sign in sign up
<<
Home , CD20

Features of Human CD3+CD20+ T Cells Elisabeth Schuh, Kerstin Berer, Matthias Mulazzani, Katharina Feil, Ingrid Meinl, Harald Lahm, Markus Krane, Rüdiger Lange, Kristina Pfannes, Marion Subklewe, Robert This information is current as Gürkov, Monika Bradl, Reinhard Hohlfeld, Tania Kümpfel, of September 29, 2021. Edgar Meinl and Markus Krumbholz J Immunol 2016; 197:1111-1117; Prepublished online 13 July 2016; doi: 10.4049/jimmunol.1600089 http://www.jimmunol.org/content/197/4/1111 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2016/07/13/jimmunol.160008

Material 9.DCSupplemental http://www.jimmunol.org/ References This article cites 33 articles, 2 of which you can access for free at: http://www.jimmunol.org/content/197/4/1111.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Features of Human CD3+CD20+ T Cells

Elisabeth Schuh,*,† Kerstin Berer,‡ Matthias Mulazzani,x,{ Katharina Feil,x Ingrid Meinl,* Harald Lahm,‖ Markus Krane,‖,# Rudiger€ Lange,‖,# Kristina Pfannes,** Marion Subklewe,** Robert Gurkov,€ †† Monika Bradl,† Reinhard Hohlfeld,*,‡‡ Tania Kumpfel,*€ Edgar Meinl,*,1 and Markus Krumbholz*,1,2

Monoclonal Abs against CD20 reduce the number of relapses in (MS); commonly this effect is solely attributed to depletion of B cells. Recently, however, a subset of CD3+CD20+ T cells has been described that is also targeted by the anti-CD20 mAb . Because the existence of cells coexpressing CD3 and CD20 is controversial and features of this subpopulation are poorly understood, we studied this issue in detail. In this study, we confirm that 3–5% of circulating human T cells display CD20 on their surface and transcribe both CD3 and CD20. We report that these CD3+CD20+ T cells pervade , bone marrow, and

secondary lymphatic organs. They are found in the cerebrospinal fluid even in the absence of inflammation; in the cerebrospinal Downloaded from fluid of MS patients they occur at a frequency similar to B cells. Phenotypically, these T cells are enriched in CD8+ and CD45RO+ memory cells and in CCR72 cells. Functionally, they show a higher frequency of IL-4–, IL-17–, IFN-g–, and TNF-a–producing cells compared with T cells lacking CD20. CD20-expressing T cells respond variably to immunomodulatory treatments given to MS patients: they are reduced by fingolimod, , and , whereas disproportionally increases them in the blood. After depletion by rituximab, they show earlier and higher repopulation than CD20+ B cells. Taken + + together, human CD3 CD20 T cells pervade lymphatic organs and the cerebrospinal fluid, have a strong ability to produce http://www.jimmunol.org/ different cytokines, and respond to MS disease modifying drugs. The Journal of Immunology, 2016, 197: 1111–1117.

argeting CD20 with depleting mAbs is an approved marker. In fact, CD20 is expressed during development and therapy in rheumatic diseases (1) and is promising in maturation from pre-B cells to plasmablasts (5, 6). However, there multiple sclerosis (MS) (2–4). The therapeutic success are conflicting reports that CD20 is also expressed by some T + has so far solely been attributed to the depletion of CD20 B cells T cells. The first report of CD20-expressing T cells in the circu- because CD20 is commonly considered as a specific B cell lation dates back to 1993, where a subset of CD3+CD20+ T cells has been described in healthy subjects (7) and later also in pe- + + ripheral (8). The description of CD3 CD20 by guest on September 29, 2021 *Institute of Clinical Neuroimmunology, Biomedical Center and University Hospital, T cells in patients and controls (9) was dis- Ludwig Maximilian University, 82152 Martinsried, Germany; †Department of Neuro- puted and has been regarded as an artifact of flow cytometry (10). immunology, Center for Brain Research, Medical University, 1090 Vienna, Austria; + + ‡ x Yet recently, a subset of CD3 CD20 T cells that is also targeted Max-Planck Institute of Biochemistry, 82152 Martinsried, Germany; Department of Neurology, University Hospital, Ludwig Maximilian University, 81377 Munich, by rituximab has been described (11). The issue remains com- { Germany; Medical Graduate Center, Technical University, 81675 Munich, plicated, however, because CD3+ B cells have been described as a Germany; ‖German Heart Center, Department of Cardiovascular Surgery and Exper- imental Surgery Laboratory, 80636 Munich, Germany; #German Center for Cardio- result from ex vivo storage of blood samples, leading to contact- vascular Research (partner site Munich Heart Alliance), 80636 Munich, Germany; dependent Ag exchange between T and B (12). **Department of Medicine III, University Hospital, Ludwig Maximilian University, We therefore aimed to clarify this issue by analysis of the ex- 81377 Munich, Germany; ††Department of Otolaryngology, University Hospital, Ludwig Maximilian University, 81377 Munich, Germany; and ‡‡Munich Cluster pression of CD20 on human T cells in detail. First, we confirmed for Systems Neurology (SyNergy), 81377 Munich, Germany that indeed ∼3–5% of human T cells in blood display CD20 on the 1E.M. and M.K. contributed equally to the study. surface and also transcribe both CD3 and CD20. We then exam- 2Current address: Department of Neurology and Stroke, Hertie Institute for Clinical ined their occurrence in human primary and secondary lymphatic Brain Research, Eberhard Karls University, Tubingen, Germany. organs and also in the cerebrospinal fluid. We determined their ORCIDs: 0000-0002-3517-5084 (M.M.); 0000-0002-4477-3406 (H.L.); 0000-0002- phenotype and their ability to produce cytokines. Furthermore, we 6662-5957 (R.L.); 0000-0003-2239-1586 (M.B.). analyzed how these cells are affected by different immunomod- Received for publication January 15, 2016. Accepted for publication June 2, 2016. ulatory treatments in MS patients. Thus, this study increases our This work was supported partially by Deutsche Forschungsgemeinschaft (Grant SFB knowledge about the biology of human CD3+CD20+ T cells and TR128), the Munich Cluster for Systems Neurology (Grant ExC 1010 SyNergy), the Clinical Competence Network for Multiple Sclerosis, and Verein zur Therapiefor- their response to immunomodulatory treatments in MS. schung fur€ Multiple Sklerose-Kranke. Address correspondence and reprint requests to Dr. Edgar Meinl, Institute of Clinical Materials and Methods Neuroimmunology, Biomedical Center and University Hospital, Ludwig Maximilian Patients and control donors University of Munich, Grosshaderner Strasse 9, D-82152 Martinsried, Germany. E-mail address: [email protected] All human samples were collected following written informed consent The online version of this article contains supplemental material. according to local ethics policy guidelines of the Ludwig-Maximilian University and the German Heart Center in accordance with the Decla- Abbreviations used in this article: FMOC, fluorescence minus-one control; FSC, forward scatter of ; FSC-A, forward scatter–area; FSC-H, forward scatter– ration of Helsinki. Peripheral blood was obtained from patients with a height; HC, healthy control; MS, multiple sclerosis; NMOSD, neuromyelitis optica confirmed diagnosis of MS (n = 39); neuromyelitis optica spectrum dis- spectrum disorder; OND, other neurological disease; SSC, side scatter of light. order (NMOSD) (n = 18), who either were untreated or received several courses of rituximab, alemtuzumab, natalizumab, fingolimod, or dimethyl Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 fumarate and healthy controls (HC, n = 11). Clinical data of MS and www.jimmunol.org/cgi/doi/10.4049/jimmunol.1600089 1112 CD3+CD20+ T CELLS

