Expression of RAGs in Peripheral B Cells outside Germinal Centers Is Associated with the Expression of CD5

This information is current as Sophie Hillion, Alain Saraux, Pierre Youinou and Christophe of September 24, 2021. Jamin J Immunol 2005; 174:5553-5561; ; doi: 10.4049/jimmunol.174.9.5553 http://www.jimmunol.org/content/174/9/5553 Downloaded from

References This article cites 58 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/174/9/5553.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 24, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Expression of RAGs in Peripheral B Cells outside Germinal Centers Is Associated with the Expression of CD51

Sophie Hillion, Alain Saraux, Pierre Youinou,2 and Christophe Jamin

Previous studies have indicated that mature B cells reactivate secondary V(D)J recombination inside and outside the germinal center (GC) of peripheral lymphoid organs. The nature of the B cells undergoing Ig rearrangement before they enter GC is unknown. In this study, we present evidence that activated mature CD5-positive human tonsil B cells coexpress both RAG1 and RAG2 mRNA and protein, and display DNA cleavage resulting from their recombinase activity. Furthermore, in vitro activation of CD5-negative naive mature B cells by IgR and CD40 cross-linking induces expression of CD5 on a subset of cells, and leads to the up-regulation of RAG1 and RAG2 only in cells turned positive for CD5. Thus, RAG gene expression is closely related to CD5 expression outside GCs. These data suggest that CD5 is associated with receptor revision in activated mature B cells and likely to

promote expression of suitable IgR capable of initiating the GC reaction. The Journal of Immunology, 2005, 174: 5553–5561. Downloaded from

econdary V(D)J rearrangement of Ig genes has been ex- process may generate cells bearing BCRs with various affinities. tensively described in immature bone marrow B cells. This The mutant cells will be selected during their differentiation into S process is referred to as receptor editing, contributes to the centrocytes Bm4 (CD38ϩϩIgDϪCD77Ϫ), depending on their BCR maintenance of immunological tolerance (1), and could rescue po- affinity for the Ag that is trapped as an immune complex on the tentially autoreactive B cells from apoptosis (2). Receptor editing surface of follicular dendritic cells. High-affinity Bm4 may interact http://www.jimmunol.org/ is initiated upon BCR engagement by Ag, resulting in the up- strongly with the Ag, process, and present it to GC T cells. These regulation of RAG gene expression, which then participates in ed- T cells will be induced to express CD40L, to secrete cytokines, and iting the autoreactive BCR-encoding Ig V(D)J rearrangements. to promote survival, proliferation, and isotype switching of the B Secondary V(D)J recombination has been shown to also occur in cells. These activated B cells will thus terminally differentiate ei- murine spleen and lymph node B cells in response to immunization ther into early memory (CD38ϩIgDϪ) and memory Bm5 (3–5). This peripheral V(D)J rearrangement, termed receptor revi- (CD38ϪIgDϪ) cells or into high-affinity Ab-forming cells. In con- sion, might contribute to the generation of high-affinity Abs in trast, autoreactive Bm4 cells would be deleted, because they do not germinal centers (GCs)3 following the process of somatic hyper- receive survival signal from T cells (11). Mutant Bm4 cells with mutation in response to stimulation by T-dependent Ags (6, 7). low affinity for Ag may have the potential to revise their receptor due by guest on September 24, 2021 There is evidence that human B cells also undergo secondary Ig to an increased RAG gene transcription (12). This could raise the recombination in the periphery (8, 9). Seven peripheral subpopu- affinity of the BCR for the Ag (8, 9). In this setting, strong BCR lations of B cells have been identified in human tonsils based on engagement would switch off RAG gene expression (13), suggesting the surface expression of CD38 and IgD in conjunction with other that receptor revision, which might be involved in affinity maturation markers (reviewed in Ref. 10), which have led to the proposition of Abs, will be terminated when BCR is strongly cross-linked. This of a model of T cell-dependent mature B cell differentiation. The process will permit the positive selection of high-affinity B cells to Ϫ ϩ Ϫ naive mature B (Bm) cells Bm1 (CD38 IgD CD23 ) and Bm2 terminally differentiate. ϩ ϩ ϩ (CD38 IgD CD23 ) would be activated in extrafollicular areas Recently, RAG expression in peripheral B cells has been ob- through interaction with interdigitating cells and Ag-specific T served outside the GC in a number of mouse models (14, 15) and cells. Activated blasts may either terminally differentiate into low- in humans (16). In the human model, RAG-positive B cells were affinity Ab-forming cells or become GC founder cells Bm2Ј found in the follicular mantle zone (FMZ) of the GCs where naive (CD38ϩϩIgDϩ). In GCs, Bm2Ј cells would differentiate into cen- ϩϩ Ϫ ϩ Bm1 and Bm2 cells are positioned (10). The T cell marker CD5 is troblast Bm3 (CD38 IgD CD77 ), in which somatic hypermu- expressed by Ͻ10% of the B cells in the adult human spleen and tation in V gene region might take place during proliferation. This Ͻ30% in lymph nodes (17). It is interesting that the CD5ϩ B cell population is also enriched in the FMZ (18, 19). Interestingly, in hen egg lysosyme (HEL)/anti-HEL transgenic Laboratory of Immunology, Brest University Medical School Hospital, Brest, France mice, CD5 expression is observed on mature anergic B cells (20). Received for publication August 25, 2004. Accepted for publication February Moreover, immature anergic B cells may activate the machinery 16, 2005. for V(D)J rearrangement to maintain B cell tolerance (21). Al- The costs of publication of this article were defrayed in part by the payment of page though CD5ϩ B cells have been shown (22) to express RAG in the charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. peritoneal cavity, it is unknown whether CD5 is involved in in- 1 This work was supported by grants from Ministe`re de l’Enseignement Supe´rieur et ducing the recombination process. Mature anergic B cells that fail de la Recherche and from Acade´mie Nationale Franc¸aise de Me´decine. to rearrange may express CD5 to negatively regulate the BCR and 2 Address correspondence and reprint requests to Prof. Pierre Youinou, Laboratory of avoid elimination, yet maintaining tolerance to self-Ag. However, Immunology, Brest University Medical School Hospital, BP 824, F 29609 Brest, by raising the threshold required for activation (23), CD5 may also France. E-mail address: [email protected] contribute to the triggering of the BCR revision. This view implies 3 Abbreviations used in this paper: GC, germinal center; Bm, mature B; FMZ, fol- licular mantle zone; HEL, hen egg lysosyme; biot, biotinylated; LM-PCR, ligation- that CD5 expression in the FMZ could be induced on mature B mediated PCR; ECD, energy-coupled dye. cells with BCR affinity insufficient to enter GC. RAG expression

