanism by which (Cocalico Biologicals). More details on antibody generation are presented in secreted proteins are regulated. SI Methods.

Methods ACKNOWLEDGMENTS. We thank Carolyn A. Worby, Gregory S. Taylor, Jenna L. Protein Purification. Flag-tagged Fam20C and FGF23 R176Q were immuno- Jewell, and members of the J.E.D. laboratory for insightful discussions purified from conditioned medium of HEK293T cells as previously described and comments regarding the manuscript. We thank David King of the Howard Hughes Medical Institute’s Mass Spectrometry Laboratory (Uni- (3). More details on protein purification are presented in SI Methods. versity of California, Berkeley) for peptide synthesis and Eric Durrant for technical assistance. This work was supported in part by National Institutes of Generation of Anti-Fam20C Antibody. Polyclonal antisera were raised in rab- Health Grants DK018849-36 and DK018024-37 (to J.E.D.), DK63934 (to K.E.W.), bits against recombinant Flag-tagged Fam20C produced in HEK293T cells and K99DK099254 (to V.S.T.).

1. Cohen P (2002) The origins of protein phosphorylation. Nat Cell Biol 4(5):E127–E130. 25. White KE, et al. (2001) Autosomal-dominant hypophosphatemic rickets (ADHR) mu- 2. Fischer EH (2013) Cellular regulation by protein phosphorylation. Biochem Biophys tations stabilize FGF-23. Kidney Int 60(6):2079–2086. Res Commun 430(2):865–867. 26. Benet-Pagès A, Orlik P, Strom TM, Lorenz-Depiereux B (2005) An FGF23 missense 3. Tagliabracci VS, et al. (2012) Secreted kinase phosphorylates extracellular proteins mutation causes familial tumoral calcinosis with hyperphosphatemia. Hum Mol Genet that regulate biomineralization. Science 336(6085):1150–1153. 14(3):385–390. 4. Ishikawa HO, Xu A, Ogura E, Manning G, Irvine KD (2012) The Raine syndrome protein 27. Topaz O, et al. (2004) Mutations in GALNT3, encoding a protein involved in O-linked FAM20C is a Golgi kinase that phosphorylates bio-mineralization proteins. PLoS ONE glycosylation, cause familial tumoral calcinosis. Nat Genet 36(6):579–581. 7(8):e42988. 28. Kato K, et al. (2006) Polypeptide GalNAc-transferase T3 and familial tumoral calci- 5. Tagliabracci VS, Pinna LA, Dixon JE (2013) Secreted protein kinases. Trends Biochem nosis. Secretion of fibroblast growth factor 23 requires O-glycosylation. J Biol Chem Sci 38(3):121–130. 281(27):18370–18377. 6. Tagliabracci VS, Xiao J, Dixon JE (2013) Phosphorylation of substrates destined for 29. Bergwitz C, et al. (2009) Defective O-glycosylation due to a novel homozygous S129P – secretion by the Fam20 kinases. Biochem Soc Trans 41(4):1061 1065. mutation is associated with lack of fibroblast growth factor 23 secretion and tumoral 7. Salvi M, Cesaro L, Tibaldi E, Pinna LA (2010) Motif analysis of phosphosites discloses calcinosis. J Clin Endocrinol Metab 94(11):4267–4274. a potential prominent role of the Golgi casein kinase (GCK) in the generation of 30. Wang X, et al. (2010) Expression of FAM20C in the osteogenesis and odontogenesis of – human plasma phospho-proteome. J Proteome Res 9(6):3335 3338. mouse. J Histochem Cytochem 58(11):957–967. 8. Zhou W, et al. (2009) An initial characterization of the serum phosphoproteome. 31. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science – J Proteome Res 8(12):5523 5531. 339(6121):819–823. 9. Bahl JM, Jensen SS, Larsen MR, Heegaard NH (2008) Characterization of the human 32. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in cerebrospinal fluid phosphoproteome by titanium dioxide affinity chromatography adaptive bacterial immunity. Science 337(6096):816–821. – and mass spectrometry. Anal Chem 80(16):6308 6316. 33. Gill DJ, Clausen H, Bard F (2011) Location, location, location: New insights into 10. Simpson MA, et al. (2007) Mutations in FAM20C are associated with lethal osteo- O-GalNAc protein glycosylation. Trends Cell Biol 21(3):149–158. sclerotic bone dysplasia (Raine syndrome), highlighting a crucial molecule in bone 34. Simpson MA, et al. (2009) Mutations in FAM20C also identified in non-lethal osteo- development. Am J Hum Genet 81(5):906–912. sclerotic bone dysplasia. Clin Genet 75(3):271–276. 