INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter ftice. while others may t>e from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print t)leedthrough, substarxJard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to t>e removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.

Photographs included in the original manuscript have t)een reproduced xerographically in this copy. Higher quality 6" x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 800-521-0600 UMI*

GENETIC BIODIVERSITY AND EVOLUTION OF TWO PRINCIPAL FISHERIES SPECIES GROUPS, THE LABEINE AND TILAPHNE, OF LAKE VICTORIA REGION, EAST AFRICA

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

BY Wilson Waiswa Mwanja, B.Sc., M.S., PGDE, Cert. Limn.

*****

The Ohio State University 2000

Dissertation Committee: AppFQved by Professor Paul A. Fuerst, Adviser i2Q. Professor Ted Cavender Adviser Associate Prof. Allison Snow Evolution, Ecology and Organismal Biology Associate Prof. Patricia E. Parker Graduate Program UMI Number 9962435

UMI

UMI Microform9962435 Copyright 2000 by Bell & Howell Information and beaming Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.

Bell & Howell Information and beaming Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT

The study sought to establish the genetic status of the remnant populations of the two original native principal commercial species in the Lake Victoria Region; the tilapiine species that formed the basis of the lacustrine fishery; and the labeine, namely Labeo victorianus, that formed the basis of the riverine fishery. The genetic status of the two the two groups were contrasted and compared with the introduced congeners in the Lake Victoria region in case of tilapiine species and to the congeners from the neighboring waters outside Lake Victoria Region for the labeine, Labeo victorianus. The study investigated the general hypothesis that the introduction of non-indigenous species and recent limnological changes that have taken place in the various water bodies of Lake Victoria region resulted not only in ecological marginalization but also led to the depletion of the genetic diversity of the native species. The genetic structures of the remnant populations of the native species and the established populations of the introduced non-indigenous congeners were contrasted using molecular analysis. RAPD analysis was used for L. victorianus while both the RAPD and microsatellite analyses were used for the tilapiine species. Among Labeines, the only recorded native species in Lake Victoria and Lake Kyoga basins of the LVR, Labeo victorianus, showed no genetic depletion compared to its congeners. L. victorianus populations were highly subdivided but with relatively polymorphic populations. 63.6% of the RAPD marker variation was found to occur among populations compared to 34.4% within-populations. As a species, L. victorianus had more private alleles than either congeners or the characid and barbine (used as outgroups in the phyletic analysis of the remnant population relative to congeners). L. victorianus exhibited molecular variation equal to or more than that of its congeners. Among tilapiines the introduced tilapiine species, Oreochromis niloticus, the ecologically most dominant tilapiine in the region, was the most genetically variable and least subdivided. Oreochromis leucostictus, another of the introduced Oreochromis species, was the second to O. niloticus in variability but had the highest gene flow amongst its populations. The high migration rate was linked to the ability for O. leucostictus to traverse swamps better than the other tilapiine species in the region. The two native tilapiine species, Oreochromis esculentus and Oreochromis variabilis, were the least variable except in cases were the populations were coexisting with the introduced congeners. Populations of O. esculentus from Nabugabo lakes. Lake Kayanja, Lake Kayugi, and Lake Manywa, and one from Lake Kawi among Kyoga lakes were foimd to be the only extant ‘pure’ forms of this species in the wild. Among the O. variabilis populations there were no discernable patterns of differentiation by Lake Systems or sub systems as in other Oreochromis species. O. variabilis populations were apparently swamped by O. niloticus like alleles, and were found to be highly differentiated as independent units, and had the least gene flow between sub-populations. Among the populations of Tilapia zilli, originally most prevalent and widespread at the time of introduction, the species was sparse and restricted in distribution. The species was found to genetically highly subdivided, but with high within population genetic variation. The high within population genetic variation, despite the high differentiation among populations, was linked to genetic interaction with Tilapia rendalli, another of the introduced species. The results showed that there was genetic interaction between the introduced and the native species. Genetic swamping of the remnant native populations by the introduced species, especially by O. niloticus over the two native species was a major force in marginalization of the remnant native populations. On a macroevolutionary level our results fcimd the sister relationship between O. niloticus and O. esculentus questionable and in need of further phylogenetic analysis. The results justify a necessity for adopting molecular markers in monitoring changes in the fishery, as

in many species in the region, including some of the introduced commercial species, face similar predicaments.

IV To Samwiri K. Mwanja and Edisa Kinawa Nabirye ACKNOWLEDGMENTS

I am highly indebted to Professor Paul Fuerst for giving me the chance to study evolutionary genetics and conservation biology in his laboratory for the past six years. I am grateful for his funding of my studies, but most important for guiding me through quite a challenging area of study in an evolutionary interesting and unique biogeographic Lake Victoria region system, and oceans away from Columbus Ohio. I am grateful to my graduate studies committee. Professors Ted Cavender, Allison Snow and Patricia Parker, for their guidance, advice and the time they put in shaping my ideas and helping me in my approach to this dissertation. I am grateful to Dr. Les Kaufman of Boston University, for the interaction, advice and training he offered me during the course of my graduate studies. His advice and exchange greatly enriched my science foundation and gave me a deeper meaning and understanding of the need to conserve nature in general. My studies at Ohio State University started with the invitation from a stranger at the time, in the hallways of the Agriculture faculty at Makerere University, Professor David Hansen. Dave suggested that I should consider working with Professor Paul Fuerst on Lake Victoria fishes since I was interested in Fish Genetics, the choice that turned out to right and great for me. I am very grateful to Professor David Hansen, Dr Mark Erbaugh, James Haldeman, Francine Jasper and all those who were involved with the Agriculture Research Training Program, through your efforts, my experience at Ohio State University was rich, wonderful and productive. I am highly indebted to the best Secretary I have known, Mrs Jessica L. Siegman and vi her colleague Marsha K. Hronek - their secretarial services and adminstration in Molecular Genetics Department made stay in the Biological Sciences College and the graduate school academically satisfying and comfortable. This work was made possible by facilitation and advice from Dr. Ogutu- Ohwayo, Dr. John Balirwa, Dr. Fred Bugenyi, Mr. Sylvester Wandera and Mr. John Kamanyi of the Fisheries Research Institute (FIRI) at Jinja in Uganda; and Mr. Andrew Asila and Joseph Mwangi of Kenya Marine and Freshwater Fisheries Research Institute (KMFRI). I am indebted to my Lab colleagues for the exchanges we had, advice they gave me, and training, especially in molecular methods, over the course of my time in Professor Paul Fuerst's laboratory. I am especially grateful to Dr. Gregory Booton, Dr. Malcomb Schug, Dr. Porter Brady, Dr. Lizhao Wu, Dr. Jeannette Krieger and Dr. Wenrui Duan, all graduates from Professor Paul Fuerst’s lab since I joined in 1993. Their time and generosity greatly enriched my evolutionary genetics background. I would like to thank my field work crew, including Mr. Bob Amina, ‘Dr.’ All Katende, Mr. John Magezi, Mr. Fred Mugume, Mr. Brian Ddungu; and my research assistants in the field, Mr. Herbert Kigenyi Mwanja, Ms Dora Mutesi and Ms Juliet Mugala Waibi. I am indebted to Rosemary Fuerst for always urging me to the finish line during the many wonderful times I had in Paul and Rosemary’s place, and to Jackie and Dustin Kaufman for the hospitality and time spent together during my studies in Dr. Les Kaufinan’s lab at Boston University. Last but not least I am grateful for the unconditional support and understanding from my family, especially from my woman, Deborah Talifuna Kintu. I am sorry 1 had to be this far from home but I look forward to rejoining you. This work was made possible by funding from the Agricultural Research Training Program of the National Agriculture Research Organization and Makerere University of Uganda, a dissertation improvement award from the Rockefeller Foundation, and funding from the National Science Foundation (USA), the Pew Charitable trust and from The Ohio State University.

VII VITA

30, November, 1967 Iganga, Uganda.

P. O. Box 27573 Kampala - Uganda Phone: Oil 256 77 447 707

Education:

B.Sc. 1987/90 Makerere University - Botany and Zoology Kampala (Uganda)

PGDE 1990/91 Makerere University - Science Education Kampala (Uganda)

Cert. Limnology 1991/92 Institute of Limnology, Mondsee, - Fish and aquatic ecology Austrian Academy of Sciences, Austria.

MS 1993/96 The Ohio State - Zoology University, Columbus, (Fish population genetics) Ohio (USA)

Work Experience

Principal Geneticist 1998/00 Lake Victoria Environment Management Program LVEMP/FIRI Uganda Fisheries Research Institute (Jinja)

Graduate Teaching 1998/00 General Biology/ Molecular Genetics Associate Ohio State University

via Graduate Research 1993/00 Molecular Genetics Department Associate Ohio State University -Cichlid Conservation Genetics

Research Assistant 1992/93 Fisheries Research Institute -(Fish Population National Agricultural Research Organization Biologist) (FIRI - NARO)

Teaching Assistant 1992/93 Hydrobiology section -Zoology Department Makerere University

Research Officer 1991/92 Uganda Freshwater -(Fish Biologist) Fisheries Research Organization

Research Publications:

1. Mwanja W., Bugenyi F., Kaufinan L., Fuerst A.P. (1997). Genetic characterization of tilapiine stocks in the Lake Victoria Region, p33-34. In R.S.V.

Pullin, C.M.V. Casal, E.K. Abban, and T.M. Falk (Eds) Characterization of

Ghanaian tilapia genetic resources for use in fisheries and aquculture. ICLARM conf.

Proc. 52, 58p.

2. Fuerst, A.P.; Mwanja, W.; Kauânan, L.S.; Booton, G.C. 1997. Genetic phylogeography of introduced Oreochromis niloticus (Pisces: Cichlidae) in Uganda.

Tilapia Aquaculture; Proceedings of the Fourth International Symposium on Tilapia in Aquaculture (I ST AIV), Northeast Regional Agricultural Engineering Service,

Ithaca, 1, 87-96.

IX 3. Mwanja, W.; Booton, G.C.; Kaufinan, L.; Fuerst, A.P. 1996. Population and

stock characterization of Lake Victoria tilapiine fishes based on RAPD markers. In

E.M.Donaldson and D.D.MacKinlay, Aquaculture Biotechnology Symposium

Proceedings o f the International Congress on the Biology o f Fishes, pp 115-124.

4. Mwanja, W. and P. A. Fuerst. 1995. Conservation and development of Lake

Victoria Fishery: biodiversity and genetics. Proceedings o f ARTP Symposium on

Ugandan Agricultural Research, p. 7.

5. Paul A. Fuerst, Wilson W. Mwanja, Gregory Booton, Melissa, Mark Chandler and Les Kaufinan. 1995. {Abstract) RAPDs as nuclear gene markers of population structure and hybridization in Lake Victoria Cichlids Proc. 1995 Keystone

Symposium on Molecular Approaches to Marine Ecology and Evolution. Journal o f

Cellular Biochemistry 19B: 339.

6. Mwanja, W.; Chandler, M; Kaufinan, L; Fuerst, A.P. 1995. {Abstract)

Population structure and hybridization in fish: Lake Victoria Tilapia studied with

Random Amplified Polymorphic DNA (RAPD) markers. Ohio J. Sci. 95 (2) 7. Mwanja, W.; Kaufinan, L.; 1995. A note on recent advances in genetic

characterization of tilapia stocks in Lake Victoria Region. Afri. J. Trop. Hydrobiol.

Fish. 6, 51-53

Fields of Study

Major Field: Evolution, Ecology, and Organismal Biology

Specialization: Evolutionary Genetics and Conservation Biology

XI TABLE OF C ONTENTS

Page A bstract...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... viii List of Tables ...... xviii List of Figures ...... xxvi Chapters:

Introduction ...... 1 1. Management and conservation of Fisheries Genetic biodiversity in the LVR 6

1.1. Lake Victoria Region: Large lakes and their surroimdings minor water bodies as a natural laboratory for spéciation and evolutionary biology ...... 7 1.1.1 Lake Victoria Region ...... 7 1.1.2 LVR as a natural experiment...... 12 1.1.3 Current biodiversity status of the LVR ...... 14 1.1.4 Human influence on the Lake Victoria Region aquatic system ...... 16 1.1.5 Species extinction — exactly how much have we lost"? 17

xii 1.1.6 Genetic analysis ...... 20 1.1.7 Satellite lakes versus large lakes ...... 20

1.2 Tilapiine and Labeine Genetic Resources of Lake Victoria Region ...... 23 1.2.1 Synopsis ...... 23 1.2.2 Introduction ...... 24 1.2.3 Biogeography of LVR tilapiine species ...... 25 1.2.4 The history of Labeine fishes in the LVR...... 26 1.2.5 Tilapiine Species composition and Distribution ...... 26 1.2.6 The isolated and displaced ...... 30 1.2.7 The shrunk and native ...... 31 1.2.8 The restricted and exotic ...... 32 1.2.9 The expanded and introduced ...... 33

2. Ecological Genetics, Phyletic Relationship and Phylogeography ...... 36

2.1 Genetic differentiation and characterization of populations of ningu, Labeo victorianus, and two other species of East African Labeo (Pisces: Cyprinidae) ...... 37 2.1.1 Synopsis ...... 37 2.1.2 Introduction ...... 38 2.1.3 Study area ...... 40 2.1.4 Natural history and evolution of Labeo victorianus 42 2.1.5 Materials and Methods ...... 42 2.1.6 Data analysis ...... 46 2.1.7 Results ...... 47 2.1.8 Discussion ...... 54

XIII 2.2 Genetic phylogeography of introduced Oreochromis niloticus (Pisces: Cichildae) of Lake Victoria Region and Lake Edward-Albert System (Uganda - E. Afnca) ...... 56 2.2.1 Synopsis ...... 56 2.2.2 Introduction ...... 57 2.2.3 Methods and Materials ...... 59 2.2.4 Data analysis ...... 62 2.2.5 Results...... 63 2.2.6 Discussion ...... 71

2.3. The Genetic Peril of the Ngege, Oreochromis esculentus, in Lake Victoria Region following the Establishment of the Exotic Tilapiine Species...... 74 2.3.1 Synopsis ...... 74 2.3.2 Introduction ...... 75 2.3.3 Materials and Methods ...... 79 2.3.4 RAPD data analysis ...... 81 2.3.5 Results...... 82 2.3.6 Discussion ...... 89

2.4 Genetic Signature of Past Introductions of Nile Tilapia (Oreochromis niloticus) into the Victoria-Kyoga System, East Africa...... 92 2.4.1 Synopsis ...... 92 2.4.2 Introduction ...... 93 2.4.3 Materials and Methods ...... 95 2.4.4 Data analysis ...... 98 2.4.5 Results...... 98 2.4.6 Discussion ...... 103 xiv Genetic Population Structure using Microsatellite Loci Analysis ...... 106 Synopsis ...... 107

3.1 Genetic evaluation of the ecological dominance of Lake Victoria Region by Oreochromis niloticus using Microsatellite Markers...... 109 3.1.1 Introduction ...... 109 3.1.2 Materials and Methods ...... 112 3.1.3 Data analysis ...... 115 3.1.4 Results...... 116 3.1.5 Discussion ...... 131

3.2 Genetic Population Structure of Remnant populations of Oreochromis esculentus of Lake Victoria Region based on Microsatellite markers ...... 135 3.2.1 Introduction ...... 135 3.2.2 Materials and .Methods ...... 137 3.2.3 Data analysis ...... 141 3.2.4 Results...... 141 3.2.5 Discussion ...... 153

3.3 Analysis of the Genetic Population Structure of Oreochromis leucostictus populations of Lake Victoria Region ...... 156 3.3.1 Introduction ...... 156 3.3.2 Materials and Methods ...... 157 3.3.3 Data analysis ...... 161 3.3.4 Results...... 161 3.3.5 Discussion ...... 173

XV 3.4 Genetic Population Structure of Oreochromis variabilis of Lake Victoria Region, East Africa, based on Microsatellite M arkers...... 176 3.4.1 Introduction ...... 176 3.4.2 Materials and Methods ...... 178 3.4.3 Data analysis ...... 182 3.4.4 Results...... 182 3.4.5 Discussion ...... 193

3.5 Microsatellite analysis of Tilapia zilli and Tilapia rendalli populations of Lake Victoria Region, East Africa ...... 196 3.5.1 Introduction ...... 196 3.5.2 Materials and Methods ...... 198 3.5.3 Data analysis ...... 200 3.5.4 Results...... 201 3.5.5 Discussion ...... 213