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00 5554 ASSOCIATION OF CD5 WITH BCR REVISION would, therefore, be found in activated cells expressing CD5. The 30 s at 94°C, 1 min at 56°C, and 1 min at 72°C with a final 10-min present study was designed to test this hypothesis. extension at 72°C. The second PCR round was for 35 cycles of 30 s at 94°C, 1 min at 56°C, and 1 min at 72°C with a final extension step at 72°C for 10 min. For the GAPDH RT-PCR amplification, only one round of PCR Materials and Methods was conducted for 40 cycles. Because the GAPDH primers spanned a short Preparation of B cells intron of 100 bp, genomic DNA could be amplified, but easily distinguish- able from the specific cDNA product. In such cases, samples were ex- Tonsils were obtained from 5- to 18-year-old children undergoing routine cluded from the RAG studies. Moreover, RAG1 and RAG2 first-round tonsillectomy. Tissues were minced up, diluted in PBS, and filtered to PCR primers spanned an intron at 5168 and 1174 bp, respectively, which deplete larger cells and clumps. Filtered cells were layered onto Ficoll- thus could not amplify contaminating genomic DNA. Taken together, these ϫ Hypaque density medium and centrifuged for 30 min at 450 g. Cells precautions certify that the PCR products originate specifically from were then incubated with neuraminidase-treated SRBC for1hat4°C. mRNA. RT-PCR products were analyzed on 2% agarose gels stained with Depletion of T cells was achieved by a second round of centrifugation on ethidium bromide. The expected size for each specific product is indicated Ficoll-Hypaque for 25 min. in Table I. Flow cytometry analysis Single-cell protocol FITC-mAbs to human CD19 (clone J4.119), CD21 (clone BL13), CD10 Individual IgDϩCD38ϩCD5ϩ Bm2 cells were sorted into PCR tubes con- (clone ALB1), CD95 (clone UB-2), CD27 (clone MP271) and CD23 (clone taining 10 ␮l of reverse transcriptase buffer (1ϫ first-strand buffer (Invitro- 9P25), rat unlabeled Ab to CD77 (clone 38-13) visualized with FITC-goat gen Life Technologies), 5 ␮M random hexamer, 0.5ϫ reverse transcriptase anti-rat, PE-linked to cyanin 5 (PC5)-Abs to CD38 (clone LS198), and buffer, 0.01 M DTT, 0.5 mM dNTP (all from Promega)), using the flow CD5 (clone BL1a), and biotinylated (biot) anti-CD5 (clone UCHT2) visu- cytometer outfitted with the Autoclone single-cell deposition unit (Beck- alized with PE-Texas Red energy-coupled dye (ECD)-streptavidin, were man Coulter). mRNA conversion from a single cell was conducted with from Beckman Coulter. FITC-anti-IgD (clone IA6-2), PE-anti-IgD, PE- Superscript II RNase H-reverse transcriptase (Invitrogen Life Technolo- Downloaded from anti-IgM (clone G20127), and biot-anti-IgM visualized with ECD-conju- gies) for2hat42°C. A nested RT-PCR for RAG1, RAG2, and GAPDH gated streptavidin were from BD Biosciences. Four-color analysis and sort- was performed with 25 cycles of 30 s at 94°C, 1 min at 56°C, and 1 min ing were performed on an Epics Elite flow cytometer (Beckman Coulter). at 72°C with a final 10-min extension at 72°C in the first round of PCR. The second PCR round was for 40 cycles of 30 s at 94°C, 1 min at 56°C, RNA isolation and RT-PCR amplification and 1 min at 72°C with a final extension at 72°C for 10 min. Frequencies ϩ Ϫ Ϫ ϩ 5 of cells positive for one transcript (RAG1 2 or RAG1 2 ), negative for Total RNA was extracted from 10 B cells using the RNable reagent (Eu- Ϫ Ϫ ϩ ϩ robio) and reverse transcribed in 20 ␮l with Superscript II RNase H-reverse both (RAG1 2 ), or positive for both (RAG1 2 ) were calculated. http://www.jimmunol.org/ transcriptase (Invitrogen Life Technologies). For RT-PCR amplifications, Ligation-mediated PCR (LM-PCR) nested reactions were performed with 1 ␮l of cDNA using the primer pairs listed in Table I with TaqDNA polymerase (Invitrogen Life Technologies) DNA was extracted from 105 cells using the DNAzol kit (Invitrogen Life as follows: in the first round of PCR, cDNA was amplified for 25 cycles of Technologies), and 500 ng ligated to the BW1/2 linker at 20 pmol with T4

Table I. Sequences of oligonucleotides used as primers for the amplification of cDNA in RT-PCR and nested RT-PCR, and of DNA in LM PCR by guest on September 24, 2021 Primers Oligonucleotides Sequences (5Ј–3Ј) Product Length (bp)

RT-PCR RAG1 sense GAGAGAGCAGAGAACACACT 349 RAG1 antisense GCTGAGTTGGGACTGGCTTCTGAC RAG1 nested sense CTGCTGAGCAAGGTACCTCAGCCAG 201 RAG1 nested antisense GAGAGGGTTTCCCCTCAAAGGAATC RAG2 sense AGCCTTCTGCTTGCCACAGTCATAG 361 RAG2 antisense GAGGAGGGAGGTAGCAGGAATCCTTAG RAG2 nested sense CCCCTCTGGCCTTCAGACAAAAATC 154 RAG2 nested antisense GGGCCAGCCTTTTTGTCAAAG GAPDH sense CTTAGCACCCCTGGCCAAGG 542 GAPDH antisense CTTACTCCTTGGAGGCCATG GAPDH nested sense CATCACTGCCACCCAGAAGACTG 441 GAPDH nested antisense AGGTCCACCACCCTGTTGCTGTAG LM-PCR J␭3–1 sense CAATCCTGGGCCTGAGTGATGGTTGGTGC J␭3–2 nested sense ACAGGATGTCACCGGTCCCCTCTCTCTGTG 191 J␭4–1 sense CCTCCTCAGCCTCGCCATTTCCAGACG J␭4–2 nested sense CGCTTGGTCGACTGTCCCATCTCAGCTTG 195 J␭5–1 sense CCCCATGGCTGCATGATGGTTGGTGG J␭5–2 nested sense GGGGTGAGTGTGGCAGCCGTGTGAACTC 162 J␭6–1 sense GTGGCGTCACCCAGCCGCTCACC J␭6–2 nested sense CCCCCTTCACCCCACCTATGGCTCACC 162 J␭7–1 sense GCCGGGACACATGGCTTCCTCCAGG J␭7–2 nested sense GCCTCCTCCCTCTCCCCTCTCCCTCTGG 230 J␬2–1 sense TGCTTCCTCAGTTGTCTGTGTCTTCTG J␬2–2 nested sense AAGGTGACTCTGCAATCAGCCTCTG 269 J␬3–1 sense GTTTACTTTGTGTTCCTTTGTGTGGATTTTC J␬3–2 nested sense TCGGATGCCAGGGATCTAACAAAC 207 J␬4–1 sense GCCATTGTATCATTTGTGCAAGTTTTG J␬4–2 nested sense TTGGTTGAATAAACCTGGTGACCCAG 243 J␬5–1 sense AGGTTTTAAATTTGGAGCGTTTTTGTG J␬5–2 nested sense GCTCAGGTCAATTCCAAAGAGTACCAG 227 BW1 GCGGTGACCCGGGAGATCTGAATTC BW2 GAATTCAGATC BW3 antisense CCGGGAGATCTGAATTCCAC The Journal of Immunology 5555

DNA ligase (Promega) in ligation buffer (66 mM Tris (pH 7.5), 5 mM

MgCl2, 1 mM DTT, and 1 mM ATP) for 16 h at 16°C (24). The BW1/2 linker was obtained by hybridization of 2 nmol BW1 primer with BW2 primer (Table I) for 5 min at 60°C. PCR was performed using TaqDNA polymerase following a denaturation step at 95°C for 15 min. In the first PCR round, linker primer BW1 was used with either J␭4-1, J␭5-1, J␭6-1, or J␭7-1 primer. Samples were denaturated for 3 min at 94°C and amplified for 15 cycles of 40 s at 94°C, 40 s at 65°C, and 1 min at 72°C, followed by a final 10-min extension at 72°C. After 3 min at 94°C for denaturation, an additional 40 cycles of PCR were performed using the BW3 linker primer with either J␭4-2, J␭5-2, J␭6-2, or J␭7-2 nested locus-specific primer. The expected size for each specific nested product is indicated in Table I. Similar PCR, with 40 s at 55°C for the hybridization step, were

also performed with the Jk locus-specific primers. PCR products were an- alyzed on 2% agarose gels stained with ethidium bromide. The identity of the amplified products were verified by digestion with BamHI restriction enzyme for the J␭7 signal end, and by sequence analysis of all the PCR products. Indirect immunofluorescence Sorted cells were washed in PBS, centrifuged onto glass slides, fixed in 4% paraformaldehyde, and further prepared as described, with modifications (25). First, to avoid nonspecific fixation, the cells were incubated in PBS Downloaded from containing 0.1% Nonidet P-40 (Sigma-Aldrich), 2% nonfat dry milk, 5% FBS, and 0.02% sodium azide, for 20 min, followed by an additional treat- ment for 1 h with 50 ␮g/ml Cohn fragment (Sigma-Aldrich). Cells were then left overnight at 4°C with goat anti-RAG2 Ab (Santa Cruz), incubated with biot donkey anti-goat IgG (Jackson ImmunoResearch Laboratories) and visualized with tetramethylrhodamine isothiocyanate-streptavidin