11. Raine J, Winter RM, Davey A, Tucker SM (1989) Unknown syndrome: Microcephaly, 35. Xiao J, Tagliabracci VS, Wen J, Kim SA, Dixon JE (2013) Crystal structure of the Golgi hypoplastic nose, exophthalmos, gum hyperplasia, cleft palate, low set ears, and casein kinase. Proc Natl Acad Sci USA 110(26):10574–10579. osteosclerosis. J Med Genet 26(12):786–788. 36. Farrow EG, et al. (2011) Iron deficiency drives an autosomal dominant hypophosphatemic 12. Rafaelsen SH, et al. (2013) Exome sequencing reveals FAM20c mutations associated rickets (ADHR) phenotype in fibroblast growth factor-23 (Fgf23) knock-in mice. Proc with FGF23-related hypophosphatemia, dental anomalies and ectopic calcification. Natl Acad Sci USA 108(46):E1146–E1155. J Bone Miner Res 28(6):1378–1385. 37. Imel EA, et al. (2011) Iron modifies plasma FGF23 differently in autosomal dominant 13. Wang X, et al. (2012) Inactivation of a novel FGF23 regulator, FAM20C, leads to hy- hypophosphatemic rickets and healthy humans. J Clin Endocrinol Metab 96(11): pophosphatemic rickets in mice. PLoS Genet 8(5):e1002708. 3541–3549. 14. Vogel P, et al. (2012) Amelogenesis imperfecta and other biomineralization defects in 38. Bhattacharyya N, et al. (2012) Mechanism of FGF23 processing in fibrous dysplasia. Fam20a and Fam20c null mice. Vet Pathol 49(6):998–1017. J Bone Miner Res 27(5):1132–1141. 15. Bhattacharyya N, Chong WH, Gafni RI, Collins MT (2012) Fibroblast growth factor 23: 39. Knutson MD (2010) Iron-sensing proteins that regulate hepcidin and enteric iron State of the field and future directions. Trends Endocrinol Metab 23(12):610–618. absorption. Annu Rev Nutr 30:149–171. 16. Farrow EG, White KE (2010) Recent advances in renal phosphate handling. Nat Rev 40. Chefetz I, et al. (2009) GALNT3, a gene associated with hyperphosphatemic fa- Nephrol 6(4):207–217. 17. Kurosu H, et al. (2006) Regulation of fibroblast growth factor-23 signaling by klotho. milial tumoral calcinosis, is transcriptionally regulated by extracellular phosphate J Biol Chem 281(10):6120–6123. and modulates matrix metalloproteinase activity. Biochim Biophys Acta 1792(1): – 18. Carpenter TO (2012) The expanding family of hypophosphatemic syndromes. J Bone 61 67. Miner Metab 30(1):1–9. 41. Schjoldager KT, Clausen H (2012) Site-specific protein O-glycosylation modulates — 19. Liu S, et al. (2006) Pathogenic role of Fgf23 in Hyp mice. Am J Physiol Endocrinol proprotein processing Deciphering specific functions of the large polypeptide GalNAc- – Metab 291(1):E38–E49. transferase gene family. Biochim Biophys Acta 1820(12):2079 2094. 20. Consortium TH; The HYP Consortium (1995) A gene (PEX) with homologies to en- 42. Hart GW, Slawson C, Ramirez-Correa G, Lagerlof O (2011) Cross talk between O-GlcNA- dopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat cylation and phosphorylation: Roles in signaling, transcription, and chronic disease. Annu Genet 11(2):130–136. Rev Biochem 80:825–858. 21. Lorenz-Depiereux B, Schnabel D, Tiosano D, Häusler G, Strom TM (2010) Loss-of- 43. Yang WH, et al. (2006) Modification of p53 with O-linked N-acetylglucosamine reg- function ENPP1 mutations cause both generalized arterial calcification of infancy ulates p53 activity and stability. Nat Cell Biol 8(10):1074–1083. and autosomal-recessive hypophosphatemic rickets. Am J Hum Genet 86(2):267– 44. Tibaldi E, et al. (2010) Golgi apparatus casein kinase phosphorylates bioactive Ser-6 of 272. bone morphogenetic protein 15 and growth and differentiation factor 9. FEBS Lett 22. Feng JQ, et al. (2006) Loss of DMP1 causes rickets and osteomalacia and identifies 584(4):801–805. a role for osteocytes in mineral metabolism. Nat Genet 38(11):1310–1315. 45. Saito S, Yano K, Sharma S, McMahon HE, Shimasaki S (2008) Characterization of the 23. Bergwitz C, Jüppner H (2010) Regulation of phosphate homeostasis by PTH, vitamin D, post-translational modification of recombinant human BMP-15 mature protein. Protein and FGF23. Annu Rev Med 61:91–104. Sci 17(2):362–370. 24. White KE, et al. (2000) Autosomal dominant hypophosphataemic rickets is associated 46. George A, Veis A (2008) Phosphorylated proteins and control over apatite nucleation, with mutations in FGF23. Nat Genet 26(3):345–348. crystal growth, and inhibition. Chem Rev 108(11):4670–4693.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1402218111 Tagliabracci et al. Supporting Information