NMOSD patients included in this study for therapy response are depicted Reverse Transcription Kit (Applied Biosystems, Foster City, CA). For real- in Supplemental Table I. Cerebrospinal fluid samples were obtained from a time PCR, TaqMan assays for cyclophilin A (peptidyl-prolyl isomerase A; total of 14 untreated patients, 6 of which had MS (n = 6). Eight patients did Applied Biosystems), CD3, CD20 (both Applied Biosystems), and CD19 not show any evidence of CNS inflammation and were classified as other [(e4) 844-F, GCAACCTGACCATGTCATTCC, (e4-5) 875Tf (C . G), neurological diseases (OND) (status epilepticus, n = 1; stroke, n =3; CACTGCTCGGCCAGTAC TATGGCACTG, (e5) 952 RAGATAAGCC- cluster headache, n = 1; intracerebral bleeding, n = 1; and dementia, n = 2). AAAGTCACAGCTGAGA)] were used in combination with the TaqMan Bone marrow was obtained by iliac crest aspiration for diagnostic reasons. PCR Core Reagent Kit (Applied Biosystems). Samples were run in In addition, we received thymic tissue from five infantile patients (01, duplicates in MicroAmp Optical 96-well reaction plates (Applied Bio- male, 87 d old; 02, female, 10 d; 03, male, 93 d; 04, male, 10 d; and 05, systems) in a 7900HT Fast Real-Time PCR System (Applied Biosystems). female, 7 d), which was removed during heart surgery. Data were analyzed using SDSv2.3 software (Applied Biosystems). Preparation of tissue samples from thymus, adenoids, bone-marrow, blood, Statistics and cerebrospinal fluid. Thymic and lymphatic tissue were minced into very small fragments by gentle mechanical disruption and stirred in RPMI 1640 Statistical significance was assessed with Prism Software (GraphPad) by medium on (2 3 10 min) to obtain single-cell suspensions. PBMC were unpaired, paired t test, or one-way ANOVA following Tukey, Holm–Sı´da´k, prepared by Pancoll (Pan Biotech, Aidenbach, Germany) density gradient or Bonferroni correction as appropriate. The p values (*p , 0.05, **p , centrifugation. Bone marrow samples, anticoagulated with EDTA, were 0.01, ***p , 0.001, and ****p , 0.0001) were considered significant and prepared by erythrocyte lysis. Samples were incubated for 12 min in lysis designated accordingly. buffer and further washed with PBS buffer, according to the manufac- turer’s protocol (Beckman Coulter, Krefeld, Germany). Results Flow cytometry Identification and phenotype of human CD3+CD20+ T cells

