Sphaeromyxids Form Part of a Diverse Group of Myxosporeans Infecting

Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 http://www.parasitesandvectors.com/content/6/1/51

RESEARCH Open Access Sphaeromyxids form part of a diverse group of myxosporeans infecting the hepatic biliary systems of a wide range of host organisms Árni Kristmundsson1 and Mark A Freeman2*

Abstract Background: Approximately 40 species of Sphaeromyxa have been described, all of which are coelozoic parasites from gall bladders of marine fish. They are unique amongst the myxosporeans as they have polar filaments that are flat and folded instead of being tubular and spirally wound. This unusual feature was used as a subordinal character to erect the suborder Sphaeromyxina, which contains one family, the Sphaeromyxidae, and a single genus Sphaeromyxa. Methods: In the present study, we examine eelpout from the genus Lycodes from Iceland for the presence of myxosporean parasites in the gall bladder and perform morphological and DNA studies. Results: A novel myxosporean, Sphaeromyxa lycodi n. sp., was identified in the gall bladders of five of the six species of Lycodes examined, with a prevalence ranging from 29 - 100%. The coelozoic plasmodia are large, polysporous and contain disporic pansporoblasts and mature spores which are arcuate. The pyriform polar capsules encase long and irregularly folded ribbon-like polar filaments. Each spore valve has two distinct ends and an almost 180° twist along the relatively indistinct suture line. The single sporoplasm is granular with two nuclei. Sphaeromyxa lycodi is phylogenetically related to other arcuate sphaeromyxids and is reproducibly placed with all known sphaeromyxids and forms part of a robustly supported clade of numerous myxosporean genera which infect the hepatic biliary systems of a wide range of hosts. Conclusions: Sphaeromyxa lycodi is a common gall bladder myxosporean in eelpout of the genus Lycodes from Northern Iceland. It has characteristics typical of the genus and develops arcuate spores. Molecular phylogenetic analyses confirm that sphaeromyxids form a monophyletic group, subdivided into straight and arcuate spore forms, within the hepatic biliary clade that infect a wide range of freshwater associated animals. The ancestral spore form for the hepatic biliary clade was probably a Chloromyxum morphotype; however, sphaeromyxids have more recently evolved from an ancestor with a spindle-shaped Myxidium spore form. We recommend that the suborder Sphaeromyxina is suppressed; however, we retain the family Sphaeromyxidae and place it in the suborder Variisporina. Keywords: Sphaeromyxa, Lycodes, Gall bladder, Myxosporean, Myxidium, Hepatic biliary group, Chloromyxum

Background There are approximately 40 species described from the Myxosporeans are common parasites of fish and have a genus Sphaeromyxa Thélohan 1892, all of which are two-host lifecycle involving an invertebrate that is gen- coelozoic parasites in gall bladders of marine fish and erally an annelid worm. The vertebrate host is typically form characteristic large flat plasmodia. Although not a fish but other aquatic-associated vertebrates such as usually associated with serious pathology, some may turtles, waterfowl and amphibians as well as terrestrial cause blockages of bile ducts which results in bile accu- insectivorous mammals are also reported as hosts [1-5]. mulation and liver inflammation [6]. Species of this genus are unusual in that they do not have a typical tube-like polar filament that is spirally wound in the * Correspondence: [email protected] 2Institute of Ocean and Earth Sciences, University of Malaya, Kuala Lumpur polar capsule. Rather, it is flat in section, broad at the 50603, Malaysia base, gradually tapering along its length and is folded Full list of author information is available at the end of the article

© 2013 Kristmundsson and Freeman; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 2 of 13 http://www.parasitesandvectors.com/content/6/1/51

upon itself several times in the polar capsule. Lom and range 43 – 62 cm: n = 10), L. gracilis(18– 27 cm; n = 21), Noble [7] proposed this unusual feature as a new subor- L. reticulatus (11 – 23 cm; n = 22), L. pallidus (18 – 26 dinal character and erected the suborder Sphaeromyxina cm; n = 4), L. seminudus (16 – 36 cm; n = 10) and L. Lom et Noble, 1984 to include a single new family eudipleurostictus (10 – 29 cm; n = 22). Immediately after Sphaeromyxidae Lom et Noble, 1984. In Thélohan’s ori- catching, the fish were frozen aboard the research vessel. ginal description of the genus, Sphaeromyxa, he consid- After the survey the fish were taken to a laboratory and ered it to be a member of the family Myxidiidae Thelohan kept frozen until examination. 1892. DNA sequence data for sphaeromyxids are somewhat limited, with information available for only 5 species. However, currently they are one of the few monophyletic Fresh material - spore measurements myxosporean taxa [8] and unusually group with a range of Thawed fish were dissected, their gall bladder removed other myxosporean genera that infect the gall bladders of and a drop of its contents put on a microscopic slide and freshwater hosts [9]. screened for the presence of myxosporean infections at a There are few reports of myxosporeans from eelpout magnifications of 200× - 400×. Initially two species of fish (Zoarcidae). The type species of the genus Shulmania, S. were chosen, L. reticulatus and L. eudipleurostictus,and ovale, was described from the urinary bladder of Lycodes descriptions and measurements of spores were taken fol- esmarkii from the Canadian Atlantic [10]. In the Pacific, lowing the guidelines of Lom and Arthur [13]. Fresh Myxidium melanostigmum was described from the gall spores were measured and photographed using bright field bladder of the eelpout Melanostigma pammelas adeepwa- and Nomarski illumination at magnification up to 1250×. ter fish off the Californian coast [11] and Myxobolus All other fish species were checked for the presence of aeglefini was found in the skeletal muscle of porous-head myxosporeans and samples taken for DNA analyses. eelpout Allolepis hollandi from the Sea of Japan [12]. In the present study, we examine eelpout, from the genus Histology Lycodes, from Iceland for the presence of myxosporean Gall bladders from two infected fish, one L. reticulatus parasites in the gall bladder. and one L. eudipleurostictus, were fixed in 10% buffered formalin, embedded in paraffin wax, sectioned (4 μm), Methods stained with Giemsa and Haematoxylin and Eosin and Fish were sampled by trawling (300 – 500 m) north of prepared for histological examination according to routine Iceland in July 2012 during an annual survey performed protocols. In addition, air dried smears from infected gall by the Marine Research Institute in Iceland (Figure 1). bladders were fixed in methanol and stained with Giemsa These included adult fish of Lycodes esmarkii (length and Haematoxylin and Eosin.