(Jackson ImmunoResearch Laboratories). Finally, the cells were left over- http://www.jimmunol.org/ night at 4°C with rabbit anti-RAG1 Ab (Santa Cruz), followed by FITC- donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories). Cells were examined immediately by fluorescence microscopy using an oil im- mersion lens (Zeiss; Axioplan), and enumerated as positive for one protein (RAG1ϩ2Ϫ or RAG1Ϫ2ϩ), negative for both (RAG1Ϫ2Ϫ), or positive for both (RAG1ϩ2ϩ). Examination by confocal microscopy (TCS NT; Leica) was also performed following staining of the cells for RAG1 or RAG2 by FITC labeling, using FITC-donkey anti-goat (Jackson ImmunoResearch Laboratories) to visualize anti-RAG2 Ab, and propidium iodide nucleus counterstaining, to evaluate the localization of each protein. The human 697 pre-B cell line and Hep-2 epithelial carcinoma cell line were used as by guest on September 24, 2021 positive and negative controls for the RAG protein detection, respectively (data not shown). Cell culture FIGURE 1. RAG1, RAG2, and CD5 expression in tonsil B cell subsets. A, Cells were cultured in RPMI 1640 medium (Invitrogen Life Technologies) Tonsillar B cell subsets were defined by the surface expression of CD19, IgD, supplemented with 10% heat-inactivated FCS (Invitrogen Life Technolo- and CD38. The gates for each subset are shown. B, Specific RAG1 and RAG2 gies), 2 mM L-glutamine (Invitrogen Life Technologies), 200 U/ml peni- mRNA of sorted subsets were amplified by nested RT-PCR and that of ␮ cillin (Rhoˆne-Poulenc), and 100 g/ml streptomycin (Diamant). A total of GAPDH by RT-PCR. C, Tonsillar B cell subsets were analyzed for the mem- 105 murine NIH3T3 fibroblasts untransfected (control), or transfected with brane expression of CD5. D, The CD5 expression was evaluated in the total B human CD40L gene, were incubated with mitomycin C (Sigma-Aldrich) cells, and the frequency of each B cell subset in the CD5-positive population and used for stimulation of B cells (26). Transfectants were grown in ϩ Ϫ DMEM medium (Invitrogen Life Technologies) supplemented with 10% was determined. E, The CD5 and CD5 fractions of each B cell subset were FCS, 2 mM L-glutamine, and 10 ␮g/ml gentamicin (Rhoˆne-Poulenc). Iso- sorted, and the RAG1, RAG2, and GAPDH mRNA were amplified. lated B cells were dispensed at 106 cells per well in a final volume of 1 ml with, or without, anti-IgM Ab-coated beads at 1 ␮g/ml. Cells were also stimulated with anti-IgM Ab-coated beads alone, or with 30 ng/ml PMA. cells entered the GC, that is, as few as 3.4 Ϯ 1.9% of Bm3/4 cells express CD5. When B cells left the GC, they did not re-express Results CD5, because there were only 9.2 Ϯ 5.3% of early Bm5 and 9.8 Ϯ Based on IgD and CD38 expression, all mature B cell subpopula- tions were sorted (Fig. 1A), and RAG mRNA was analyzed by nested RT-PCR. As expected, we found that Bm3/4 GC cells con- Table II. Distribution of the different B cell subpopulation in human tained RAG1 and RAG2 mRNA. Furthermore, all but naive Bm1 tonsil B lymphocytes and frequency of the CD5ϩ B cell subset cells and Bm5 memory cells expressed both RAG transcripts (Fig. 1B), supporting the notion that some B cells outside GC may also Frequency of CD5ϩ a b undergo secondary rearrangement. Specifically activated naive Subpopulation Phenotype Distribution (%) Cells (%) Bm2 cells, pre-GC Bm2Ј cells, and early Bm5 memory cells Bm1 IgDϩCD38Ϫ 11.1 Ϯ 6.0c 16.2 Ϯ 4.7 seemed to have the machinery to rearrange. Bm2 IgDϩCD38ϩ 18.9 Ϯ 4.3 18.1 Ϯ 7.4 ϩ ϩϩ To determine whether the presence of CD5 influences RAG Bm2Ј IgD CD38 5.5 Ϯ 4.2 22.7 Ϯ 10.9 Bm3/4 IgDϪCD38ϩϩ 33.9 Ϯ 12.1 3.4 Ϯ 1.9 transcription, we first examined each subpopulation for the expres- Ϫ ϩ ϩ Early Bm5 IgD CD38 11.8 Ϯ 4.6 9.2 Ϯ 5.3 sion of CD5 (Fig. 1C). The frequency of CD5 B lymphocytes Bm5 IgDϪCD38Ϫ 10.1 Ϯ 7.2 9.8 Ϯ 6.4 Ϯ increased in the extrafollicular areas from 16.2 4.7% in Bm1 to a Ϯ Ϯ Ј Percentage of the total B cells. 18.1 7.4% in Bm2, and to 22.7 10.9% in Bm2 subpopula- b Percentage of CD5ϩ cells in each subpopulation. tions (Table II). Remarkably, the frequency decreased once the c Mean Ϯ SD of 15 human tonsil samples. 5556 ASSOCIATION OF CD5 WITH BCR REVISION

6.4% of Bm5 cells to carry CD5ϩ. We reasoned that, because it is transiently expressed on extrafollicular lymphocytes, CD5 may in- fluence B cell behavior before their entry into the GC. Next, we sorted the B cell subpopulations according to their CD5 expression (Fig. 1D) and analyzed the presence of RAG1 and RAG2 mRNA by nested RT-PCR. Interestingly, from the B lym- phocytes located in the extrafollicular areas, only the activated Bm2 cells expressing CD5 displayed RAG1 and RAG2 transcripts (Fig. 1E). These observations suggest that the presence of CD5 at this stage of maturation may be associated with the recombination machinery to be operational. In contrast, because both CD5ϩ and CD5Ϫ early Bm5 displayed RAG1 and RAG2 mRNA, CD5 ex- pression does not seems to be influential on V(D)J rearrangement at the memory stage. RAG1 and RAG2 mRNA detection was per- formed on different tonsil samples. In five of eight, the CD5ϩ Bm2 lymphocytes expressed RAG1 and RAG2 transcripts. Among them, one sample showed the CD5Ϫ Bm2 cells also expressing both RAG gene mRNA.

For the V(D)J recombination machinery to be operational, both Downloaded from RAG1 and RAG2 mRNA must be coordinately expressed in a cell at the same time (27). With this requirement in view, we used single-cell RT-PCR to assay for RAG1 and RAG2 transcript ex- pression. In four different tonsil samples, single CD5ϩ Bm2 lym- phocytes were sorted, and nested RT-PCR was performed to eval-

