DOCSLIB.ORG

ZBED6 the Birth of a Transcription Factor in Placental Mammals Wild

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ZBED6 the Birth of a Transcription Factor in Placental Mammals Wild ZBED6 Wild Boar X domestic pig intercross initiated 1989 the birth of a transcription factor in placental mammals X F1 X F1 Göran Andersson Swedish University of Agricultural Sciences ALLBIO- Scilife-UPPNEX-BILS course 15 May 2014 200 F2 A paternally expressed QTL affecting skeletal and cardiac QTL mapping of fatness traits in the Wild Boar muscle mass in pigs maps to the IGF2 locus intercross, a model for mild obesity in humans 30 Lean meat in ham •Strong selection for lean growth in commercial lines of 25 Lean meat mass in ham pigs has enriched for mutations reducing fat deposition 20 Longissimus muscle area 15 Heart F ratio 10 0.1% Average back fat depth • Wild boars have the capacity to store excess food as fat 5% 5 5% Birth weight 0 Abdominal fat • QTL analysis revealed two major loci on chr. 2 and chr. 0.1 % Genome wide significance 4 controlling a large proportion of the difference in fat 5 % Genome wide significance deposition between the Wild Boar and Large white 5 % Suggestive significance domestic pigs. Pig Chromosome 2 The QTL allele from domestic Large White pig increases muscle content with 3-4%, reduces subcutaneous fat and increase the size of the heart Comparative sequencing of TH-INS-IGF2 in pigs, human The paternally expressed IGF2 QTL has ”major” and mice phenotypic effects Trait W/W D/D % of variance % Meat in ham 63.6 67.3 30.6 Subcutaneous fat (mm) 27.2 24.7 10.4 Heart weight (gr) 226 244 14.4 4b VISTA-plot IGF-II gene structure • Ten exons, 1-7 non-coding • Four promoters, P1-P4 P1 P2 P3 P4 E1 E2 E3 E4 E4b E5 E6 E7 E8 E9 E7 - E9 are IGF2 Coding exons IGF2-AS * E5 E4E3 E2 E1 a b c E3 E2b d 30 kb Resequencing of 15 chromosomes classified as The QTN located in IGF2 intron 3 is part of an « Q » or « q » identified the Evolutionary Conserved Region Quantitative Trait Nucleotide (QTN) Pig.q CCTGCCCGCGGCGGCAGCCGGGCCGCGGCTTCGCCTAGGCTCGCAGCGCGGGAGCGCGTGGGGCGCGGCGGCGGCGGGGAG Pig.Q ..........................................A...................................... Bovine ..............TC..............................A.................................. Horse ...............G...C..T.......................................................... Dog ...............C......AT......................................................... Rabbit .......C.......G...C...............................A..............A.T............ Human .....T.C...T...G..TC...............................AG...A.........A.T....AG...... Mouse T......C.......T...T....C..A................G...TCT...............A.G............ Rat T......C.......C...C....C..A................G....CT...............A.G...A.T.....A 16 bp around the QTN is 100% identical among 18/18 placental mammals In#pigs#that#carry#the#muta1on…# Electrophore1c#Mobility#ShiE#Assay# !!!!!!Postnatally:# 20 C2C12 cell (myoblast) nuclear extracts 18 q Q # 14 10 Mutant •#36fold# !#of#IGF2% 6 Wild-type What#is#this#protein?# 1.5 * ##mRNA#in#skeletal# * ** IGF2/GAPDH 1 * ##muscle#and#heart,# 0.5 * 0 ##but#not#liver.# mRNA, fetal 3 w 2 m 4 m 6 m 3 w 4 m 3 w 4 m Muscle heart liver # Does!the!muta/on!affect!binding!with!some!transcrip/on!factor?! Wild boar (q) CTAGGCTCGCAGCGCGG Large white (Q) CTAGGCTCA CAGCGCGG Nature 425 (2003) Nature 425 (2003) Stable Isotope Labeling with AA in Cell Culture Identification of a novel protein! 