ZBED6 Wild Boar X domestic pig intercross initiated 1989 the birth of a transcription factor in placental mammals X F1 X F1 Göran Andersson Swedish University of Agricultural Sciences ALLBIO- Scilife-UPPNEX-BILS course 15 May 2014 200 F2 A paternally expressed QTL affecting skeletal and cardiac QTL mapping of fatness traits in the Wild Boar muscle mass in pigs maps to the IGF2 locus intercross, a model for mild obesity in humans 30 Lean meat in ham •Strong selection for lean growth in commercial lines of 25 Lean meat mass in ham pigs has enriched for mutations reducing fat deposition 20 Longissimus muscle area 15 Heart F ratio 10 0.1% Average back fat depth • Wild boars have the capacity to store excess food as fat 5% 5 5% Birth weight 0 Abdominal fat • QTL analysis revealed two major loci on chr. 2 and chr. 0.1 % Genome wide significance 4 controlling a large proportion of the difference in fat 5 % Genome wide significance deposition between the Wild Boar and Large white 5 % Suggestive significance domestic pigs. Pig Chromosome 2 The QTL allele from domestic Large White pig increases muscle content with 3-4%, reduces subcutaneous fat and increase the size of the heart Comparative sequencing of TH-INS-IGF2 in pigs, human The paternally expressed IGF2 QTL has ”major” and mice phenotypic effects Trait W/W D/D % of variance % Meat in ham 63.6 67.3 30.6 Subcutaneous fat (mm) 27.2 24.7 10.4 Heart weight (gr) 226 244 14.4 4b VISTA-plot IGF-II gene structure • Ten exons, 1-7 non-coding • Four promoters, P1-P4 P1 P2 P3 P4 E1 E2 E3 E4 E4b E5 E6 E7 E8 E9 E7 - E9 are IGF2 Coding exons IGF2-AS * E5 E4E3 E2 E1 a b c E3 E2b d 30 kb Resequencing of 15 chromosomes classified as The QTN located in IGF2 intron 3 is part of an « Q » or « q » identified the Evolutionary Conserved Region Quantitative Trait Nucleotide (QTN) Pig.q CCTGCCCGCGGCGGCAGCCGGGCCGCGGCTTCGCCTAGGCTCGCAGCGCGGGAGCGCGTGGGGCGCGGCGGCGGCGGGGAG Pig.Q ..........................................A...................................... Bovine ..............TC..............................A.................................. Horse ...............G...C..T.......................................................... Dog ...............C......AT......................................................... Rabbit .......C.......G...C...............................A..............A.T............ Human .....T.C...T...G..TC...............................AG...A.........A.T....AG...... Mouse T......C.......T...T....C..A................G...TCT...............A.G............ Rat T......C.......C...C....C..A................G....CT...............A.G...A.T.....A 16 bp around the QTN is 100% identical among 18/18 placental mammals In#pigs#that#carry#the#muta1on…# Electrophore1c#Mobility#ShiE#Assay# !!!!!!Postnatally:# 20 C2C12 cell (myoblast) nuclear extracts 18 q Q # 14 10 Mutant •#36fold# !#of#IGF2% 6 Wild-type What#is#this#protein?# 1.5 * ##mRNA#in#skeletal# * ** IGF2/GAPDH 1 * ##muscle#and#heart,# 0.5 * 0 ##but#not#liver.# mRNA, fetal 3 w 2 m 4 m 6 m 3 w 4 m 3 w 4 m Muscle heart liver # Does!the!muta/on!affect!binding!with!some!transcrip/on!factor?! Wild boar (q) CTAGGCTCGCAGCGCGG Large white (Q) CTAGGCTCA CAGCGCGG Nature 425 (2003) Nature 425 (2003) Stable Isotope Labeling with AA in Cell Culture Identification of a novel protein! 13 C66L6Arg# Wild Boar (q) CTAGGCTCGCAGCGCGG Natural#isotopes# 13C6,#15N26L6Lys# Large white (Q) CTAGGCTCA CAGCGCGG Light# Heavy# nuclear#extracts# A# bead bead G# mutated# wildtype# Liquid Chromatography Mass Spectrometry (LCMS) PLoS Biology 7 (2009) ZBED6! ZBED6#belongs#to#the#hAT#superfamily# • Domes1cated#DNA#transposon## • Performs#important#func1ons#in#placental#mammals.## • Recently#iden1fied#novel#mammalian#transcrip1on#factor.# ZBED6 • Repressor#of#IGF2#P3#and#P4#transcrip1on#in#skeletal# muscle# hATC dimerization domain (Andersson#et#al.,!2010)(Van#Laere#et#al.,#2003)#(#Markljung#et#al.,#2009)# Zn2+ finger BED domain ZBED6! (hobo from Drosophila, Activator from maize and Tam3 from snap-dragon) Human Chromosome 1 PLoS Biology 7 (2009) Known!ZBED!Genes! Func/ons!of!other!ZBEDs! CD96 Intron 6 3 # DHRSX ZBED2! 5 • ZBED1#plays#an#important#role#in#cell#prolifera1on#and#regulates# Y # # Intron 1 # transcrip1on#of#DNA#pol#gene#and#different#genes#encoding# ZBED3! ZBED1! (Yamashita#et#al,#2003)# # ribosomal#proteins# # # ZBEDS! • ZBED3#binds#with#axin#and#is#involved#in#wnt/βcatenin#signaling# (Chen#et#al.,#2009)# Zc3h11a 1 22 Intron 1 # # ZBED6! ZBED4! • ZBED2#6>?