uate the transcription of RAG1 and RAG2 mRNA in the same cell. http://www.jimmunol.org/ This analysis was restricted to cells expressing GAPDH mRNA to make sure cDNA was present in the samples after sorting, whereas samples with contaminated genomic DNA were excluded (Fig. 2A). We found that 23.5 Ϯ 8.4% of the cells coexpressed RAG1 and RAG2 mRNA, 37.3 Ϯ 10.7 and 14.7 Ϯ 5.8% expressed either RAG1 or RAG2, respectively, whereas 22.9 Ϯ 13.9% expressed neither (Fig. 2B). We noticed that almost one-fourth of the CD5ϩ Bm2 cells expressed both mRNA, whereas 37.1% of the Bm3/4 cells, 6 and 16.6% of the CD5ϩ and CD5Ϫ early Bm5, respec- by guest on September 24, 2021 tively, expressed also RAG1 and RAG2 transcripts (data not shown). Given that CD5ϩ Bm2 cells represented 2.6–13.9% of the total B cells, the CD5ϩ Bm2 lymphocytes that have a complete machinery for V(D)J rearrangement accounted for 0.7–2% of the total tonsil B lymphocytes (Table III). Synthesis of RAG1 and RAG2 proteins was then established to confirm that RAG1 and RAG2 mRNA transcription resulted in the FIGURE 2. Single-cell mRNA and protein expression of RAG1 and expression of the complete enzymatic complex in the same cell. ϩ ϩ RAG2 in individual tonsil Bm2 cell subset. A, Individual IgD CD38 CD5ϩ and CD5Ϫ Bm2 lymphocytes were sorted, and immunoflu- ϩ CD5 tonsil Bm2 cells were sorted with the Autoclone single-cell depo- orescence analysis was performed (Fig. 2C) on cytocentrifuged sition unit of the Epics Elite flow cytometer. RAG1 and RAG2 mRNA expression were analyzed by nested RT-PCR. Among 40 cells sorted in each experiment, only GAPDH mRNA-positive cells were considered for Table III. Proportion of RAG-expressing CD5ϩ Bm2 cells in human analysis. A representative example is shown where crosses indicate cells tonsils excluded from the RAG1 and RAG2 analysis. B, The frequencies of single RAG1- or RAG2-positive cells as well as the frequencies of RAG1- and RT-PCR FACS Frequency of RAG2-double-negative or -positive cells are shown. Mean Ϯ SD of four ϩ ϩ Analysisa % Analysisb % RAG CD5 experiments. C, Tonsil Bm2 cells identified by the expression of IgD and RAG1ϩRAG2ϩ CD5ϩ Bm2 Bm2 Cellsc CD38 were sorted according to the presence of CD5. Purified B cells were cytocentrifuged and stained for RAG1 and RAG2 protein detection by Expt. 1 14.8 (4/27) 13.9 2 immunofluorescence. Cells stained without anti-RAG1 and anti-RAG2 Expt. 2 34.3 (11/32) 5.3 1.8 Abs were used as controls. D, Among the IgDϩCD38ϩCD5ϩ tonsil Bm2 Expt. 3 25.9 (7/27) 2.6 0.7 ϩ ϩ Expt. 4 19.3 (6/31) 5.7 1.1 cell subpopulation, the frequencies of single RAG1 or RAG2 cells, as well as the frequencies of RAG1- and RAG2-double-negative or -positive Meand 23.6 Ϯ 8.5 6.9 Ϯ 4.9 1.4 Ϯ 0.6 cells were established by direct enumeration in a randomly selected subset. Mean Ϯ SD of three experiments. E, IgDϩCD38ϩ CD5ϩ and CD5Ϫ tonsil a Percentage of RAG1- and RAG2-positive lymphocytes in CD5ϩ Bm2 single- Bm2 cell subsets were sorted, and RAG1 and RAG2 enzymatic activity cell sorted cells for which GAPDH was detected. Forty cells were sorted in each ␭ experiment, and analyses were performed with nested RT-PCR. was evaluated. The J signal breaks were detected by LM-PCR using dif- b Percentage of CD5ϩ Bm2 lymphocytes in total B cells analyzed by flow cy- ferent sets of specific primers. LM-PCR products were visualized on tometry following FITC-CD19, PE-IgD, ECD-CD5, and PC5-CD38 multiple ethidium bromide-stained gel. The identity of the J␭7 amplified product labeling. c ϩ was confirmed by BamHI enzymatic digestion. Percentage of CD5 Bm2 lymphocytes coexpressing RAG1 and RAG2 mRNA in total B cells. d Mean Ϯ SD of the four experiments. The Journal of Immunology 5557

Table IV. Expression of RAG1 and RAG2 proteins in CD5ϩ Bm2 The PCR-amplified fragment contained a BamHI cleavage site. lymphocytes Digestion of the PCR product with BamHI produced two frag- ments at the expected size, thus confirming the identity of the Immunofluorescencea FACS Frequency of E b ϩ ϩ amplified product (Fig. 2 ). This latter was also sequenced. The Analysis Analysis % RAG CD5 Ј ␭ % RAG1ϩRAG2ϩ CD5ϩ Bm2 Bm2 Cellsc alignment with the 3 end upstream the J 7 gene of the genomic DNA further confirmed the specificity of the product (data not Expt. 1 39.8 (78/196) 5.4 2.1 shown). Recombination of the J␬4 and J␬5 genes were also found Expt. 2 41.5 (85/205) 6.1 2.5 in some CD5ϩ Bm2 cell samples. Both products were also verified Expt. 3 18.4 (57/310) 9.1 1.6 as specific by sequencing (data not shown). These data demon- Meand 33.2 Ϯ 12.9 6.9 Ϯ 1.9 2.1 Ϯ 0.4 strate the presence of active V(D)J recombination enzyme in the ϩ a Percentage of RAG1- and RAG2-positive lymphocytes in CD5ϩ Bm2-sorted CD5 subset of the Bm2 lymphocyte subpopulation. cells. Indirect immunofluorescence analyses were performed on cytospined cells with It may be argued that RAG-positive cells in peripheral lymphoid anti-RAG1 and anti-RAG2 mAbs. organs could in fact be immature B cells (28) and, specifically, b Percentage of CD5ϩ Bm2 lymphocytes in total B cells analyzed by flow cy- tometry following PE-IgD, ECD-CD5, and PC5-CD38 multiple labeling. transitional B cells (29). Moreover, transitional type 2 cells are c Percentage of CD5ϩ Bm2 lymphocytes coexpressing RAG1 and RAG2 proteins located in the follicles (30). It was thus important to ascertain in total B cells. whether the IgDϩCD5ϩ Bm2 cells were premature or mature B d Mean Ϯ SD of the three experiments. cells. Based on surface expression of IgD and IgM, discrete mouse B cell subpopulation may be identified. Transitional type 2 B lym- cells. Although (Fig. 2D) most of these cells were negative for phocytes are IgD positive and IgM bright, and express a high level Downloaded from both proteins (25.5 Ϯ 12.7% RAG1ϪRAG2Ϫ), or positive for only of CD21. They can be distinguished from mature B cells which are one (28.1 Ϯ 3% RAG1ϩRAG2Ϫ, and 13 Ϯ 1.8% IgD bright, IgM dull, and CD21 positive (30). Although transi- RAG1ϪRAG2ϩ), we observed that one-third of them coexpressed tional B cells have not been evidenced in human, we performed both proteins (33.2 Ϯ 12.9% RAG1ϩRAG2ϩ). Although RAG1 fine flow cytometric studies on human tonsil B lymphocytes using and RAG2 were detectable in the cytoplasm, both proteins were these definitions. When gated on IgD-positive cells, we identified predominantly colocalized to the nucleus when examined by con- two discrete subpopulations in the CD21/IgM bi-parametric anal- http://www.jimmunol.org/ ϩ ysis (Fig. 3A). The expression of CD5 was determined on their focal microscopy (data not shown). Because CD5 Bm2 cells rep- ϩ ϩ ϩ resented 5.4–9.1% of the total B cells, 1.6–2.1% of the B lym- surface. We found that the IgD IgM CD21 mature B cells con- ϩ ϩ bright bright phocytes would thus be CD5ϩ Bm2 lymphocytes expressing the tained a CD5 subset, in contrast to the IgD IgM CD21 whole enzymatic machinery for V(D)J recombination (Table IV), transitional type 2-like B cells, which lack CD5 expression (Fig. confirming the mRNA data. These findings indicate that very few 3A). These phenotypical analyses indicate that premature transi- B cells may rearrange outside the GCs. To definitively underscore tional type 2 B lymphocytes might be present in human tonsils but the functionality of RAG1 and RAG2, LM-PCR was performed do not express CD5. When gated on IgD-negative cells, B lym- Ϫ bright according to previously described procedure (24) on DNA isolated phocytes displayed a marginal zone phenotype (IgD IgM bright by guest on September 24, 2021 from sorted CD5ϩ and CD5Ϫ Bm2 lymphocytes. Putative DNA CD21 ) without expression of CD5, whereas transitional type Ϫ bright Ϫ breaks on recombination signal sequences due to recombinase ac- 1 population (IgD IgM CD21 ) was undetected (our unpub- Ј lished observations). tivity were determined using primers upstream the 5 end of each ϩ J␭3 to J␭7 and J␬2 to J␬5 genes paired with primer encompassing To establish the mature status of the CD5 B cell subpopula- the LM-PCR linker and the recombination signal sequences. The tion, we studied the expression of the surface markers that identify the seven B cell subpopulations in human tonsils (10). When gated expected product lengths are indicated in Table I. We found a ϩ ϩ ϩ ␭ on CD5 lymphocytes, we found that the IgD CD38 B cell sub- specific PCR product corresponding to a recombination of the J 7 ϩ ϩ ϩ gene in the CD5ϩ but not in the CD5Ϫ Bm2 population (Fig. 2E). population appeared to be IgM , CD23 , and CD44 , but CD10,