67°18´N 21°44´W 67°10´N 15°51´W

66°26´N 18°33´W

Iceland

Figure 1 Sampling area of Lycodes spp. north of Iceland (shaded area) demarcated by three coordinates. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 3 of 13 http://www.parasitesandvectors.com/content/6/1/51

SEM methods adjusted manually to achieve optimum alignments. The The contents of an infected gall bladder from each spe- final alignment was manually edited using the BioEdit cies (L. reticulatus and L. eudipleurostictus)ofhostfish sequence alignment editor and contained 2619 charac- were fixed in 2.5% glutaraldehyde for 4 hrs at 4°C, and ters of which 1358 were informative sites. then rinsed four times in 100 mM sodium cacodylate Phylogenetic analyses were performed using the max- buffer pH 7.2 allowing the spores to settle under gravity imum likelihood methodology in PhyML [18] with the between each rinse. The resulting spore suspension was general time-reversible substitution model selected and W passed through a 0.4 μm Whatman Cyclopore track- 100 bootstrap repeats. Maximum parsimony in PAUP*4.0 etched polycarbonate membrane using a syringe and beta10 [19] using a heuristic search with random taxa filter clamp. The membrane was then post-fixed in 1% addition (10 replications), the ACCTRAN-option, and the osmium tetroxide in 100 mM sodium cacodylate buffer TBR swapping algorithm with gaps treated as missing data pH 7.2 for 2hrs and taken through an ethanol series of and branch supports obtained with 1000 bootstrap rep- 30%, 60%, 90% and 2 × 100% 30 mins each, transferred licates. Bayesian inference (BI) analysis using MrBayes into 50% hexamethyldisilazane (HMDS) in 100% ethanol v. 3.2.1 [20]. The BI analysis models of nucleotide sub- followed by two changes of 100% HMDS each for 45 min. stitution were first evaluated for the alignment using Excess HMDS was removed and the membranes allowed MrModeltest v. 2.2 [21]. The most parameter-rich to air dry overnight. The membranes were then mounted evolutionary model based on the AIC was the general onto aluminium stubs, earthed with silver dag paint and time-reversible, GTR+I+G model of evolution. Therefore, sputter-coated with gold. Samples were viewed with a Jeol the settings used for the analysis were nst = 6, with the JSM 6460 LV SEM instrument. gamma- distributed rate variation across sites and a pro- portion of invariable sites (rates = invgamma). The priors DNA analysis on state frequency were left at the default setting (Prset Gall bladder contents from three infected fish from, L. statefreqpr = dirichlet (1, 1, 1, 1)). Posterior probability reticulatus and L. eudipleurostictus, were used in initial distributions were generated using the Markov Chain DNA extractions and to obtain the majority (18e-18gM) Monte Carlo (MCMC) method with four chains being run of the small subunit ribosomal DNA (SSU rDNA) se- simultaneously for 1000,000 generations. Burn in was set quence. Total DNA was extracted using a GeneMATRIX at 2500 and trees were sampled every 100 generations kit (EURx Poland) following the tissue protocol. Parasite making a total of 7500 trees used to compile the majority SSU rDNA was amplified using the myxosporean PCR rule consensus trees. primers and methodology described by Freeman et al. [14] and the additional primers set 390f 5’agagggagcctgagaaacg S. lycodi. 3’ and 1830r 5’ tctaagggcatcacagacctg 3’ using the same In accordance with section 8.6 of the ICZN's International PCR conditions. DNA samples from additional infected Code of Zoological Nomenclature, details of the new spe- fish, 2 per species, L. gracilis, L. pallidus and L. seminudus, cies have been submitted to ZooBank with the Life Science were extracted as above and amplified using primers Identifier (LSID) zoobank.org:pub:B7DFC3E9-5F5A-4239- designed to be specific for sphaeromyxid taxa, Sphy-F B811-4C435DAA5423. 5’gaaaggctcagtatatcag 3’ and Sphy-R 5’ tattcaaggcacgyyatgc 3’ which amplify a 744 base pair region of the SSU rDNA Results that includes the phylogenetically informative V4 region. Five of six Lycodes species examined were found to be PCR conditions were the same as those described above. infected with a novel Sphaeromyxa species. The prevalence All PCRs were completed in triplicate and PCR products of figures for each fish species were: Lycodes pallidus:number the expected sizes were recovered using a GeneMATRIX infected/total number examined = 4/4; prevalence = 100%, PCR products extraction kit (EURx Poland). L. reticulatus: 18/22; 82%, L. seminudus:7/10;70%, Sequencing reactions were performed using BigDyeTM L. eudipleurostictus: 15/22; 68%, L. gracilis:6/21; Terminator Cycle Sequencing chemistry utilising the same 29%, L. esmarkii: 0/10; 0%. oligonucleotide primers that were used for the original PCRs. DNA sequencing was performed in both forward Description of Sphaeromyxa lycodi n. sp. and reverse directions for all PCR products and nucleotide The plasmodia are coelozoic, i.e. floating freely in the bile BLAST searches performed for each sequence read to of the gall bladder and commonly occupying significant confirm a myxosporean origin [15]. The contiguous parts of the gall bladder’s volume, causing opacity in some sequence was obtained manually using CLUSTAL_X cases. They are polymorphic, long and slender with ir- and BioEdit [16,17]. CLUSTAL X was used for the initial regular and long pseudopodial projections (Figure 2A). sequence alignments of 54 myxosporean taxa, with the They are wrapped around themselves as well as settings for gap opening/extension penalties being neighbouring plasmodia; similar to rivets of tangled yarn Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 4 of 13 http://www.parasitesandvectors.com/content/6/1/51