Tagliabracci et al. 10.1073/pnas.1402218111 SI Methods Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 Molecular Biology, Cell Culture, and Transfection. Human cDNAs for Genome Editing. The 20-nt guide sequences targeting human FGF23, PCSK1, PCSK3 (furin), and the family with sequence sim- FAM20C and FURIN were designed using the clustered regularly ilarity 20, member C (Fam20C) were from Open Biosystems. Human interspaced short palindromic repeats (CRISPR) design tool PCSK2 and N-acetylgalactosaminyltransferase 3 (GalNAc-T3) at www.genome-engineering.org/crispr (2) and cloned into a bi- cDNAs were from DNASU. The ORFs were amplified by PCR cistronic expression vector (pX330) containing human codon- and cloned into mammalian expression plasmids containing optimized Cas9 and the RNA components (2) (Addgene). a C-terminal V5/His tag (pcDNA4.0; Invitrogen) or a C-terminal The guide sequences targeting exon 1 of human FAM20C and Flag tag (pCCF). QuikChange site-directed mutagenesis (Agi- exon 7 of human FURIN are shown below. lent Technologies) was performed to introduce mutations. U2OS FAM20C. and HEK293T cells were grown in DMEM containing 10% 5′-GGGCTGCGCGCACGAACAGC-3′ (clone 5) (vol/vol) FBS with 100 μg/mL penicillin/streptomycin (GIBCO) at 5 5′-CCGCCCCCGCAAGGCGCGCT-3′ (clone 9) 37 °C with 5% CO2. For coexpression experiments, 5 × 10 cells were seeded in 2 mL in a six-well plate format. Approximately 24 h FURIN. later, cells were transfected with 0.5 μg pCCF-PCSK1/2/3 or pCCF- 5′-TACACCACAGACACCGTTGT-3′ (clones 17 and 82) Fam20C (or mutants) and 2 μg pcDNA4.0-FGF23 (or mutants) with 7 μL FuGENE 6 (Roche) as recommended by the man- The single-guide RNAs (sgRNAs) in the pX330 vector (4 μg) ufacturer. Forty to 48 h after transfection, the conditioned me- were mixed with EGFP (1 μg; Clontech) and cotransfected into dium and cell extracts were harvested and analyzed. U2OS cells using FuGENE 6. Twenty-four hours posttransfection, the cells were trypsinized, washed with PBS, and resuspended Protein Immunoblotting and Immunoprecipitations. V5- and Flag- in fluorescence-activated cell sorting (FACS) buffer (PBS, 5 tagged proteins were analyzed by immunoprecipitation and im- mM EDTA, 2% FBS, and 100 μg/mL penicillin/streptomycin). munoblotting as described (1). Furin protein was analyzed by GFP-positive cells were single-cell–sorted by FACS (Human immunoblotting cell extracts with an anti-furin polyclonal anti- Embryonic Stem Cell Core, University of California, San Diego; body (1:1,000 dilution; GeneTex). To detect Fam20C protein in BD Influx) into a 96-well plate format into DMEM containing conditioned medium, cells were extensively washed with PBS 20% FBS and 100 μg/mL penicillin/streptomycin. Single clones and serum-free DMEM and then incubated for a minimum of were expanded and screened for Fam20C and furin by protein 16 h in serum-free DMEM. The medium was centrifuged at 750 × g immunoblotting. Genomic DNA (gDNA) was purified from for 5 min to remove cell debris. The supernatant was further clones using the Quick-gDNA Prep Kit (Zymo Research), and centrifuged at 10,000 × g for 10 min, and 100% trichloroacetic the region surrounding the protospacer adjacent motif (PAM) acid (one-quarter the volume of the medium) was added to the was amplified with Q5 polymerase (New England Biolabs) using resulting supernatant. The proteins were precipitated overnight the following primers (linkers containing EcoRI and HindIII at 4 °C and washed two or three times with −20 °C acetone. The restriction sites are underlined). samples were dried in a SpeedVac and resuspended in 1× SDS FAM20C. loading buffer. Fam20C protein was analyzed by immunoblotting Forward: 5′-AAAAGAATTCTGGAGAGGAGCGCGCTGA- with a rabbit polyclonal anti-Fam20C antibody. GGATC-3′ Generation of Anti-Fam20C Antibody. Anti-Fam20C antibodies were Reverse: 5′-AAAAAAGCTTTCCGGGTTCTCCGCCGCTT- affinity-purified by coupling maltose-binding protein (MBP) fusion TG-3′ peptides to HiTrap NHS-activated HP columns (GE Healthcare). The N-terminal MBP-fusion peptides (residues 20–361, 381–496, FURIN. 423–584, and 381–584 of human Fam20C) were produced in Es- Forward: 5′-AAAAGAATTCACTCAGGGGATGATGGG- cherichia coli and affinity-purified using amylose resin (New TGTC-3′ England Biolabs). Reverse: 5′-AAAAAAGCTTAGAGAAGGAAAAAGAGA- Metabolic Radiolabeling of U2OS Cells. For metabolic radiolabeling ACACCTCC-3′ experiments, 5 × 105 cells were seeded in 2 mL in a six-well plate PCR products were purified using the DNA Clean & Con- format. Approximately 24 h later, cells were transfected with μ μ centrator Kit (Zymo Research) and cloned into pBluescript II 5 g of pcDNA4.0-FGF23 or pcDNA4.0-osteopontin with 10 L KS+. To determine the indels of individual alleles, ∼10 bacterial FuGENE 6. Forty to 48 h after transfection, the medium was colonies were expanded and the plasmid DNA was purified and replaced with phosphate-free DMEM containing 10% (vol/vol) sequenced. dialyzed FBS and 1 mCi/mL [32P]orthophosphate (PerkinElmer). The cells were incubated for an additional 6–8 h at which time Protein Purification. Flag-tagged Fam20C and FGF23 R176Q were the conditioned medium was centrifuged at 750 × g for 5 min immunopurified from conditioned medium of HEK293T cells as to remove cell debris. The medium was further centrifuged at previously described (1). FGF23 R176Q was further purified by 10,000 × g for 10 min and V5-tagged proteins were immuno- Superdex 200 size-exclusion chromatography. To generate a se- precipitated from the supernatant, washed five times with PBS creted form of GalNAc-T3 (sGalNAc-T3), the nucleotides en- containing 0.4 mM EDTA and 1% Nonidet P-40, and then coding residues 38–633 of human GalNAc-T3 were cloned into analyzed for protein and incorporated 32P by immunoblotting a modified retroviral (pQCXIP; Clontech) vector containing and autoradiography. an N-terminal interleukin 2 signal peptide and a C-terminal Flag