4. Genetic Variability and Genetic Interaction Among species ...... 217

4.1 Comparison of the Genetic Population Structures of Lake Victoria Region Tilapiine species using Microsatellite M arkers...... 218 4.1.1 Introductions ...... 218 4.1.2 Materials and Methods ...... 220 4.1.3 Results ...... 222 4.1.3.1 Species subdivision and population difrerentiation ...... 222 4.1.3.2 Gene flow among populations within species 223 4.1.3.3 Phyletic relationships among population ...... 224 xvi 4.1.4 Discussion ...... 233 4.1.4.1 Cross amplification ...... 233 4.1.4.2 Microsatellite loci variability ...... 234 4.1.4.3 Population variability ...... 234 4.1.4.4 Phyletic relationships...... 235 4.1.4.5 Genetic interaction ...... 236

5. Molecular Biotechnology and Fishery Resources Management ...... 238

5.1 Adopting molecular biotechnology in management of Lake Victoria Region Fisheries Biodiversity ...... 239 5.1.1 History of molecular analysis in natural populations ...... 239 5.1.2 Appropriate molecular technology in management of Lake Victoria Region fisheries ...... 242

List of References ...... 249

XV» LIST OF TABLES

Table Page 1.1 Estimates of the number of cichlid fishes contained in the LVR satellite lakes based on our field survey data from 1990 to 1997 ...... 15

1.2 List of examples of genera extinct from the main Lakes Victoria and Kyoga but still extant in satellite lakes ...... 19

1.3. Preliminary Genetic analysis of cichlid fishes of satellite lakes’ species in comparison to similar species of the main lakes based on RAPD (for tilapiine species) and microsatellite markers (haplochromine species). Results are extracted from Mwanja (1996), Wu et al. (1997) and Wu (1999) ...... 22

1.4. Tilapiine species caught during the fishing survey of LVR from 1992 to 1997. Relative qualitative abundance is shown by number of the positive signs while absence of a species is indicated by number of the dashes. ON = O. niloticus, OE = O. esculentus, OL = O. leucostictus, OV = O. variabilis, TZ = Tilapia zilli, and TR = Tilapia rendalli...... 28

XVlIl 1.5 Trophic resource utilization and feeding ranges of LVR tilapiine species...... 30

2.1. Indices and sequences of the five primers used ...... 43

2..2 Species, populations and source and sample sizes (N). Abbreviations in parenthesis are prefixes of the labels for individuals from the respective populations as they appear in the cladogram and as labelled in the Professor Paul Fuerst’s DNA archive ...... 45

2.3 Number of bands generated by each of the five primers for each population and species sampled (1995) ...... 48

2.4. Number and proportion of unique bands (alleles), and percent level of polymorphic bands (loci), i.e., loci with alleles of a frequency of 0.95 or less ...... 48

2.5. Partitioning of molecular diversity of ningu populations, revealed by five primers, into within (Hpop/Hspp) and between [(Hspp -Hpop)/Hspp]. Population components and within-population molecular diversity of its congeners, L. coubie and L. horie...... 50

2.6. Within (Hw) and between (He) population gene diversity (heterozygosity) estimates. Wright’s measure of population subdivision (Fst), number of loci (L), for three ningu (Lva) populations (K, M, n) and within-population diversity for ningu congeners, L coubie (LC) and L. horie (L H )...... 51

2.7. RAPD primer index: Oligodeoxynucleotide 10-mer sequences ...... 62

XIX 2.8 RAPD Band sharing within and between the LVR O. niloticus populations (not bold) and similarity indices between populations derived from the band sharing proportions (in bold) ...... 64 2.9. Allele frequency population attributes for O. niloticus populations 66

2.10 Allele frequency population attributes for O. niloticus populations of the LVR...... 66

2.11 RAPD primer index: Oligodeoxynucleotide 10-mer sequences ...... 80

2.12. Number of RAPD bands that were amplified by specific primers for each population ...... 82

2.13 Number of population-specific (unique or private alleles) bands and proportion of polymorphic bands found in O. esculentus populations of Lake Victoria basin ...... 84

2.14. Proportional band sharing (below the bold diagonal) and similarity indices (above the bold diagonal) derived from the band sharing proportions between individuals ...... 85

2.15. Genetic distances between O. esculentus populations of Lake Victoria basin estimated band sharing proportions based on Nei (1972) with O. niloticus from Lake Victoria as the outgroup ...... 86

2.16. Proportion of unique alleles and polymorphic loci, and the mean gene diversity per locus and mean diversity per locus (Heterozygosity) within- populations for five O. niloticus populations ...... 99

XX 2.17. Estimated gene diversity (heterozygosity) between populations ...... 100

2.18. Mean genetic diversity indices (standard error given in parenthesis) for the five populations compared to the mean of the three Lake Victoria populations ...... 100 3.1. Populations sampled, basin of origin and the sample sizes used in the study ...... 113

3.2. Microsatellite primer sequences and reaction conditions for 10 loci 115

3.3. Diversity indices for microsatellite loci of Oreochromis niloticus populations in LVR ...... 118

3.4. F-statistics were estimated (Fwc) as in Weir and Cockerham (1984). Genepop (Version 3.1b). Number of populations detected: 15, number of loci detected 10 ...... 119

3.5. Diversity indices for populations of Oreoc/jrom/j m7o//cM5 ...... 121

3.6. Genic differentiation testing, Genepop (Version 3.1b) using Markov chain parameters: dememorization as 1000, batches as 50 and iterations a batch as 1000 ...... 122

3.7. Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis esculentus populations ...... 123

3.8. Unbiased estimates of Hardy-Weinberg exact P-values by the Markov chain method by Genepop (version 3.1b) for Hardy-Weinberg test, P-values are associated with Ho = Hardy-Weinberg equilibruim 124

3.9. Fst is estimated as in Weir and Cockerham (1984) for all loci using Genepop (version 3.1b): pairwise IIS for population pairs ...... 126

x x i 3.10 Populations and basin of origin together with the sample sizes used in the study ...... 138

3.11 Microsatellite primer sequences and reaction conditions for 10 loci used for Oreochromis esculentus...... 140

3.12. Diversity indices of microsatellite loci for Oreochromis esculentus populations in Lake Victoria Region ...... 143

3.13. F-statistics estimated as in Weir and Cockerham, Fwc (1984) using computer software program Genepop (version 3.1b). Number of populations detected: 11. Number of loci detected: 10...... 146

3.14. Diversity indices for Oreochromis esculentus populations from Lake Victoria region population based on MICROS AT 1.5 (Minch, 1996), computer software...... 146

3.15 Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis esculentus populations ...... 147

3.16. Intra class correlation using allele frequency for Oreochromis esculentus populations (F-statistics) based on Genepop computer software. F-statistics were estimated as in Weir and Cockerham (1984) ...... 148

3.17. Populations and basin of origin together with the sample sizes used in the study ...... 158

XXII 3.18. Microsatellite primer sequences and reaction conditions for 10 loci of Oreochromis leucostictus...... 160

3.19. Diversity indices for microsatellite loci of Oreochromis leucostictus in Lake Victoria Region based on MICROS AT 1.5 computer software program (Minch, 1996) ...... 163

3.20. F-statistics are estimated (Fwc) as in Weir and Cockerham (1984) for Oreochromis leucostictus populations based on intra class correlations using allele frequency by Genepop (3.1) computer software ...... 164

3.21. Diversity indices for Oreochromis leucostictus populations in Lake Victoria Region based on MICROSAT1.5 computer software (Minch, 1996)...... 166

3.22. Observed heterozygosity, private alleles, allele numbers, and number of loci studied for the 10 Oreochromis leucostictus populations ...... 167

3.23 Intra class correlation using allele frequency (F-statistics) for Oreochromis leucostictus populations based on Genepop (3.1) computer software. F-statistics were estimated (Fwc) as in Weir and Cockerham (1984) ...... 17

3.24. Oreochromis variabilis populations and basin of origin together with the sample sizes used in the study...... 179

3.25. Microsatellite primer sequences and reaction conditions for 10 loci of Oreochromis variabilis...... 181

XXIIl 3.26. Diversity indices for microsatellite loci of Oreochromis variabilis populations in Lake Victoria region based on MICROS AT 1.5 computer software program (Minch, 1996) ...... 184

3.27. F-statistics estimated as in Weir and Cockerham, Fwc, (1984) for Within Lake Victoria Region Oreochromis variabilis analysis using Genepop (version 3.1b). Number of populations: 6; Number of loci: 10 ...... 185

3.28. Diversity indices for Oreochromis variabilis populations in Lake Victoria region based on MICROS AT 1.5 computer software program (Minch, 1996)...... 187

3.29. Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis variabilis populations ...... 188

3.30 Oreochromis variabilis populations intra class correlation using allele frequency (F-statistics) based on Genepop (3.1) computer software. F-statistics were estimated (Fwc) as in Weir and Cockerham (1984) ...... 189

3.31. Lake Victoria region and Lake Albert populations of Tilapia zilli and Tilapia rendalli and their sample sizes...... 198

3.32. Microsatellite primer sequences and reaction conditions for 10 loci o f Tilapia spp...... 200

3.33. Diversity indices for microsatellite loci of Tilapia zilli from Lake Victoria Region ...... 203

XXIV 3.34. F-statistics for Tilapia zilli populations estimated (Fwc) as in Weir and Cockerham (1984) ...... 204

3.35. Diversity indices for Tilapia zilli and Tilapia rendalli populations in Lake Victoria Region based on MICROS AT 1.5 computer software Program (Minch, 1996) ...... 206

3.36. Number of loci, allele number, private alleles, observed heterozygosity for Tilapia zilli and Tilapia rendalli Lake Victoria Region populations.... 207

3.37 Fst for Tilapia spp populations estimated as in Weir and Cockerham (1984) using Genepop (version 3.1b); Pairwise IIS for population ...... 208

4.1 Microsatellite loci variability for Lake Victoria region Tilapiine Populations ...... 221

4.2 Microsatellite population variability for Lake Victoria region Tilapiine populations ...... 222

4.3 F-statistics for Lake Victoria region tilapiine species estimated (Fwc) as in Weir and Cockerham (1984) ...... 222

4.4 Number of migrants estimated using private allele method after Barton and Slatkin (1986). Values are corrected for sample sizes ...... 224

4.5 Oreochromis esculentus, Oreochromis variabilis and the exotic Tilapia rendalli populations and their congeners with which they coexist, and the most dominant of the congeners ...... 226

XXV LIST OF FIGURES

Figure Page

1.1. Map of Lake Victoria region showing the three main lake systems: Lake Victoria, Lake Kyoga, Lake Edward/George and adjoining Nilotic system comprising of Nile River, Lake Albert and Turkana ...... 9

1.2. A Map of Lake Kyoga system showing the main Lake Kyoga and Satellite lakes: 1. Nawampasa; 2-Muwuru; 3-Nabusejere; 4-Kiondo; 5-Naragaga; 6-Pachoto; 7-Kadiko; 8-Meito; 9-Kodiki; 10-Gawe; 11-Kochobo; 12-Kasago; 13-Opare; 14-AJama; 15-Semere; 16-Owapet; 17-Namumbya ...... 10

1.3. A Map showing Nabugabo lakes: Lake Nabugabo (1 ), Lake Kayanja (2); Lake Kayugi (3); Lake Manywa (4); and Koki lakes: Lake Mburo (5); Lake Kachira (6); Lake Kijanebalola (7) and Lake Nakivali (8) ...... 11

XXVI 2.1. Sample sites for Labeo victorianus: Majanji (1 ) and Kusa beach (2) of Lake Victoria. Bukimgu of Lake Kyoga (3); and for the sister species characid at Wanseko (4) of Lake Albert ...... 41

2.2. A cladogram of three populations of Labeo victorianus (Lva) which includes Majanji (M), Kyoga (n) and Kusa beach (K); one of Labeo horie, Labeo coubie and one of Barbus bynii...... 53

2.3. A dendogram of 11 Oreochromis niloticus populations based on Nei’s Genetic distance derived band sharing proportions. The dendogram was constructed using MEGA computer software ...... 69

2.4. A cladogram o f Oreochromis niloticus individuals from 11 populations: L. Victoria (vie), Kyoga lakes: L. Nakuwa (LN); L. Muwuru (LM), L. Kyoga (KO), L. Nawampasa (NW); and Lakes Nabugabo (NB), Edward (ED), Kachera (KC), George (GE), Mburo (MB) and Albert (AB) ...... 70

2.5. A cladogram o f Oreochromis esculentus individuals from Lake Victoria region based on presence/absence RAPD band data. The cladogram was drawn using PAUP (Swofford, 1991) computer software ...... 87

2.6. Dendogram based on Nei’s genetic distance measure for Oreochromis esculentus populations in Lake Victoria region relative to Oreochromis niloticus from Napoleon Gulf of Lake Victoria ...... 88

XXVII 2.7. Sites sampled for within Lake Victoria Oreochromis niloticus population analysis. Three sites within Lake Victoria: Napoleon gulf (1), Winam gulf (2), Kasensero Bay (3); one in Victoria Nile River at Namasagali (4); and one in Lake Kyoga at Bukimgu (5) ...... 96

2.8. A dendogram o f Oreochromis niloticus populations from three sites within

Lake Victoria (Napoleon Gulf, Winam Gulf and Kasensero Bay) and

one from Victoria Nile at Namasagali, and one from Lake Kyoga

at Bukimgu ...... 102

3.1. Phyletic relationships among Oreochromis niloticus populations of Lake

Victoria region based on Rst distance measure. Distances were calculated

using MICROS AT 1.5 computer software program and dendogram was

drawn using MEGA computer software ...... 128

3.2. Phyletic relationships among Oreochromis niloticus introduced populations of Lake Victoria region relative to the putative origin from Lakes Edward, George and Albert based on Fst distance measure using Lake Albert population as the root. Distances were calculated and phylogram was drawn using MICROS AT 1.5 and MEGA computer program respectively ...... 129

3.3. Phyletic relationships among Oreochromis niloticus introduced populations of Lake Victoria region relative to the putative origin populations of Lakes Edward, George and Albert based on proportion of shared alleles ...... 130 xxviii 3.4. Phyletic relationships among remnant populations of Oreochromis

esculentus in Lake Victoria Region based on proportion of shared

alleles (ps) standardized as l-(ps) ...... 150

3.5. Phyletic relationships among remnant populations of Oreochromis

esculentus based on Fst genetic distance measure ...... 151

3.6. Phyletic relationships among the remnant Oreochromis esculentus

populations of Lake Victoria region based on Rst genetic distance

measure...... 152

3.7. Phyletic relationships of the introduced Oreochromis leucostictus

populations relative to their putative origin populations from Lakes

Albert and George ...... 170

3.8. Phyletic relationships of the introduced Oreochromis /ewcostictus

populations of Lake Victoria region relative to conspecifics of putative

origins in Lakes George and Albert...... 171

XXIX 3.9. Phyletic relationships among introduced Oreochromis leucostictus

populations of Lake Victoria region relative to conspecifics from their

putative origins of Lakes George and Albert based on proportion

of shared alleles ...... 172

3.10. Phylogram of the remnant Oreochromis variabilis populations in Lake

Victoria region based on Fst genetic distance measure ...... 190

3.11. Phylogram of remnant populations of Oreochromis variabilis in Lake

Victoria region based on proportions of shared alleles ...... 191

3.12. Phylogram of the remnant Oreochromis variabilis populations in Lake

Victoria region based on Rst genetic distance measure ...... 192

3.13. Phylogram of Tilapia zilli populations in Lake Victoria region together

with their conspecific from their putative origin (Lake Albert) in relation

to Tilapia rendalli from Lake Nabugabo. The Phylogram was based on

Fst genetic distance measure ...... 210

XXX 3.14 A phylogram of populations of Tilapia zilli in Lake Victoria region and conspecific from their putative origin in Lake Albert in relation to Tilapia

rendalli from Lake Nabugabo. The phylogram is based on Rst genetic

distance measure ...... 211

3.15. A phylogram o f Tilapia zilli populations in Lake Victoria region together

with their conspecifics from their putative origin(Lake Albert) in relation

to Tilapia rendalli population from Lake Nabugabo. The phylogram

was based on proportion of shared alleles ...... 212

4.1. A phyolgram of Oreochromis species populations from Lake Victoria

region and their conspecifics based on Fst genetic distance measure ...... 227

4.2. A phylogram of populations of Oreochromis species in Lake Victoria

region and conspecifics from Lake Albert based on Nei’s genetic distance measure, Gst...... 228