Gbw

B C D

Sl Gl Ep

Figure 2 Stained histological sections. (A) A section through a gall bladder infected with Sphaeromyxa locodi n. sp. showing large polymorphic plasmodia (thin arrows) occupying large parts of its volume. (B) Mature S. lycodi spores within a plasmodium. (C) Several developing pansporoblasts (arrows) and one mature spore (arrowhead) within a plasmodium. (D) Typical ectoplasm of a plasmodium; a narrow compact outer layer (broad arrow), a triple eosinophilic inner layer, a broader finely granular layer (Gl) enclosed by two radially striated layers (Sl). (E) A less commonly detected ectoplasmic layer with spherical bodies (white arrows) and villar protrusions (black arrow). (A), (C) and (D) are stained with Haematoxylin and Eosin stain but (B) and (E) with Giemsa. Scale bars: (A) = 500 μm; (B)=30μm(C)=10μm; (D) and (E)=5μm. Gbw - gall bladder wall. Ep – endoplasm. threads. Estimating their exact length is problematic but view the spores are slightly sigmoid, tapering somewhat the longest unbroken plasmodium detected in histological towards the blunt ends. The sporoplasm is granular with a sections was approximately 10 mm long. They are pair of ovoid and centrally located nuclei parallel along polysporous and packed with numerous mature spores the shorter axis. The pyriform polar capsules encase long and developing sporoblasts (Figures 2B, C). They form and irregularly folded polar filaments. When extruded, the disporic pansporoblasts. Most commonly the ectoplasm is filaments appear flat along their entire length, broad composed of a narrow (1.0 - 1.5 μm) compact outer layer where they exit the spore valve and gradually taper along and a thicker (5 - 7 μm) and triple eosinophilic inner layer; their length (Figures 3A, B and 4A, B). a finely granular layer enclosed with radially striated layers The suture line is relatively indistinct and similar in ap- (Figure 2D). Occasionally, plasmodia with ectoplasm pearance to the valve striations, of which there are 6 – 7 having spherical bodies and prominent villar projections on each spore valve. Each valve has one bulbous / rounded were detected (Figure 2E). The endoplasm is vacuolated end that houses the polar capsule with the other end more and loosely connected. In frontal view the spore body is spoon-like to receive the polar capsule from the opposing arcuate and tapers towards its rounded ends. In sutural rounded valve end. The valves have an almost 180° twist Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 5 of 13 http://www.parasitesandvectors.com/content/6/1/51

thickness (sutural view) 4.5 – 6.2 μm (5.7 ± 0.8), length of polar capsule 5.8 – 9.8 μm (8.32 ± 1.0), width of polar capsule 2.5 – 4.5 μm (3.3 ± 0.8), length of polar filaments 28.8 – 48.3 μm (36.5 ± 5.6). Spore measurements of S. lycodi from L. reticulatus and L. eudipleurostictus were found to be comparable in all dimensions, and were not significantly different.

DNA analysis The same myxosporean SSU rDNA sequence was obtained from both L. reticulatus and L. eudipleurostictus, with a contiguous sequence of 1983 bp submitted to Genbank under the accession number KC524734. Blast searches revealed the closest match in the databases to be Sphaeromyxa kenti and isolates of Sphaeromyxa hellandi, with a 94% and 91% identity respectively. Shorter sequenced regions of the SSU rDNA from L. gracilis, L. pallidus and L. seminudus all had identical sequence A B reads to the two type species with longer reads. Phylogenetic analyses using three methodologies pro- Figure 3 Line drawings of a mature spore of Sphaeromyxa lycodi n. sp., (A) Frontal view and (B) sutural view. Scale duced congruent tree topologies with respect to the posi- bar = 10 μm. tioning and members of the major clades (Figure 7). Sphaeromyxa lycodi was reproducibly placed with other sphaeromyxid taxa in all analyses and formed part of a robustly supported clade of 19 taxa that are found infecting along the suture length so that like ends appear to be in the hepatic biliary systems of a wide range of hosts the same plane. Striations are present that start from the (Figure 7). Although the hepatic biliary clade was strongly rounded end and extend down the valve, parallel to the supported in all analyses, the relative positions of the 19 suture, but not along the entire length. There is a short taxa varied depending on the phylogenetic methodology terminal striation on the rounded ends (Figures 5A, B and used (Figures 8A, B). Nevertheless, the sphaeromyxids 6A, B). were always robustly placed in a monophyletic group and Dimensions, based on measurement of 60 spores (20 were most closely related to Myxidium coryphaenoideum for spore thickness and length of polar filaments) are as in all analyses. In both maximum likelihood and max- follows. Spore length (straight distance between the tips imum parsimony topologies M. coryphaenoideum was the of the arcuate spore) 19.6 – 25.3 μm(mean±s.d.= basal taxon for the hepatic biliary clade (Figures 7 and 8B), 22.4 ± 1.4), spore width 4.6 – 6.9 μm (5.7 ± 0.6), spore however, in the Bayesian analysis M. coryphaenoideum,

A B

Figure 4 Micrograph of fresh mature spores of Sphaeromyxa lycodi n. sp. (Nomarski interference). (A) Frontal view with its polar filament folded in the polar capsules. (B) Two mature spores with their polar filaments extruded; 1.5 - 2 times longer than the valve length. Note the morphology of the polar filaments; broad at the base and tapering towards the ends. Scale bars: (A)=5μm, (B)=10μm. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 6 of 13 http://www.parasitesandvectors.com/content/6/1/51