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 1of10 tag. Stable expression and purification of sGalNAc-T3 from solid-phase chemistry on Wang resin using an ABI 431A synthesizer conditioned medium were performed as described (1). and incorporating pSer as its Fmoc-O-benzyl ester. Peptide–resin was cleaved with reagent K (2-Ethyl-5-phenylisoxazolium-3′- Enzyme Assays. Kinase assays. In vitro kinase assays were performed sulfonate). Identity and purity were assessed by electrospray essentially as described (1). The reaction mixture contained 32.5 ionization-Fourier transform ion cyclotron resonance mass spec- mM Tris·HCl (pH 7.5), 100 mM NaCl, 12.5% glycerol, 10 mM trometry; the purity of crude peptide was at least 90%. Peptides γ 32 – MnCl2,0.5mM[- P]ATP (specific activity 100 500 cpm/pmol), were dissolved in 10 mM Hepes and the pH was adjusted to 7 with 0.5 mg/mL FGF23 R176Q, and 20 μg/mL Fam20C-Flag or Fam20C NaOH before use. (D478A)-Flag. Glycosylation assays. In vitro O-glycosylation assays were per- Mass Spectrometry. Fifty picomoles of Flag-tagged FGF23 R176Q formed essentially as described (3). Reactions were performed in was oxidized with 4 mM DTT and alkylated with 8 mM iodoa- a 20-μL mixture containing 25 mM sodium cacodylate (pH 7.4), cetamide and digested with either trypsin, endoproteinase GluC, 10 mM MnCl2, 1.5 mM UDP-GalNAc (Sigma), 0.5 mg/mL pep- or chymotrypsin. The resulting peptide extract was diluted into tide substrate: PIPRRHTRSAEDDSERDPL; FGF23(172–190) a solution of 2% acetonitrile, 0.1% formic acid (buffer A) for or PIPRRHTRpSAEDDSERDPL; pFGF23(172–190), and 50 analysis. Two picomoles of each digest was analyzed by automated μg/mL sGalNAc-T3. Reactions were incubated at 37 °C and microcapillary liquid chromatography-tandem mass spectrome- terminated at the indicated time points by the addition of an try. Fused-silica capillaries (100-μm inner diameter; i.d.) were equal volume of Sigma-Aldrich universal MALDI matrix re- pulled using a P-2000 CO2 laser puller (Sutter Instruments) to suspended in 78% acetonitrile and 0.1% trifluoroacetic acid. a5-μm i.d. tip and packed with 10 cm of 5-μm Magic C18 ma- Protease assays. Furin cleavage assays were performed as previ- terial (Agilent) using a pressure bomb. This column was then μ ously described (3). Reactions were performed in a 20- L mixture installed in-line with a Dionex 3000 HPLC pump running at 300 containing 50 mM Hepes (pH 7.5), 1 mM CaCl2, 0.5 mg/mL nL/min. Peptides were loaded with an autosampler directly onto – – μ FGF23(172 190) or pFGF23(172 190), and 0.02 units per L the column and were eluted from the column by applying a furin (New England Biolabs). Reactions were incubated at 37 °C 30-min gradient from 5% buffer B to 40% buffer B (98% aceto- and terminated at the indicated time points by the addition of nitrile, 0.1% formic acid). The gradient was switched from 40% to an equal volume of Sigma-Aldrich universal MALDI matrix re- 80% buffer B over 5 min and held constant for 3 min. Finally, the suspended in 78% acetonitrile and 0.1% trifluoroacetic acid. λ gradient was changed from 80% buffer B to 100% buffer A over Deglycosylation and -phosphatase assays. V5-immunoprecipitates 0.1 min, and then held constant at 100% buffer A for 15 more from conditioned medium of U2OS cells transiently expressing V5- minutes. The application of a 1.8-kV distal voltage electro- tagged FGF23 were treated with O-glycosidase and α-(2→3,6,8,9)- sprayed the eluting peptides directly into an LTQ XL ion trap neuraminidase to remove O-linked glycosylation or PNGase F to mass spectrometer equipped with a nano-liquid chromatography remove N-linked glycosylation according to the manufacturer’s electrospray ionization source. Full mass spectra were recorded on instructions (Sigma-Aldrich; Enzymatic Protein Deglycosylation the peptides over 400–2,000 m/z, followed by five tandem mass Kit). λ-Phosphatase assays were performed as described (1). (MS/MS) events on the five most intense ions. Mass spectrometer Matrix-Assisted Laser Desorption/Ionization Analysis. Glycosylation scan functions and HPLC solvent gradients were controlled by the and protease reaction products (1 μL) were plated on an Applied Xcalibur data system (Thermo Finnigan). MS/MS spectra were Biosciences (ABI) MALDI target plate for analysis. The ABI extracted with ReAdW.exe (http://sourceforge.net/projects/sashimi). 4800 MALDI-TOF/TOF was calibrated at 25 ppm mass error The resulting mzXML file contains all of the data for all MS/MS with a peptide mix standard. After calibration, each spot was spectra and can be read by the subsequent analysis software. The analyzed using reflectron positive ionization and a laser power of MS/MS data were searched with Inspect (4) against a database 30%. Masses that corresponded to truncated forms of peptide containing protein sequences for all E. coli proteins, common PIPRRHTRSAEDDSERDPL and the phosphorylated version contaminants, and the sequence for FGF23 R176Q (2,786 pro- PIPRRHTRpSAEDDSERDPL were sequenced de novo for teins) with modifications: +16 on methionine (oxidation), +57 validation. In addition, b- and y-ion masses were used to localize on cysteine (carbamidomethyl), and + 80 on threonine, serine, or phosphorylated residues on fragment ions. tyrosine (phosphorylation). Only peptides with at least a P value of 0.01 were analyzed further. The MS/MS data of putative Peptide Synthesis. Peptides and phosphopeptides were synthesized phosphorylated peptides were manually verified. In addition, by standard O-(Benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium further verification was performed by analyzing putative phos- hexafluorophosphate/1-Hydroxybenzotriazole (HBTU/HOBt) Fmoc phorylated peptides in targeted MS/MS mode.