Single lymphocytes of human PBMC were identified by forward scatter We compared two mAbs against CD20 and found that clone 2H7 is Downloaded from of light (FSC) and side scatter of light (SSC). We further divided + + 2 more sensitive than clone L27 to identify CD3 CD20 T cells, the lymphocytes into CD3+CD19 T cells, CD19+CD20+ B cells and CD3+ CD192CD20+ T cells by FACSVerse (BD Biosciences, San Jose, CA) although both mAbs clearly stain CD20 on B cells (Supplemental using APC-conjugated anti-CD3 (clone HIT3a), PE-conjugated anti-CD19 Fig. 1B). This can be explained by the higher binding intensity of (clone HIB19; BD Biosciences), Pe-Cy7–conjugated anti-CD20 (clone clone 2H7 (MCF ratio of CD20/background for CD20+ lympho- 2H7; eBioscience, San Diego, CA) Abs. Detailed phenotypic marker ex- cytes was 531 for clone 2H7 versus 37 for clone L27) and by the pression of each cell type was determined by surface staining in FACS lower surface expression level of CD20 on this T cell subset http://www.jimmunol.org/ buffer (PBS containing 1% BSA and 0.1% NaN3) with the following fluorochrome-labeled mAbs: FITC conjugated anti-CD3 (clone HIB19), compared with B cells (Supplemental Fig. 1B). The display of APC-conjugated anti-CD8 (clone SK1), PE-conjugated anti-CD4 (clone CD20 on a subset of T cells is not due to doublets between B and OKT-4), Pe-Cy7–conjugated anti-CD20 (clone 2H7), PerCP-conjugated T cells, because these cells display a lower level of CD20 than anti-CD20 (clone L27), APC-conjugated anti-CD3 (clone HIT3a), V450- conjugated anti-CD86 (clone FUN-1), FITC conjugated anti–HLA-DR B cells and lack markers typically found on B cells such as HLA-DR, (clone L423), efluor450 Fluor–conjugated anti-CD40 (clone 5C3), PE- CD40 (Fig. 1), and CD19. conjugated anti-CD45 RA (clone HI100), PE-conjugated anti-CD45 RO We compared the phenotype of CD3+CD20+ T cells and CD3+ (clone UCHL1), FITC-conjugated anti-CD27 (clone LG.7F9), PE-conjugated CD20- T cells. Fig. 1 shows one representative sample and the anti-CD19 (clone SJ25C1), efluorV450–conjugated anti-CD38 (clone HIT2), statistical evaluation of measurements from six different healthy and APC-conjugated anti-CCR7 (clone 3D12). All Abs were purchased from + + by guest on September 29, 2021 eBioscience or BD Biosciences. The CD20 cutoff for negative versus positive donors. CD3 CD20 T cells contained a lower percentage of cell fraction was determined using fluorescence minus-one control (FMOC), CD4+ cells, correspondingly more CD8+ cells (p , 0.0001; representing controls stained with all the fluorochromes minus one fluo- Fig. 1A, 1B, 1K), less CCR7+ cells (p , 0.001; Fig. 1C, 1K), and rochrome, as well as the appropriate isotype control. Propidium iodide more CD45RO+ cells (p , 0.001; Fig. 1D, 1K) than CD202 (eBioscience) was used to determine cell death. FlowJo software was used for data analysis. T cells. HLA-DR, an activation marker for human T cells, was + + + + The number of CD3+CD20+ cells were determined as described previ- hardly observed on CD3 CD20 T cells (Fig. 1E). CD3 CD20 2 ously (11). Briefly, we identified these T cells by gating on CD3+CD19 and CD3+CD202 T cells expressed CD27+ and CD86+ similarly cells and afterward determining the CD20 expression (Supplemental Fig. (Fig. 1F, 1G). All subsets including CD3+CD20+ 1A). Doublets were excluded prior to analysis by determining forward scatter–area (FSC-A) against forward scatter–height (FSC-H). T cells displayed CD49d (VLA-4), the target of natalizumab, on For intracellular cytokine staining, cells were activated with 50 ng/ml the surface (Fig. 1H). PMA (Sigma-Aldrich, St. Louis, MO) and 500 ng/ml ionomycin (Sigma- CD20-expressing T cells transcribe both CD3 and CD20 Aldrich) in the presence of 5 mg/ml brefeldin A (Sigma-Aldrich) for 4 h at 37˚C. Prior to fixation, cells were stained with APC-conjugated mAb We sorted CD3+CD20+ cells, CD3+CD202 T cells, and CD19+ specific for CD3 (BD Biosciences) and Pe-Cy7–conjugated mAb specific CD20+ B cells from healthy donors to compare their transcript for CD20 (eBioscience). After surface staining, cells were fixed and per- levels of CD3, CD19, and CD20 by quantitative PCR. Thereby meabilized in 4% paraformaldehyde/0.1% saponin in HEPES-buffered + 2 HBSS containing 5 mM EDTA, 15 mM HEPES, and 10% FBS. For in- we confirmed that CD20 but not CD20 Tcellstranscribe 2 tracellular staining, the following Abs were used: PE-conjugated anti– CD20 (p = 0.0076) (Fig. 2). Accordingly, CD3+CD20 T cells TNF-a (clone MAb11), PerCP Cy5.5–conjugated anti–IFN-g (clone transcribed only CD3 but not CD19 or CD20. As expected, 4S.B3), PE-conjugated anti–IL-4 (clone 8D4-8), and efluorV450– CD19+CD20+ B cells transcribed CD19 and CD20 but not CD3 conjugated IL-17 (clone eBio64DEC17) (eBioscience). (Fig. 2). B cells expressed ∼15-fold higher levels of CD20 Cell sorting transcripts than CD3+CD20+ T cells reflecting the greater APC-conjugated anti-CD3 (BD Biosciences), PE conjugated anti-CD19 surface expression of CD20 on B cells (Fig. 2, Supplemental (BD Biosciences), Pe-Cy7–conjugated anti-CD20 (eBioscience)–labeled Fig. 1B). CD3+CD192CD202 T cells, CD19+CD20+ B cells, and CD3+CD192 CD20+ T cells were FACS-sorted using Moflo Astorios (Beckman Coulter). Cytokine production by CD20-expressing T cells The content of contaminating cells in the fractions of sorted CD3+CD192 2 + + + 2 + We analyzed the ability of CD20 expressing T cells from CD20 Tcells,CD19CD20 B cells, and CD3 CD19 CD20 Tcells healthy donors to produce cytokines upon stimulation with routinely was ∼1%. PMA and ionomycin. Thereby we found that CD3+CD20+ Quantitative PCR T cells produce more readily IL-4, IL-17, TNF-a,andIFN-g + - RNA was obtained with the RNeasy Micro Kit (Qiagen, Venlo, the than CD3 CD20 T cells (Fig. 3, Supplemental Fig. 1C). Netherlands), and cDNA was generated using the High Capacity cDNA Furthermore, we analyzed the cytokine production of CD4+ or The Journal of Immunology 1113 Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021

FIGURE 1. Phenotype of CD3+CD202 T cells. The phenotype of CD3+CD202 T cells, CD3+CD20+ T cells, and CD19+20+ B cells was determined by flow cytometry using PBMC of healthy donors. First, we gated on all lymphocytes determined by FSC/SSC and excluded doublets prior to further analysis by assigning FSC-A against FSC-H. To assess different T cell subpopulations, we gated on CD3+CD202 versus CD3+CD20+ T cells and determined CD20 expression compared with FMOC as well as isotype control. B cells subpopulation was obtained by gating on CD19+CD20+.(A–J) For each analyzed surface marker, one representative staining and the mean 6 SEM for the T cell subsets of three to six independent experiments with different donors are shown. (K) CD3+CD20+ T cells contain more CD8+, more CD45RO+, and less CCR7+ cells than CD3+CD202 T cells (mean 6 SEM, unpaired t test and Holm–Sı´da´k correction, **p , 0.01, ***p , 0.001, ****p , 0.0001).