Figure 5 Scanning electron micrographs of Sphaeromyxa lycodi n. sp. Spores have an indistinct suture line (white arrows). Each valve has one rounded/bulbous end that supports the polar capsule and the other more spoon-like to receive the polar capsule from the opposing valve. The valves have an almost 180° twist along the suture length so that like ends appear to be in the same plane. Striations are present that start from the rounded/bulbous end extending along the valve but not for the entire length. There is a terminal short striation on the rounded/ bulbous ends (white asterisk).

together with the sphaeromyxids, formed a sister clade Sphaeromyxa sequences, supports this grouping (Figure 9). to one containing Myxidium anatidum and Cystodiscus Sphaeromyxids have been shown to have unusually low spp. infecting waterfowl and amphibians respectively host specificity [24], a characteristic also demonstrated in (Figures 8A). Myxidium hardella and M. chelonarum, this study with 5 of the 6 Lycodes spp. as hosts. As DNA from freshwater turtles, consistently grouped together data for the group is limited (six species now have SSU in all analyses and formed as a sister clade to the fish- rDNA data, Figure 9), most descriptions of sphaeromyxids infecting species. However, the position of Myxidium have been based exclusively on morphological characteris- scripta, also from freshwater turtles, in the group was tics, and therefore, it is important to demonstrate that not consistent and was poorly supported in all tree top- potential new species are novel. The arcuate species S. ologies and did not group with other species infecting hellandi and S. kenti [8,25] are the most phylogenetically turtles. Soricimyxum fegati isolated from the liver of the related to S. lycodi n. sp., but are too distant to be the con- common shrew formed a consistent clade in all analyses sidered conspecific (Figure 9). Five other known arcuate with Chloromyxum trijugum infecting sunfish gall bladder species, S. arcuata, S. curvula, S. sabrazesi, S. elegini and and formed as a sister clade to the fish-infecting group S. noblei, show some resemblance to S. lycodi with regard (Figures 7 and 8A, B). to spore size. However, when compared they are all quite A more focused analysis of all known sphaeromyxid different with respect to one or more features (Table 1). SSU rDNA sequences, including those with short Firstly, all these species have very different geographic sequence reads, revealed a robust group divided into distributions with one reported from the Mediterranean, strongly supported sub-clades representing those with one from Australian waters, one from Japan and Barents straight spores or those with curved ones (Figure 9). Sea and one from the South Atlantic [23,24,26]. With Sphaeromyxa lycodi forms a clade with S. kenti,inthe regard to morphology, S. arcuata and S. curvula,have groupwithcurvedsporeswithisolatesofS. hellandi. considerably more slender polar capsules than S. lycodi. The only sequence from non-fish host that grouped Furthermore, S. arcuata is generally slightly longer while outside the hepatic biliary clade was Chloromyxum S. curvula is slightly shorter than S. lycodi [23]. Both the careni isolated from the kidney of the Malayan horned spore body and the polar capsules of S. sabrazesi are frog Megophrys nasuta [22]. significantly narrower in addition to the polar filaments being only half the length of those from S. lycodi [23]. Discussion Sphaeromyxa elegini is different in having a very small To date approximately 40 Sphaeromyxa species have been (10 × 18 μm) disporous plasmodia but also a differently reported, all of which are parasitic in the hepatic biliary arranged nuclei [26]. Finally, S. noblei has a leaf-like systems of marine fishes, typically found in the gall plasmodia and differently arranged nuclei [24]. Scanning bladder. On the basis of the morphological features of electron microscopy of spores of S. lycodi has allowed us mature spores, they have been divided into two main to visualise the shape and arrangement of the two valves groups; having either arcuate or straight spores [23], and (Figures 5 and 6), which appear to be somewhat similar to DNA analysis in the present paper, based on available those in the phylogenetically related species S. kenti. This Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 7 of 13 http://www.parasitesandvectors.com/content/6/1/51

Rbe

Sce B

Rbe

Sce

Rbe

Sce Figure 6 (A) and (B) Line drawings showing the frontal view of the two valves of S. lycodi n. sp. separated. Each valve has two different ends; a round/bulbous shaped end (Rbe) and a spoon/cup shaped end (Sce). The valves have an approximately 180° twist and consequently analogous ends of the two valves lie in the same plane. In frontal view most of the one valve's body is visible (A) but only the ends of the opposing valve (B). (C) The suture of the valve ends. The Rbe type appears to sit inside the Sce end and supports the polar capsule. Scale bars = 2 μm. valvular arrangement, one rounded end and one cupped with the exception of L. esmarkii. Lycodes esmarkii is a end, may be a common feature in arcuate spore forms but member of the clade of long-tailed species, and hence may SEM data is limited for the group. also be a host for S. lycodi, but was not detected in this Although L. reticulatus and L. eudipleurostictus, the type study. It is also possible that other related fish genera hosts for S. lycodi, occupy the same genus, they are readily could be susceptible to infection with S. lycodi. Indeed, phylogenetically distinguished from each other using both other sphaeromyxids such as S. hellandi and the type morphological (tail length) and DNA sequence data [27]. species S. balbianii are known from multiple fish hosts, Lycodes reticulatus forms part of the monophyletic short often distantly related [24], indicating that sphaeromyxids tail group that is also supported in multiple gene phyloge- are not routinely host specific and susceptibility to infec- nies, whilst L. eudipleurostictus is part of the sister clade tion may be due to other factors. The prevalence of infec- of long-tailed species [27]. We have demonstrated that fish tion in adult Lycodes spp. was high in most cases, and from both major groups of Lycodes are host to S. lycodi, apart from opacity in some gall bladders no pathology was Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 8 of 13 http://www.parasitesandvectors.com/content/6/1/51