1. Tagliabracci VS, et al. (2012) Secreted kinase phosphorylates extracellular proteins that 3. Kato K, et al. (2006) Polypeptide GalNAc-transferase T3 and familial tumoral calcinosis. regulate biomineralization. Science 336(6085):1150–1153. Secretion of fibroblast growth factor 23 requires O-glycosylation. J Biol Chem 281(27): 2. Hsu PD, et al. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat 18370–18377. Biotechnol 31(9):827–832. 4. Tanner S, et al. (2005) InsPecT: Identification of posttranslationally modified peptides from tandem mass spectra. Anal Chem 77(14):4626–4639.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 2of10 b b b b b A 6 7 8 9 11 178T R S A E D D S E R D P L190

y11 y10 y9 y8 y7 y6 +2 b11 632.0926 100

30 b6 y6 b 20 +2 7 y 660.3980 716.4478 775.4199 7 y10 y b y 10 831.4466 b 8 9 y9 11 488.3409 574.5496 8 991.4409 309.2543 416.3833 862.4384946.4575 1075.58481165.5139 1233.5381 1314.6639 1379.6982 0 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 m/z

b7 b11 b12 B 178T R Sp A E D D S E R D P L190

y8 y7 y4

+2 (MH-H3PO4) 737.1538 100

50 +2 40 (b11-H3PO4) +2 30 b 623.0914 11 672.0321 +2 20 (b12-H3PO4) y y7 b +2 10 4 7 y (b -H PO ) 1342.4809 776.9341 831.4779 8 11 3 4 327.3252 398.3367 500.4369 565.5755 894.5484 946.5019 984.6955 1076.9574 1146.5485 1244.5568 1324.4948 1384.7170 0 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 m/z

Fig. S1. FGF23 is phosphorylated on Ser180. Representative MS/MS fragmentation spectra of a chymotryptic peptide (FGF23 178–190) depicting Ser180 phosphorylation of FGF23 R176Q purified from conditioned medium of HEK293T cells. The nonphosphopeptide and the phosphopeptide are shown in A and B, respectively.

A RT: 42.00 - 57.00 SM: 15G RT: 45.68 100 AA: 812455

50 SAEDDSERDPLNVLKPR

100

50 RT: 46.99 SphosAEDDSERDPLNVLKPR AA: 38501 0 RT: 51.81 100 AA: 2432500

- Fam20C SEDAGFVVITGVMSR 50 for loading control

0 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Time (min) B RT: 42.00 - 57.00 SM: 15G RT: 46.16 100 AA: 714375 SAEDDSERDPLNVLKPR 50

0 RT: 47.47 100 MA: 340573

50 SphosAEDDSERDPLNVLKPR

42.70 43.16 43.88 45.58 45.94 46.49 48.55 49.36 50.24 50.91 51.49 52.18 52.65 53.20 54.88 55.40 55.73 56.81 0

100

+Fam20C SEDAGFVVITGVMSR 50 RT: 52.45 for loading control AA: 600174 0 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Time (min)

Fig. S2. Fam20C phosphorylates FGF23 on Ser180. Selected ion chromatograms of tryptic peptides (FGF23 180–196) from FGF23 R176Q (A) or FGF23 R176Q that had been treated with recombinant Fam20C (B). Note the relative 10-fold increase in the relative abundance of the phosphopeptide upon treatment with Fam20C. Calculations are estimated based on the areas under the curve for the selected ion species (AA phospho/nonphospho; 38,501/812,455 = 0.05; 340,573/ 714,375 = 0.5). AA and MA, area; RT, retention time.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 3of10 sgRNA A 3’ 20 nt 5’

5’ 3’ G 3’ G 5’ N PAM Cas9 B

Human locus 3’-CGACAAGCACGCGCGUCGGG-5’ sgRNA_02

5’...TCGGGGGAGCCCGGCTGTTCGTGCGCGCAGCCCGCCGCCGAGGTGG...3’ 3’...AGCCCCCTCGGGCCGACAAGCACGCGCGTCGGGCGGCGGCTCCACC...5’ PAM

C Indel 5’...TCGGGGGAGCCCGGCG------GAGGTGG...3’