CD8+ and CD45RA+ or CD45RO+ subsets of CD3+CD20+ and produced more TNF-a than CD45RA+CD3+CD20+ T cells CD3+CD202 T cells. This showed that CD4+CD3+CD20+ (Supplemental Fig. 2). In comparison with CD19+CD20+ B cells, T cells produced more IL-4, IL-17, and TNF-a than CD8+ each analyzed cytokine was expressed by a greater proportion of CD3+CD20+ T cells, whereas CD45RO+CD3+CD20+ T cells CD3+CD20+ T cells. 1114 CD3+CD20+ T CELLS

FIGURE 2. CD3+CD20+ T cells carry CD3 and CD20 transcripts. CD3+CD20- T cells, CD3+CD20+ T cells, and B cells from healthy donors were sorted and the transcript levels of CD3, CD19, and CD20 were determined in comparison with the housekeeping cyclophilin (CYC%). (A) CD3+CD20- and CD3+CD20+ T cells contained similar amounts of CD3 transcripts. (B) Both CD3+CD20+ and CD3+CD202 T cells lacked CD19 transcripts, which were detectable solely in B cells. (B) CD20 transcripts were only detected in T cells with surface expression of CD20. (C) We noted that B cells (CD19+CD20+) showed ∼15-fold higher levels of CD20 transcripts than CD20-expressing T cells. Combined data (mean 6 SEM) of three independent experiments from three independent donors are depicted (unpaired t test, **p , 0.01).

CD20-expressing T cells in primary and secondary human CD3+CD20+ T cells in the cerebrospinal fluid in the absence Downloaded from lymphatic organs and presence of CNS inflammation Using clone 2H7, we found that 3.8 6 0.6% (mean 6 SEM of 11 We examined the presence of CD3+CD20+ T cells in the cere- independent experiments from 11 different donors) of all lymphocytes brospinal fluid of donors with and without signs of inflammation in human blood from healthy donors display CD20 (Fig. 4). We de- in the CNS. We analyzed cerebrospinal fluid samples from eight tected CD20-expressing T cells not only in blood (Fig. 4) but also in OND patients, who did not show pleocytosis, a disturbance of the http://www.jimmunol.org/ adenoids (3.9 6 0.45%) and in the bone marrow at a frequency of blood–brain barrier, or intrathecal IgG production. There we de- 8.0 6 0.32% (Fig. 4). In addition, we studied the presence of CD3+ tected CD3+CD20+ T cells regularly, namely with a mean fre- CD20+ T cells in the thymus of young children who underwent quency of 4.7 6 1.2% (Fig. 4). In the cerebrospinal fluid of MS cardiac surgery. We found CD3+CD20+ in three of five thymi in patients at relapse, we observed CD3+CD20+ T cells with a similar mature medullary thymocytes (CD4+CD82 or CD42CD8+) (Fig.4). frequency of 2.9 6 1.3% (mean 6 SEM of six patients) of by guest on September 29, 2021

FIGURE 3. Cytokine production by CD3+CD20+ T cells. PBMC from healthy donors were stimulated with PMA and ionomycin in the presence of brefeldin A for 4 h. Cytokine pro- duction in the immune cell subsets wasanalyzedbyflowcytometry. Gating strategy was assed as follow- ing: we gated on all lymphocytes de- termined by FSC/SSC and excluded doublets prior to further analysis by assigning FSC-A against FSC-H. In the second step, we discriminated between CD3+CD192, CD3+CD20+ T cells, and CD19+CD20+ B cells and then determined cytokine expression including IL-4 (A), IL-17 (B), TNF-a (C), and IFN-g (D) in comparison with FMOC and isotype control. Data are presented as mean 6 SEM of 11 independent experiments from 11 dif- ferent donors (mean 6 SEM, one- way ANOVA and Tukey correction, *p , 0.05, **p , 0.01, ***p , 0.001, and ****p , 0.0001). The Journal of Immunology 1115

patients CD20+ B cells were more frequent in blood than CD20+ T cells, this ratio inverted in the recovery phase (Fig. 6). Detailed replenishment kinetics of 8 patients revealed an earlier appearance and higher frequency of CD20+ T cells in comparison with CD19+ CD20+ B cells following a course of rituximab (Supplemental Fig. 3). Three of these eight patients (Supplemental Fig. 3B, 3D, 3E) had relapses 4–8 mo after the last rituximab infusion, at a time when there were more CD3+CD20+ T cells than B cells in the blood. In one of these patients (Supplemental Fig. 3D), a relapse occurred when CD20-expressing T cells had reached 4% of all lymphocytes, whereas CD20+ B cells were hardly detectable in blood.

Discussion This study shows that human CD20-expressing T cells pervade primary and secondary lymphatic tissues, blood, and cerebrospinal fluid. CD3+CD20+ T cells produce more readily the cytokines + 2 FIGURE 4. Frequency of CD3+CD20+ T cells in lymphatic tissue, IL-4, IL-17, TNF-a, and IFN-g than CD3 CD20 T cells and blood, and cerebrospinal fluid (CSF). The frequency of CD3+CD20+ respond to immunomodulatory drugs. Downloaded from T cells was determined in different human compartments by flow Our analysis demonstrates a CD3+CD20+ population comprising cytometry as described in Materials and Methods. CD3+CD20+ T cells 3–5% of all lymphocytes in human blood, corroborating previous were more frequently observed in bone marrow (BM) than in thymus (p , reports (11, 13). This cell population is a T cell subset because 0.05), whereas their frequency in all other compartments did not differ these cells transcribe CD3 at a similar level as conventional T cells significantly (thymus versus BM p = 0.0117, thymus versus adenoids p = and lack surface molecules found on B cells such as CD19, CD40, 0.8881, thymus versus blood p = 0.7769, thymus versus CSF p = 0.7769,