FIGURE 3. Mature differentiation state of the CD5ϩ Bm2 cell subset. A, Anti-IgD, anti-IgM, anti-CD21, and anti-CD5 Abs were used to distin- FIGURE 4. Regulated expression of RAG1, RAG2, and CD5. Tonsillar guish the Bm cell population (IgDϩIgMϩCD21ϩ) from the premature type B cells were isolated and cultured with PMA at 30 ng/ml or with anti- 2 transitional B cell (BT2) population (IgDϩIgMbrightCD21bright)byflow IgM-coated beads at 1 ␮g/ml for 30 h, or on CD40L-transfected fibroblasts cytometry. CD5 expression was analyzed on both populations. B, The mat- alone or together with 1 ␮g/ml anti-IgM-coated beads for 6 days. A, Fre- uration status of the IgDϩCD38ϩCD5ϩ Bm2 cells were further evidenced quencies of CD5ϩ B cells were determined by flow cytometry. Mean Ϯ SD by flow cytometric analysis using a combination of anti-IgD, anti-CD38, of three experiments. B, RAG1 and RAG2 mRNA expression of cultured and anti-CD5 Abs associated with anti-IgM, anti-CD23, anti-CD44, anti- B cells was analyzed by nested RT-PCR, and that of GAPDH by RT-PCR. CD10, anti-CD77, anti-CD27, or anti-CD95 Abs. A representative data for each culture condition is shown. 5558 ASSOCIATION OF CD5 WITH BCR REVISION

FIGURE 5. Induced expression of RAG1 and RAG2 in CD5ϩ acquired Bm2 cells. A, IgDϩCD38Ϫ/ϩCD5Ϫ tonsil B cells were sorted and cultured on CD40L- transfected fibroblasts with anti-IgM-coated beads at 1 ␮g/ml for up to 5 days. Frequency of CD5ϩ induced B cells was evaluated by flow cytometry, and RAG1 and RAG2 mRNA expression was analyzed by nested RT-PCR and that of GAPDH by RT-PCR. B, IgDϩ CD38Ϫ/ϩCD5Ϫ tonsil B cells were sorted and cultured as above for 5 days. Then, cells turned positive for CD5 and cells still negative were sorted again, and expres- sion of RAG1, RAG2, and GAPDH mRNA was ana- lyzed as above. Downloaded from

CD77, CD27, and CD95 negative (Fig. 3B). Such observations following costimulation. We thus looked for RAG transcripts in ϩ confirm the mature status of the CD5 subpopulation in which tonsillar B lymphocytes following costimulation with anti-IgM http://www.jimmunol.org/ RAG1 and RAG2 mRNA are inducible. Although CD44 is ex- and CD40L, known to trigger survival of anti-IgM-induced apo- pressed on naive and memory cells, the absence of CD27 demon- ptosis (36). As may be predicted from the previous experiments, strates that they do not belong to the memory pool. They do not CD5 expression was induced increasingly, for up to 5 days of belong either to the centroblast pool, because they do not express culture (Fig. 4A). Interestingly, at day 4, this costimulation system CD77. Furthermore, expression of IgM and CD23 by the IgDϩ extended the induction of both RAG1 and RAG2 mRNA tran- CD38ϩCD5ϩ B cells is evidence for activation of a preswitch scripts (Fig. 4B). naive subset. Finally, the absence of CD95 suggests that they are To more definitively elucidate the association between CD5 ex- not prone to apoptosis through interaction with CD95L on T cells. pression and RAG transcription, CD5-nonexpressing Bm1 and To directly ascertain whether CD5 could be associated with Bm2 lymphocytes were sorted and stimulated with anti-IgM plus by guest on September 24, 2021 RAG expression and to determine how this might work, we con- CD40L. A CD5ϩ subpopulation was generated anew, and, at days ducted in vitro stimulation on mature tonsil B lymphocytes. Our 4 and 5, RAG1 and RAG2 mRNA were coexpressed (Fig. 5A). aim was to assess whether induction of CD5 correlated with RAG1 These data demonstrate that RAG1 and RAG2 can be concomi- and RAG2 mRNA transcription. It has long been known that mem- tantly up-regulated with the induction of CD5 expression. To iden- brane CD5 can be induced on human B cell following stimulation tify those cells expressing RAG, we repeated the experiments by with PMA (17, 31, 32). PMA stimulation of total tonsil B lym- sorting CD5ϩ and CD5Ϫ B cells after 5 days of culture, and an- phocytes indeed generated an increase in CD5ϩ B cell number that alyzed RAG transcripts in both populations. As shown in Fig. 5B, plateaued after 30 h (Fig. 4A). However, although RAG1 and cells turned positive for CD5 expressed both RAG1 and RAG2 RAG2 mRNA were detected in isolated cells before activation, transcripts, whereas cells that remained CD5 negative expressed mRNA for the two genes was down-regulated after stimulation RAG1 only. These data demonstrate that, when activated, only when measured by nested RT-PCR (Fig. 4B). This suggests that CD5-induced IgD-positive cells were capable of rearrange their specific signals might be required for the cells to induce CD5, and BCR-encoding genes. to permit the transcription of RAG1 and RAG2 mRNA. The effect of direct antigenic stimulation was, therefore, investigated, and Discussion tonsillar B cells activated with anti-IgM Abs. Because this activa- The origin and functions of the CD5ϩ B cells have fueled exten- tion leads to a high rate of apoptosis over 30 h (33, 34), hampering sive studies and discussions. Two mutually exclusive hypotheses analysis of RAG expression, the investigation was limited to the have been proposed as to the origin of CD5ϩ B cells. The first is first 30 h of stimulation. The frequency of CD5ϩ B lymphocytes the lineage hypothesis, which contends that some B cell precursors increased until 30 h (Fig. 4A), consistent with the detection of are destined to become CD5ϩ B cells (reviewed in Ref. 37). In RAG1, but not RAG2 mRNA, at that time (B). Inasmuch as CD40/ contrast, the differentiation hypothesis implies that all B cells have CD40L interaction has also been shown to induce CD5 on B cell the potential to acquire CD5ϩ B lymphocyte characteristics (re- surface (35), we cultured tonsillar B lymphocytes on CD40L-trans- viewed in Ref. 38). A new paradigm has recently emerged that fected fibroblasts. The experiments confirmed that, following 3 reconciles both hypotheses, proposing that two subsets of CD5 B days of stimulation, CD5 was induced on a subpopulation of cells cells may exist in mice (39) as well as in humans (17). One subset for up to 6 days of culture (Fig. 4A), but without up-regulation of of B cells would constitutively express CD5, whereas the other RAG1 and RAG2 mRNA transcription (B). These results indicate may be induced to do so in response to specific activation. The that specific conditions may be combined for CD5 to be induced present work extends the knowledge of the latter subpopulation by and to permit V(D)J rearrangement. From the data reported with demonstrating that, under specific stimulation conditions, some ac- mouse spleen B cells (3), but in contrast to human GC B cells (13), tivated tonsillar B cells may be induced to express CD5 and, at the RAG transcription may be up-regulated in mature B cells in vitro same time, gain the capacity to revise their BCR. The Journal of Immunology 5559