Stop TCGGGGGAGCCCGGCGGAGGTGG 1 22 200 584

SP Kinase Domain

46 Frameshift

Human locus 3’-UCGCGCGGAACGCCCCCGCC-5’ sgRNA_05

5’...GCCGAGCCGGCCGAGCGCGCCTTGCGGGGGCGGGATCCCGGCGCCC...3’

3’...CGGCTCGGCCGGCTCGCGCGGAACGCCCCCGCCCTAGGGCCGCGGG...5’ PAM E Indel Allele 1 5’...GCCGATCCT------TGCGGGGGCGGGATCCCGGCGCCC...3’ Indel Allele 2 5’...GCCGAGCCGCCCCGCAA------GGCGCCC...3’

GCCGATCCTTGCGGGGGCGGGATCCCGGCGCCC Stop 584 1 22 125

SP Kinase Domain

116 Frameshift

Stop GCCGAGCCGCCCCGCAAGGCGCCC 1 22 122 584

SP Kinase Domain

116 Frameshift

Fig. S3. Generation of Fam20C knockout cells using CRISPR/Cas9 genome editing. (A) The type II prokaryotic CRISPR/Cas9 from Streptococcus pyogenes has been shown to facilitate RNA-guided site-specific DNA cleavage and can be harnessed to target the destruction of specific genes in mammalian cells (1–3). Any genomic locus followed by a 5′-NGG PAM (red) can be targeted by a chimeric single guide RNA (sgRNA) (green) consisting of a 20-nt guide sequence and a scaffold. The sgRNA directs the Cas9 nuclease (gray) to the genomic target, resulting in a double-strand break. The double-strand break is repaired by error- prone nonhomologous end joining or by homologous recombination. (B and D) Schematic representations of the base pairing between guide RNAs and the targeting locus of exon 1 in the human FAM20C gene. (C and E) The sequences of the mutated alleles in FAM20C clone 5 (C) and clone 9 (E) and representative chromatograms depicting the indels (red) are shown. The indels are predicted to cause frameshift mutations producing inactive copies of the protein. SP, signal peptide.

1. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823. 2. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096):816–821. 3. Jinek M, et al. (2013) RNA-programmed genome editing in human cells. Elife 2:e00471.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 4of10 250 KDa

130 KDa

100 KDa

sGalNAc-T3 70 KDa

55 KDa

35 KDa

Fig. S4. Expression and purification of sGalNAc-T3. SDS/PAGE and Coomassie staining of Flag-tagged sGalNAc-T3 immunopurified from the conditioned medium of HEK293T cells.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 5of10 A PIPRRHTRSAEDDSERDPL t = 0 hr 100 2246.9653 FGF23(172-190) 2.2E+4 80 60 40 2145.9343 % Intensity 20 1989.8309 2127.9814 2268.9426 875.9688 995.8828 1124.4824 1301.6438 1416.6814 1531.6946 1696.6592 1852.7721 2464.1057 0 80011801560194023202700 Mass (m/z)

t = 1 hr PIPRRHTRSAEDDSERDPL 100 589.6 FGF23(172-190) 2246.9341 80 60 ensity

t PIPRRHTRSAEDDSERDPL +

n 875.9564 40 I 2145.8850 867.0152 2268.8789 203 Da (galNAc) % 20 1078.0046 1989.7593 2134.8645 2272.0603 2450.0347 801.0538 888.9924 1289.0570 1438.4230 1538.6671 1646.4606 1785.7836 2538.9307 0 80011801560194023202700 Mass (m/z)

t = 4 hr PIPRRHTRSAEDDSERDPL 100 FGF23(172-190) 2246.8987 3481.8 80 PIPRRHTRSAEDDSERDPL + 60 203 Da (galNAc) tensity 2145.8821 n 40 2449.9575 2090.8315 % I 2228.9409 20 1989.7943 2462.9995 875.9891 1124.4659 1852.7705 2127.8992 2239.7542 2361.9468 995.2341 1225.9937 1325.2849 1448.3438 1596.4999 1696.6565 1954.7197 0 80011801560194023202700 Mass (m/z) t = o/n PIPRRHTRSAEDDSERDPL +

100 FGF23(172-190) PIPRRHTRSAEDDSERDPL 203 Da (galNAc) 90 1298.1 2246.9456 2450.0085 ty 80 70 60 2145.9033 50 40 30 875.9642 2090.8511 2228.9495 2432.0042 % Intensi 1989.8335 2573.9971 20 1078.0222 1225.5336 1852.8047 2161.8525 2302.9805 2408.0195 10 889.0198 1358.4662 1474.6487 1696.6166 1954.8719 0 80011801560194023202700 Mass (m/z)