Figure 7 Maximum likelihood topology based on dataset of 54 aligned myxosporean SSU rDNA sequences, generated using the general time reversible model of nucleotide substitution in PhyML. Thick branches terminate in a node that received full support from three independent phylogenetic methodologies, numbers at the nodes refer to bootstrap support values for maximum likelihood (100 samplings), Bayesian posterior probability support and percentage bootstrap support for maximum parsimony (1000 samplings), (ns) indicates an unsupported node or one with a support value below 50. The light red shaded box represents a well-supported clade of myxosporeans that infect the hepatic biliary systems of a wide range of host organisms, the number at the nodes in this clade refer to maximum likelihood support values (see Figure 8 for Bayesian and maximum parsimony topologies for this clade). The darker red shaded box within the hepatic biliary clade contains Sphaeromyxa lycodi and other sphaeromyxid taxa. The shaded areas bordered by a bold dashed line represent taxa from the suborder Variisporina, with the exception of the Multivalvulida sequences from the marine teleost group (blue box).The light orange shaded area, bordered by a solid line contains taxa from the suborder Platysporina. All myxosporean sequences were taken from fish hosts unless specified with symbols after the specific names: representing turtle, shrew, waterfowl or amphibian hosts. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 9 of 13 http://www.parasitesandvectors.com/content/6/1/51

Figure 8 Part of the phylogenetic trees for Bayesian analysis (A) and maximum parsimony analysis (B) for the nineteen myxosporean taxa that form the hepatic biliary clade; taken from trees generated using the same alignment of 54 taxa used in Figure 7. Thick branches represent a support value of >95 and (ns) indicates nodes with a support of <50. Sphaeromyxa lycodi is strongly supported in a clade with other sphaeromyxid taxa and has Myxidium coryphaenoideum as the closest known relative in both trees, but receiving very strong support in the Bayesian analysis. Shaded boxes represent clades that were recovered in all analyses. apparent, suggesting that S. lycodi is not pathogenic to the Lycodes in this study. Our phylogenetic analyses also the host. demonstrate that sphaeromyxids form a well-supported Myxosporeans tend to have a characteristic size of SSU monophyletic group within this freshwater clade and share rDNA depending whether they are marine or freshwater a common ancestor with Myxidium coryphaenoideum. species and typically form reliable freshwater and marine Myxidium coryphaenoideum and morphologically similar clades in phylogenetic analyses [9]. The length of the SSU species M. melanostigum, M. melanocetum and M. rDNA sequence for S. lycodi is comparable to that of other bajacalifornium all share numerous characteristics sphaeromyxids, which are more similar to freshwater with sphaeromyxids. They are elongate spindle-like myxosporeans than marine species [9]. Indeed, in all of myxosporeans with two nuclei; all are known to de- our phylogenetic analyses, the sphaeromyxids are robustly velop large polysporous plasmodia in the gall bladders supported in a discrete clade of myxosporeans that infect of deep sea fish, some with ‘heavy’ polar filaments [11]. the hepatic biliary systems of numerous freshwater as- Myxidium coryphaenoideum is also known to exhibit low sociated hosts, including fishes, turtles, amphibians, host specificity and have an atypical ‘rough’ polar filament waterfowl and terrestrial insectivorous mammals. How- [28,29]. These similarities to Sphaeromyxa spp. support ever, sphaeromyxids are all described from marine fish, this type of ancestral Myxidium as the correct morphotype including those from deep water environments such as for the sphaeromyxids. Fiala [9] supplied the SSU rDNA Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 10 of 13 http://www.parasitesandvectors.com/content/6/1/51

Figure 9 Maximum likelihood phylogeny based on 11 SSU rDNA sequences (2033 characters) of sphaeromyxids and related taxa. Sphaeromyxa lycodi forms a robust clade with S. kenti, which is a well-supported sister clade to the S. hellandi group. The sphaeromyxids form two robustly supported groups from node A (arrowed); one clade contains taxa with straight spores (blue box) and the other contains those with curved spores (green box). Figures at the nodes represent percentage bootstrap support values from 1000 samplings. Cystodiscus melleni is used as the outgroup and to root the tree. sequence for M. coryphaenoideum and in his phylogenetic common ancestor with an elongate spindle form, similar analyses he also found it grouped basally to sequences to that of M. coryphaenoideum and the DNA data is sup- for sphaeromyxids and formed part of a clade of portive of a freshwater origin. However, what is less clear myxosporeans infecting the gall bladders of freshwater is whether this spore form is the ancestral morphotype for fishes. Fiala [9] concluded that sphaeromyxids are the well-supported hepatic biliary clade (Figures 7 and 8). closely related to Myxidium species, M. coryphaenoideum It has been well reported that Myxidium and Zschokkella- being the closest species and suggested that the common shaped spores are polyphyletically distributed within ancestor of marine Sphaeromyxa spp. was a freshwater myxosporean systematics and hence are assumed to have myxosporean with Myxidium-shaped spores. We agree evolved on numerous occasions throughout myxosporean that the evidence, both morphological and molecular, is evolution [9,30,31]. It may be possible that all myxosporean highly indicative that all sphaeromyxids evolved from a spore forms are as plastic as Myxidium over evolutionary

Table 1 Comparison of S. lycodi with other arcuate Sphaeromyxa species which overlap with regard to spore length [8,23,25,26] Body Polar capsules Polar Plasmodium Nuclei Geograpic filaments Length Type Location distribution Length Width W:L Length Width W:L S. lycodi 19.6-25.3 4.6-6.9 0.25 6.3-9.8 2.5-4.5 0.40 28.8-48.3 Polysporous Parallel to North off Long and short axis Iceland slender S. hellandi 22.5-30 4.5-7.5 0.21 8.5-12.5 2.5-3.5 0.28 n.d. Polysporous Parallel to Atlantic Ocean Auerbach, 1909 Leaf like long axis Barents Sea S. kenti Whipps & 17.5-19.5 3.8-5.2 0.24 5.8-8.6 2.0-2.6 0.31 n.d. Polysporous Parallel to Lake Font, 2012 Discoid long axis Pontchartrain, Louisiana S. noblei Lom, 18.5-21.5 5.2-6.0 0.28 5.0-6.5 2.5-2.7 0.44 n.d. Polysporous Parallel to Australian 2004 Leaf like long axis waters S. elegini Dogiel, 21-26 4.5-8.8 0.28 7.5-9.0 3.0-4.5 0.45 n.d. Disporous Parallel to Japan Sea 1948 Small (10x18μm) long axis Bering Sea S. curvula 19-22 4-6 0,24 7-9 2-3 0.31 n.d. n.d. n.d. S-Atl. Ocean Fantham, 1930 off Namibia S. sabrazesi 22-25 3-4 0,15 8-10 2-3 0.28 12 Polysporous n.d. Mediterranean Leveran et Discoid Sea off Monaco Mesnil, 1900 All measurements in μm. n.d. = no data. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 11 of 13 http://www.parasitesandvectors.com/content/6/1/51