4.3 Phyletic relationships among Oreochromis variabilis populations of

Lake Victoria region in relationship to a ‘pure’ representative population

of Oreochromis niloticus from Lake Albert, based on the proportion of

shared alleles (ps), standardized as ‘-ln(ps)’ ...... 229

XXXI 4.4. Phylogram of populations of Oreochromis esculentus and Oreochromis

niloticus from Lake Victoria region and Lake Albert based on proportion

of shared alleles (ps) standardized as ‘-ln(ps)’ ...... 230

4.5. A phylogram of select sample of ‘pure’ and hybrid’ populations of

Oreochromis niloticus, Oreochromis leucosticX\xs and Oreochromis

esculentus from Lake Victoria region and Lake Albert, based on

proportion of shared alleles between populations ...... 231

4.6. A phylogram of populations of Tilapia zilli from Lake Victoria region and their conspecifics from their putative origin of Lake Albert in relation to Tilapia rendalli from Lake Nabugabo. Genetic distances were based on proportion of shared alleles ...... 232

XXXII INTRODUCTION

Problem Statement The common to most African aquatic life, and that of many other water bodies elsewhere, has been the severe reduction in population sizes, division of original stocks into disjunct sub-populations within a water body and/or into isolated small populations into separate water bodies. Such fragmentation of the stocks is known to be accompanied by immediate reduction in genetic diversity through loss of allelic diversity, and in most cases is followed by long term loss of heterozygosity and overall polymorphism (Fuerst and Maruyma, 1986; Ryman and Utter, 1987). Rare alleles and phenotypically unique polymorphisms are especially vulnerable to rapid loss through genetic drift even without any specific selection pressure. Effects of random genetic drift are accelerated by reduction in population size and by population fragmentation driving the resultant sub populations into faster differentiation among units, while inbreeding and reduced or lack of gene flow among the independent units leads to increased uniformity within sub populations (Wright, 1978). Such phenomena make the continued existence of fisheries stocks in the wild precarious, more so in the face of the increasing fishing pressure and competition from exotic species introduced to bolster the ailing fisheries. In the Lake Victoria Region (LVR) the two native principal fisheries species groups collapsed in the 1950s, at the time when the fishery was beginning to be of major commercial importance in the region with expanded market and use of more efficient gears for exploitation (Ogutu-Ohwayo, 1990). In an effort to augment the fishery managers then sought to use non-indigenous species that have since

I dominated the fishery and are thought to have curtailed the recovery of the native species (Kudhogania and Chitamweba, 1995). In an effort to understand the genetic impact of the dramatic changes within the LVR and establish the evolutionary status of the remnant populations, we designed a genetics study based on molecular methods to investigate and establish the following ideas: 1. to what extent is population structiuing of native fishery species different fi-om that of the non indigenous species? 2. what is relationship between population size, spread/distribution and genetic diversity of tilapiines and labeines in the LVR? 3. does segregation into separate subunits play a major role in maintaining genetic variability in native species, and/or what is the role of satellite lakes in maintaining genetic diversity in the LVR? 4. are differences in structuring among the non indigenous species attributable to the level of genetic diversity in the putative origins of the respective species into the LVR?

RATIONALE OF STUDY The change in structure from a continuous single population to disjunct units, with little or no gene flow among units and to completely isolated units into independent water bodies, has put the native species in a situation of accelerated interpopulation differentiation among sub populations. Subdivision of the originally widely distributed populations of the native species is expected to result in loss of genetic variability within units through genetic drift, inbreeding and reduced genetic exchange between sub populations. There are two typical resultant structures, the shrunk and disjunct, and the shrunk and isolated. Interpopulation differentiation and loss of genetic variability within units is expected to be more extreme in the latter given that there is no chance of genetic interaction among populations in such a case. Based on earlier studies (Fryer and lies, 1972; Trewavas, 1983; Leveque, 1997) Tilapiine species have been found to hybridize readily and so in cases where closely related species coexist hybridization is expected to occur between such species. The 2 resultant genetic exchange between natives and introduced species may signal elevated genetic variability in populations that would have otherwise been predicted to be low in variability. Typically such a population would be quite distant from the ‘pure’ forms of that species. Introduced non-indigenous species are expected to reflect the genetic variability from their introduction histories as well as a representation of the genetic structure of their putative origins into the LVR given the fact that it has been only since the 1960s that these species got established in the region. Populations in LVR that originated from the populations that are ecologically dominant and of high genetic variability relative to congeners are expected to reflect the same structure in the LVR relative to their conspeciflcs and/or congeners. Based on the knowledge of the ecological trends and status of the LVR native fish species, the main goal of this study was to genetically model the differential impact of the ecological changes on the genetic variation of labeine and tilapiine populations in the region. Population shrinkage and subdivision within the main lakes was compared to the depleted metapopulation but with several isolated introduced populations within the minor water bodies. The specific objectives included the following: 1. to estimate the genetic variation within and between populations; 2. to assess the degree of population subdivision; 3. to estimate the amount of gene flow between populations, and among closely related species; 4. to estimate the phylogenetic relationship and phylogeography among populations and species; 5. to identify and explain the underlying processes (both ecological and genetic) driving the observed differences among populations, and species.

STUDY DESIGN Field work involved assessing the ecological status of the remnant populations of the native species, and the extent of establishment of the non- indigenous species. All major lakes in the LVR were surveyed together with a majority of the satellite lakes around the main lakes. For the purposes of this study 3 each independent water body, except Lake Victoria because of its size and the significant structuring within species established in the preliminary studies, was considered as containing a single panmictic population. For Labeo victorianus a population was considered as that caught in a particular river/stream adjoining the main lake and fi'om within the main lake but associated with a particular adjoining stream or habitat. L. victorianus breeds upstream and randomly, that the only clear physical separation among its individuals in the same lake was association to a specific stream or to their breeding grounds. Whether there was natal fidelity to specific streams/rivers or segregation along breeding grounds was also a focus of this investigation. Molecular analysis in the lab was designed to study individual populations and then compare the genetic structures of conspecifics and congeners. As comparison among species was the overall aim, molecular tools were standardized to allow comparison of data across species. In population genetic structure analysis a method that results in higher number of polymorphic loci across populations and species yields better representation of the genetic relationships of the populations/species studied. Two molecular methods were used, the random amplified polymorphic DNA (RAPDs) and microsatellite techniques were used. Both RAPD and Microsatellite technique yield markers that are highly polymorphic and of higher evolutionary rate compared to the other conventional markers (Avise, 1994). The fast evolution rate is of importance especially when you are looking at recent evolution. With the RAPD technique we were able to generate adequate number of bands (loci) which enabled us to compare such populations phylogenetically but not necessarily provide the genetic population statistics, especially in cases where sample sizes were small. RAPDs technique also allowed us to use cladistics with individuals as the taxa based on the highly variable and numerous band patterns generated by this technique. With the microsatellite technique we were able to generate more accurate population statistics for all populations where we had ample population sizes. The technique also allows for the phenetic estimation of the phylogenies based on population genetic distances. SIGNIFICANCE OF STUDY Riparian states of the LVR, like other African countries, are engaged in a search for resources that would boost their economies and support their fast growing populations. Fish industry is being targeted at a time when the major fish producing water bodies, such as Lakes Victoria and Kyoga, have already once been biologically over fished. Reduction in native commercial fishery production was a major factor that contributed to the introduction of non-indigenous tilapiine species and the ecologically ‘infamous’ Nile perch in the LVR (Fryer and lies, 1972, Ogutu-Ohwayo, 1990). The quest for economic growth and increase in demand for fish can be met with minimal damage to the biodiversity and ecosystems only if there is sufficient knowledge of the extant species and their relatedness within the wild. Aquaculture and supportive breeding through hatchery cultures are viewed as the only way to alleviate fishing pressure on the already stressed fisheries (LVEMP project, 1998). Aquaculture and hatchery supported fishery practices can be accomplished without further damage to wild stocks only if the decisions are based on scientific knowledge of what the wild offers as brood stocks. Central to this study was the identification, evaluation, and characterization of the remnant surviving populations of the original commercial species of the LVR as candidate brood stocks for aquaculture, hatchery stocks, and remnant native populations worthy of conservation efforts and government protection, and restoration purposes CHAPTER 1

Management and Conservation of Fisheries Genetic Biodiversity in LVR 1. Lake Victoria Region: Large lakes and their surrounding minor water bodies as a natural laboratory for spéciation and evolutionary biology

Lake Victoria Region The Lake Victoria Region (LVR) has long been considered a unique zoogeographical area (Fryer and lies, 1972; Lowe-McConnell, 1987). Among the characteristics that set it apart firom other localities is the concentration of the different freshwater lakes within the region in which each contains largely similar fish fauna especially at generic level (Kaufinan and Ochumba, 1993). Evolution appears to have repeated itself numerous times in the LVR, and some of these repetitive patterns are attributable to evolutionary parallelism, while others are probably the result of seemingly improbable but nonetheless real dispersal events among lake basins. According to the distribution of the extant fish species a more expansive lake with adjoining east-west rurming rivers is thought to have historically occupied the region (Greenwood, 1981). This historical system broke up following the tectonic earth movements and the volcanic activity that characterized the early history of the LVR to form the present lakes firom about 750,000 years ago up to as recent as 4000 years back (Greenwood, 1981; Lowe-McConnell, 1996; Johnson et al., 1996). The LVR is now comprised of five large lakes, Victoria, Kyoga, Edward, George and Kivu (Figure 1.1), each containing similar species groups that share a common origin (Greenwood, 1981). The lakes, though zoogeographically similar, are geologically, hydrologically and limnologically different fi'om each other. Each of the large lakes in the region is associated with surrounding minor 7 water bodies, from a few to several small lakes. We commonly refer to these small lakes aroimd large lakes as "satellite lakes" of the larger systems. There are a variety of satellite lakes in the LVR. Examples of satellite lakes include: the crater lakes of western Uganda around Lakes Edward and George; the swamp lakes of the Kyoga basin; the rifr valley lakes of Kenya and Tanzania; and the small lake systems such as those of Nabugabo, the Koki lakes and the lakes of the Yala system in Lake Victoria Basin. The main lake-systems are shown in Figure 1.1, the Kyoga lake system is shown in Figure 1.2 while Figure 1.3 represents Nabugabo lakes. Lato Kyoga Syatam

Figure 1.1 \ Map of Lake Victoria region showing three main lake systems: Lake Victoria, Lake Kyoga, Lakes Edward/George and the adjoining nilotic system comprising of Nile River. Lakes Albert and Tmkana y----- soNon

C b i s i n a

o

l J \^.P 4lllS 4 t SW4MP

KAMMLI 20

Figure 1.2 a Map of Lake Kyoga syslem showing die inain Lake Kyoga and salcllile lakes: 1 -Nawampasa; 2-Muwuiu; 3-Nabusejere; 4-Kiondo; 5-Naragaga; 6-Pachoto; 7-Kadiko; 8-Meiio; 9-Kodiki; lO-ûawe; tl-Kochobo; 12 Kasago; 13 Opare; 14-Ajama; 15-Scmere; 16-Owapel; 17-Namumbya %

1WKM

m g

L Edward

/ I

Figure 1.3 A Map showing Nabugabo lakes: Lake Nabugabo (1), Lake Kayanja (2); Lake Kayugi (3); Lake Manywa (4); and Koki lakes: Lake Mburo (S); Lake Kachiia (6); Lake Kijanebalola (7) and Lake Na^vali (8)

11 LVR as a natural experiment The differences in geology, hydrology and limnology of different lakes of the LVR present contrasting conditions that offer different challenges and opportunities for scientific exploration and inquiries into fish faunal evolution and trends in the historical limnology of the region. Most of the lakes in the LVR are of recent origin and are characterized by a history of dramatic changes, brought about most importantly by volcanism and/or long spells of complete drying up. The largest of the lakes in the region. Lake Victoria, is known to have been formed about 750,000 years ago and geological evidence indicates that it has gone through at least one, and probably several long cycles of completely drying up and then refilling (Johnson et al., 1996). Johnson’s group found that the last time of drying for Lake Victoria is thought to have occurred as recently as 14,000 years ago, and lasted for an estimated 2000 years. Based on the fish fauna similarities and distribution. Lake Edward is thought to have been more expansive than its present size, one that possibly stretched farther east as to the shores of the current position of Lake Victoria (Kaufman, pers. comm). Lake Edward history makes it a possible source of progenitor of fish species that reinvaded Lake Victoria after the last dry spell. With the volcanism. Lake Edward is believed to have receded and finally broken up into the Lakes George, Kivu, the current Edward, and several satellite lakes. The history of Lake Kyoga is quite different. Lake Kyoga has a mean depth of only three meters and is a massive swampy area thought to have been turned into a lake when the outflow connecting Lake Victoria to the Nilotic water system filled a shallow trough on the course of River Nile to the north. The variety of lake geological situations and histories presents an interesting scientific challenge in understanding the relationships among the water bodies and among their associated flora and fauna. The challenge is increased by the apparent similarity in fish species composition among lakes of the LVR. One of the intriguing facts about the fish faima diversity of the African Great Lakes regions is the enormous adaptive radiation of cichlid species and the high endemism associated 12 with each of the lakes (Fryer and lies, 1972; Greenwood, 1991, Lowe-McConnell, 1996). The estimates for Lake Victoria alone are that over 500 species have evolved within the lake in only 12,000 years since the lake’s last major dry spell (Seehansen, 1996; Kaufman, 1997; Kaufman et al., 1997). The recent evolutionary history of the fishes in the LVR presents an opportunity rarely found in other natural faunal systems. In the case of the LVR cichlids the opportunity exists to examine the phylogenetic linkages with ancestral taxa that are actually still extant. In most cases evolutionary relationships must be reconstructed from extant species and through fossil remains of ancestral forms in what is often a very patchy or absent fossil record. The enormous and repetitive adaptive radiation of the haplochromine cichlids into the numerous ecological habitats presented by various water bodies in the LVR, while maintaining their basic body plan, allows scientists to study phenomena such as morphogenesis along phyletic lineages. The ability to generate vast number of morphotypes with little or no genetic change is an issue that has formed the basis of our research involving the cichlid fishes (Fuerst and Kaufrnan, the NSF cichlid conservation genetics project - 1992). Earlier studies characterized LVR haplochromine cichlid fishes as being genetically depauperate in genetic variation (Sage et al., 1984; Meyer, 1990). Also studies based on morphology have found that despite the enormous ecological and morphological radiation found among haplochromine species they still retain the similar basic body plan or as commonly referred to same ‘bauplan’ (Fryer and lies, 1972, Greenwood, 1981; Stiassny, 1991, Kaufrnan, 1997). As such we were interested in contrasting the spéciation mechanisms of the genetically depauperate yet morphologically radiant species (haplochromine cichlids) to species in the region that are genetically diverse yet not as radiant (Tilapiine cichlids). Our interest was geared toward investigating how organisms adjust morphologically to changing habitats over very short but volatile evolutionary time scales (Mwanja, et al., 1999; Mwanja, et al, submitted). In addition, the circumstances in the LVR present the possibility to correlate the limnological and 13 geological history of the region with the history inferred from the relationships derived from the phylogeny among species of the different groups and water bodies.

Current biodiversity status of the LVR A collection of fish species that was made during the initial study visit to Lake Nawampasa, one of the Lake Kyoga basin satellite lakes, revealed occurrence of species that were reported to be extinct or rare in the LVR (Greenwood, 1981; Kaufrnan, 1992; Mwanja et al., submitted). The study also revealed morphs that were equivalent or similar to some of the extinct cichlid taxa of the main lakes (Kaufrnan et al. in prep). As a consequence of these observations, a study was designed, that included making fish species collections from the various representative satellite lakes in region (Table 1.1). Effort was made to cover all types of habitats and seasons, taking into account both the diurnal and annual variations in weather and habitat types. The capture of fish specimens involved setting a fleet of 10 gillnet panels ranging in mesh size from 0.5 inches to 5.0 inches by the shoreline, a fleet at 20 m from the shore and one fleet offshore. These mesh size range was found to be appropriate for both haplochromine and tilapiine groups of fishes. The set fleets of gillnets were checked for the catch at regular intervals throughout the day. The duration of the fishing depended on the fauna content, variability of habitats within the lakes and size of the lakes. In locations were the catch was poor the nets were left for the overnight catch, while in some cases where species were rare we conducted repeated sampling over several days, across all the possible microhabitats of the targeted species.