Based on IgD and CD38 expression, we have identified different This indicates that V(D)J recombination might be induced by ac- subpopulations in human tonsils and established that RAG expres- tivation. We found that stimulation with PMA, known to be a sion was not restricted to GC cells. Our study revealed that acti- potent cell activator and inducer of CD5 expression (31, 32), re- vated Bm2 cells, pre-GC Bm2Ј cells, and early Bm5 memory cells duces RAG expression. This is consistent with previous work (43) all displayed RAG1 and RAG2 mRNA. However, when subdi- and supports the notion that specific activation, such as Ag en- vided according to the expression of CD5, the Bm2 CD5ϩ cells counter, might be required for RAG up-regulation, as recently sug- was identified as a subpopulation that subsists outside GC and has gested (16). However, from our in vitro studies, BCR engagement the potential to undergo secondary Ig gene recombination. Indeed, alone cannot promote RAG mRNA up-regulation. In RAG1Ϫ/Ϫ the results have shown that, for this B cell subset, RAG1 and mice reconstituted with RAG1-GFP splenic B cells, in vitro stim- RAG2 transcripts and proteins are expressed at the single-cell ulation with either IL-1 and anti-IgM or IL-7 with anti-CD40 level. Frequencies of double-positive cells in the different B cell failed to induce GFP signal, suggesting that other mechanisms subsets are in the same range as those determined by others (16). might contribute to receptor revision (15). A second signal deliv- Cells negative for both enzymes or positive for only one were also ered by T lymphocytes seems to be necessary. Thus, BCR and found. This might be attributable to the different means of RAG1 CD40 coligation triggers expression of RAG1 and RAG2. Inter- and RAG2 regulation. Although RAG1 expression mainly depends estingly, this was induced only in the naive mature B cells turned upon the cell activation status (40), that of RAG2 is linked to the positive for CD5, indicating that CD5ϩ B cells expressing RAG cell cycle phase leading to its accumulation during the G1 phase mRNA are likely to belong to the inducible CD5 B cell subpopu- (41). Because isolated B cells were not synchronized, all of the lation, although the involvement of the “constitutive” CD5ϩ B cell ϩ patterns of RAG1 and RAG2 expressions could be observed dur- pool (17) cannot be totally discounted. Whether RAG B1 cells Downloaded from ing the kinetics study. Furthermore, we have confirmed their func- found in the peritoneal cavity of mice are part of the “inducible” tional recombinase activity. Thus, freshly isolated CD5ϩ Bm2 CD5ϩ B cells remains also to be determined (22). It is now clear cells had J␭7, J␬4, and/or J␬5 signal breaks. Because detection of that induction of CD5 expression on human mature B cells repre- L chain recombination intermediates as well as increased ␭ gene sents part of the differentiation pathway and is a particular feature usage have been correlated to receptor revision (13), our results of certain B cells that are susceptible to special inductive signals ϩ ϩ indicate that CD5 Bm2 cells have a functional V(D)J recombi- (44). The decreased frequency of CD5 B cells observed once the http://www.jimmunol.org/ nation machinery. From these combined data, we conclude that, cells entered the GC lends support to this hypothesis, indicating before the cells enter the GC in vivo, naive activated Bm2 lym- that CD5 expression might be lost at this stage of development. phocytes may initiate V(D)J rearrangement when they express the However, we cannot rule out the possibility that a selection may CD5 molecule. This conclusion is strengthened by our in vitro also operate resulting in a diminished expression of CD5. experiments. They showed that, when stimulated with anti-IgM The CD5 expression, associated with RAG1 and RAG2 up-reg- plus CD40L, some IgDϩCD38ϩCD5Ϫ Bm2 cells were encouraged ulation, raised the question as to how appearance of CD5 may to express RAG1 and RAG2, but this behavior was restricted to influence RAG1 and RAG2 expression. Other questions are the those turned into CD5 positive. nature of the B cell subpopulation affected and the physiological It has been shown that a subset of transitional B cells retains the role this process plays in vivo. It has been shown that receptor by guest on September 24, 2021 capacity to up-regulate RAG genes when stimulated via their BCR editing in immature B cells is induced because of distinct BCR in an appropriate environment (42). Although transitional B cells signaling capacities in these cells compared with mature B cells. In have not been underscored in humans, and do not express CD5 in immature B cells, engagement of the BCR leads to small increases mice (37), it was of importance to prove that the presence of in intracellular free Ca2ϩ and to the induction of receptor editing. RAGϩ B cells in human tonsils could not be ascribed to newly In contrast, BCR engagement in mature B cells results in high immigrated immature-type B lymphocytes. According to the de- elevation in intracellular Ca2ϩ concentration leading to the up- scription by Loder et al. (30), we found transitional type-2-like B regulation of CD86, CD69, and MHC class II, but not V(D)J re- cells (IgDϩIgMbrightCD21bright) in the IgDϩ population, but their combination (45). CD5ϩ B lymphocytes in mice have been shown functional characteristics remain to be determined. However, we to be hyporesponsive to BCR ligation compared with their CD5Ϫ observed that these lymphocytes do not express CD5 and that all B cell counterpart. They have a reduced capacity for intracellular the CD5ϩ cells belong to the mature population (IgDϩIgMϩ Ca2ϩ mobilization, diminished proliferation, and increased apo- CD21ϩ). Furthermore, expression of IgM, CD23, and CD44, and ptosis after BCR cross-linking due to a negative role for CD5 in lack of CD10, CD77, and CD27 expression strongly confirm the the BCR signaling (23, 46). CD5 reduces strong BCR-mediated preswitch characteristics of the IgDϩCD38ϩCD5ϩ B cells, i.e., signaling and permits only limited increases in intracellular free before they enter the GC (10). Taken together, these data demon- Ca2ϩ (23). Similarly, CD5 expression may increase BCR thresh- strate the mature status of the CD5ϩ B cells expressing RAG1 and old in human Bm2 lymphocytes. In this setting, such activated RAG2 genes and thus undergoing V(D)J recombination outside cells would respond like immature B cells with respect to Ca2ϩ GCs. However, it should be noted that, in one case, the CD5Ϫ Bm2 mobilization. Low intracellular Ca2ϩ mobilization would thus pro- lymphocytes also expressed RAG1 and RAG2 mRNA. Because mote the induction of RAG expression, leading ultimately to re- CD5 is transiently induced, it is likely that these latter cells may be ceptor revision. Therefore, the physiological relevance of this pro- CD5-induced Bm2 lymphocytes that have achieved V(D)J rear- cess may be as follows: whereas clones of B cells with high BCR rangement, and for which CD5 expression has been terminated, affinity would be permitted to migrate into the dark zone and pro- but not that of RAG1 and RAG2. Moreover, the presence of liferate as centroblasts, B cells with very low BCR affinity would RAG1 and RAG2 transcripts in both CD5ϩ and CD5Ϫ early be deprived of rescuing signals, and thus deleted by apoptosis. We Bm5 cells indicates that some postswitch B lymphocytes may hypothesize that B cell clones with intermediate BCR affinity re- revise their BCR independently of CD5 expression. However, ceive signals not strong enough to induce maturation into centro- the recombinase activity of the RAG protein in these cells re- blast cells but sufficient enough to avoid deletion and trigger CD5 mains to be demonstrated. expression. Together with CD40 engagement, this will promote In contrast to activated naive Bm2 lymphocytes, resting naive V(D)J rearrangement. When high-affinity revised BCR is ex- Bm1 cells were negative for RAG1 and RAG2 mRNA expression. pressed, BCR engagement would trigger maturation of the cells 5560 ASSOCIATION OF CD5 WITH BCR REVISION into centroblasts and in the process turn off RAG expression (13), 5. Papavasiliou, F., R. Casellas, H. Suh, X. F. Qin, E. Besmer, R. Pelanda, and possibly CD5, which is known to be transiently induced under D. Nemazee, K. Rajewsky, and M. C. Nussenzweig. 1997. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science 278:298. T-dependent activation (47). The relevance of this process may be 6. Kelsoe, G. 1999. V(D)J hypermutation and receptor revision: coloring outside the to raise the affinity of the BCR up to the level required for matu- lines. Curr. Opin. Immunol. 