time, or it may be that some forms evolve at slower rates is likely that, when more molecular data exist for and are more likely to be true ancestral morphotypes for myxosporean taxa from the renal systems of amphibians, clades such as the hepatic biliary group. The majority of they will form a clade with C. careni reinforcing the poten- knowntaxainthehepaticbiliaryclade(Myxidium, tial importance of the Chloromyxum morphotype as Zschokkella, Sphaeromyxa, Cystodiscus and Soricimyxum) ancestral forms to some of the currently recognised clades could have, and likely did, all evolve from an immediate in myxosporean systematics. Myxidium morphotype ancestry. However, the unambigu- The sphaeromyxids are currently classified in a separate ous inclusion of Chloromyxum trijugum in the group suborder, the Sphaeromyxina Lom et Noble, 1984, due to makes it unlikely that the ancestral morphotype for the the presence of the unique ribbon-like polar filament they hepatic biliary clade was Myxidium-like. A study of the his- all possess. Sphaeromyxids do form a monophyletic clade tory of character evolution in myxozoans also indicates in this and other phylogenetic studies [8,9], including that the Chloromyxum spore morphotype was more stable multiple gene analyses [38] suggesting that this feature is during the evolution of the myxosporeans and was respon- unique amongst the myxosporeans and was derived from sible for the radiation of freshwater myxosporeans after an ancestor common to all known sphaeromyxids. How- separation from the marine Chloromyxum leydigi group ever, their assignment to a separate suborder is no longer [31] that infects various elasmobranchs (Figure 7). There- justified as they are robustly located within taxa from the fore, we consider it more likely that the ancestral spore suborder Variisporina Lom et Noble, 1984, in phylogenetic form for the hepatic biliary clade was a Chloromyxum analyses and have clearly evolved from a common ances- morphotype. tor with an elongate Myxidium form, similar to that of M. Myxosporeans from the hepatic biliary clade infecting coryphaenoideum. Other recent molecular studies on gall bladders of invasive amphibians, such as the cane toad sphaeromyxids [9,39] and Lom and Dyková’ssynopsisof (Bufo marinus) in Australia, are known to spread to nu- myxozoan genera [40] support these findings; therefore, merous endemic species [32,33], again indicating the very we recommend that the suborder Sphaeromyxina is no low host specificity found in this group of myxosporeans. longer retained. However, due to the polyphyletic nature The spread of wildlife pathogens into new geographical of Myxidium in myxosporean systematics, and the place- ranges or populations is a conservation concern for ment of the type species, M. lieberkuehni, in a different endangered species of which amphibian decline is one of clade to the sphaeromyxids (Figure 7), we retain the family the most dramatic examples. Sphaeromyxidae and place it in the suborder Variisporina Myxosporeans that infect certain organs or tissues Lom et Noble, 1984. have been shown to reproducibly cluster together in molecular phylogenetic analyses [9,34] and all taxa in Taxanomic summary: the hepatic biliary group are found infecting the gall bladder, bile ducts or liver of their hosts. However, Phylum: Cnidaria Hatschek, 1888 Myxidium scripta and M. hardella, infecting freshwater Unranked subphylum: Myxozoa Grassé 1970 turtles, are also reported from renal tubules as well as Class: Myxosporea Bütschli, 1881 from the bile ducts and gall bladder [35,36]. This may Order: Bivalvulida Schulman, 1959 be due to these reports being from systemic infections, Suborder: Variisporina Lom et Noble, 1984 as in both cases severe pathologies and mortalities had Family: Sphaeromyxidae Lom et Noble, 1984 occurred, and it is possible that the hepatic biliary Genus: Sphaeromyxa Thélohan, 1892 system is the initial site of infection with other organs only becoming infected during the advanced stages of Amended description for genus Sphaeromyxa: infection. However, it may also be possible that turtle Polar filament is not tube-like as in other Myxosporea, be- myxosporeans in this clade are an exception to this ing flat with a broad base that gradually tapers to the end. pattern. Currently only a single taxon, Chloromyxum In the polar capsule it is irregularly folded several times careni, isolated from kidney tissues alone, from a non-fish instead of being spirally wound. Polysporous plasmodia host groups outside the hepatic biliary clade. In our containing disporic pansporoblasts are coelozoic in the analyses it forms a moderately supported group with other gall bladder and bile ducts of marine fishes, and may be species of Chloromyxum that infect the gall bladders of several mm in length or diameter. Spore elongated, some- freshwater fishes (Figure 7). However, in other analyses times slightly curved or arcuate; the two polar capsules lie that are more focused on the phylogenetic relationships in its opposite, tapering and truncate ends. Spores open at amongst Chloromyxum spp., its position is unresolved and the level of the straight or curved suture line, bisecting the it forms a solitary branch between a clade of urinary spore and connecting both its ends. Shell valves smooth bladder infecting species and the Myxidium lieberkuehni or ridged. One binucleate sporoplasm. Marked pathology clade, both of which contain Chloromyxum taxa [37]. It may result in forms that infect bile ducts. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 12 of 13 http://www.parasitesandvectors.com/content/6/1/51

Main amendments include: polar filament no longer de- Competing interests scribed as short, and pathology may result from infection. The authors declare that they have no competing interests.