13 C66L6Arg# Wild Boar (q) CTAGGCTCGCAGCGCGG Natural#isotopes# 13C6,#15N26L6Lys# Large white (Q) CTAGGCTCA CAGCGCGG Light# Heavy# nuclear#extracts# A# bead bead G# mutated# wildtype# Liquid Chromatography Mass Spectrometry (LCMS) PLoS Biology 7 (2009) ZBED6! ZBED6#belongs#to#the#hAT#superfamily# • Domes1cated#DNA#transposon## • Performs#important#func1ons#in#placental#mammals.## • Recently#iden1fied#novel#mammalian#transcrip1on#factor.# ZBED6 • Repressor#of#IGF2#P3#and#P4#transcrip1on#in#skeletal# muscle# hATC dimerization domain (Andersson#et#al.,!2010)(Van#Laere#et#al.,#2003)#(#Markljung#et#al.,#2009)# Zn2+ finger BED domain ZBED6! (hobo from Drosophila, Activator from maize and Tam3 from snap-dragon) Human Chromosome 1 PLoS Biology 7 (2009) Known!ZBED!Genes! Func/ons!of!other!ZBEDs! CD96 Intron 6 3 # DHRSX ZBED2! 5 • ZBED1#plays#an#important#role#in#cell#prolifera1on#and#regulates# Y # # Intron 1 # transcrip1on#of#DNA#pol#gene#and#different#genes#encoding# ZBED3! ZBED1! (Yamashita#et#al,#2003)# # ribosomal#proteins# # # ZBEDS! • ZBED3#binds#with#axin#and#is#involved#in#wnt/βcatenin#signaling# (Chen#et#al.,#2009)# Zc3h11a 1 22 Intron 1 # # ZBED6! ZBED4! • ZBED2#6>?# # # # ZBED5! • ZBED4#is#expressed#in#human#re1na#and#acts#as#regulator#of# # nuclear#hormone#receptor#(Saghizadeh#et#al.,#2009).# 11 # • ZBED5#(buster1/#charlie6like#transposon)#6>#?# ZBED!domains! Protein Tree BUSTER Family BE hATC D ZBED1 AC ZBED4 ZBED2 & 3 Family ZBED5 ZBED6 ZBED1 ZBED2 ZBED3 ZBED6#is#a#domes1cated#transposon#that#“hitch6hikes”# The DNA binding BED domain in ZBED6 is extremely well on#the#ZC3H11A#promoter# conserved among mammals bp ZBED6 ZC3H11A • Intron retention: ZBED6 • Normal intron splicing: ZC3H11A PLoS Biology 7 (2009) Immunohistochemistry shows that ZBED6 has a ZBED6 is an innovation in placental mammals broad tissue distribution during development and in adult mice and a nuclear localization ZBED6 ZC3H11A Efficient silencing of Zbed6 in mouse C2C12 ZBED6#is#enriched#in#the#nucleolus# cells ZBED6 Nucleophosmin Merge PLoS Biology 7 (2009) Luciferase assay provides conclusive evidence that ZBED6 is the Luciferase assay provides conclusive evidence that ZBED6 is the nuclear factor interacting with the CpG island in IGF2 intron 2 nuclear factor interacting with the CpG island in IGF2 intron 2 pIGF2 P3 Luciferase pIGF2 P3 Luciferase ZBED6 ZBED6 pIGF2 - q pIGF2 P3 Luciferase pIGF2 - q pIGF2 P3 Luciferase pIGF2 - Q pIGF2 P3 Luciferase pIGF2 - Q pIGF2 P3 Luciferase 45! ZBED6!siRNA!50nm! 40! 16! 35! 14! 30! 12! 25! 10! 20! 8! 15! 6! 10! 4! 5! 2! Rela/ve!Luciferase!Units,!firefly/renilla! 0! 0! P3!promoter! WildJtype! WildJtype! Mutant!185bp!Mutant!145bp! Rela/ve!Luciferase!Units,!firefly/renilla! P3!promoter! WildJtype! WildJtype! Mutant!185bp! Mutant!145bp! 185bp! 145bp! 185bp! 145bp! ZBED6#repression#is#not#promoter6specific# ChIP-sequencing reveals about 2,500 Zbed6 binding sites in C2C12 cells Mouse, myoblast 700 600 500 400 300 200 100 Relative luciferase units 0 SV40 + enhancer SV40 + enh + SV40 + enh + wild-type qTN mutant QTN Human, rhabdomyosarcoma 500 400 Units 300 200 Luciferase 100 0 Relative SV40 + enhancer SV40 + enh + SV40 + enh + wild-type qTN mutant QTN Zbed6 binds preferentially to the vicinity of start of Gene Ontology classifications show a striking over- transcription sites (TSS) and CpG islands representation of certain biological functions The results suggest that ZBED6 has an important regulatory role in placental mammals Figure!1.!RNA!sequencing!of!Zbed6Jsilenced!myoblast!cells.! How does ZBED6 mediate transcriptional regulation of downstream targets? ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!2.!Muscle!proteins!were!significantly!enriched!among!the!differen/ally!expressed!(DE)!genes.! Table!2.!Analysis!of!the!correla/on!between!differen/al!gene!expression!(DE)!a]er!Zbed6!silencing!and!the! presence!of!ZBED6!binding!sites!within!5!kb!of!the!transcrip/on!start!site!(TSS).! Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!5.!ZBED6!modulates!the!expression!of!Igf2!and!Myogenin!during!differen/a/on!of!C2C12!cells.! The mutation at the ZBED6 binding site at the CpG site in pig IGF2 intron 3 - does not alter the status of imprinting - does not lead to gross changes in DNA methylation patterns Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!4.!Histone!modifica/ons!associated!with!ZBED6!target!sites!and!other!sites!in!C2C12!myoblast!cells.! # ChIP6seq#data#for#ZBED6#and#six#histone# modifica1ons#in#C2C12#myoblast#cells# ! Active promoters Enhancers Repression Average coverage Average Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Zbed6 Distance to Zbed6 binding sites ! G Model#for#ZBED6#func1on# IGF2 Wild boar ZBED6 Repressed state G GCTCG Chinese Meishan Mutation at Epigenetic Down- Loss-of- A target site activation regulation function Hampshire ZBED6 ZBED6 ZBED6 ZBED6 Active A X Me state Pietrain GCTCA GCTCG GCTCG GCTCG PLoS Biology 7 (2009) Acknowledgements Elizabeth Gilbert, Lin Jiang, Awaisa Ghazal, Shady Yunis, Carl-Johan Rubin, Ola Wallerman, Anna-Maja Molin, Rajesh Gupta, Elisabeth Sundström, Anders Lindroth, Göran Hjälm, Leif Andersson Broad Institute: Li Wang, Xiaolan Zhang, Tarjei Mikkelsen, Kerstin Lindblad-Toh, and the Broad Institute Epigenomics Initiative .
Load more

Recommended publications
  • Transcriptional Modulator ZBED6 Affects Cell Cycle and Growth of Human Colorectal Cancer Cells
    Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells Muhammad Akhtar Alia,1, Shady Younisb,c,1, Ola Wallermand, Rajesh Guptab, Leif Anderssonb,d,e,1,2, and Tobias Sjöbloma,1 aScience For Life Laboratory, Department of Immunology, Genetics and Pathology, Uppsala University, SE-751 85 Uppsala, Sweden; bScience for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala University, SE-751 85 Uppsala, Sweden; cDepartment of Animal Production, Ain Shams University, Shoubra El-Kheima, 11241 Cairo, Egypt; dDepartment of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, SE-75007 Uppsala, Sweden; and eDepartment of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843 Contributed by Leif Andersson, May 15, 2015 (sent for review December 10, 2014; reviewed by Jan-Ake Gustafsson) The transcription factor ZBED6 (zinc finger, BED-type containing 6) (QTN) with a large impact on body composition (muscle growth is a repressor of IGF2 whose action impacts development, cell pro- and fat deposition); mutant animals showed threefold higher IGF2 liferation, and growth in placental mammals. In human colorectal expression in postnatal muscle (11). ZBED6 was identified as the cancers, IGF2 overexpression is mutually exclusive with somatic nuclear factor specifically binding the wild-type IGF2 sequence but mutations in PI3K signaling components, providing genetic evi- not the mutated site. ChIP sequencing (ChIP-seq) in mouse C2C12 dence for a role in the PI3K pathway. To understand the role of cells identified more than 1,200 putative ZBED6 target genes, in- ZBED6 in tumorigenesis, we engineered and validated somatic cell cluding 262 genes encoding transcription factors (6).