and HLA-DR. All this justifies to call this population CD20 http://www.jimmunol.org/ BM versus adenoids p = 0.7163, BM versus blood p = 0.0539, BM versus CSF p = 0.0539, adenoids versus blood p = 0.0983, adenoids versus CSF expressing T cells. This CD20-expressing T cell subset is clearly p = 0.0983, and blood versus CSF p . 0.9999). We did not detect a sig- distinct from a recently described population of CD3-expressing nificant difference in the frequency of CD3+CD20+ T cells in blood or CSF B cells that were reported to be an artifact based on storing between the different donor subgroups (blood: HC versus MS p = 0.4663, conditions (12) for the following reasons: first, the CD20- HC versus OND p = 0.9967, MS versus OND p = 0.7170; CSF: HC versus expressing T cells described in this article display T cell mark- MS p = 0.3207, HC versus OND p = 0.9802, MS versus OND p = 0.4781) ers, not markers typically found on B cells such as CD19, CD40, (mean 6 SEM, one-way ANOVA and Tukey correction). and HLA-DR; second, they transcribe both CD3 and CD20; and third, this population is seen in direct ex vivo analyses without all lymphocytes (Fig. 4).We compared frequencies of CD3+CD20+ prior storage. by guest on September 29, 2021 T cells and CD19+CD20+ B cells in the cerebrospinal fluid. In the An intercellular transfer of cell surface from APCs to absence of inflammation, CD20+ T cells showed a trend to be T cells may follow TCR triggering, a process called trogocytosis more abundant in the cerebrospinal fluid than CD20+ Bcells (14). In vitro, T cells may acquire CD20 from B cells within + + (4.73 6 1.1 versus 0.48 6 0.2%; p = 0.088; mean 6 SEM of eight minutes (15). Thus, in theory, the CD3 CD20 T cells present in donors). In MS patients, CD3+CD20+ T cells and CD19+CD20+ human blood could display CD20 because of trogocytosis or be- B cells occurred at a similar frequency (2.9 6 1.3 and 2.6 6 0.3%, cause these T cells transcribe it themselves. To address this issue, + + respectively; mean 6 SEM of six patients). we have sorted CD3 CD20 T cells directly from blood and de- termined the transcription of CD20. We found that—in contrast to CD20-expressing T cells respond to immunomodulatory MS conventional T cells—this T cell subset transcribes CD20, con- therapies sistent with recent data (11). We also found that these CD3+ Although we noted a similar frequency of CD3+CD20+ T cells in CD20+ T cells do not display HLA-DR, which is commonly the blood of untreated MS patients, OND patients and healthy transferred to T cells during trogocytosis (16). Also, other mole- controls (Fig. 4), we observed a strong response of this T cell cules typically found on B cells such as CD19, HLA-DR, and population to disease modifying treatments (Fig. 5). We ana- CD40 were absent on CD3+CD20+ T cells. The presence of CD20 lyzed the effect of natalizumab, alemtuzumab, dimethyl fumarate transcripts together with the absence of HLA-DR implies that and fingolimod on blood cells of MS patients in a cross-sectional CD20+ T cells present in human blood produce CD20 themselves. study in comparison with untreated MS patients. We analyzed The transcript level of CD20 was lower in CD3+CD20+ T cells both the absolute number (Fig. 5A) and the percentage of CD3+ than in B cells, further reflected by the lower level of surface CD20+ T cells compared with all lymphocytes (Fig. 5B). Natali- expression of CD20 in this T cell subset as compared with B cells. zumab increased the absolute number of CD20 expressing T cells, The lower surface expression of CD20 in CD3+CD20+ T cells while alemtuzumab, fingolimod, and dimethyl fumarate decreased compared with B cells explains why detection of CD20 on this it (Fig. 5A). In addition, natalizumab also increased the relative T cell subset can only be achieved with a high-affinity anti-CD20 frequency of CD3+CD20+ T cells compared with all lymphocytes mAb (such as the mAb 2H7 as we show in this article). This may (Fig. 5B). partly explain conflicting reports about the existence of CD3+ Rituximab depleted CD3+CD20+ T cells in peripheral blood CD20+ T cells. (Fig. 6). We went on to compare the recovery of CD3+CD20+ Our phenotypic analysis showed that CD3+CD20+ are enriched T cells in comparison with CD19+CD20+ B cells after rituximab in CD8+ T cells and cells expressing the memory marker treatment. For this part of the study, we used both MS and CD45RO. They show a higher percentage of T cells that lacked NMOSD patients. CD20-expressing T cells replenished earlier the chemokine receptor CCR7. Although CCR7+ T cells include and in higher frequencies than B cells. Although in untreated central memory T cells in lymphatic tissue, T cells lacking CCR7 1116 CD3+CD20+ T CELLS