14 Hapiocromines Tilapiines Nile perch Lake Victoria Basin Species number Species number Rel. abundance Main Lake Native Introduced Lake Victoria >200 I Dominant Nabugabo lakes Lake Nabugabo <5 0 4 Dominant Lake Manywa <5 1 0 Absent Lake Kayanja <5 1 2 Absent Kioki lakes Lake Kachera >20 I 4 Absent Lake Kijanebalola >20 1 4 Absent Lake Mburo >20 1 4 Absent

Lake Kyoga Basin Main Lake Lake Kyoga <50 0 Dominant Satellite lakes Lake Nawampasa >60 2 3 Absent Lake Lemwa >50 2 2 Absent Lake Bisina >30 2 4 Rare Lake Nyaguo >50 2 2 Absent Lake Nakuwa <5 0 4 Dominant Lake Nyasala <30 1 4 Dominant

Lake Edward-George System Main Lakes Lake Edward ~50 3 2 Absent Lake George >40 3 1 Absent Satellite lakes Lake Saka >30 0 1 Absent Lake Kabaleka >40 3 1 Absent

Table 1.1. Estimates of the number of cichlid species contained in the LVR satellite lakes based on our field survey data fi'om 1990 to 1997. The table also shows the occurrence of the Nile perch, Lates niloticus in LVR.

15 The human influence in the Lake Victoria Region aquatic systems

The introduction of Nile perch and non-indigenous tilapiine fishes beginning in the 1930s up to the mid 1960s into the LVR left little refuge for the native fish species, especially in the main lakes (Trewavas et al., 1985, Barel et al., 1985, Kudhongania and Chitamweba, 1995). This loss of refuge for native species happened at a time of heightened fishing pressure that also contributed to the collapse of the native commercial species (Balirwa, 1992; Kaufinan and Ochumba, 1993; Craig, 1992). The native commercial fishes primarily included the only two native tilapiine species and a number of native predatory fish species such as lungfish and catfishes in Lakes Kyoga and Victoria. The collapse of the native fishery also overlapped a time of limnological changes in the lake, from a predominantly diatomous ecosystem to one that is currently blue-green algae (cyanobacteria) dominated (Ochumba and Kibara, 1989; Hecky and Bugenyi, 1992). Supplanting of the native tilapiine fishery by that of Nile perch and Nile tilapia could be argued to have been good for the economics of the fishery since these two species have so far performed as they were intended to do (Ogutu-Ohwayo, 1990). The two species were arguably brought in to transform the commercially ‘redundant biomass’ into edible and profitable fish (Fryer and lies, 1972). The success the Nile perch and Nile tilapia on the other hand has been given as the primary cause for the loss of hundreds of haplochromine species (Trewavas et al., 1985, Barel et al., 1985; Witte et al., 1992; Kaufman, 1992). The analysis of the content of the satellite lakes in the ecological survey we conducted (Kaufman et al., in prep., Mwanja et al, submitted) represents hope for the lost species. Several satellite lakes in the LVR were found to contain many of the endangered and/or extinct groups of the main lakes. Only in a few of the minor lakes (such as Lake Nabugabo in the Victoria Basin and Lake Nyasala in Lake Kyoga Basin) was the Nile perch able to successfully get established and to exert its ‘extinction machinery’ on the endemics (Kaufinan and Ochumba, 1993). In some of 16 the minor lakes, such as Lake Bisina in Lake Kyoga Basin, the Nile perch flourished at first following its introduction, but has since been knocked back by selective fishing mortality and/or recent changes in the limnology in these small water bodies (Mwanja et al., submitted). High fishing pressure and the invasion of the water hyacinth also brought down the numbers of the Nile perch in some areas of the large lakes, making the waters where the Nile perch collapsed a haven for the resurgence of many of the original native cichlid species (Twongo, pers. comm.). Such situations provide us with natural experiments on the mechanisms of cichlid spéciation and/or other factors that have been thought to have led to the resurgence of fish species in the LVR as a whole. Together with new data on the evolutionary history of the species of the LVR, information about the changing limnology, and the hydrological history of the region we may be able to clarify some of the contentious issues pertaining to evolutionary theories and how new species are derived from existing forms. The numerous satellite lakes surrounding the large lakes, the vast number of species, human influence, and the recent history of the LVR provide us with a great opportunity and challenge to scientifically unravel the confusing picture presented to us by nature.

Species extinction — exactly how much have we lost?

Despite its young age. Lake Victoria is estimated to have contained over 500 species of cichlids prior to changes in the lake caused by human activity that have taken place during this century (Seehausen, 1996; Kaufinan, 1997). It is estimated that these changes resulted in the extinction of nearly two hundred species, with more species found to be at a great risk of extinction with every expedition made to the lakes (Witte et al., 1992). Unfortunately, large portions of the extant cichlid fauna in the LVR remain undescribed, as was the largest portion of the extinct taxa. The continued changes in the lake ecosystem have put increased urgency on the need for studies to assess what is left in the wild. This urgency exists even if 17 there is no reprieve for many of the most endangered species. We must at least try to tap the invaluable evolutionary information contained in the species that may be going extinct at a rate greater than we can currently study them. Some solace can be taken from the knowledge that some of the rarer forms may not yet be lost. The satellite lakes such as the Kyoga lakes in central Uganda have a wide variety of species which include both known species and several undescribed species that seem to be sister species to some that are known to be extinct from the main lakes (Kaufman et al. in prep). For example, we have discovered the scale-eating haplochromines of the genus Allochromis, thought to be endemic to Lake Victoria, alive and well, though extremely imcommon, in the Kyoga lakes. The examples of the extant species/genera obtained in surveys of the satellite lakes are shown in Table 1.2. Some of the satellite lakes, such as the Nabugabo lakes contained only a small number of species. Others, such as the satellite lakes around Lake Kyoga had a wide variety of taxa, which included both known species and several undescribed species. We found that these species (Mwanja et al., in press) were ecologically equivalent and relatively close in general morphology and dentition to species or genera reminiscent of the main lakes before the establishment of the Nile perch (Greenwood, 1981; Kaufman and Wandera, in prep). A few groups, such as Astatoreochromis allaudi, Pseudocrenilabrus victoriae, and species of the genera Astatotilapia and Paralabidochromis, were widely distributed both in the main lakes and in the satellite lakes. Most of the piscivorous cichlids, such as species of the genera Harpogochromis, Psammochromis and Prognathochromis, were restricted to only a few satellite lakes, but also had a few of their species widely distributed among the satellite lakes. Among the native tilapiine cichlids of the LVR, we found significant populations of the two native forms, Oreochromis esculentus and Oreochromis variabilis, in several of the satellite lakes. The former of the two species was displaced completely from the main lakes while the latter was extant in the Lake Victoria but as disjunct small pockets of individuals around enclosed bays or at the mouths of rivers adjoining Lake Victoria (Mwanja, 1996). 1 8 Taxa Occurrence Main Lakes Satellite lakes Allochromis Extinct present (Kyoga lakes) Harpogochromis Extinct present (Nabugabo, Kyoga, and Koki lakes) Astatotilapia latafisciata Extinct present (Kyoga lakes) Prognathochromis Extinct present (Nabugabo, Kyoga and Koki lakes) Lipochromis Extinct present (Kyoga lakes) Piscichromis Extinct present (Kyoga lakes) Haplochromis annectendensAbsent rare (Nabugabo lakes) Haplochromis obliquidensExtinct absent Haplochromis lividis Extinct absent Tridontochromis Extinct only one extant species (Kyoga lakes) Prognathochromis perrieriExtinct absent

Table 1.2. List of examples of genera extinct from the main Lakes Victoria and Kyoga but still extant in satellite lakes.

Although studies during the 1980's and early 1990's revealed no marked genetic differences between various Lake Victoria haplochromine species, microsatellite markers designed for the LVR haplochromine cichlid species in our laboratory (Wu, 1999), differentiated populations and species even at a very fine scale (Wu et al., 1999). These microsatellite markers were in addition useful in the

19 phylogenetic analysis of cichlid species of the LVR (Wu, 1999). The phylogenetic analyses are important to our understanding of the evolutionary and hydrological processes that have shaped the LVR system. For example the ability to determine whether the cichlid species of the satellite lakes are of recent origin or instead reflect longer historical changes will depend on our ability to discern the phylogeny of cichlid species in the LVR. Conservation of the aquatic biodiversity of the LVR will also require phylogenetic knowledge of the endangered or rare species, and the establishing of the relationships among extant evolutionary and ecological groups.

Genetic analysis

Molecular analyses of the haplochromine cichlid species of the LVR done by Wu (1999), revealed that there was strong population structuring, with differentiation between the remnant populations within the main lakes and between the main lakes and associated satellite lakes. All species, both the wide spread and restricted forms, were subdivided. Migration was estimated to be highest within lakes and least between the totally isolated satellite lakes (Wu et al., 1999). The majority of species exhibited high within population heterozygosity and allelic diversity (Table 1.3). The genetic diversity has not been depleted in cichlid species with the majority of it found between populations compared to within populations. In Mwanja (1996) and Mwanja et al. (1995) genetic analysis of tilapiine populations in the region showed evidence of genetic interaction between the native and introduced species. Populations of all tilapiine species in the region were found to subdivided but the tilapiine swamp forms such as Oreochromis leucostictus were less differentiated than the more strict lacustrine species like O. esculentus.

Satellite lakes versus large lakes

On the macroevolutionary level, a question of major interest was the role of satellite lakes in the evolution of cichlid fishes in the LVR. The eventual goal was to

2 0 answer the question whether the satellite lakes were residual ponds left behind with large portions of the diversity as the originally expansive large lakes receded during the extensive desiccation periods? Alternatively, were satellite lakes nursery beds for cichlid species that acted as lifeboats during periods of desiccation and later fed their trapped fauna back into the large lakes? The issue of evolution and diversity of cichlid fishes in these minor lakes was first considered by Greenwood in several of his papers (Greenwood, 1965, 1974 and 1981). Among the satellite lakes on which Greenwood worked were the Nabugabo lakes west of Lake Victoria. Greenwood found these minor lakes not to be as speciose as Lake Victoria but containing sister taxa to those in the larger lakes. Greenwood concluded that minor lakes acted as nursery beds that generated ‘prototypes’ that later moved into the larger systems. The recent discovery in satellite lakes in the LVR of cichlid fauna equivalent to portions of the extinct species of the main Lakes Kyoga and Victoria, led us into speculation of a broader, and rather different role for satellite lakes than Greenwood ( 1965 & 1974) envisioned. Minor satellite lakes act both as nursery beds of prototypes for the big lakes and may generate species through allopatric isolation and local selection regimes at the same pace, but on a smaller scale, as the large lakes. Meanwhile, their sheltered habitats offer protection to species equivalent to those in the greater systems from the anthropogenic changes that the big lakes have been experiencing. We think the small lakes have often been part of the ontogenetic spéciation cycles o f big lakes (Kaufrnan, 1996). Remembering that this is so may help explain some of the faimal peculiarities of these systems. On a long-term scale, tracing the impact of the limnological changes on particular fish species and on the overall fish biodiversity could be enhanced by studies of these various satellite lakes. Any connection identified could then be extended to the big lakes, and used to monitor changes that may be threatening to part of the faima. Because satellite lakes are small, variability in limnology is expected to be lower than in the main lakes, which makes small lakes easier to sample and analyze. Satellite lakes are expected provide good reference points concerning changes that may have occurred over wider parts of the LVR. Practically, satellite 21 lakes offer management options with respect to the simultaneous management of fisheries and preservation of species biodiversity, since they can be closed to fishing and easily monitored.

Genetic attribute/ Polymorphism Heterozygosity Allelic diversity Population Subdivision Tilapiine Complex Native O. esculentus Higher Higher Higher Higher O. variabilis Equivalent Equivalent Higher Higher Non indigenous O. leucostictus Higher Higher Higher Lower O. niloticus Lower Lower Higher Higher T. rendalii Equivalent Lower Higher Higher T zilli Equivalent Higher Higher Equivalent Haplochromine complex Haplochromine sppHigher Higher Higher Higher A. alluadi Lower Equivalent Equivalent Higher Astatotilapia spp Higher Higher Higher Higher

Table 1.3. Preliminary Genetic analysis of cichlid fishes of satellite lakes species in comparison to similar species of the main lakes based on RAPD (for tilapiine species) and microsatellite markers (for haplochromine species). Results were extracted from Mwanja (1996), Wu et al (1997), and Wu (1999).

2 2 2. Tilapia and Labeine Genetic Resources of Lake Victoria Region

SYNOPSIS

Tilapiine cichlids in the Lake Victoria Region (LVR), as elsewhere in the tropics and subtropics, have been subject to repeated introductions and transplants, throughout the region in both minor and major lakes. In the LVR, the results have been dramatic changes in species composition and population structure of the tilapiine species assemblages, with consequent displacement of the native forms and genetic interaction among the native and non-indigenous species. Among the Labeine species in the LVR, ningu {Labeo victorianus) has gotten the most attention but there are other species in the region that may be undergoing similar adverse situations. Ningu, once the main riverine fishery species in LVR is no longer landed commercially and currently is considered to be endangered. In both Labeine and Tilapiine groups, native species have become marginalized and currently exist as disjunct populations in the LVR. The resources of Labeine and Tilapiine species in the LVR are reviewed. Ecological survey and genetic data combined with laboratory studies of the feeding kinematics and behaviour of the tilapiine species, offer perspectives on mechanisms imderlying the replacement of native by introduced species. The ecological and genetic implications of these changes should form the basis of adaptive conservation and management activities now scheduled for the region.

23 INTRODUCTION

The increased food and economic importance of commercial fishing in the LVR on the backdrop of drastic changes in the region's aquatic environment and the displacement of the native species are the reasons for instituting these studies. The tilapiine species, especially those of the genus Oreochromis, rank among the leading species in the world in the frequency with which they have been moved either for aquaculture use or for introduction in the wild to boost the natural fisheries. Beginning in the 1950’s, non-indigenous tilapiine species and Nile perch were introduced into Lake Victoria to augment the declining tilapia stocks of the lake (Fryer and lies 1972, Ogutu-Ohwayo 1990). The result was severe population shrinkage of one of the native forms. O. variabilis, that was the minor part of the traditional fisheries, into disjunct small population units in the main lakes. The major component of the native tilapiine fishery, the ngege {O. esculentus) was completely displaced from the main Lakes Victoria and Kyoga. The only natural réfugia for this previous highlight of the regional fisheries have been isolated populations foimd in several satellite lakes aroimd Lakes Victoria and Kyoga. The remnant populations of O. esculentus unfortimately occur together with several of the other non-endemic species, although almost never with the Nile perch, which had a negative effect on the presence of native forms. Prior to the inception of a commercial fishery in Lake Victoria and Lake Kyoga basins, it was that recorded that a scoop of water with a fishing basket was sufficient to bring ashore a load of table size ngege, O. esculentus, and/or its native congener O. variabilis (Graham, 1927). Fiber gillnets were introduced with the start of commercial exploitation on a large scale in the early part of the 20'*’ century. Later on nylon gillnets and beach seines became the choice for fishing gear in LVR. All this occurred at an inopportune time when the main lakes were undergoing major drastic changes in their nutrient dynamics and algal composition. Lake Victoria is

24 noted to have changed from a predominantly diatomous lake to a lake dominated by blue greens and frequent algal blooms (Hecky 1993, Muggide 1993, Lehman 1996). Our objective was to establish the ecological and genetic status of the native forms and to assess the extent of establishment of non-indigenous species in LVR. We also sought to highlight the importance of satellite water bodies in preserving the remnant biodiversity of the native tilapiine species. The studies are part of a regional and international effort to evaluate, conserve and restore the original native cichlids of Lake Kyoga and Lake Victoria basins.