# # # # ZBED5! • ZBED4#is#expressed#in#human#re1na#and#acts#as#regulator#of# # nuclear#hormone#receptor#(Saghizadeh#et#al.,#2009).# 11 # • ZBED5#(buster1/#charlie6like#transposon)#6>#?# ZBED!domains! Protein Tree BUSTER Family BE hATC D ZBED1 AC ZBED4 ZBED2 & 3 Family ZBED5 ZBED6 ZBED1 ZBED2 ZBED3 ZBED6#is#a#domes1cated#transposon#that#“hitch6hikes”# The DNA binding BED domain in ZBED6 is extremely well on#the#ZC3H11A#promoter# conserved among mammals bp ZBED6 ZC3H11A • Intron retention: ZBED6 • Normal intron splicing: ZC3H11A PLoS Biology 7 (2009) Immunohistochemistry shows that ZBED6 has a ZBED6 is an innovation in placental mammals broad tissue distribution during development and in adult mice and a nuclear localization ZBED6 ZC3H11A Efficient silencing of Zbed6 in mouse C2C12 ZBED6#is#enriched#in#the#nucleolus# cells ZBED6 Nucleophosmin Merge PLoS Biology 7 (2009) Luciferase assay provides conclusive evidence that ZBED6 is the Luciferase assay provides conclusive evidence that ZBED6 is the nuclear factor interacting with the CpG island in IGF2 intron 2 nuclear factor interacting with the CpG island in IGF2 intron 2 pIGF2 P3 Luciferase pIGF2 P3 Luciferase ZBED6 ZBED6 pIGF2 - q pIGF2 P3 Luciferase pIGF2 - q pIGF2 P3 Luciferase pIGF2 - Q pIGF2 P3 Luciferase pIGF2 - Q pIGF2 P3 Luciferase 45! ZBED6!siRNA!50nm! 40! 16! 35! 14! 30! 12! 25! 10! 20! 8! 15! 6! 10! 4! 5! 2! Rela/ve!Luciferase!Units,!firefly/renilla! 0! 0! P3!promoter! WildJtype! WildJtype! Mutant!185bp!Mutant!145bp! Rela/ve!Luciferase!Units,!firefly/renilla! P3!promoter! WildJtype! WildJtype! Mutant!185bp! Mutant!145bp! 185bp! 145bp! 185bp! 145bp! ZBED6#repression#is#not#promoter6specific# ChIP-sequencing reveals about 2,500 Zbed6 binding sites in C2C12 cells Mouse, myoblast 700 600 500 400 300 200 100 Relative luciferase units 0 SV40 + enhancer SV40 + enh + SV40 + enh + wild-type qTN mutant QTN Human, rhabdomyosarcoma 500 400 Units 300 200 Luciferase 100 0 Relative SV40 + enhancer SV40 + enh + SV40 + enh + wild-type qTN mutant QTN Zbed6 binds preferentially to the vicinity of start of Gene Ontology classifications show a striking over- transcription sites (TSS) and CpG islands representation of certain biological functions The results suggest that ZBED6 has an important regulatory role in placental mammals Figure!1.!RNA!sequencing!of!Zbed6Jsilenced!myoblast!cells.! How does ZBED6 mediate transcriptional regulation of downstream targets? ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!2.!Muscle!proteins!were!significantly!enriched!among!the!differen/ally!expressed!(DE)!genes.! Table!2.!Analysis!of!the!correla/on!between!differen/al!gene!expression!(DE)!a]er!Zbed6!silencing!and!the! presence!of!ZBED6!binding!sites!within!5!kb!of!the!transcrip/on!start!site!(TSS).! Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!5.!ZBED6!modulates!the!expression!of!Igf2!and!Myogenin!during!differen/a/on!of!C2C12!cells.! The mutation at the ZBED6 binding site at the CpG site in pig IGF2 intron 3 - does not alter the status of imprinting - does not lead to gross changes in DNA methylation patterns Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Figure!4.!Histone!modifica/ons!associated!with!ZBED6!target!sites!and!other!sites!in!C2C12!myoblast!cells.! # ChIP6seq#data#for#ZBED6#and#six#histone# modifica1ons#in#C2C12#myoblast#cells# ! Active promoters Enhancers Repression Average coverage Average Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) ZBED6 Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e94187. doi:10.1371/journal.pone.0094187 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0094187 Zbed6 Distance to Zbed6 binding sites ! G Model#for#ZBED6#func1on# IGF2 Wild boar ZBED6 Repressed state G GCTCG Chinese Meishan Mutation at Epigenetic Down- Loss-of- A target site activation regulation function Hampshire ZBED6 ZBED6 ZBED6 ZBED6 Active A X Me state Pietrain GCTCA GCTCG GCTCG GCTCG PLoS Biology 7 (2009) Acknowledgements Elizabeth Gilbert, Lin Jiang, Awaisa Ghazal, Shady Yunis, Carl-Johan Rubin, Ola Wallerman, Anna-Maja Molin, Rajesh Gupta, Elisabeth Sundström, Anders Lindroth, Göran Hjälm, Leif Andersson Broad Institute: Li Wang, Xiaolan Zhang, Tarjei Mikkelsen, Kerstin Lindblad-Toh, and the Broad Institute Epigenomics Initiative .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages11 Page
-
File Size-