FIGURE 5. CD3+CD20+ T cells respond to immunmodulatory MS therapies. We determined the effects of natalizumab (NTZ), alemtuzumab (ATZ), dimethyl fumarate (DMF), and fingolimod (FTY) in comparison with untreated MS patients (untreated [UNT]) on circulating blood cells by flow cytometry. In (A), the absolute number of CD3+CD20+ T cells is given. In (B), the relative amount of CD3+CD20+ T cells compared with all circulating T cells is shown (mean 6 SEM, one-way ANOVA, and Holm–Sı´da´k correction, *p , 0.05, **p , 0.01, ***p , 0.001, and ****p , 0.0001). include effector memory T cells, which are enriched in peripheral We found that these CD20+ T cells are enriched in CD8+ cells. Downloaded from organs and show a high propensity to produce IFN-g (17). In CD8+ T cells are more abundant in MS lesions than CD4+ T cells agreement with this, we found that CD20+ T cells contain after in MS lesions (22, 23). The role of CD8+ T cells is expected to stimulation a higher proportion of IL-4–, IL-17–, IFN-g–, and include both cytotoxic (24) and regulatory features (25). TNF-a–producing cells than conventional CD3+CD202 T cells, We went on to analyze the response of these CD20-expressing whereas previously production of IL-17 by this subpopulation in T cells to different immunomodulatory treatments in MS. The rheumatoid arthritis has been reported (13). Taken together, CD3+ number of approved drugs to treat MS has increased enormously in http://www.jimmunol.org/ CD20+ cells are a heterogeneous group of CD20 transcribing recent years: these show different modes of action, some of which T cells comprising ∼3–5% of human blood lymphocytes and are are only partly understood (26). CD20-expressing T cells in blood enriched in CD8+ T cells with phenotypic and functional features were depleted by rituximab, in accordance with others (11). The of effector memory T cells. effect of rituximab on B cells and T cells in the cerebrospinal fluid We identified that these CD20+ T cells pervade human primary has also been examined: rituximab largely depletes B cells in the (thymus and bone marrow) and secondary (adenoid) lymphatic cerebrospinal fluid, although not in all patients as complete as in tissue. Within the thymus we detected this T cell population blood (27, 28). Interestingly, rituximab reduces also the number of within the mature, CD4 or CD8 single positive medullary T cell T cells in the cerebrospinal fluid to about half of the original by guest on September 29, 2021 population. This might indicate that these cells originate from the number (27). We found that ∼5% of all T cells in the cerebro- thymus, although also evidence for a migration from mature spinal fluid express CD20. Thus, the depletion of T cells in the T cells back to the thymic medulla has been reported (18, 19). cerebrospinal fluid is presumably because of two effects: elimi- Further, our work reveals that CD20 expressing T cells are nation of CD3+CD20+ T cells and reduction of CD3+CD202 present in the cerebrospinal fluid in the absence of inflammation. T cells because of a diminished inflammation. For immunosurveillance of the brain, immune cell entry into the The timing of a maintenance therapy during rituximab treatment cerebrospinal fluid–drained spaces is an actively regulated pro- is a clinically relevant issue. The reappearance of CD20-expressing cess. Thereby, the immune cell composition in the cerebrospinal B cells was previously linked to new relapses in NMO patients (29). fluid can be highly selective as opposed to merely reflect the B cell subsets reconstitute different after rituximab, initially only immune cell population in the blood (20). naive B cells with a delayed appearance of memory B cells; the In MS and other neuroinflammatory diseases, we observed these reappearance of memory B cells may suggest that a maintenance T cells in the cerebrospinal fluid, albeit not enriched compared with therapy with rituximab should be performed (30). We ascertained blood. We noted that these cells are in the cerebrospinal fluid in MS that the replenishment of CD20-expressing T cells occurs much about as abundant as CD20-expressing B cells. The presence of earlier than that of CD20-expressing B cells. In fact, 3 mo after such cells was also reported within tissue lesions of MS patients rituximab, CD20-expressing T cells were more frequent in blood (21), which could also indicate their participation in this disease. than CD20-expressing B cells. We observed that one patient un-