B t = 0 hr PIPRRHTRSAEDDSERDPL + 80 Da 100 pFGF23(172-190) 2326.8672 1.9E+4 80 60

40 2229.8970

% Intensity 20 2308.9275 875.9765 2185.8677 2423.8950 995.9240 1164.4697 1357.6862 1496.6134 1642.7976 1805.6265 1919.8557 2056.8757 2592.9290 0 800 1180 1560 1940 2320 2700 Mass (m/z)

t = 1 hr PIPRRHTRSAEDDSERDPL + 80 Da 100 pFGF23(172-190) 2326.7622 2648.0 80 ity

ns 60

nte 40 I 2228.9524 % 1164.4160 2348.7339 20 875.9684 2210.8323 2483.7969 2593.6543 993.8598 1298.2729 1411.3496 1594.2863 1805.5557 0 800 1180 1560 1940 2320 2700 Mass (m/z)

t = 4 hr PIPRRHTRSAEDDSERDPL + 80 Da 100 2326.8025 586.3 pFGF23(172-190) 80 ity s

n 60

nte 40

I 2329.6543 2229.7610 % 1163.9380 20 866.9969 2212.6812 2348.7607 2477.7830 2592.8838 955.1647 1155.5500 1289.0267 1419.4576 1567.5562 1675.3680 1805.5955 0 800 1180 1560 1940 2320 2700 Mass (m/z)

t = o/n PIPRRHTRSAEDDSERDPL + 80 Da 100 90 pFGF23(172-190) 2326.8223 4063.3 80 70 60 50 40 30 2229.0076 % Intensity 812.1735 2348.8284 20 918.1966 1025.1989 1164.3790 1411.3699 2212.0173 2449.9084 2592.8958 10 1268.3641 1549.3765 1657.3813 1806.5597 1961.6111 0 800 1180 1560 1940 2320 2700 Mass (m/z)

Fig. S5. Ser180-phosphorylated FGF23(172–190) is not a substrate for sGalNAc-T3. Full MALDI-TOF MS spectra depicting the time-dependent incorporation of GalNAc from UDP-GalNAc into FGF23(172–190) (A)orSer180-phosphorylated FGF23(172–190) (B).

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 6of10 b12 1619. 8210 100 2058. 9 +203 90

P I P R R H T R S A E D D S E R D P L 80

50 % I ntensity

1621. 7793 40 b17

30 2221. 8337 b13 1602. 8506 1734. 8497 b11 20 1521. 8096 1636. 8594 b b b 16 2210. 9585 8 15 2203. 9907 10 1217. 7279 1606. 0093 217. 2169 b10 1950. 8562 2249. 1919 b b4 b5 y7 1174. 6664 1487. 7770 1643. 0380 1813. 6967 2123. 8806 2 840. 4355 1158. 5181 1286. 6121 211. 1945 355. 6335 464. 4430 578. 5170 947. 4656 0 168 612 1056 1500 1944 2388 Mass (m/z)

Fig. S6. Thr178 is O-glycosylated by sGalNAc-T3. Representative MS/MS fragmentation spectrum of the selected ion peak at m/z 2450 in Fig. S5A, depicting the addition of GalNAc to Thr178.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 7of10 A Clone 17 E

Human locus 3’-UGUUGCCACAGACACCACAU-5’ sgRNA_18 Control Clone 17 Clone 82 250 KDa 5’...GCTGCGGTGGCCAACAACGGTGTCTGTGGTGTAGGTGTGGCCTACA...3’ 3’...CGACGCCACCGGTTGTTGCCACAGACACCACATCCACACCGGATGT...5’ PAM B Indel 130 KDa Allele 1 5’...GCTGCGGTGGCCAACA------TGTGGCCTACA...3’ Indel -Furin Allele 2 5’...GCTGCGGTGGCCAAAACACGGTGTCTGTGGTGTAGGTGTGGCCTACA...3’ 100 KDa Extracts

Stop Allele 1 GCTGCGGTGGCCAACATGTGGCCTACA 253 794 70 KDa SP FURIN

208 Frameshift

55 KDa Allele 2 GCTGCGGTGGCCAAAACACGGTGTCTGTGGTGTAGGTGTGGCCTACA Stop 794 259 35 KDa -GAPDH SP FURIN

207 Frameshift

C Clone 82

Human locus 3’-UGUUGCCACAGACACCACAU-5’ sgRNA_18 5’...CGGTGTGCGGGGGAAGTGGCTGCGGTGGCCAACAACGGTGTCTGTGGTGTAGGTGTGGC...3’ 3’...GCCACACGCCCCCTTCACCGACGCCACCGGTTGTTGCCACAGACACCACATCCACACCG...5’ D PAM Indel Allele 1 5’...CGGTGT------CTGTGGTGTAGGTGTGGC...3’ Indel Allele 2 5’...CGGTGTGCGGGGGAAGTGGCTGCGGTG------TCTGTGGTGTAGGTGTGGC...3’

Stop 794 Allele 1 CGGTGTCTGTGGTGTAGGTGTGGC 247 SP FURIN

199 Frameshift

Stop Allele 2 CGGTGTGCGGGGGAAGTGGCTGCGGTGTCTGTGGTGTAGGTGTGGC 209 794

SP FURIN

206 Frameshift

Fig. S7. Generation of FURIN knockout cells using CRISPR/Cas9 genome editing. (A and C) Schematic representations of the base pairing between a guide RNA (sgRNA_18) and the targeting locus of exon 7 in the human FURIN gene. (B and D) The sequences of the mutated alleles in FURIN clone 17 (B) and clone 82 (D) and representative chromatograms depicting the indels (red) are shown. The indels are predicted to cause frameshift mutations producing inactive copies of the protein. (E) Protein immunoblotting of cell extracts from control and furin KO cells.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 8of10 A t=0hr PIPRRHTRSAEDDSERDPL 100 2246.990 90 FGF23(172-190) 7076.1 y