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Dissection of the Cellular Function of the ZBED6 Transcription Factor in Mouse
    bioRxiv preprint doi: https://doi.org/10.1101/540914; this version posted February 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Dissection of the cellular function of the ZBED6 transcription factor in mouse 2 myoblast cells using gene editing, RNAseq and proteomics 3 4 Shady Younis1, Rakan Naboulsi1, Xuan Wang2, Xiaofang Cao1, Mårten Larsson1, Ernest 5 Sargsyan2, Peter Bergsten2, Nils Welsh2, Leif Andersson1,3,4 6 7 1Science for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala 8 University, SE-751 23 Uppsala, Sweden. 2Science for Life Laboratory, Department of Medical 9 Cell Biology, Uppsala University, SE-751 23 Uppsala, Sweden. 3Department of Animal 10 Breeding and Genetics, Swedish University of Agricultural Sciences, SE-75007 Uppsala, 11 Sweden. 4Department of Veterinary Integrative Biosciences, Texas A&M University, College 12 Station, TX 77843, USA. 13 14 15 1 bioRxiv preprint doi: https://doi.org/10.1101/540914; this version posted February 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 16 SUMMARY 17 The transcription factor ZBED6 acts as a repressor of Igf2 and affects directly or indirectly the 18 transcriptional regulation of thousands of genes. Here, we use gene editing in mouse C2C12 19 myoblasts and show that ZBED6 regulates Igf2 exclusively through its binding site 5′-GGCTCG- Δ 20 3′ in intron 1 of Igf2. Deletion of this motif (Igf2 GGCT) or complete ablation of Zbed6 leads to 21 ~20-fold up-regulation of IGF2 protein.
    [Show full text]
  • Transcriptional Modulator ZBED6 Affects Cell Cycle and Growth of Human Colorectal Cancer Cells
    Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells Muhammad Akhtar Alia,1, Shady Younisb,c,1, Ola Wallermand, Rajesh Guptab, Leif Anderssonb,d,e,1,2, and Tobias Sjöbloma,1 aScience For Life Laboratory, Department of Immunology, Genetics and Pathology, Uppsala University, SE-751 85 Uppsala, Sweden; bScience for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala University, SE-751 85 Uppsala, Sweden; cDepartment of Animal Production, Ain Shams University, Shoubra El-Kheima, 11241 Cairo, Egypt; dDepartment of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, SE-75007 Uppsala, Sweden; and eDepartment of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843 Contributed by Leif Andersson, May 15, 2015 (sent for review December 10, 2014; reviewed by Jan-Ake Gustafsson) The transcription factor ZBED6 (zinc finger, BED-type containing 6) (QTN) with a large impact on body composition (muscle growth is a repressor of IGF2 whose action impacts development, cell pro- and fat deposition); mutant animals showed threefold higher IGF2 liferation, and growth in placental mammals. In human colorectal expression in postnatal muscle (11). ZBED6 was identified as the cancers, IGF2 overexpression is mutually exclusive with somatic nuclear factor specifically binding the wild-type IGF2 sequence but mutations in PI3K signaling components, providing genetic evi- not the mutated site. ChIP sequencing (ChIP-seq) in mouse C2C12 dence for a role in the PI3K pathway. To understand the role of cells identified more than 1,200 putative ZBED6 target genes, in- ZBED6 in tumorigenesis, we engineered and validated somatic cell cluding 262 genes encoding transcription factors (6).
    [Show full text]
  • Functional Characterization of the Biological Significance of the ZBED6/ZC3H11A Locus in Placental Mammals
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1372 Functional characterization of the biological significance of the ZBED6/ZC3H11A locus in placental mammals SHADY YOUNIS ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-513-0072-6 UPPSALA urn:nbn:se:uu:diva-329190 2017 Dissertation presented at Uppsala University to be publicly examined in B/B42, Biomedicinskt centrum (BMC), Uppsala, Monday, 30 October 2017 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: Docent Ola Hansson (Department of Clinical Sciences, Malmö University Hospital, Lund University). Abstract Younis, S. 2017. Functional characterization of the biological significance of the ZBED6/ ZC3H11A locus in placental mammals. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1372. 57 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0072-6. The recent advances in molecular and computational biology have made possible the study of complicated transcriptional regulatory networks that control a wide range of biological processes and phenotypic traits. In this thesis, several approaches were combined including next generation sequencing, gene expression profiling, chromatin and RNA immunoprecipitation, bioinformatics and genome editing methods in order to characterize the biological significance of the ZBED6 and ZC3H11A genes. A mutation in the binding site of ZBED6, located in an intron of IGF2, disrupts the binding and leads to 3-fold upregulation of IGF2 mRNA in pig muscle tissues. The first part of the thesis presents a detailed functional characterization of ZBED6. Transient silencing of ZBED6 expression in mouse myoblasts led to increased Igf2 expression (~2-fold).