FIGURE 6. After rituximab CD20+ T cells replenish earlier than CD20+ B cells. Frequencies of CD3+CD20+ T cells and B cells (CD19+CD20+) were determined in blood. (A) In untreated MS patients, CD20+ B cells are more frequent than CD20+ T cells (paired t test, ***p , 0.001). (B) Recovery phase. Four to eight months after rituximab, CD20+ T cells are more frequent than B cells (paired t test, **p , 0.01). Detailed replenishment kinetics of individ- ual patients is presented in Supplemental Fig. 3. The Journal of Immunology 1117 derwent a relapse when CD3+CD20+ T cells were replenished to 11. Palanichamy, A., S. Jahn, D. Nickles, M. Derstine, A. Abounasr, S. L. Hauser, S. E. Baranzini, D. Leppert, and H. C. von Budingen.€ 2014. Rituximab effi- normal levels, but B cells were still depleted. Thus, future studies ciently depletes increased CD20-expressing T cells in multiple sclerosis patients. will clarify whether monitoring of the earlier reappearance of J. Immunol. 193: 580–586. CD20-expressing T cells results in optimization of anti-CD20 12. Nagel, A., C. Mo¨bs, H. Raifer, H. Wiendl, M. Hertl, and R. Eming. 2014. CD3- positive B cells: a storage-dependent phenomenon. PLoS One 9: e110138. therapies. 13. Eggleton, P., E. Bremer, J. M. Tarr, M. de Bruyn, W. Helfrich, A. Kendall, Dimethyl fumarate, which has a differential effect on circulating R. C. Haigh, N. J. Viner, and P. G. Winyard. 2011. Frequency of Th17 CD20+ lymphocytes (31) and fingolimod, which retains mainly CCR7+ cells in the peripheral blood of rheumatoid arthritis patients is higher compared + to healthy subjects. Arthritis Res. Ther. 13: R208. T cells in the lymph node (32) reduced CD20 T cells in the 14. Davis, D. M. 2007. Intercellular transfer of cell-surface proteins is common and peripheral blood. We found that natalizumab, which blocks a4 can affect many stages of an immune response. Nat. Rev. Immunol. 7: 238–243. 15. de Bruyn, M., V. R. Wiersma, M. C. Wouters, D. F. Samplonius, H. G. Klip, integrin–mediated adhesion (33), has a disproportionally strong + + + W. Helfrich, H. W. Nijman, P. Eggleton, and E. Bremer. 2015. CD20 T cells effect on CD3 CD20 T cells indicating that the migratory pattern have a predominantly Tc1 effector memory phenotype and are expanded in the of CD20-expressing T cells is highly regulated by a4 integrin. ascites of patients with ovarian cancer. OncoImmunology 4: e999536. 16. Martı´nez-Martı´n, N., E. Ferna´ndez-Arenas, S. Cemerski, P. Delgado, M. Turner, In summary, the intrathecal presence of CD20-expressing J. Heuser, D. J. Irvine, B. Huang, X. R. Bustelo, A. Shaw, and B. Alarco´n. 2011. T cells, their strong propensity to cytokine production and their T cell receptor internalization from the immunological synapse is mediated by response to disease modifying drugs suggest a role in the patho- TC21 and RhoG GTPase-dependent phagocytosis. Immunity 35: 208–222. 17. Mueller, S. N., T. Gebhardt, F. R. Carbone, and W. R. Heath. 2013. Memory genesis of MS. Effects on CD20-expressing T cells should be T cell subsets, migration patterns, and tissue residence. Annu. Rev. Immunol. 31: considered when elaborating mechanisms of action of different 137–161. immunomodulatory drugs and monitoring of CD20-expressing 18. Petrie, H. T. 2003. Cell migration and the control of post-natal T-cell lympho- poiesis in the thymus. Nat. Rev. Immunol. 3: 859–866. T cells might help to optimize therapy in MS and NMOSD. 19. Bosco, N., J. Kirberg, R. Ceredig, and F. Agene`s. 2009. Peripheral T cells in the Downloaded from thymus: have they just lost their way or do they do something? Immunol. Cell Biol. 87: 50–57. Acknowledgments 20. Kivisa¨kk, P., D. J. Mahad, M. K. Callahan, C. Trebst, B. Tucky, T. Wei, L. Wu, We thank the German Heart Center for thymus samples. Furthermore, we E. S. Baekkevold, H. Lassmann, S. M. Staugaitis, et al. 2003. Human cerebro- + thank Drs Wick and Weigand for measurements in the Clinical Chemistry spinal fluid central memory CD4 T cells: evidence for trafficking through Laboratory; Drs. Joachim Havla, Sabine Liebscher, Franziska Hoffmann, choroid plexus and meninges via P-. Proc. Natl. Acad. Sci. USA 100: 8389–8394. and Lisa-Ann Gerdes for clinical sampling; Angelika Bamberger and 21. Holley, J. E., E. Bremer, A. C. Kendall, M. de Bruyn, W. Helfrich, J. M. Tarr, http://www.jimmunol.org/ Sabine Pitter for excellent assistance; and Drs. Held, Kawakami, and J. Newcombe, N. J. Gutowski, and P. Eggleton. 2014. CD20+ inflammatory Be`ltran for comments on the manuscript. T-cells are present in blood and brain of multiple sclerosis patients and can be selectively targeted for apoptotic elimination. Mult. Scler. Relat. Disord. 3: 650–658. Disclosures 22. Hohlfeld, R., K. Dornmair, E. Meinl, and H. Wekerle. 2015. The search for the target antigens of multiple sclerosis, part 1: autoreactive CD4+ T lymphocytes as The authors have no financial conflicts of interest. pathogenic effectors and therapeutic targets. Lancet Neurol. 15: 198–209. 23. Hohlfeld, R., K. Dornmair, E. Meinl, and H. Wekerle. 2016. The search for the target antigens of multiple sclerosis, part 2: CD8+ T cells, B cells, and References in the focus of reverse-translational research. Lancet Neurol. 15: 317–331. + 1. Faurschou, M., and D. R. Jayne. 2014. Anti-B cell therapies for in- 24. Friese, M. A., and L. Fugger. 2009. Pathogenic CD8 T cells in multiple scle- flammatory rheumatic diseases. Annu. Rev. Med. 65: 263–278. rosis. Ann. Neurol. 66: 132–141. by guest on September 29, 2021 2. Hauser, S. L., E. Waubant, D. L. Arnold, T. Vollmer, J. Antel, R. J. Fox, A. Bar- 25. Sinha, S., A. W. Boyden, F. R. Itani, M. P. Crawford, and N. J. Karandikar. 2015. + Or, M. Panzara, N. Sarkar, S. Agarwal, et al. 2008. B-cell depletion with rituximab CD8 T-cells as immune regulators of multiple sclerosis. Front. Immunol. 6: 619. in relapsing-remitting multiple sclerosis. N.Engl.J.Med.358: 676–688. 26. Ransohoff, R. M., D. A. Hafler, and C. F. Lucchinetti. 2015. Multiple sclerosis— 3. Kappos, L., D. Li, P. A. Calabresi, P. O’Connor, A. Bar-Or, F. Barkhof, M. Yin, a quiet revolution. Nat. Rev. Neurol. 11: 134–142. D. Leppert, R. Glanzman, J. Tinbergen, and S. L. Hauser. 2011. in 27. Cross, A. H., J. L. Stark, J. Lauber, M. J. Ramsbottom, and J. A. Lyons. 2006. relapsing-remitting multiple sclerosis: a phase 2, randomised, placebo- Rituximab reduces B cells and T cells in cerebrospinal fluid of multiple sclerosis controlled, multicentre trial. Lancet 378: 1779–1787. patients. J. Neuroimmunol. 180: 63–70. 4. Sorensen, P. S., S. Lisby, R. Grove, F. Derosier, S. Shackelford, E. Havrdova, 28. Monson, N. L., P. D. Cravens, E. M. Frohman, K. Hawker, and M. K. Racke. J. Drulovic, and M. Filippi. 2014. Safety and efficacy of in 2005. Effect of rituximab on the peripheral blood and cerebrospinal fluid B cells relapsing-remitting multiple sclerosis: a phase 2 study. Neurology 82: 573–581. in patients with primary progressive multiple sclerosis. Arch. Neurol. 62: 258– 5. Meinl, E., M. Krumbholz, and R. Hohlfeld. 2006. B lineage cells in the in- 264. flammatory central nervous system environment: migration, maintenance, local 29. Pellkofer, H. L., M. Krumbholz, A. Berthele, B. Hemmer, L. A. Gerdes, J. Havla, antibody production, and therapeutic modulation. Ann. Neurol. 59: 880–892. R. Bittner, M. Canis, E. Meinl, R. Hohlfeld, and T. Kuempfel. 2011. Long-term 6. von Budingen,€ H. C., A. Bar-Or, and S. S. Zamvil. 2011. B cells in multiple follow-up of patients with neuromyelitis optica after repeated therapy with rit- sclerosis: connecting the dots. Curr. Opin. Immunol. 23: 713–720. uximab. Neurology 76: 1310–1315. 7. Hultin, L. E., M. A. Hausner, P. M. Hultin, and J. V. Giorgi. 1993. CD20 (pan- 30. Kim, S. H., S. Y. Huh, S. J. Lee, A. Joung, and H. J. Kim. 2013. A 5-year follow- B cell) antigen is expressed at a low level on a subpopulation of human up of rituximab treatment in patients with neuromyelitis optica spectrum dis- T lymphocytes. Cytometry 14: 196–204. order. JAMA Neurol. 70: 1110–1117. 8. Mohrmann, R. L., and D. A. Arber. 2000. CD20-positive peripheral T-cell 31. Spencer, C. M., E. C. Crabtree-Hartman, K. Lehmann-Horn, B. A. Cree, and lymphoma: report of a case after Hodgkin’s disease and re- S. S. Zamvil. 2015. Reduction of CD8+ T lymphocytes in multiple sclerosis view of the literature. Mod. Pathol. 13: 1244–1252. patients treated with dimethyl fumarate. Neurol. Neuroimmunol. Neuroinflamm. 9. Wilk, E., T. Witte, N. Marquardt, T. Horvath, K. Kalippke, K. Scholz, N. Wilke, 2: e76. R. E. Schmidt, and R. Jacobs. 2009. Depletion of functionally active CD20+ 32. Mehling, M., V. Brinkmann, J. Antel, A. Bar-Or, N. Goebels, C. Vedrine, T cells by rituximab treatment. Arthritis Rheum. 60: 3563–3571. C. Kristofic, J. Kuhle, R. L. Lindberg, and L. Kappos. 2008. FTY720 therapy 10. Henry, C., A. Ramadan, N. Montcuquet, J. R. Pallandre, P. Mercier-Letondal, exerts differential effects on T cell subsets in multiple sclerosis. Neurology 71: M. Deschamps, P. Tiberghien, C. Ferrand, and E. Robinet. 2010. CD3+CD20+ 1261–1267. cells may be an artifact of flow cytometry: comment on the article by Wilk et al. 33. Engelhardt, B., and L. Kappos. 2008. Natalizumab: targeting a4-integrins in Arthritis Rheum. 62: 2561–2563, author reply 2563–2565. multiple sclerosis. Neurodegener. Dis. 5: 16–22. Supplementary Table 1. Clinical data of patients included in this study