11:70. 7. Nemazee, D., and M. Weigert. 2000. Revising B cell receptors. J. Exp. Med. ration and differentiation. Our data suggest that BCR revision is 191:1813. not confined to a specific subpopulation but rather may involve a 8. de Wildt, R. M., R. M. Hoet, W. J. van Venrooij, I. M. Tomlinson, and G. Winter. broad spectrum of B cells. Any B cell may express CD5, depend- 1999. Analysis of heavy and light chain pairings indicates that receptor editing shapes the human antibody repertoire. J. Mol. Biol. 285:895. ing on its BCR affinity and/or specificity and, thereby, acquire the 9. Wilson, P. C., K. Wilson, Y. J. Liu, J. Banchereau, V. Pascual, and J. D. Capra. potential to revise its BCR. This is consistent with the hypothesis 2000. Receptor revision of immunoglobulin heavy chain variable region genes in that CD5ϩ B cells may generate CD5Ϫ B cells and contribute to normal human B lymphocytes. J. Exp. Med. 191:1881. 10. Liu, Y. J., and C. Arpin. 1997. Germinal center development. Immunol. Rev. the heterogeneity of cell populations that proliferate in the 156:111. GC (48). 11. Lindhout, E., G. Koopman, S. T. Pals, and C. de Groot. 1997. Triple check for This phenomenon may also have pathophysiological conse- antigen specificity of B cells during germinal centre reactions. Immunol. Today ϩ 18:573. quences. Modification of the BCR in anergic CD5 B cells in 12. Giachino, C., E. Padovan, and A. Lanzavecchia. 1998. Re-expression of RAG-1 autoimmune transgenic HEL/anti-HEL model has been observed and RAG-2 genes and evidence for secondary rearrangements in human germinal center B lymphocytes. Eur. J. Immunol. 28:3506. (20). BCR engagement through low-affinity auto-Ags generates 13. Meffre, E., F. Papavasiliou, P. Cohen, O. de Bouteiller, D. Bell, H. Karasuyama, weak mobilization and reduced proliferation (49), which are ame- C. Schiff, J. Banchereau, Y. J. Liu, and M. C. Nussenzweig. 1998. Antigen re- liorated when the mice are bred onto a CD5Ϫ/Ϫ background. These ceptor engagement turns off the V(D)J recombination machinery in human tonsil ϩ B cells. J. Exp. Med. 188:765. Downloaded from CD5 B cells manifest similarities with anergic cells. For exam- 14. Hertz, M., V. Kouskoff, T. Nakamura, and D. Nemazee. 1998. V(D)J recombi- ple, both populations are stimulated by Ag (50, 51), respond sub- nase induction in splenic B lymphocytes is inhibited by antigen-receptor signal- optimally to IgM cross-linking (49, 52), show evidence of second- ling. Nature 394:292. 15. Igarashi, H., N. Kuwata, K. Kiyota, K. Sumita, T. Suda, S. Ono, S. R. Bauer, and ary receptor recombination (22, 53), and are excluded from the N. Sakaguchi. 2001. Localization of recombination activating gene 1/green flu- GCs (reviewed in Ref. 54). An obvious relationship links anergy orescent protein (RAG1/GFP) expression in secondary lymphoid organs after and V(D)J rearrangement in maintaining B cell tolerance, as well immunization with T-dependent antigens in rag1/gfp knock-in mice. Blood ϩ 97:2680. as anergy-like state and CD5 B cell development (20). Interest- 16. Girschick, H. J., A. C. Grammer, T. Nanki, M. Mayo, and P. E. Lipsky. 2001. http://www.jimmunol.org/ ingly, we observed that the CD5ϩ Bm2 cells lack CD95 expression RAG1 and RAG2 expression by B cell subsets from human tonsil and peripheral Ϫ blood. J. Immunol. 166:377. and display lower levels of IgM compared with the CD5 coun- 17. Youinou, P., C. Jamin, and P. M. Lydyard. 1999. CD5 expression in human terpart (our unpublished observations). These cells, which are pro- B-cell populations. Immunol. Today 20:312. tected from T-dependent apoptosis, might be in an anergic-like 18. Dono, M., V. L. Burgio, C. Tacchetti, A. Favre, A. Augliera, S. Zupo, G. Taborelli, N. Chiorazzi, C. E. Grossi, and M. Ferrarini. 1996. Subepithelial B state. cells in the human palatine tonsil. I. Morphologic, cytochemical and phenotypic ϩ CD5 B cells constitute a major source of natural auto-Abs, characterization. Eur. J. Immunol. 26:2035. although they require exposure to Ag for maturation into Ab-se- 19. Abe, M., K. Tominaga, and H. Wakasa. 1994. Phenotypic characterization of human B-lymphocyte subpopulations, particularly human CD5ϩ B-lymphocyte creting cells (51). Furthermore, anergy-inducing BCR engagement subpopulation within the mantle zones of secondary follicles. Leukemia 8:1039. is often associated with receptor editing (53, 55), suggesting that a 20. Hippen, K. L., L. E. Tze, and T. W. Behrens. 2000. CD5 maintains tolerance in by guest on September 24, 2021 hierarchy of decreasing signaling thresholds is required in anergic B cells. J. Exp. Med. 191:883. 21. Tze, L. E., E. A. Baness, K. L. Hippen, and T. W. Behrens. 2000. Ig light chain BCR/Ag interactions for the induction of editing, anergy, and se- receptor editing in anergic B cells. J. Immunol. 165:6796. lection of CD5ϩ or CD5Ϫ B cells (56). Therefore, the accumula- 22. Qin, X. F., S. Schwers, W. Yu, F. Papavasiliou, H. Suh, A. Nussenzweig, ϩ K. Rajewsky, and M. C. Nussenzweig. 1999. Secondary V(D)J recombination in tion of CD5 B cells in human autoimmune diseases (57, 58) may B-1 cells. Nature 397:355. reflect Ag-driven activation and subsequent anergy-like state in- 23. Bikah, G., J. Carey, J. R. Ciallela, A. Tarakhovky, and S. Bordada. 1996. CD5- duction of autoreactive B cells. From observations described mediated negative regulation of antigen receptor-induced growth signals in B-1 Science 274:1906 herein, mechanisms contributing to the maintenance of tolerance in B cells. . ϩ 24. Schlissel, M., A. Constantinescu, T. Morrow, M. Baxter, and A. Peng. 1993. anergic CD5 B cells may include the control of V(D)J recombi- Double-strand signal sequence breaks in V(D)J recombination are blunt, 5Ј-phos- nation at the CD5ϩ Bm2 state. The control of CD5 expression phorylated, RAG-dependent, and cell cycle regulated. Genes Dev. 7:2520. 25. Leu, T. M., and D. G. Schatz. 1995. rag-1 and rag-2 are components of a high- and/or receptor revision before the cells enter the GC may be molecular-weight complex, and association of rag-2 with this complex is rag-1 faulty in autoimmune disorders and leads to the emergence of au- dependent. Mol. Cell. Biol. 15:5657. to-Ab-secreting cells. 26. Schultze, J. L., S. Michalak, M. J. Seamon, G. Dranoff, K. Jung, J. Daley, J. C. Delgado, J. G. Gribben, and L. M. Nadler. 1997. CD40-activated human B cells: an alternative source of highly efficient antigen presenting cells to generate Acknowledgments autologous antigen-specific T cells for adoptive immunotherapy. J. Clin. Invest. 100:2757. We acknowledge Laetitia Le Pottier for her skillful and cheerful assistance. 27. Oettinger, M. A., D. G. Schatz, C. Gorka, and D. Baltimore. 1990. RAG-1 and The editorial assistance of Prof. Rizgar A. Mageed is greatly appreciated. RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science Thanks are also due to Simone Forest and Cindy Se´ne´ for secretarial 248:1517. assistance. 28. Nagaoka, H., G. Gonzalez-Aseguinolaza, M. Tsuji, and M. C. Nussenzweig. 2000. Immunization and infection change the number of recombination activating gene (RAG)-expressing B cells in the periphery by altering immature lymphocyte Disclosures production. J. Exp. Med. 191:2113. The authors have no financial conflict of interest. 29. Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, and M. C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. References Nature 400:682. 1. Hertz, M., and D. Nemazee. 1997. BCR ligation induces receptor editing in 30. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, IgMϩIgDϪ bone marrow B cells in vitro. Immunity 6:429. M. C. Lamers, and R. Carsetti. 1999. B cell development in the spleen takes place 2. Radic, M. Z., and M. Zouali. 1996. Receptor editing, immune diversification, and in discrete steps and is determined by the quality of B cell receptor-derived self-tolerance. Immunity 5:505. signals. J. Exp. Med. 190:75. 3. Hikida, M., M. Mori, T. Takai, K. Tomochika, K. Hamatani, and H. Ohmori. 31. Miller, R. A., and J. Gralow. 1984. The induction of Leu-1 antigen expression in 1996. Reexpression of RAG-1 and RAG-2 genes in activated mature mouse B human malignant and normal B cells by phorbol myristic acetate (PMA). J. Im- cells. Science 274:2092. munol. 133:3408. 4. Han, S., B. Zheng, D. G. Schatz, E. Spanopoulou, and G. Kelsoe. 1996. Neoteny 32. Youinou, P., L. Mackenzie, J. Jouquan, P. Le Goff, and P. M. Lydyard. 1987. in lymphocytes: Rag1 and Rag2 expression in germinal center B cells. Science CD5-positive B cells in patients with rheumatoid arthritis: phorbol ester-mediated 274:2094. enhancement of detection. Ann. Rheum. Dis. 46:17. The Journal of Immunology 5561