Biogeography of LVR tilapiine species LVR fishery is mainly that of the cichlid species with a sizeable cyprinid complement and relatively minor component of other species such as limgfishes, mormyrids and catfishes (Greenwood 1966). Taxonomically the two major groups of the cichlids (tilapiine and haplochromine) are well represented in the LVR. The haplochromine group in the LVR, like in Lake Malawi and Lake Tanganyika, is known for its enormous diversity, and is in contrast to the tilapiine group, which is naturally far less diverse and represented only by a few native species. In Lake Victoria and Lake Kyoga basins only two species, Oreochromis esculentus (G.) and Oreochromis variabilis (B.) are endemic tilapiine species. Other tilapiine species in LVR include Nile tilapia, Oreochromis niloticus (L.), a native to Lakes Edward and George in LVR and Lake Albert. Nile tilapia has been repeatedly transplanted and introduced almost in all available water bodies in LVR. Another is Oreochromis leucostictus, a non-indigenous species introduced from Lake Albert along with Tilapia zilli. Oreochromis spirulus nigra, that was endemic to Lake Naivasha imtil it was swamped out by O. leucostictus and O. niloticus (Leveque, 1997), was introduced in a number of other water bodies in the LVR in the early 1900s. But has been supplanted by the two congeners that extirpated from its native habitat. Tilapia rendalii, an exotic species in the LVR, was introduced from Congo ponds (EAFFRO reports)

25 The history of Labeine fishes in LVR. Two species of the Labeine group exist in Lake Victoria and Lake Kyoga basins, Labeo victorianus (locally know us ningu) and Labeo forskhalii a minor component only found out recently. The two are currently believed to have been part of the fish faima of Lakes Kyoga and Victoria (Kaufinan pers. comm.) but the latter seems to have been totally missed in the earlier reports by Greenwood (1966). In our latest collection an expert on Labeo taxonomy identified two of the specimens caught in the Victoria Nile as belonging to Labeo forskhalii rather than ningu which Greenwood reported as the only Labeine species in that area. Labeo forskhalii is insignificant in population size even in Lake Edward where Greenwood (1966) recorded it to occur naturally. Since L. forskhalii was not commercially significant and naturally rare in the LVR, it may be more endangered than even ningu. Other labeine species foimd close by are Labeo coubie and Labeo horie, in Lake Albert. Unfortunately, the evolution and phyletic relationships of the labeines are still uncertain due to the ecoplasticity, interspecies overlap and plesiomorphic nature of the morphological characteristic among labeine species (Reid, 1985).

Tilapiine species composition and distribution. In Lake Victoria Region both in the main lakes and satellite minor water bodies the non-indigenous species make the largest part of the fishery of the region (Table 1.1). Most fi'equently encountered and currently forming the mainstay of the fishery in the region is O. niloticus especially in the main lakes. In all water bodies our survey unveiled four species of the genus Oreochromis and two of genus Tilapia. One species of genus Sarotherodon was only found in Lake Albert were it has been recorded to occur naturally in the Bugoigo lagoons by Lake Albert (Greenwood 1966). O. esculentus was found exclusively in satellite water bodies while O. variabilis was found within Lake Victoria and Victoria Nile as small disjunct pockets of individual in the main lakes as well as in several minor satellite lakes within the Lake Kyoga basin.

2 6 Intermediate morphs especially between O. niloticus and O. esculentus were caught in many of the lakes in which congeners coexisted including O. leucostictus and O. esculentus, O. niloticus and O. variabilis, and between the two introduced species of the genus Tilapia, T. zilli and T. rendalii. O. niloticus was the most abundant and widely distributed in Lake Victoria region and it formed by far the largest part of the fishermen’s catch. Native species, O. esculentus and O. variabilis were found to be dominant only in a few of the satellite lakes.

27 Species/ ON CE OL OV SG T Z TR Victoria(main lake) +++ - ++ + ++ -i- Wamala (isolated lake) Nabugabo lakes Nabugabo Kayanja Kayugi Manywa Species/ ON OE OL OV SG TZ TR Kioki lakes Mburo -H- ++ + - - Kachera Kijanebalola Yala System Kanyaboli Sale Victoria Nile System Species/ ON OE OL OV SG TZ TR Namasagali Bugondo (Mbulamuti) Nababirye (Kisozi) Buwendha ++

Table 1.4. Tilapiine species caught during the fishing survey of LVR from 1992 to 1997. Relative qualitative abundance is shown by number of the positive signs and absence of a species is indicated by the dashes. ON = Oreochromis niloticus, OE = Oreochromis esculentus, OL = Oreochromis leucostictus, OV= Oreochromis variabilis, TZ = Tilapia zilli, and TR = Tilapia rendalii.

2 8 Table 1.4 continued.

Lake Kyoga Basin Species/ ON OE OL o v SGTZ TR Kyoga (main lake) +++ - 4-4- -- 4-4- * Nawampasa + 4-4- 4- 4-4- - 4- - Nakuwa ++ - 4- - -- - Kasudho + 4-4- 4- 4- - 4- 4- Nabusejere -H- 4-4- 4- 4- - - - Muwuru +-f 4-4- 4- -f- - 4- - Namumbya 4-4- 4-4- 44- 4-4- -- - Lemwa 4- 4-4-4------Dalaja 4-4- 4- 4- 4- -- - Nyaguo 4-4- 4-4-4- 4- 4- - 4- - Bisina 4-4- 4-4- 4- 4-4- - 4-4- - Ameito 4-4- 4-

29 O. esculentus O. variabilis O. leucostictus O. niloticus T. zilli T. rendalii

Diatoms + + + + - - Filamentous algae - - - 4- + 4- Blue greens - - - -f - Other green algae + + + 4- - - High plant material -- - 4- 4- 4-

Fish scales - - + 4 - - -

Detritus -- + 4 - - - Crustacea/insect larvae - - - 4- - Water Column feeder + - + 4" - Bottom feeder + + + -

Littoral feeders + + + + 4 - 4 - Swamp edges - + + 4"

Table 1.5: Trophic resource utilization and feeding ranges of LVR tilapiine species.

The isolated and displaced. Change in algae composition in Lakes Victoria and Kyoga, from diatomous dominated waters to waters dominated by cyanobacteria (blue greens) combined with predatory pressure from the exotic Nile perch, and heightened fishing pressure are thought to have led to the collapse of Oreochromis esculentus Balirwa, 1992; Sanderson, 1995; Batjakas, 1997). O. esculentus was recorded to feed mainly on diatomous algae and in the water column (Fryer, 1961). The initial collapse of the O. esculentus fishery was due to the increase in fishing pressure but the introduction of closely related congeners, algal changes and the establishment of the Nile perch served to curtail recovery of this species. Ecological surveys carried out between 1992 to 1997 revealed a sparse distribution with concentrations of the species in a few of the minor lakes. In addition, in all lakes where O. esculentus coexisted with 30 Oreochromis niloticus and Oreochromis leucostictus , intermediate morphs between O. esculentus and each of the two species were caught with increasing frequency in lakes where theO. esculentus was marginal in abundance compared to the non indigenous forms.

The shrunk and native

The other of the two endemic tilapiine species of the LVR, Oreochromis variabilis locally known as mpongo or mbiru, belongs to a separate subgenus, Nyasaplasa. The only other species in this subgenus in the LVR is Oreochromis tanganicae, found in Lake Kivu (Trewavas, 1983). O. variabilis is native to Lakes Victoria, Kyoga and Nabugabo, and Victoria Nile river but was transplanted to satellite lakes and water reservoirs in the region since the 1930s (Greenwood, 1966). O. variabilis was a significant complement of O. esculentus fishery and as equally distributed as the latter (Garrod, 1959; Fryer 1961). Like with O. esculentus, the excessive fishing pressure, introduction of exotic species in the LVR, and concurrent limnological changes resulted in marginalization of O. variabilis. The species is currently of no commercial value in the LVR. Oreochromis variabilis was found in the main lakes as disjunct small populations in sheltered waters, and was frequent in the Victoria Nile fish catches but insignificant in abundance compared to the non-indigenous species. Since in the satellite lakes O. variabilis was introduced based on a few individuals, only a small portion of the original genetic variation is represented in natural waters. Thus we have a situation where the originally wide spread species was shrunk to almost non-viable pockets of individuals that has put O. variabilis at verge of total collapse from the LVR. In fact there are no recent records of O. variabilis in Lakes Kyoga and Nabugabo. Within the satellite water bodies we found Oreochromis variabilis to be the least common among the tilapiine species in the region. In a few of the satellites it occurred exclusively of other tilapiine species, situations that may protect it from 31 effects of coexistence with the non-indigenous congeners. Where it exists with the non-indigenous tilapiine species O. variabilis has been found to be marginal in abundance. We found intermediate morphs between O. variabilis and O. niloticus. Hybridization between O. variabilis and Oreochromis. niloticus in the wild was documented before in northern Lake Victoria (Greenwood, 1966; Welcome, 1967; Fryer and lies, 1972).

The restricted and exotic Introduced in the LVR together with, and mistakenly for Oreochromis niloticus was Oreochromis leucostictus, locally known as Nzizi (Lake Albert) or Kinyamuroro in Lunyakole language (Greenwood, 1966; Fryer and lies, 1972). The species is native to Lakes Albert, Edward, and George (Greenwood, 1966; Trewavas, 1983) and is found mainly in the inshore and in the lagoons behind fringing swamps. O. leucostictus occurred everywhere O. niloticus was found including Lakes Victoria and Kyoga and in waters such as Lake Wamala and several other satellite lakes and water reservoirs in the region (Lowe, 1958; Fryer, 1961; Greenwood, 1966). O. leucostictus was found to be more prevalent before the establishment of O. niloticus and the Nile perch (Fryer, 1961; Welcomme, 1965, 1966). O. leucostictus greatly reduced in population size following the establishment of the two currently most dominant species in the main lakes, a factor that may account for failure of the species to expand to the southern part of Lake Victoria. In this study Oreochromis leucostictus was foimd to be a minor component of the tilapiine fishery in the main lakes but had significant sizes in a number of the satellite lakes, especially those fringed by swamps. O. leucostictus is tolerant to and easily inhabits anoxic habitats such as the swamps(Greenwood, 1966, Chapmans, 1995). The other species that were prevalent on introduction (Fryer, 1961) but were restricted to specific habitats and low abundance in this study, are Tilapia zilli and Tilapia rendalii. T. zilli and T. rendalii are non-indigenous species to the LVR. T. zilli is endemic to Lake Albert, and T. rendalii is native of the River Zambezi basin of Southern Africa (Barnard, 1948; Lowe-McConnell, 1975; Trewavas, 1983). The 32 former is more frequent and abundant than the latter. T. zilli and T. rendalii were introduced to utilize the aquatic macrophytes that were abundant unutilized. T. zilli and T. rendalii, together with O. leucostictus, were prevalent and considered as competitors to the native tilapiine species (Fryer, 1961; Welcomme , 1964a, 1964b; Greenwood, 1966,). O. leucostictus was commonly found together with O. esculentus in shallow bays while theTilapia spp were found together on rocky habitats withO. variabilis (Fryer, 1961). The non-indigenous species were always much more abundant than the native species (Fryer, 1961, Welcome, 1964). In this study Tilapia zilli was widely distributed throughout the main lakes in the region but formed relatively a minor component of the tilapiine catches. Tilapia rendalii was caught exclusively in the northern waters within Lake Victoria. T. rendalii had a uniform but scanty distribution in Lakes Kyoga, Edward, higher frequency of occurrence in Nabugabo lakes, and scanty distribution in a few of the Kyoga lakes. Molecular analysis of T zilli populations has depicted the species to be relatively variable (Mwanja et al., 1996) compared to other tilapiines in the region other than O. niloticus. T. rendalii was found to be less polymorphic than T. zilli and more subdivided among populations as close as Nabugabo lakes (Mwanja, 1996). There was strong morphological and molecular evidence of hybridization between T. rendalii and T. zilli in Lake Nabugabo in waters where the two species were found occurring together.

The expanded and introduced The resilience to fishing pressure, ability to breed in disturbed enviroiunents such as bays with high levels of siltation, the remarkable adjustment from predominantly diatomous diet to cyanobactrial dominated waters, the aggressive behaviour, and the labile trophic ecology, are thought to have combined to make Oreochromis niloticus (Nile tilapia) the most abimdant tilapiine species in the LVR despite the ever increasing fishing (Balirwa, 1992; Sanderson et al., 1995; Batjakas et al., 1997). O. nilotictis was introduced in LVR over several since the 1930’s when it was first noticed that native tilapiine stocks were rapidly dwindling, until the 1960s 33 (Lowe-McConnell, 1958, 1959, 1975; Fryer and lies, 1972, Trewavas, 1983). O. niloticus only establish in the late 1960’s (Welcome, 1967) along with the voracious predator, the Nile perch, that was known to feed indiscriminately on all fish species (Fryer, 1972). The surprising coexistence of these two species has been attributed to the long history of coexistence in their endemic origins, the Nilotic system (Balirwa, 1992). Earlier studies (Lowe, 1958, 59; Welcome, 1964; Fryer and lies, 1972) and more recently (Balirwa, 1992, Mwanja, 1996, Leveque, 1997) reported genetic interaction between O. niloticus and the LVR native congeners. Studies in the kinematics of feeding and behaviour of O. niloticus compared to its congeners showed O. niloticus to be superior in inter-species interaction and competition for any ecological resource such as food or space (Sanderson et al., 1995; Batjakas, 1997). O. niloticus was found to have the ability to feed on either smaller or less bulky particles than its congeneric O. esculentus, and it is a more efficient filter feeder overall (Batjakas et al., 1997; Batjakas et al., in prep) with the help of strands and aggregates of mucus which it used to trap small particles (Sanderson et al., 1995). Previous and recent studies have shown that the O. niloticus has a wide trophic niche (Lowe-McConnell, 1958; Batjakas et al., 1997), including eating and digesting blue- green algae (Moriarty, 1973; Northcott et al., 1991). Furthermore, O. niloticus was found to have the ability to distinguish between toxic and non-toxic strains of blue- green algae (Beveridge et al., 1993). More specifically, in Lake Victoria O. niloticus was foimd to be omnivorous in diet and of wider ecological breadth than its congeners in the lake (Balirwa, 1992). In the laboratory experiments, O. niloticus individuals always intimidated and outcompeted O. esculentus individuals for food, even in cases where O. niloticus was outnumbered by O. esculentus (Batjakas et ai., 1997). Predation pressure on O. niloticus by endemic and exotic predatory fishes such as Lates niloticus is thought to be much lower than the predation on other tilapiine species due to its fast growth, wide body, strong spines and a very efficient antipredatory schooling behavior during its juvenile stage (Batjakas et al., 1997). The availability of numerous minor satellite 34 lakes in LVR may offer management options in maintaining as much diversity as possible while extracting large volumes of proteins from the major lakes. Such a policy would require active monitoring of the satellite lakes against excessive harvest. Alternatively selective augmentation of any species found to be at risk from congeners or other disturbances. Emphasis for conservation should be placed on the severely reduced and genetically less variable native species. These native species are again faced with ecological competition and interaction from the non-indigenous species. Selective cropping of the non-indigenous species or scientifically managed culturing to boost the status of the populations of the native species would ensure continued refuge for marginalized species. Certainly increased regulation of fishing mortality and blocking of influence from terrestrial human activities such as crop and animal husbandry by the swamp edges of these satellite lakes would allow for natural conditions in which the native species can compete with the introduced forms without anthropogenic influence.

35 CHAPTER 2

Ecological Genetics, Phyletic Relationships and Phylogeography

36 1. Genetic différentiation and characterisation of populations of ningu,Labeo victorianus, and two other species of East AfricanLabeo (Pisces: Cyprinidae)

SYNOPSIS

Molecular analysis of the evolution of the ningu, Labeo victorianus, fishery in the Lakes Victoria and Kyoga based on RAPD technique was conducted. Ningu, a delicacy cherished by the peoples of Lake Victoria and Lake Kyoga basins for its sweet flesh and caviar, and a highly sought after fish in the past, formed the basis of the riverine fishery in Lake Victoria region (LVR) before its eventual collapse in the 1950s. Ningu currently exists as isolated and/or disjunct small populations of no commercial value in Lakes Victoria and Kyoga. Over exploitation and drift netting of the ningu during its annual breeding upstream migrations were thought to be the reasons for the collapse of the ningu fishery in the LVR. The establishment of non- indigenous species in the Lakes Victoria and Kyoga is thought to have curtailed recovery of ningu even after reduction in fishing effort that targeted ningu. In this study three remnant populations of ningu were sampled and characterized relative to its congeners, L. horie and L. coubie, from Lake Albert using random amplified polymorphic DNA molecular markers. The ningu populations were markedly differentiated by locality, with 64.4 % of RAPD variation found as between- population and 35.6 % as within-population diversity. The high between-population variation accounts for the high polymorphism and overall gene diversity exhibited by ningu compared to its congeners. Two postulations were made of the RAPD ningu

37 data analysis: ningu populations are restricted by ecological factors/changes and have evolved into distinct units; and/or populations of ningu exhibit natal stream fidelity.