Authors' contributions Specific diagnosis of Sphaeromyxum lycodi n. sp. ÁK and MF dissected the fish and isolated the myxosporeans. ÁK performed the morphological and histological studies. MF carried out the DNA analyses Large polysporous plasmodia, up to 10 mm in length, and the SEM. ÁK and MF jointly wrote the manuscript. Both authors containing disporic pansporoblasts, are coelozoic in the approved the final version of the manuscript. gall bladder of Lycodes spp. In frontal view the spore body Acknowledgements is arcuate and tapers towards its rounded ends. In sutural We would like to thank the staff at the Marine Research Institute in Iceland view the spores are slightly sigmoid, tapering somewhat and the crew of the vessel for assistance with sampling the fish. Funding for towards the blunt ends. The suture line is relatively indis- the molecular study was provided by a University of Malaya Research Grant (UMRG) No: RG201-12SUS and partial funding for publication costs was tinct and similar in appearance to the valve striations. provided by the University of Malaya RU fund. Each valve has one bulbous / rounded end that supports the polar capsule with the other end more spoon-like to Author details 1Institute for Experimental Pathology, University of Iceland, Keldur v/ receive the polar capsule from the opposing rounded valve Vesturlandsveg, 112, Reykjavik, Iceland. 2Institute of Ocean and Earth end. The valves have an almost 180° twist along the suture Sciences, University of Malaya, Kuala Lumpur 50603, Malaysia. length so that like ends appear to be in the same plane; – Received: 26 January 2013 Accepted: 20 February 2013 there are 6 7 striations present on each valve. The Published: 1 March 2013 pyriform polar capsules encase relatively long and irregularly folded polar filaments. When extruded, the filaments References appear flat along their entire length, broad where they exit 1. Friedrich C, Ingolic E, Freitag B, Kastberger G, Hohnmann V, Skofitsch G, Neumaister U, Kepka O: A myxozoan-like parasite causing xenomas in the the spore valve and gradually taper along their length. The brain of the mole Talpa europaea L., 1758. Parasitology 2000, 121:438–492. sporoplasm is granular with a pair of ovoid and centrally 2. Eiras JC: An overview on the myxosporean parasites in amphibians and located nuclei. reptiles. Acta Parasitol 2005, 50:267–275. 3. Dyková I, Tyml T, Fialaand I, Lom J: New data on Soricimyxum fegati (Myxozoa) including analysis of its phylogenetic position inferred from Type host: Lycodes reticulatus and L. eudipleurostictus the SSU rRNA gene sequence. Folia Parasitol 2007, 54:272–276. Type location: Northern Icelandic waters 4. Bartholomew JL, Atkinson SD, Hallett SL, Lowenstine LJ, Garner MM, Gardiner CH, Rideout BA, Keel MK, Brown JD: Myxozoan parasitism in Site of infection: Coelozoic in gall bladder waterfowl. Int J Parasitol 2008, 38:1199–1207. Etymology: lycodi refers to the generic name of the 5. Hartigan A, Fiala I, Dyková I, Rose K, Phalen DN, Šlapeta J: New species of host fish Lycodes Myxosporea from frogs and resurrection of the genus Cystodiscus Lutz, 1889 for species with myxospores in gallbladders of amphibians. Type material: Deposited at Natural History Museum Parasitology 2012, 139:478–96. London (NHMUK) 2013.1 Slide 1 Holotype, 2013.2 6. Sears BF, Anderson P, Greiner EC: A new species of myxosporean Slide 2 Paratype, 2013.3 Slide 3 Paratype. (Sphaeromyxidae), a parasite of lined seahorses, Hippocampus erectus, from the Gulf of Mexico. J Parasitol 2011, 97:713–6. A SSU rDNA sequence was submitted to Genbank 7. Lom J, Noble E: Revised classification of the class of Myxosporea under the accession number KC524734 Bütschili, 1881. Folia Parasitol 1984, 31:193–205. 8. Whipps CM, Font WF: Interaction of two myxozoan parasites from naked goby Gobiosoma bosc, in Lake Pontchartrain, Louisiana. J Parasitol, Conclusions in press. 9. Fiala I: The phylogeny of Myxosporea (Myxozoa) based on small subunit Sphaeromyxa lycodi n. sp. is a common gall bladder ribosomal RNA gene analysis. Int J Parasitol 2006, 36:1521–1534. myxosporean in numerous eelpout of the genus Lycodes 10. Kovaleva AA, Zubchecko AV, Krasin VK: Foundation of a new from Northern Iceland. It has characteristics typical of the Myxosporidean family (Protozoa, Myxosporidia) with a description of two new genera. Parazitologiya 1983, 17:195–202 (In Russian). genus and forms arcuate spores. The spore valves have 11. Noble ER: Myxosporidia in deepwater fishes. J Parasitol 1966, 52:685–690. one rounded end that supports the polar capsule and one 12. Yokoyama H, Wakabayashi S: Myxobolus aeglefini found in the skeletal spoon-like end to receive the polar capsule from the op- muscle of porous-head eelpout Allolepis hollandi from the Sea of Japan. Fisheries Sci 2000, 66:963–966. posing rounded valve. Molecular phylogenetic analyses 13. Lom J, Arthur JR: A guideline for the preparation of species description confirm that sphaeromyxids form a monophyletic group, on Myxosporea. J Fish Dis 1989, 12:151–156. subdivided into straight and arcuate spore forms, within 14. Freeman MA, Yokoyama H, Ogawa K: Description and phylogeny of Ceratomyxa anko sp. n. and Zschokkella lophii sp. n. from the Japanese the hepatic biliary clade that infect a wide range of fresh- anglerfish, Lophius litulon (Jordan). J Fish Dis 2008, 31:921–930. water associated animals. The ancestral spore form for 15. Zhang Z, Schwartz S, Wagner L, Miller W: A greedy algorithm for aligning the hepatic biliary clade was probably a Chloromyxum DNA sequences. J Comput Biol 2000, 7:203–214. 16. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The morphotype; however, sphaeromyxids have more recently CLUSTAL-X windows interface: flexible strategies for multiple sequence evolved from a Myxidium ancestor with a spindle-shaped alignment aided by quality analysis tools. Nucl Acids Res 1997, spore. We recommend that the suborder Sphaeromyxina is 24:4876–4882. 17. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and suppressed; however, we retain the family Sphaeromyxidae analysis program for Windows 95/98/ NT. Nucleic Acids Symp Ser 1999, and place it in the suborder Variisporina. 41:95–98. Kristmundsson and Freeman Parasites & Vectors 2013, 6:51 Page 13 of 13 http://www.parasitesandvectors.com/content/6/1/51