Age (year) sex Diagnosis Disease-modifying treatment

67 F NMOSDa RTX

64 F RRMS RTX

52 F Aquaporin-4 pos. NMOSD RTX

50 M NMOSD RTX

56 F NMOSD RTX

28 M MOG pos. NMOSD RTX, MTX

33 F RRMS RTX

69 F MOG pos. NMOSD RTX

56 M Aquaporin-4 pos. NMOSD RTX

50 M Aquaporin-4 pos. NMOSD RTX

57 F Aquaporin-4 pos. NMOSD RTX, MTX

58 F Aquaporin-4 pos. NMOSD RTX

30 F Aquaporin-4 pos. NMOSD RTX

45 F Aquaporin-4 pos. NMOSD RTX

54 F Aquaporin-4 pos. NMOSD RTX

35 F NMOSD RTX

43 F NMOSD RTX

30 F RRMS RTX

35 M RRMS DMF

55 F RRMS DMF

33 M RRMS DMF

43 F RRMS DMF

60 F RRMS DMF

46 M RRMS DMF

52 F RRMS DMF

46 M RRMS DMF

37 M RRMS DMF

37 M RRMS ATZ

25 M RRMS ATZ

24 F RRMS ATZ 36 F RRMS ATZ

61 M RRMS NTZ

50 M RRMS NTZ

25 M RRMS NTZ

47 F RRMS NTZ

33 F RRMS NTZ

36 M RRMS NTZ

47 F RRMS NTZ

46 F RRMS NTZ

29 F RRMS NTZ

62 RRMS FTY F 29 RRMS FTY F 41 RRMS FTY F 48 RRMS FTY F 34 RRMS FTY M 55 RRMS FTY M 44 RRMS UNT F 45 RRMS UNT F 37 F RRMS UNT

37 M RRMS UNT

36 F RRMS UNT

67 M RRMS UNT

47 F RRMS UNT

34 F RRMS UNT

20 M RRMS UNT

53 F RRMS UNT

Footnote to supplementary Table 1: a Abbreviations used in this table: DMF: dimethylfumarat; FTY: ; NTZ: natalizumab; ATZ: alemtuzumab; UNT: untreated; RTX: rituximab; MTX: methothrexat; NMOSD: neuromyelitis spectrum disoders; MOG: oligodendrocyte glycoprotein; RRMS: relapsing-remitting multiple sclerosis

Supplementary Figure 1

Legend to supplementary Figure 1: Strategy to identify CD3+CD20+ T cells and determination of cytokine production. PBMC were triple stained for CD3, CD19, and CD20. First, CD3+CD19- cells were gated and then CD20 expression on these cells was determined as described in materials and methods (A). We noted that in our assays the anti-CD20 clone 2H7 gave a stronger staining and was more sensitive to identify these cells than the anti-CD20 clone L27 (B). PBMC were simultaneously treated with PMA, iononmycin and brefeldin A for 4 hours. Then a multi-color, intracellular FACS was performed to determine expression of IL-4, IL-17, TNF-α and IFN-γ in comparison with isotype control. One representative experiment of 11 independent experiments is shown (C).

Supplementary Figure 2

Legend to supplementary Figure 2. Cytokine production by CD20 expressing T cell subsets. PBMC were stimulated with PMA and ionomycin in the presence of brefeldin A for 4 hours and cytokine production was analyzed by flow cytometry. We distinguished subsets of CD3+CD20- and CD3+CD20+ T cells based on the differential expression of CD4 or CD8 (A) and CD45RA or CD45 RO (B). Data of 6 independent experiments from 6 different donors are shown (mean±SEM, one-way ANOVA and Bonferroni correction;*< 0.05, **<0.01, ***<0.001, ****<0.0001).

Supplementary Figure 3

Legend to supplementary Figure 3: Frequency of CD3+CD20+ T cells and CD20+ B cells in individual patients during therapy with rituximab. Eight patients (MS:D; NMOSD: A, B, C, E, F, G, H) were followed longitudinally. The frequencies of CD3+CD20+ T cells and CD19+CD20+ B cells in blood were determined by flow cytometry. Time point zero represents the last rituximab infusion before start of the study.