INTRODUCTION

The study addresses the issue of genetic population viability of remnant ningu populations after the severe reduction of the originally large commercial population to disjunct commercially non-viable pockets of individuals within the Lakes Victoria and Kyoga. For effective management of endangered or commercially important natural resources, it is necessary to characterize the genetic variation within and among extant populations, and the genetic interaction, phylogenetic and phylogeographic relationships among the remnant populations of the target species (Allendorf and Leary, 1986; Lande and Barrowclough, 1987). Its not enough to list a species as endangered, but it is also necessary that critical data on the prospects of continued existence of the target species is acquired to convince governments to allocate resources to protect and develop such a species. This information is especially needed where the decision to save a species depends on the competing needs for the meagre resources, as is the case for the conservation of ningu. The genetic data generated can reveal the ability of a species or population to evolve in recovery, and the size of the population needed for the recovery (Allendorf and Leary, 1986; Lande and Barrowclough, 1987; Primack, 1993). Molecular ecology of the remnant ningu populations as management tool is of paramoimt importance to establish the genetic population structure and evolutionary significance of the distinct subunits of ningu species. Given the severe reduction in population size, our main concern was the level of genetic variation and its distribution within and between remnant populations of ningu. The comparison to congeners was because the two congeners used have stable populations and are not commercially important, that they expected to exhibit genetic structure not influenced by fishing mortality as is the case with ningu. The molecular technique used does not reveal

38 absolute values of genetic diversity but relative differences between species, as the exact nature of the targeted variation in the genomes is not known and is primed randomly (Hadrys et al., 1992; Hedrick, 1992). In addition, the logistic limitations in acquiring sufficient samples for detailed analysis, especially due to the rarity of ningu, made it necessary to use the two congeners for relative instead of absolute genetic diversity indices. The labeines belong to family Cyprinidae of the teleost fishes (Skelton et al., 1991). They are a diverse group of carp-like fishes, with sucker lips, which occur throughout the old world tropics playing a major role in the tropics as food species with individuals of some species weighing over 10 Kg (Reid, 1985). Ningu, Labeo victorianus, is a lacustrine labeine species endemic to Lakes Victoria and Kyoga (Greenwood, 1966). Ningu is one o f the two lacustrine labeines known to migrate upstream for breeding and spawning purposes, the other being Labeo altivelus of Lake Malawi which breeds in the adjoining Shire River (Reid, 1985). It is during the upstream migration of these species, and on their return, that the fishermen catch them by drift netting at the river mouths, and by deep traps in swamps and flood plains in which they spawn. These modes of fishing were thought to be responsible for the sharp decline in ningu (Cadwalldar, 1965a; Ogutu-Ohwayo, 1990). The severe depletion of ningu stocks led to the current endangered status of this species in both Lake Victoria and Lake Kyoga. The severe reduction in population size occurred at an inopportune time, a time of both increased use of nylon gillnets and the introduction of non-endemic species (Fryer and lies, 1972). Before ningu could recover several introduced species including the voracious predator, the Nile perch, became established and dominated Lake Victoria and Lake Kyoga. The establishment of the non-indigenous species acted to further curtail the recovery of ningu even after the institution of regulations against upstream drift netting (Ogutu-Ohwayo, 1990). Ningu is now extant only in isolated small populations around river mouths adjoining Lake Victoria, and by the margins of Lake Kyoga connected to small streams that are protected by the extensive papyrus swamp edges characteristic of Lake Kyoga basin. 39 STUDY AREA Ningu was found in only two locations in Lake Victoria and by swampy edges of Lake Kyoga at Bukungu (Figure 2.1). In Lake Victoria, the ningu was found at the mouth of Sio River in the north east part of the lake at Majanji by Uganda/Kenya border, and at Kusa beach (Kenya) in the eastern edge of the lake. Survey around small temporary streams adjoining Lake Victoria and Lake Kyoga, the ningu primary breeding habitat (Greenwood, 1966), will perhaps uncover additional extant populations. This study included a fish survey of Victoria Nile River where only four individuals were caught near Lake Kyoga, two of these were identified as Labeo forskahlii (Kaufinan, pers. Comm ). In addition to the four locations mentioned above, several small streams around Jinja adjoining Lake Victoria and upper Victoria Nile and by the mouth of River Kagera at Kasensero were surveyed for ningu. Other locations surveyed included a number of low flowing streams by Nyanza gulf around Kisumu and a series of surveys across Lake Kyoga. Fishing was done within the rivers during the rainy season, a period when the ningu was expected to be migrating upstream for breeding, and within the lakes during the dry seasons a period in which ningu were expected to be foraging. In the long term, this study was planned to include all major affluent streams of lakes Victoria and Kyoga, and many of the smaller ones that are accessible.

40 UGANDA \

ZAIRE

KENYA

RWANDA\ -wJ'T TANZANIA

Figure 2.1 Sample sites for Lebeo victorianus: M a|aaji (1) and Kusa beach (2) o f Lake Victocia: Bnkungu of Lake Kyoga (3); and for the sister species and charcid at W cnseko (4) o f Lake A lbeit

41 Natural history and evolution ofLabeo victorianus

The ningu was recorded by Greenwood (1966) to be native to Lakes Victoria and Kyoga, and to rivers adjoining these two lakes, including the Victoria Nile. Ningu belongs to a genus, which may not necessarily be monophyletic, with over 100 species in Africa alone (Reid, 1985). The nearest relative of the genus Labeo is thought to be Osteochilus, with the phylogeny of Labeines still uncertain. The labeine species rarely have ‘unique characters’ possessed by all of the individuals included in any one species, and many described’ species have overlapping variation (Reid, 1982). Most of the nomenclature of these species was based on statistical comparisons using modal values of traits with uncertainty regarding the biological reality of the comparisons and their significance to the evolutionary relationships (Reid, 1985). Growth characters used in cyprinid taxonomy such as body depth and lip fleshiness can vary with habitat making ecophenotypic variation a common occurrence among the labeines (Reid, 1985; Skelton et al., 1991). Ningu most closely resembles Labeo forskahlii, but differs from the latter in that ningu lacks the anterior barbels (at least in adults) while its posterior barbels, unlike those of L. forskahlii, are incorporated in the skin folds (Reid, 1982).

MATERIALS AND METHODS

Random Amplified Polymorphic DNA (RAPD) technique The RAPD technique is a modification of the basic PCR (Williams et al., 1990; Welsh and McClelland, 1990) that offers a number of advantages over many conventional molecular tools such as Restriction Fragment Length Polymorphisms (RFLP) and allozyme markers (Hedricks, 1992). RAPD analysis requires only small amounts of DNA, does not require prior DNA sequence information and radioisotope 42 labelling. The technique is simple and robust and can be used to analyse large numbers of individuals and/or populations in relative short time. The technique has been suggested as an appropriate tool for molecular ecology (Hadrys et al., 1992; Hedrick, 1992; Russell et al., 1993; Dawson, et al., 1993). RAPD technique has been used in differentiation of subspecies of Oreochromis niloticus (Pisces: Cichlidae) (Bardacki and Skinbinski, 1994, Naish et al., 1995), and in the analysis of the genetic variability and population structure of tilapiine species of Lake Victoria basin (Mwanja, 1995). In this study a set of five arbitrary decamer primers, ordered from Operon technologies, Alemada, CA, USA (Table 2.1) were used to generate markers that readily differentiated populations of Labeo victorianus, two congeners, and the distantly related species, a characid {Hydrocynus baremose) and a barbine (Barbus bynii) as outgroups.

Primer index Sequence (5' to 3') OPM 07 ccgtgactca OPM 12 gggacgttgg OPM 13 ggtggttcaag OPM 14 agggtcgttc OPM 19 ccttcaggca

Table 2.1 Indices and sequences of the five primers used.

43 Sample collections Fish were caught using gillnets of 1.5" to 2.5" set in high waters, and seine nets of small mesh size in low waters. A few individuals at each location (Table 2.2.) were sacrificed, and approximately 2-3 g of muscle tissue was taken from each individual for DNA analysis. The muscle tissue of each individual was initially put in vial containing 1.0 ml of 95% ethanol, and one hour later transferred to another vial with fresh 95% ethanol where it was stored until the DNA extraction. The remainder of the tissue samples from all individual tissue specimens used in molecular analysis, and the rest of DNA specimens were similarly labelled and were archived in Professor Paul Fuerst’s Laboratory at Ohio State University, Columbus Ohio. Table 2.2 lists the number of individuals used in the molecular analysis. The advantage of RAPD technique is that it generates many marker bands and each band or band position on the gel for each primer is equivalent to a genetic locus (Lynch and Milligan, 1994). The many loci generated can compensate for the small sample size in the genetic analysis of the population structure (Nei et al., 1983). 10 individuals per sample is still on the lower side of the required number of individuals even for conventional markers such as the allozyme markers. But RAPD data offers another advantage in that the data generated can be handled as presence/absence data. This allows for phylogenetic analysis of populations using individuals as independent taxa rather than the overall index typical of phenetic approach in analysis of population structure. Each presence or absence of an amplified product at locus is considered as a characteristic of an individual in a population. When individuals are analyzed as independent taxa, the data allows for cladistic analysis of the variation both within and among populations generated as a cladogram. Comparison of the two kinds of analyses allows for compensation of the limited sample sizes in ningu.

44 Species Local name Population N Origin Labeo victorianus ningu (Lva) Lakes Kyoga and Victoria

Majanji (M) 10 Lake Victoria, Majanji Kusa (K) 10 Lake Victoria, Kusa Beach Kyoga (n) 10 Lake Kyoga, Bukungu

Labeo horie kanika (LH) 10 Lake Albert, Wanseko Labeo coubie kwangurameli (LC) 4 Lake Albert, Wanseko Barbus bynii kisinja (Bb) 10 Lake Albert, Wanseko

2.2. Species, populations and source and sample sizes (N). Abbreviations in parenthesis are prefixes to the labels for individuals from the respective populations as they appear in the cladogram, and as labelled in the Professor Paul Fuerst’s DNA archive.

DNA Extraction About one gram of the piece of muscle tissue collected was wiped of the excess alcohol and allowed to dry on a sterilized glass plate. The tissue was chopped and ground in 1.5 ml eppendorf tubes in a volume o f400 ml of ABI lysis buffer (Seutin et al., 1991). 10 ul of proteinase K enzyme (20 mg in 1 ml of pure water) was added and the mixture incubated at 45°C for overnight. DNA extraction was then performed on the lysate using the standard phenol/chloroform extraction procedure. Two series of phenol/chloroform (250 ul of both phenol and chloroform) extraction followed by 500 ul of chloroform, with mixing and centrifuging each time. The phenol/chloroform step was repeated as many times as was necessary until a clear

45 phase, instead of the solid one, was seen between the resultant two liquid layers of which the top one contained the DNA extract. The DNA was precipitated using refrigerated cold absolute ethanol. The extra salts were washed off using 70 % ethanol. The excess ethanol was allowed to evaporate before re-suspension in TE (Tris-EDTA buffer, pH 7.6) in a warm water bath at 65®C for one hour. The extract was labelled the same as the label on the remainder of the archived tissue sample of that individual and was stored at 4°C.

PCR conditions. Gel Electrophoresis and Band Scoring The amplification reactions contained 50 ng of genomic DNA, 100 uM final volume of each of dATP, dCTP, dGTP, dTTP, 200 nM single arbitrary 10-mer primer, 2.5 ul of Taq Polymerase buffer (10 mM Tris Hcl, pH 8.8), 50 mM potassium chloride, 1.5 mM MgCl, O.l ionic detergent), and O.lul of Taq polymerase (5 units BRL technologies, Gaithersburg, MD, USA) in a final volume of 25 ul overlain with two drops of oil to prevent the mixture from evaporating. The amplifications were done by Perkin Elmer Cetus thermocycler (Fairfield, OH, USA) as follows: 3 min at 94°C hot start, followed by 45 cycles of the following sequence: 30 sec at 94°C, 1 min at 35°C, and 2 min at 72°C. This was linked to a 72oC extension cycle of ID min, at the end followed by a soak temperature of 4°C. The amplification products were separated electrophoretically in 2.0 % agarose gels and were viewed under ultra violet light. Bands were scored as T' for present and as 'O' for absent against a standard DNA ladder 123 bp marker (BRL, Gaithersburg, MD, USA).

Data Analysis Each sample of 4 to 10 individuals was assessed for the proportion of unique bands (private alleles), level of bandsharing within and between samples, and proportion of polymorphic loci for each sample. Polymorphism was assessed as the proportion of bands/loci in a sample at which one or more individuals did not have a fragment that was present in the rest of the individuals in that sample at that band position (= locus). The analysis of the molecular diversity among samples was done 46 using Shannon’s index of diversity (King et al., 1993). Lynch and Milligan (1994) derivations were used to estimate allelic frequencies and assess the gene diversity and population subdivision within each of the species. Estimates of heterozygosity were done following Lynch and Millgan’s (1994) derivations for genetic population structure analysis using RAPD data. Their derivations are adjusted to correct for the bias in RAPD band data due to the dominant nature of the amplified alleles, unlike the conventional codominant markers where both alternate alleles can be amplified in cases where both exist in the population. The PAUP computer software program version 3. i(Swofford, 1991) was used to estimate the phylogeographic relationship of the populations of the ningu in relation to the individuals of their congeners. Individuals of the characid, Hydrocynus baremose, and those of a cyprinid, Barbus bynii, populations were included in the estimation of the phyletic relationships as outgroups.

RESULTS

Amplification Five primers generated a total of 100 amplification products (Table 2.3). Each primer generated between 15 to 24 bands across the three populations of ningu, three labeine cyprinid species, one barbine and one characid species. The molecular profiles generated were variable among individuals and across populations and species, with sufficient polymorphism for genetic analysis (Table 2.4).

47 Species L. victorianus L coubie L. horie B. bynii H. baremose Total ningu populations congeners Barbine Characid K M n LC LH Bb Hb OPM 07 5 3 4 5 5 9 9 20 OPM 12 5 8 6 7 1 9 11 22 OPM 13 3 7 7 6 4 7 3 15 OPM 14 7 8 3 9 10 9 17 19 OPM 19 12 13 8 10 7 5 12 24 Total 32 39 28 37 27 39 48 100

Table 2.3. Number of bands generated by each of the five primers for each population and species sampled (1995).

Species L. victorianus L. victorianus L. coubie L. horie B. bynii H. baremose (within Ningu) Lva LC LH Bb Hb Total

Within Lva K M n No. unique alleles 4 4 4 17 3 4 3 14 41

Proportion 0.04 0.04 0.04 0.17 0.03 0.04 0.03 0.14 0.41

Percent polymorphism 93.80 81.60 71.40 82.30 67.70 81.50 66.60 88.50 N/A

Table 2.4. Number and proportion of unique bands (alleles), and percent level of polymorphic bands (loci), i.e., loci with alleles of a frequency of 0.95 or less. 48 Polymorphism

The ningu, Labeo victorianus, had significantly higher number (X^-test = 15.26, df = 1, P < 0.5) of unique alleles compared to its congeners, L. horie, and L. coubie (Table 2.5). The level of the allelic polymorphism for L. victorianus though higher was not significantly different from that of its congeners. Among the cyprinids Barbus bynii showed a much lower level of polymorphism as compared to the three labeine species (Table 2.5). Of the two non labeine species, the characid, Hydrocynus baremose, exhibited relatively much higher number of unique alleles as well as higher level of polymorphism compared to B. bynii. Among the three populations of ningu, the Kusa population (K) had the highest level of polymorphism with Kyoga population (n) exhibiting the least. All three ningu populations had the same number of unique alleles. The Kusa beach (K) population had a higher mean diversity per locus than that of Sio River (t -test, P < 0.05), and exhibited a much higher mean diversity per band than the Lake Kyoga population (t-test, P < 0.05). Lake Kyoga population was not different (t-test, P = 0.05) in mean diversity per locus from the Sio River population. The analysis of the relative proportion of molecular diversity present within (Hpop/Hspp) and between ([Hssp -Hpop]/Hspp) population revealed that a higher proportion of the diversity was maintained as between-population (58.5 %) than within population (41.5 %) for the three ningu populations studied (Table 2.5). At the species level among the labeine species, L. coubie had a comparably higher molecular diversity than its congeners, ningu and L. horie, though there were no significant differences (X^, P = 0.05). Ningu had the largest number of private alleles among the labeines and all species included in the study (Table 2.4).