18. Guindon S, Dufayard JF, Lefort V: Anisimov, M, Hordijk W, Gascuel O: New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 2010, 59:307–321. 19. Swofford DL: PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods), Volume v. 4.0 beta10. Sunderland, MA, USA: Sinauer Associates; 2002. 20. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19:1572–1574. 21. Nylander JAA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL: Bayesian phylogenetic analysis of combined data. Syst Biol 2004, 53:47–67. 22. Jirku M, Bartošová P, Kodadkova A, Mutschmann F: Another Chloromyxid Lineage: Molecular Phylogeny and Redescription of Chloromyxum careni from the Asian Horned frog Megophrys nasuta. J Eukaryot Microbiol 2011, 58:50–59. 23. Laird M: The protozoa of New Zealand intertidal zone fishes. Transactions and Proceedings of the Royal Society of New Zealand 1953, 81:79–143. 24. Lom J: Morphology and ultrastructure of Sphaeromyxa noblei sp. n. (Myxozoa), parasite of Heteroclinus whiteleggii (Pisces) from Australian New South Wales coast. Folia Parasitol 2004, 51:19–26. 25. Kalvati C, MacKenzie K: The genera Ceratomyxa Thélohan, 1892, Leptotheca Thélohan, 1895 and Sphaeromyxa Thélohan, 1892 (Myxosporea: Bivalvulida) in gadid fish of the northeast Atlantic. Syst Parasitol 1999, 43:209–216. 26. Shulman SS: Myxosporidia of the USSR. Izd. Nauka, Akad. Sci. USSR, Moskva-Leningrad 1966, :504. In Russian. 27. Møller PR, Gravlund P: Phylogeny of the eelpout genus Lycodes (Pisces, Zoarcidae) as inferred from mitochondrial cytochrome b and 12S rDNA. Mol Phylogenet Evol 2003, 26:369–388. 28. Zubchenko AV, Krasin VK: Myxosporidia of the genus Myxidium in some macrurids in the North Atlantic and Pacific Oceans. Parazitologiya 1980, 14:168–176. 29. Threlfall W, Khan RA: Myxozoa of deep-sea fishes in the Northwestern Atlantic. J Parasitol 1990, 76:288–290. 30. Freeman MA, Shinn AP: Myxosporean hyperparasites of gill monogeneans are basal to the Multivalvulida. Parasit Vectors 2011, 4:220. 31. Fiala I, Bartošová P: History of myxozoan character evolution on the basis of rDNA and EF-2 data. BMC Evol Biol 2010, 10:228. 32. Hartigan A, Phalen DN, Šlapeta J: Museum material reveals a frog parasite emergence after the invasion of the cane toad in Australia. Parasit Vectors 2010, 3:50. 33. Hartigan A, Peacock L, Rosenwax A, Phalen DN, Šlapeta J: Emerging myxosporean parasites of Australian frogs take a ride with fresh fruit transport. Parasit Vectors 2012, 5:208. 34. Bartošová P, Freeman MA, Yokoyama H, Caffara M, Fiala I: Phylogenetic position of Sphaerospora testicularis and Latyspora scomberomori n. gen. n. sp. (Myxozoa) within the marine urinary clade. Parasitology 2011, 138:381–93. 35. Garner MM, Bartholomew JL, Whipps CM, Nordhausen RW, Raiti P: Renal myxozoanosis in Crowned River turtles Hardella thurjii: Description of the putative agent Myxidium hardella n. sp by histopathology, electron microscopy, and DNA sequencing. Vet Pathol 2005, 42:589–595. 36. Roberts JF, Whipps CM, Bartholomew JL, Schneider L, Jacobson ER: Myxidium scripta n. sp identified in urinary and biliary tract of Louisiana- farmed red-eared slider turtles Trachemys scripta elegans. Dis Aquat Org 2008, 80:199–209. 37. Gleeson RJ, Adlard RD: Phylogenetic relationships amongst Chloromyxum Mingazzini, 1890 (Myxozoa: Myxosporea), and the description of six novel species from Australian elasmobranchs. Parasitol Int 2012, 61:267–274. 38. Bartošová P, Fiala I, HypšaV:Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide an effective tool for their molecular Submit your next manuscript to BioMed Central phylogenetics. Mol Phylogenet Evol 2009, 53:81–93. and take full advantage of: 39. Diamant A, Whipps CM, Kent ML: A new species of Sphaeromyxa (Myxosporea: Sphaeromyxina: Sphaeromyxidae) in devil firefish, • Convenient online submission Pterois miles (Scorpaenidae), from the northern Red Sea: Morphology, • Thorough peer review ultrastructure, and phylogeny. J Parasitol 2004, 90:1434–1442. 40. Lom J, Dyková I: Myxozoan genera: definition and notes on taxonomy, • No space constraints or color ﬁgure charges – lifecycle terminology and pathogenic species. Folia Parasitol 2006, 53:1 36. • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar doi:10.1186/1756-3305-6-51 Cite this article as: Kristmundsson and Freeman: Sphaeromyxids form • Research which is freely available for redistribution part of a diverse group of myxosporeans infecting the hepatic biliary systems of a wide range of host organisms. Parasites & Vectors 2013 6:51. Submit your manuscript at www.biomedcentral.com/submit