    [Show full text]
  • SMARCA4 Regulates Spatially Restricted Metabolic Plasticity in 3D Multicellular Tissue
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436346; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SMARCA4 regulates spatially restricted metabolic plasticity in 3D multicellular tissue Katerina Cermakova1,2,*, Eric A. Smith1,2,*, Yuen San Chan1,2, Mario Loeza Cabrera1,2, Courtney Chambers1,2, Maria I. Jarvis3, Lukas M. Simon4, Yuan Xu5, Abhinav Jain6, Nagireddy Putluri1, Rui Chen7, R. Taylor Ripley5, Omid Veiseh3, and H. Courtney Hodges1,2,3,8,9,‡ 1. Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA 2. Center for Precision Environmental Health, Baylor College of Medicine, Houston, TX, USA 3. Department of Bioengineering, Rice University, Houston, TX, USA 4. Therapeutic Innovation Center, Baylor College of Medicine, Houston, TX, USA 5. Department of Surgery, Division of General Thoracic Surgery, Baylor College of Medicine, Houston, TX, USA 6. Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 7. Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA 8. Center for Cancer Epigenetics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 9. Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX, USA * These authors contributed equally to this work ‡ Corresponding author: H. Courtney Hodges, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX, USA, [email protected]. Abstract SWI/SNF and related chromatin remodeling complexes act as tissue-specific tumor suppressors and are frequently inactivated in different cancers.
    [Show full text]
  • Imprint Stability and Plasticity During Development
    156 1 REPRODUCTIONREVIEW Imprint stability and plasticity during development Sarah-Jayne Mackin, Avinash Thakur*, and Colum P Walsh Genomic Medicine Research Group, School of Biomedical Sciences, Ulster University, Northern Ireland, UK Correspondence should be addressed to C P Walsh; Email: [email protected] *(A Thakur is currently at Terry Fox Laboratory, BC Cancer Research Centre, 675 West 10th Avenue, Room 13-112, Vancouver, BC V5Z 1L3, Canada) Abstract There have been a number of recent insights in the area of genomic imprinting, the phenomenon whereby one of two autosomal alleles is selected for expression based on the parent of origin. This is due in part to a proliferation of new techniques for interrogating the genome that are leading researchers working on organisms other than mouse and human, where imprinting has been most studied, to become interested in looking for potential imprinting effects. Here, we recap what is known about the importance of imprints for growth and body size, as well as the main types of locus control. Interestingly, work from a number of labs has now shown that maintenance of the imprint post implantation appears to be a more crucial step than previously appreciated. We ask whether imprints can be reprogrammed somatically, how many loci there are and how conserved imprinted regions are in other species. Finally, we survey some of the methods available for examining DNA methylation genome-wide and look to the future of this burgeoning field. Reproduction (2018) 156 R43–R55 Introduction hypothesis (Haig & Graham 1991, Moore & Haig 1991). Many imprinting phenomena involve effects on growth, Genomic imprinting is a classic epigenetic phenomenon, nutrition or metabolic balance, and this theory was partly and after X-inactivation, one of the best understood.
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • Methylation of a Newly Identified Region of the INS-IGF2 Gene Determines IGF2 Expression in Breast Cancer Tumors and in Breast Cancer Cells
    www.oncotarget.com Oncotarget, 2020, Vol. 11, (No. 44), pp: 3904-3920 Research Paper Methylation of a newly identified region of the INS-IGF2 gene determines IGF2 expression in breast cancer tumors and in breast cancer cells Vinodh Kumar Radhakrishnan1, Kameswaran Ravichandran2, Chibuzo Eke1, Amanda Ortiz-Vicil1, Qianwei Tan1, Marino De León1 and Daisy D. De León1 1Center for Health Disparities and Molecular Medicine, Loma Linda University School of Medicine, Loma Linda, CA 92350, USA 2Division of Renal Diseases and Hypertension, University of Colorado at Denver, Aurora, CO 80045, USA Correspondence to: Daisy D. De León, email: [email protected] Keywords: IGF2; INS-IGF2; hypermethylation; DMR; epigenetics, Received: December 13, 2018 Accepted: June 01, 2020 Published: November 03, 2020 Copyright: @2020 Radhakrishnan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT IGF2 is essential in breast differentiation, lactation, tumor growth, and in breast cancer (BC) development and progression. This growth factor also inhibits apoptosis and promotes metastasis and chemoresistance, contributing to more aggressive tumors. We previously demonstrated that IGF2 protein levels are higher in BC tissues from African American women than in Caucasian women. We also showed that high IGF2 protein levels are expressed in normal breast tissues of African American women while little or no IGF2 was detected in tissues from Caucasian women. Others showed that decreased DNA methylation of the IGF2 gene leads to different BC clinical features.