33. Chaouchi, N., A. Vazquez, P. Galanaud, and C. Leprince. 1995. B cell antigen 46. Morris, D. L., and T. L. Rothstein. 1993. Abnormal transcription factor induction receptor-mediated apoptosis: importance of accessory molecules CD19 and through the surface immunoglobulin M receptor of B-1 lymphocytes. J. Exp. CD22, and of surface IgM cross-linking. J. Immunol. 154:3096. Med. 177:857. 34. Pers, J. O., C. Jamin, R. Le Corre, P. M. Lydyard, and P. Youinou. 1998. Ligation 47. Vernino, L. A., D. S. Pisetsky, and P. E. Lipsky. 1992. Analysis of the expression of CD5 on resting B cells, but not on resting T cells, results in apoptosis. Eur. of CD5 by human B cells and correlation with functional activity. Cell. Immunol. J. Immunol. 28:4170. 139:185. 35. Gagro, A., N. McCloskey, A. Challa, M. Holder, G. Grafton, J. D. Pound, and 48. Caligaris-Cappio, F., M. Riva, L. Tesio, M. Schena, G. Gaidano, and L. Bergui. 1989. Human normal CD5ϩ B lymphocytes can be induced to differentiate to T. Gordon. 2000. CD5-positive and CD5-negative human B cells converge to an Ϫ indistinguishable population on signalling through B-cell receptor and CD40. CD5 B lymphocytes with germinal center cell features. Blood 73:1259. Immunology 101:201. 49. Cooke, M. P., A. W. Heath, K. M. Shokat, Y. Zeng, F. D. Finkelman, P. S. Linsley, M. Howard, and C. C. Goodnow. 1994. Immunoglobulin signal 36. Valentine, M. A., and K. A. Licciardi. 1992. Rescue from anti-IgM-induced transduction guides the specificity of B cell-T cell interactions and is blocked in programmed cell death by the B cell surface proteins CD20 and CD40. Eur. tolerant self-reactive B cells. J. Exp. Med. 179:425. J. Immunol. 22:3141. 50. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, 37. Hardy, R. R., and K. Hayakawa. 2001. B cell development pathways. Annu. Rev. R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, and Immunol. 19:595. K. Raphael. 1988. Altered immunoglobulin expression and functional silencing 38. Berland, R., and H. H. Wortis. 2002. Origins and functions of B-1 cells with notes of self-reactive B lymphocytes in transgenic mice. Nature 334:676. on the role of CD5. Annu. Rev. Immunol. 20:253. 51. Hayakawa, K., M. Asano, S. A. Shinton, M. Gui, D. Allman, C. L. Stewart, 39. Rothstein, T. L. 2002. Cutting edge commentary: two B-1 or not to be one. J. Silver, and R. R. Hardy. 1999. Positive selection of natural autoreactive B cells. J. Immunol. 168:4257. Science 285:113. 40. Neale, G. A., T. J. Fitzgerald, and R. M. Goorha. 1992. Expression of the V(D)J 52. Tsubata, T., M. Murakami, and T. Honjo. 1994. Antigen-receptor cross-linking recombinase gene RAG-1 is tightly regulated and involves both transcriptional induces peritoneal B-cell apoptosis in normal but not autoimmunity-prone mice. and post-transcriptional controls. Mol. Immunol. 29:1457. Curr. Biol. 4:8. 41. Li, Z., D. I. Dordai, J. Lee, and S. Desiderio. 1996. A conserved degradation 53. Fang, W., B. C. Weintraub, B. Dunlap, P. Garside, K. A. Pape, M. K. Jenkins, signal regulates RAG-2 accumulation during cell division and links V(D)J re- C. C. Goodnow, D. L. Mueller, and T. W. Behrens. 1998. Self-reactive B lym- Downloaded from combination to the cell cycle. Immunity 5:575. phocytes overexpressing Bcl-xL escape negative selection and are tolerized by clonal anergy and receptor editing. Immunity 9:35. 42. Sandel, P. C., and J. G. Monroe. 1999. Negative selection of immature B cells by 54. Hardy, R. R., C. E. Carmack, Y. S. Li, and K. Hayakawa. 1994. Distinctive receptor editing or deletion is determined by site of antigen encounter. Immunity ϩ developmental origins and specificities of murine CD5 B cells. Immunol. Rev. 10:289. 137:91. 43. Casillas, A. M., A. D. Thompson, S. Cheshier, S. Hernandez, and R. J. Aguilera. 55. Chen, C., E. L. Prak, and M. Weigert. 1997. Editing disease-associated autoan- 1995. RAG-1 and RAG-2 gene expression and V(D)J recombinase activity are tibodies. Immunity 6:97. enhanced by protein phosphatase 1 and 2A inhibition in lymphocyte cell lines. 56. Chumley, M. J., J. M. Dal Porto, and J. C. Cambier. 2002. The unique antigen Mol. Immunol. 32:167.

receptor signaling phenotype of B-1 cells is influenced by locale but induced by http://www.jimmunol.org/ 44. Zupo, S., M. Dono, R. Massara, G. Taborelli, N. Chiorazzi, and M. Ferrarini. antigen. J. Immunol. 169:1735. Ϫ 1994. Expression of CD5 and CD38 by human CD5 B cells: requirement for 57. Porakishvili, N., R. Mageed, C. Jamin, J. O. Pers, N. Kulikova, Y. Renaudineau, special stimuli. Eur. J. Immunol. 24:1426. P. M. Lydyard, and P. Youinou. 2001. Recent progress in the understanding of 45. Benschop, R. J., E. Brandl, A. C. Chan, and J. C. Cambier. 2001. Unique sig- B-cell functions in autoimmunity. Scand. J. Immunol. 54:30. naling properties of B cell antigen receptor in mature and immature B cells: 58. Youinou, P., and P. M. Lydyard. 2001. CD5ϩ B cells in nonorgan-specific au- implications for tolerance and activation. J. Immunol. 167:4172. toimmune diseases: a fresh look. Lupus 10:523. by guest on September 24, 2021