49 Species/ Total (Hpop) Hpop/ Hspp (Hssp * Hpop) / Hspp

L victorianus Average 7.77 0.415 0.585 Species 18.72

Within L. victorianus Mean Hpop/band Nyando River, K 8.93 0.279 0.477 0.523 Sio River, M 8.47 0.223 0.453 0.547 Lake Kyoga, n 5.90 0.211 0.316 0.684

L. coubie 7.92 -- . L. horie 5.91

Table 2.5. Partitioning of molecular diversity of ningu populations, revealed by five primers, into within-population (Hpop/ Hspp) and between-population ([Hssp - Hpop] / Hspp) components, and within population molecular diversity of its congeners, L. coubie and L. horie.

Heterozygosity estimates The ningu population fi*om the Sio River ‘M’ exhibited a higher gene diversity (Table 2.6) compared to both the Kusa beach population ‘K’ (t-test, P < 0.05) and the Lake Kyoga population ‘n’ (t-test, P < 0.05). The Lake Kyoga population was not significantly different (t-test, P = 0.05) in heterozygosity fi’om the Kusa beach population. 64.4 % of the ningu gene diversity was maintained by

50 between population diversity, and with a much lower level, 35.6 %, by within population gene diversity (Table 2.6). At the species level, the congeners of ningu had comparably lower (t-test, P = 0.05) heterozygosity estimates than the ningu. L. coubie, like as with molecular diversity (Table 2.5), exhibited higher gene diversity than L. horie (Table 2.6).

Population Lva LC LH

KM n (P=3) (P=l) (P=l) Hw 0.194 0.217 0.207 0.206 0.168 0.147 SE 0.023 0.025 0.029 0.007 0.022 0.032 L 32 38 28 37 27

Hb 0.372 - -

SE 0.001 - -

Est 0.644 - - p = number of populations

Table 2.6. Within (Hw) and between (H b) population gene diversity (heterozygosity) estimates, Wright’s measure of population subdivision (F st), number of loci (L), for three ningu (Lva) populations (K, M, n), and within population diversity for ningu congeners, I. coubie (LC) and L. horie (LH).

51 Population differentiation A cladistic analysis using PAUP computer software (Swofford, 1991) was used to estimate the phylogeny of ningu populations and its congeners. Individuals from each of the three populations of the ningu were clearly differentiated into their respective distinct populations, but populations were found spread between congeners (Figure 2.2). Individuals of ningu congeners, L. horie and L. coubie were grouped by their respective species, inside the ningu branches. Similarly individuals of Barbus bynii were located inside the ningu branches as a more derived group than the labeine species.

52 Majoniy ruie MOO*. M 003 M004 MOOS £3 MOOS M 010 MOOS < M009 fiS M 002 MOOT nOOl n002 rN n003 O nOOS % nOOS n004 r - nOOT < n 0 0 9 fid nOOS nOlO LH01 r - LH02 LH05 o LH'J9 LH10 LH06 LHOa LH07 LH04 ' LH03 > K001 7^ • K002 c . K004 fia K006 O' K003 S K005 Q. K007 % K008 r KOOS < K010 & r-, LC01 . LC02 __ 9 LC03 ^ LC04 2 : BbOl Bb02 % Bb03 G BblO ^ Bb04 s

BbOS S. Bb06 ~ Bb09

Figure 2. 2 A cladogram of three populations ofLabeo victorianus (Lva) which includes Mi^anji (M), Kyoga (n) and Kusa beach (K); one ofLabeo horie, one of Labeo coubie and one ofBarbus bynii

53 DISCUSSION

The ‘random amplified polymorphic DNA (RAPD)’ analysis of populations of ningu and its congeners revealed variation within, between and among populations/species sufficient for genetic analysis. The individuals of the ningu were subdivided into distinct genetic groups associated with the stream or localities in which they were caught, a situation that points to populations of ningu breeding only in specific streams and/or absence of spatial population overlap between populations. This absence of genetic exchange raises the need to study and consider individuals by stream or locality rather than as uniform entities across the lakes. However, the low proportion of unique alleles across ningu populations was a good indication that migration between populations occurs despite the local differentiation. At the species level, tfiC high proportion of unique alleles for ningu compared to its congeners, L. horie and L. coubie, was a manifestation of reduced population sizes. The reduction in population sizes, together with processes such as genetic drift, resulted in increased occurrence of unique alleles in locally differentiated populations, and loss of originally shared rare alleles of the original diverse population. Similarly, the high level of polymorphism exhibited by the ningu populations compared to its congeners was a manifestation of the increased population subdivision that resulted in increased variability overall for the species. At the family level, the high number of unique alleles of the characid compared to the other cyprinid species was a reflection of long evolutionary separation between the species of the two families. The higher between population gene diversity (64.4 %) as compared to within population (35.6 %), and the higher between population molecular diversity (58.5 %) as compared to within population (41.5 %) molecular diversity, was further evidence for limited overlap and gene flow between populations and/or local differentiation of locale based populations. The higher diversity of ningu relative to its congeners was due to the subdivision of ningu population both by individuals or populations 54 breeding in different streams, and artificially as a result of the severe population reduction. The distinction into genetically segregated populations may be a result of individuals always returning to the same breeding sites. We postulate that both natal stream fidelity and genetic bottle necking due to population shrinkage have contributed to the observed pattern of genetic structure of ningu. The economical value and the presence of more favoured species to humans as compared to ningu congeners have guarded against the heavy exploitation such as that experienced by ningu populations. The protaginous behavior that makes ningu easy to catch at a particular time of the year, cherished caviar, and comparably sweet flesh together with spawning habitats’ destruction changed the genetic structure of ningu. The current population and genetic structures of ningu require that we attend to population by population in case of conservation and restoration. The good news is that with fidelity to natal streams it would be much easier to invest in restoration and conservation of one watershed at a time, with the advantage that we can invest in recovery of one population at a time. We can probably never know the genetic structure of the original ningu populations before the ningu fishery collapsed in lakes Victoria and Kyoga, but studies like this one give us the opportunity to establish a basis for conservation and further evaluation of such an endangered species. The current data were not sufficient to reveal the complete genetic structure of labeines from lakes Albert and Edward. However, most important for survival, conservation and development of ningu species in the Lakes Kyoga and Victoria is a systematic assessment of genetic variation that is still extant in its own remnant surviving populations. The RAPD technique offers a robust and relatively inexpensive molecular tool for quick genetic assessment and characterization of ningu populations. Perhaps deeper genetic questions like labeine species phylogeny would need auxiliary techniques, but for purposes of salvaging ningu, the technique is an adequate molecular tool.

55 2. Genetic phylogeography of IntroducedOreochromis niloticus (Pisces: Cichlidae) of Lake Victoria Region and Lake Edward>A!bert System (Uganda E. Africa).

SYNOPSIS

Molecular genetic methods were used to investigate the historical population patterns resulting from the introduction of Oreochromis niloticus into the Lake Victoria and the Lake Kyoga basins. The genetic polymorphisms were studied in populations from the two basins, both in which it is not native. Genetic variation was also studied in populations from Lake Albert and the Lakes Edward-George system, that are the putative origins of O. niloticus into the Lake Victoria and the Lake Kyoga basins. The genetic variation was determined using the Random Amplified Polymorphic DNA (RAPD) technique. The analysis of the phyletic relationships was based on genetic distances derived from the band sharing proportions and similarity indices. Populations within a lake basin (i.e.. Lake Victoria or Lake Kyoga) were more similar to each other than to populations from different basins. The populations from the Lake Victoria basin were more similar to the putative source population of Lake Edward than to the other possible source (Lake Albert), while the populations from the Lake Kyoga basin were more similar to the Lake Albert population. Populations from the Lake Kyoga basin were less diverse than populations from Lake Victoria basin. Lower diversity of Kyoga populations is consistent with the hypothesis that introductions into the Lake Kyoga basin are more recent than

56 introductions into the Lake Victoria basin. The higher diversity among the Lake Victoria basin O. niloticus populations is postulated to be a result of a diverse set of brood stock from multiple sources with repeated introductions that were done earlier and longer than in the Lake Kyoga basin.

INTRODUCTION

Fish rank second to plants as a protein source in many developing nations. In Uganda fish is the most affordable and primary source of animal protein. Although Uganda has a high potential for aquaculture, nearly all of its native foodfish are got from the wild. Pressure on wild fisheries stocks in the Lake Victoria Region (LVR) by early 1950’s prompted resource managers to begin widespread introduction of exotic fish species into the LVR waters (Fryer, 1972; Fryer and lies, 1972). The most notorious exotic species is the Nile perch {Lates niloticus), a voracious predator that contributed to the extinction of himdreds of indigenous species in all the lakes where it was introduced (Barel et al., 1985, Trewavas et al., 1985; Kaufinan, 1992, Witte et al 1992, Kaufinan and Ochumba 1993). Less celebrated but potentially important are several exotic tilapiine cichlids, especially the Nile tilapia, Oreochromis niloticus. Today, the fisheries of Lake Victoria and Lake Kyoga, as well as several of the nearby, minor lakes, are dominated by Nile perch and Nile tilapia, and the two endemic tilapiines of this region hover near extinction. The idea of exotic fish introductions was opposed by the scientists (Fryer, 1972). But the prospect of a quick fix for wild stock declines held sway. The introduced food fishes eventually exploded in abimdance, clearly an immediate benefit, but the original ecosystem was destroyed with the loss of large numbers of indigenous species and in addition resulted in unknown and largely unforeseeable long-term consequences. Among the losses were several major native food fishes: the two endemic tilapiines O. esculentus and O. variabilis, the anadromous cyprinids Labeo victorianus and Barbus altenalis, several catfish species, chiefly Bagrus 57 docmac, Clarias gariepinnus, and Schilbe intermedius, and the lungfish, Protopterus aethiopicus (Ogutu-Ohwayo, 1990; Kudhogania and Chitamwebwa, 1995). All of these taxa persist as small populations in minor lakes (Kaufman and Ochumba, 1993) or as disjunct remnant pockets of few individuals within the large lakes (Mwanja, 1996). The apparent mass extinction of the hundreds of haplochromine taxa was also widely decried, not only because biodiversity is currently recognized as having intrinsic and opportunity values, but the haplochomine taxa were important in maintaining the ecosystem resiliency and integrity prior to their loss (Kaufinan, 1992). According to Trewavas (1983), Oreochromis niloticus was already introduced into the LVR via Lake Bunyonyi, a satellite lake in the extreme southwestern Uganda fi’om Lake Edward by the 1920s, and directly into Lakes Victoria and Kyoga mistaken for Tilapia zilli introduced to use the abundant macrophytes. These introductions were followed by deliberate transplantings fi-om both Lake Edward and Lake Albert, directly or via ponds, into many small lakes and dams throughout the LVR. By 1951 O. niloticus had started showing up in the fish catches fi-om Lake Victoria as a result of earlier unintentional introduction along with the deliberate introductions of Tilapia zilli (Fryer, 1961, 1972). The intentional introductions into Lake Kyoga and surrounding minor lakes started in the late 1950s and the brood stock was thought to be fi-om a single source - Lake Albert, as opposed to multiple origins into Lake Victoria (Balirwa, 1992). Oreochromis niloticus is currently the dominant tilapiine in lacustrine and riverine habitats throughout the LVR (Ogutu-Ohwayo, 1990; Balirwa, 1992). The protracted frenzy of the introductions, plus transplanting of indigenous Lake Victoria species into minor lakes and reservoirs within the LVR, created a complex web of more or less isolated tilapiine sub-populations. This tortured history greatly complicates the identification of genetically meaningful units for conservation or management. Local differentiation of tilapia phenotypes is sometimes apparent by eye, but there are few biometric, morphological and genetic data to support this contention. Here we present molecular evidence concerning the genetic population 58 structure of naturalized O. niloticus in the LVR. In this study the Random Amplified Polymorphic DNA (RAPD) technique (Hedricks, 1992, Dawson et al., 1992, Russell et al., 1993) was employed. Bardakci and Skibinski (1994) and Naish et al. (1995) have previously reported successful use of the RAPD technique in identifying subspecies and strains of O. niloticus.

METHODS AND MATERIALS

Sample locations Samples were obtained from several locations in East Africa, three lakes in the Lake Victoria basin and four from the adjacent Lake Kyoga basin (Figures 1.1, 1.2 and 1. 3 in chapter 1). These two basins plus Lakes Edward, George, Kivu, and scores of minor, satellite lakes comprise the Lake Victoria Region (Kaufinan et al. 1997). The populations sampled in Lake Kyoga basin include Lakes Kyoga, Muwuru, Nawampasa, and Nakuwa (Figure 1.2, in chapter 1 ). Samples were obtained in the Lake Victoria basin from populations in the Lakes Victoria, Nabugabo, and Kachera (Figure 1.3, in chapter 1). Samples were also obtained from Lake Edward and Lake George. In this study only those lakes containing O. niloticus were included. In addition, this study included a sample of O. niloticus from Lake Albert so that we could estimate the relative genetic differentiation from the source populations of O. niloticus for original introductions into the LVR. For the purpose of this study, each lake was assumed to contain a single panmictic population of O. niloticus.

Molecular analysis The DNA extraction was performed using the standard phenol/chloroform extraction method (Sambooke et al., 1989). The PCR reaction mixtures of 25 ul final volume containing 50 ng of genomic DNA, 25 uM final concentration of each of the four nucleotide bases (dATP, dTTP, dCTP, dGTP), 3.0 ul o f200 nM primer, 2.5 ul of 59 a reaction buffer, and 0.1 ul of 5 units/ul Taq polymerase enzyme from BRL technologies. RAPD decamer primers (Operon Technologies, Alameda, California) were used in a Perkin-Elmer thermocycler at the following sequence: a hot start for 3 min at 94°C, then 45 cycles for 30 seconds at 94®C, 1 min at 35°C, and 2 min at 72°C, with a ten minutes delay at 72°C at the of the 45 cycles. Repeatability and potential contamination of reaction conditions were checked using both a positive and a negative control for every reaction set, for each primer. The RAPD amplifications by PCR were separated by 1.6% agarose gel electrophoresis. The gels were stained by direct infusion of ethidium bromide and amplification products were visualized using UV light.

Tissue coUecdon Fish samples were taken from the commercial landings of the fishermen as well as fish caught from our seine-net and gillnet sets. Approximately 3g of muscle tissue from each individual were removed from the right epaxial musculature of each Oreochromis niloticus specimen. The tissue sample of each individual was placed in a vial containing 95% ethanol. After one hour the ethanol was decanted and replaced, and the vial labelled and sealed until DNA extraction. Ten individuals from each population were used for analysis of the molecular variation using eight RAPD primers. The choice of 10 individuals per sample was due to the limited sample size in some of the populations used. Small sample size can be compensated for by the fact that the RAPD technique allows for phyletic comparison of individuals as independent taxa instead of generation of a population statistic as is the case for the conventional population genetic structure analysis tools (Mwanja, 1996). Another advantage of the RAPD technique is that it generates many marker bands and each band or band position on the gel for each primer is equivalent to a genetic locus. The many loci generated can compensate for the small sample size in the genetic analysis of the population structure (Nei et al., 1983). Ten individuals per sample is still on the lower side of the required number of individuals even for conventional markers such as the allozyme markers. But the phylogenetic analysis of populations using 60 individuals as independent taxa rather than the overall index typical of phenetic approach in analysis of population structure offers a good representation of the genetic distance of individuals within and between populations. Each presence or absence of an amplified product at locus is considered as a characteristic of an individual in a population. When individuals are analyzed as independent taxa, the data allows for cladistic analysis of the variation both within and among populations generated as a cladogram.

Primer indexing and product (band) scoring The primers (Table 2.7) were indexed based on their source as OPM (OP for Operon technologies, and M for the set used among various sets offered that are made of random sequences with sets differentiated by levels of G+C content) followed by a number specifying one of the random sequences within a primer set. The products were indexed using the primer code followed by a band number scored relative to the position of a standard DNA ladder marker bands (123 bp Ladder DNA from BRL Life technologies) electrophoresed together with each reaction set. Bands were matched with corresponding standard ladder band migration position, and scored as ‘ r if present and ‘0’ if absent at that position for each individual lane of each sample/population for every primer used. Each band position scored in all the amplifications for each primer for all the populations was regarded as a single locus.