    [Show full text]
  • Transcription Factor ZBED6 Mediates IGF2 Gene Expression By
    OPEN Transcription Factor ZBED6 Mediates SUBJECT AREAS: IGF2 Gene Expression by Regulating TOR SIGNALLING GENE REGULATION Promoter Activity and DNA Methylation Received in Myoblasts 13 January 2014 Yong-Zhen Huang1, Liang-Zhi Zhang1, Xin-Sheng Lai1, Ming-Xun Li1, Yu-Jia Sun1, Cong-Jun Li2, Accepted Xian-Yong Lan1, Chu-Zhao Lei1, Chun-Lei Zhang3, Xin Zhao1 & Hong Chen1 18 March 2014 Published 1College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for 2 April 2014 Agriculture, Yangling Shaanxi, People’s Republic of China, 2United States Department of Agriculture–Agricultural Research Service, Bovine Functional Genomics Laboratory, Beltsville, Maryland, United States of America, 3Institute of Cellular and Molecular Biology, Jiangsu Normal University, Xuzhou Jiangsu, People’s Republic of China. Correspondence and requests for materials should be addressed to Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the H.C. ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were (chenhong1212@ negatively associated with the methylation status in beef cattle (P , 0.05). A luciferase assay for the IGF2 263.net) intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P , 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro.
    [Show full text]
  • A Global View of Porcine Transcriptome in Three Tissues from a Full-Sib Pair
    Chen et al. BMC Genomics 2011, 12:448 http://www.biomedcentral.com/1471-2164/12/448 RESEARCH ARTICLE Open Access A global view of porcine transcriptome in three tissues from a full-sib pair with extreme phenotypes in growth and fat deposition by paired-end RNA sequencing Congying Chen, Huashui Ai, Jun Ren, Wanbo Li, Pinghua Li, Ruimin Qiao, Jing Ouyang, Ming Yang, Junwu Ma and Lusheng Huang* Abstract Background: Elucidation of the pig transcriptome is essential for interpreting functional elements of the genome and understanding the genetic architecture of complex traits such as fat deposition, metabolism and growth. Results: Here we used massive parallel high-throughput RNA sequencing to generate a high-resolution map of the porcine mRNA and miRNA transcriptome in liver, longissimus dorsi and abdominal fat from two full-sib F2 hybrid pigs with segregated phenotypes on growth, blood physiological and biochemical parameters, and fat deposition. We obtained 8,508,418-10,219,332 uniquely mapped reads that covered 78.0% of the current annotated transcripts and identified 48,045-122,931 novel transcript fragments, which constituted 17,085-29,499 novel transcriptional active regions in six tested samples. We found that about 18.8% of the annotated genes showed alternative splicing patterns, and alternative 3’ splicing is the most common type of alternative splicing events in pigs. Cross- tissue comparison revealed that many transcriptional events are tissue-differential and related to important biological functions in their corresponding tissues. We also detected a total of 164 potential novel miRNAs, most of which were tissue-specifically identified. Integrated analysis of genome-wide association study and differential gene expression revealed interesting candidate genes for complex traits, such as IGF2, CYP1A1, CKM and CES1 for heart weight, hemoglobin, pork pH value and serum cholesterol, respectively.
    [Show full text]
  • ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells
    ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Jiang, L., O. Wallerman, S. Younis, C. Rubin, E. R. Gilbert, E. Sundström, A. Ghazal, et al. 2014. “ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells.” PLoS ONE 9 (4): e94187. doi:10.1371/journal.pone.0094187. http:// dx.doi.org/10.1371/journal.pone.0094187. Published Version doi:10.1371/journal.pone.0094187 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12152887 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells Lin Jiang1, Ola Wallerman1, Shady Younis1,2, Carl-Johan Rubin1, Elizabeth R. Gilbert1¤, Elisabeth Sundstro¨ m1, Awaisa Ghazal3, Xiaolan Zhang4, Li Wang4, Tarjei S. Mikkelsen4,5, Go¨ ran Andersson3, Leif Andersson1,3* 1 Science for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala University, Uppsala, Sweden, 2 Department of Animal Production, Ain Shams University, Shoubra El-Kheima, Cairo, Egypt, 3 Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Uppsala, Sweden, 4 Broad Institute, Cambridge, Massachusetts, United States of America, 5 Harvard Stem Cell Institute and Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts, United States of America Abstract ZBED6 is a recently discovered transcription factor, unique to placental mammals, that has evolved from a domesticated DNA transposon.
    [Show full text]