t 80 i 70 60 ens 50 -101 -h20 nt 40 I 30 -156 2145.951 % 2229.017 20 -257 1124.505 1989.856 2206.102 2314.038 10 812.207 918.2401015.257 1203.345 1283.327 1416.715 1505.381 1592.343 1726.537 1852.791 2109.895 2396.012 0 800 1140 1480 1820 2160 2500 Mass (m/z) PIPRRHTR t=1hr 1032.555 100 90 FGF23(172-190) 5.6E+4 y

t 80 70 60 PIPRRHTRSAEDDSERDPL ensi t 50 2246.992 40 -101 2145.955 30 SAEDDSERDPL % In 20 1054.541 1989.861 2127.989 2229.022 10 803.180 931.513 1138.583 1233.447 1318.695 1416.693 1531.705 1696.707 1852.800 2314.021 0 800 1140 1480 1820 2160 2500 Mass (m/z) PIPRRHTR t=4hr 1032.539 100 FGF23(172-190) 6.2E+4 80 60 -101

tensity 931.513 40 In PIPRRHT 2090.898 PIPRRHTRSAEDDSERDPL

% 1054.545 20 SAEDDSERDPL 1989.861 1015.509 2072.921 2161.945 2246.980 803.188 876.468 947.502 1122.601 1233.457 1315.644 1472.7271583.629 1696.682 1852.804 1971.880 2326.941 0 800 1140 1480 1820 2160 2500 Mass (m/z) PIPRRHTR t=o/n 1032.562 100 90 FGF23(172-190) 1.4E+4 y

t 80 i

s 70 60 en t 50 -101 n 40 I 30 931.521 SAEDDSERDPL % PIPRRHTRSAEDDSERDPL 20 PIPRRHT 1054.550 1989.861 2090.898 10 803.195 876.464 953.513 1138.578 1233.455 1323.307 1472.728 1696.718 1852.813 2246.977 2385.052 0 800 1140 1480 1820 2160 2500 Mass (m/z) B t=0hr pFGF23(172-190) PIPRRHTRSAEDDSERDPL + 80 Da (phosphorylation) 100 2326.8293 4477.7

y 80 it s

n 60

nte 40 I 2230.3557

% 20 2227.9402 813.2053 1164.4210 2424.8955 2592.9058 919.2242 1033.2991 1297.4475 1411.3760 1513.7103 1658.4591 1805.5619 2056.8494 2163.2263 0 800 1180 1560 1940 2320 2700 t=1hr Mass (m/z) pFGF23(172-190) PIPRRHTR 1032.5424 100 3.0E+4

ty 80 i s

n 60

nte 40 PIPRRHTRSAEDDSERDPL + 80 Da

% I -101 20 1054.5382 1188.6511 2326.9058 803.1926 931.5209 1651.8958 1076.5306 1184.5566 1298.6267 1495.8107 1788.9536 1919.7991 2056.8838 2225.8892 2334.1633 2463.9785 2592.9861 0 80011801560194023202700 t=4hr Mass (m/z) pFGF23(172-190) PIPRRHTR 1032.5347 100 6.8E+4 y

t 80 si 60 en t

n 40 I 1188.6462 -101 % 1054.5345 20 931.5107 1145.6257 1651.9012 803.1787 1030.5420 1298.6360 1495.8112 1788.9540 1919.8431 2056.8630 2225.8679 2326.9136 2463.9319 2592.9482 0 80011801560194023202700 t=o/n Mass (m/z) pFGF23(172-190) PIPRRHTR 1032.7383 100 -101 90 1.1E+4 y 80 931.5189

sit 70 n 60 1188.6627 50 nte 40 933.5178 I 1054.5577 30 1169.6224 1651.9218 % 850.4355 20 990.5574 1298.6570 1788.9728 1184.5713 1495.8334 10 800.1817 890.4687 1301.6627 1609.9100 1808.0243 1961.7966 2157.9851 2314.0679 2464.0020 2593.0498 0 800 1180 1560 1940 2320 2700 Mass (m/z)

Fig. S8. Ser180-phosphorylated FGF23(172–190) is cleaved by furin. Full MALDI-TOF MS spectra depicting the time-dependent cleavage of FGF23(172–190) (A) or Ser180-phosphorylated FGF23(172–190) (B).

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 9of10 i) ii) GalNAc-T3 Fam20C others?

ATP UDP-GalNAc

GalNAc GalNAc P GalNAc N P P ? N FGF23 FGF23 P FGF23 FGF23 C C Furin XFurin

GalNAc GalNAc P ? GalNAc N P P FGF23 P N FGF23N-Ter FGF23 FGF23 Fragment C Inactive C FGF23 Active FGF23

Fig. S9. Model for the regulation of FGF23 by Fam20C. We propose that interplay between phosphorylation by Fam20C (i) and O-glycosylation by GalNAc-T3 (ii) regulates the processing and activity of FGF23 by furin. Phosphorylation of FGF23 at Ser180 by Fam20C inhibits GalNAc-T3-mediated O-glycosylation at Thr178 and promotes inactivation by furin. Fam20C may also phosphorylate predicted Ser-x-Glu/pSer residues in the C-terminal region of FGF23.

Tagliabracci et al. www.pnas.org/cgi/content/short/1402218111 10 of 10