61 Primer Sequence

OPM2 5'acaacgcctc3' OPM7 5'ccgtgactca3' O PM ll S’gtccactgtgS' OPM12 S'gggacgttggS’ OPM14 5'agggtcgttc3' OPM15 5'gacctaccac3' OPM17 5'tcagtccggg3' OPM19 5'ccttcaggca3'

Table 2.7. RAPD primer index: Oligodeoxynucleotide 10-mer sequences.

Data analysis The individuals of each population were analyzed for occurrence of rare alleles that were in the populations of the putative origin (Lakes Edward-George system and Lake Albert strains) of Oreochromis niloticus into the LVR. The assessment of the change in rare alleles was done as part of the measure of the changes in allelic diversity, a statistic known to be the first to vary with any change in genetic structure of the population. Populations were also analyzed for private alleles, as a measure of the degree of divergence among populations. The number and the proportion of polymorphic loci were determined as all loci that had equal to or less than 95% fi’equency among individuals within each sample. Band sharing proportions, similarity indices, and genetic distances were estimated following Nei

6 2 (1972). The genetic distances were used to determine population relationships using the Neighbor Joining method (Saitou and Nei, 1987). RAPD band presence/absence for individuals were used as character data to investigate the phylogeny of the populations by cladistic methods, using PAUP version 3.1 (Swofford, 1991).

RESULTS

Band sharing proportions Eight RAPD primers produced a total of 177 reproducible RAPD markers generated for the nine O. niloticus populations. Populations shared more bands within than between species (Table 2.8). At a higher level, populations from the Kyoga basin (lakes Kyoga, Muwuru, Nawampasa, and Nakuwa) and Victoria basin (lakes Victoria, Nabugabo, and Kachera) shared more bands among populations of the same basin, than between the two basins. In general, populations within LVR had higher band sharing with Lake George and Lake Edward populations than with Lake Albert population (Table 2.8). The populations from Lakes Nakuwa and Muwuru had the highest band sharing, and the two are geographically very close (Figure 1.2, in chapter 1 ), so individuals of the two populations were combined in further analysis (Tables 2.9).

63 Nabugabo Kachera Victoria Kyoga George Albert Nakuwa Muwuru Nawampasa Edward N = 10 10 10 10 10 10 7 4 10 10 Nabugabo 0.491 0.326 0.315 0.209 0374 0.233 0.258 0.253 0.198 0.258 Kachera 0.534 0.731 0.406 0.392 0.296 0.264 0.401 0.382 0.226 035 0 Victoria 0.520 0.559 0.722 0.333 0.352 0.265 0.396 0.368 0.319 0.247 Kyoga 0.362 0.560 0.480 0.667 0.357 0.259 0.430 0.402 0.364 0.309 George 0.467 0.419 0.500 0 3 2 9 0.683 0.400 0.421 0.369 0.409 0.271 Albert 0.403 0.379 0.382 0.390 0.594* 0.664 0.301 0.387 0.233 0.176 Nakuwa 0.405 0.530 0.525 0.594 0.573 0.416 0.785 0.643 0.378 0.322 Muwuru 0.374 0.479 0.465 0.526 0.488 0.507 0.780 0.863 0.278 0.272 Nawampasa 0.329 0 J I3 0.445 0.529 0.587 0.340 0.506 0 3 5 3 0.710 0.232 Edward 0 J8 1 0 3 7 2 0 3 7 0 0.482 0.419* ' 0.275* 0.460 0.369 0359 0.613

Table 2.8. RAPD Band sharing within and between the LVR O. niloticus populations (not in bold) and similarity indices between populations derived from the band sharing proportions (in bold). N = to sample size. Lakes Nakuwa and Muwuru were combined for further analyses.

Similarity indices The index of genetic similarity presented basically the same picture of relationship as the band sharing proportions (Table 2.8). Populations from the LVR had higher similarity relative the Lake George population than to either Lake Edward or Lake Albert populations and in most cases even when compared amongst them. There was also a greater similarity between populations from the Lakes George and Albert population than between populations from the Lakes George and Edward populations.

64 Polymorphism The percent polymorphism (alleles with frequency of < 0.9, which was to equivalent to 1 in 10 as an alternate allele) ranged from 21.5% for Lake Kachera to 47.5% for Lakes Nakuwa and Muwuru combined (Table 2.9). Table 2.9 also gives several other attributes of interpopulation variability among the nine populations including: number and percentage of rare alleles (i.e., alleles that occurred at < 10% frequency in the population); number and percentage of null alleles (presumed homozygous alternate state of the amplified allele); number and percentage of monomorphic alleles (alleles at 100% frequency in population); number and percentage of rare alleles of populations from Lake Albert and Lake George that were found missing in the every population; and the number and percentage of unique (population specific) alleles carried by each population.

65 Pops. Unique Monom Polymor Null Rare Lost Lost Alleles orphism phism Alleles Alleles Albert George Rare Alle. Rare Alle.

no. % no. % No. % No. % no. % no. % no. %

Nabugabo 0 0.0 0 0.0 46 26.0 131 74.0 11 6.2 15 79.0 10 100

Kachera 2 I.l 13 7.4 38 21.5 126 71.1 6 3.4 13 68.4 10 100

Victoria 4 2.3 12 6.8 49 27.7 116 65.5 13 7.3 16 842 9 90.0

Kyoga 8 4.5 12 6.8 66 37.3 99 55.9 13 7.3 13 68.4 7 70.0

George 3 1.7 10 5.7 64 36.1 103 58.2 10 5.7 15 79.0 -

Albert 16 9.0 12 6.8 80 45.2 85 48.0 19 10.7 -- 5 50.0

Nakuwa- 8 4.5 24 13.6 84 47.5 69 39.0 15 8.5 14 73.7 1 10.0 Muwuru

Edward 3 1.7 12 6.8 41 23.2 124 70.1 14 7.9 13 68.4 8 80.0

Calculated 18.35 13.97 20.94 17.56 4.37 3.32 135.01 • $ * *«

P<0.05,df= 7: -nonsignificant ~ highly non significant * significant ** highly significant

Table 2.9. Allele frequency population attributes for O. niloticus populations of the LVR.

66 Allelic differences When all populations were considered, three categories of data were significantly different (Table 2.9). Populations were different in proportion of private (unique) alleles, level of polymorphism and the number of Lake George population rare alleles not contained (lost) in each of the other populations studied. The populations were also significantly different in the proportion of ‘null alleles’ within each population. There were no differences in the proportion of rare Lake Albert population alleles lost when differences for all the populations were considered (X^, P = 0.05). The Lake Albert population exhibited a relatively high number of unique alleles as well as rare alleles amongst the nine populations. The combined population of Lakes Nakuwa and Muwuru showed comparably higher levels of monomorphic alleles and had a higher level of polymorphism. The Lake Victoria basin populations had comparably lower levels of polymorphism than the populations from the Lake Kyoga basin and Lake Edward-Albert system. Likewise the Lake Victoria basin populations exhibited greater loss of Lake George population rare alleles as compared to moderate loss in Lake Kyoga basin populations. The Lake Edward population showed higher similarity in all attributes studied to the Lake Victoria basin populations than to the populations from Lake Kyoga basin.

Population differentiation The genetic distances were calculated from the band sharing proportions according to Nei (1972) and were used to determine relationships among the nine populations (Figures 2.3). The populations clustered by basins, equivalent of a metapopulation structure with the main lakes containing the core populations. A higher level of structuring was evident between basins. Lake Victoria and Lake Edward are each other’s closest relatives. The Lakes Kyoga, George and Albert metapopulations apparently have a closer phyletic relationship than Lake George population was to Lake Edward population. The Lake Mburo population branched 67 off together with the Lake Edw;ud population. The Lake Nawampasa population exhibited a close phyletic association with the Lake George/Lake Albert. When analyzed cladistically using PAUP, individuals clustered with their respective populations (Figiue 2.4) in a similar manner as in the dendogram in Figure 2.3.

68 G eorge Naujampasa A I b e r t Kyoga

—M u u u I u Nakuua ——V Î ct or I a ------Nabugabo K a c h Î r a Mburo Eduar d

Figure 2.3. A dendogram of 11 Oreochromis miloticus populations based on Nei’s genetic distance derived firom band sharing proportions. The ciadogram was constructed using MEGA computer software.

69 Mawyiue

Figure 2.4. ciadognm of Oreochromis niioticus individuals from 11 popuiauons: L. Victoria (vie). Kyoga lakes: L. Nakuwa (LN), L. Muwuru fLM). L. Kyoga (KO). L. Nawampasa (NW); and Lakes Nabugabo (NB). EdwanI (ED). Kachira (KC). George (GE). Mburo (MB) ana Albert (AB) 70 DISCUSSION

Compared to other tilapiine cichlids, Oreochromis niloticus is remarkable for its functional versatility and labile ecology (Fryer and lies 1972, Trewavas 1983, Sanderson et al. 1995, Batjakas et al. 1997). This versatility, together with its high adaptation to virtually all the tropical and subtropical environments, explains its position among the top aquaculture species in the world. The successful evolution of O. niloticus fishery in the Lake Victoria in face of the introduced voracious predator, Nile perch {Lates niloticus), was credited by Balirwa (1992) to several factors: a long history of coexistence with the Nile perch in its native range both in Lake Turkana and Lake Albert; trophic virtuosity, allowing access to a wide range of ecological niches; and ability to breed under conditions that congeners and other species would not tolerate, such as high littoral turbidity and siltation. Oreochromis niloticus also has the ability to swamp out closely related congeners through competition and introgressive hybridization (Fryer and lies, 1972; Trewavas, 1983; Ogutu-Ohwayo, 1990 & 1988, Mwanja 1996). In Lake Bimyoni, in South Western Uganda, O. niloticus from Lake Edward was introduced in 1927 followed by Oreochromis spilurus nigra from Lake Naivasha in 1932. Hybrids of these two species were recorded in 1937 as being more frequent than either species but by 1947 O. spilurus nigra had disappeared and only O. niloticus was in the Lake Bunyonyi (Lowe, 1958, 1959). In addition, O. spilurus nigra failed to establish in the Koki lakes in the west of Lake Victoria basin despite repeated introductions (Fryer and lies, 1972). The disappearance of O. spilurus nigra was attributed to hybridization and subsequent swamping by O. niloticus and Oreochromis leucostictus that were introduced in these lakes at about the same time (Fryer and lies, 1972,

71 Leveque, 1997). Hybridization and swamping of the native tilapiine species in the LVR by the introduced non-indigenous tilapiine species is thought to be the most critical factor leading to marginalization and disappearance of the native species, especially, in disturbed waters. Such a phenomenon has also been witnessed in the Australian water bodies and in many Asian countries where the species co-exists with other feral populations (Arlington et al. 1984, Taniguchi et al. 1985, Maracanas et al. 1986, 1995). Several species were introduced into LVR together with O. niloticus, but none of the others have been as successful in establishing as O. niloticus. Population structure can provide clues to help explain both their success and their durability in a rapidly fluctuating ecosystem such as the LVR waters. The O. niloticus populations we examined were well differentiated by basin, as indicated by the high within basin bandsharing, smaller differences in within and between population gene diversity estimates, and differences in homozygote alternate alleles among populations within basins. Nonetheless, there was also considerable variation among populations within a basin. For Nile tilapia, O. niloticus, in the LVR, the high level of between population differentiation and yet relatively high genetic polymorphism within individual populations may explain the continued ecological dominance or reflection of it in the region despite the dramatic changes in the system. The inherent traits of this species have enabled the species to reign supreme in tropic and subtropic regions and its varied genetic structure is a perhaps exact reflection of that here in the LVR and elsewhere. The Lake Victoria metapopulation appears more likely to have descended from Lake Edward stock than from Lake Albert. The differences in relation to brood stocks (putative origins) could also be a reflection of how modified the Victoria metapopulation has become as a result of multiple seed source into the basin. The Kyoga metapopulation on the other hand appears to have been founded by brood stock from Lake Albert, and/or could be a reflection of a more recent introduction history out of this source compared to Lake Victoria metapopulation. The greater proportion of homozygous alternate alleles for Lake Victoria basin populations, and 72 larger difference from Lake George and Lake Albert populations compared to Lake Kyoga basin populations, suggests that introductions or colonization of O. niloticus in Lake Victoria basin are older than within Lake Kyoga basin. Results indicated that O. niloticus should have been established earlier in Lake Victoria basin than in Lake Kyoga basin. According to Trewavas (1983), introductions o f O. niloticus were first done in the early 1920s in the Lake Victoria through the adjoining minor lakes. The earliest report of introductions into Lake Kyoga indicates that it was only done in the late 1950s and early 1960s (Fryer and lies, 1972; EAFFRO, 1947-1967). Later introductions between 1950 and the mid 1960s involved a multitude of sources including Lake Turkana, Lake Albert, and Lake George. This introduction history could explain the close similarity between Lake Kyoga basin populations and those of Lakes George and Albert. Greenwood (1981) noted that the Edward-George system was rife with biogeographical peculiarities. For example. Lake Edward has many endemic haplochromine species, even though the two lakes share many other species that are found all through the Kazinga channel. The closer similarity between O. niloticus populations of Lake George and Lake Albert, than between those of Lake George and Lake Edward, offers another such puzzle. The simplest explanation, however, troubling, is that O. niloticus populations in Lake George have been influenced by anthropogenic introductions of stock from other sources, even though the species already occurred there. Lake Albert O. niloticus {O. niloticus O. niloticus) could have been introduced into Lake George at the same time as the introductions into Lake Victoria basin. Morphologically, we have noted significant differences between Lake George and Lake Edward O. niloticus (Mwanja, unpublished data). Doubt as to the movement of species is greatly diminished by our recent discovery of both threatened Oreochromis esculentus and the exotic Tilapia rendalli populations in Lake Edward-George system. Neither of the two species had ever been recorded before, and neither occurs there naturally (Greenwood, 1966; Fryer and lies, 1972; Trewavas, 1983). The historical biogeography of fishes in East Africa will always be of great interest due to its fascinating evolutionary implications. This fact 73 is all the more reason for practitioners to beware of the oft-times unfortunate and confounding influence of humanity’s fervor to reorganize the nature of Africa.

3. The Genetic Peril of the Ngege, Oreochromis esculentus, in Lake Victoria Region following the Establishment of the Exotic Tilapiine Species.

SYNOPSIS

The fishery of the Lake Victoria basin, dominated by the Cichlidae family of fishes, has suffered significant species loss due to over fishing. Lake basin wide environmental changes, and introduction of non-indigenous species. Among the species severely affected were the endemic Tilapiine species, Oreochromis variabilis and Oreochromis esculentus (locally known as ngege). The ngege has nearly been extirpated from Lake Victoria and currently survives as small remnant populations in a number of the small isolated satellite lakes. In this study. Random Amplified Polymorphic DNA (RAPD) molecular markers were used to examine and characterize the remnant populations of ngege of Lake Victoria basin in relation to the introduced non-indigenous sister species, Oreochromis niloticus. Populations of the ngege were characterized by significant proportion of private alleles. The ngege populations that coexisted with O. niloticus showed relatively higher levels of polymorphism as well as gene diversity than the ones that didn't coexist with O. niloticus. Without direct intervention by enhancing the population size of the ngege that coexist with closely related congeners such as O. niloticus, O. esculentus will likely be swamped out into extinction.

74 INTRODUCTION

Oreochromis esculentus (Pisces: Cichlidae: subfamily: Tilapiinae) is thought to be a sister species to Nile tilapia, O. niloticus (Trewavas, 1983), a species well known for it’s aquaculture potential and for it’s introduction and successful establishment all over the tropics and subtropics. O. esculentus together with O. variabilis are the only endemic tilapiine species of Lakes Kyoga and Victoria of East Africa. These two species originally formed the mainstay of the Lake Victoria and Lake Kyoga commercial fisheries, with O. esculentus as the major contributor. This has long changed with the introduction and establishment of non-indigenous tilapiines and a voracious predator, the Nile perch, Lates niloticus in mid 1960s (Ogutu- Ohwayo, 1990; Balirwa, 1992; Kaufinan, 1992). O. esculentus has been displaced from the main lakes and currently exists in several uncotmected small populations in the isolated satellite lakes around Lake Victoria and Lake Kyoga. O. esculentus and O. variabilis are no longer landed commercially on Lakes Kyoga and Victoria, and face increasing pressure firom fishing mortality, hybridization and competition with the introduced ecologically more labile tilapiine species in their only natural réfugia, the satellite lakes. The satellite lakes have long been thought of as vestiges of native tilapiine species serving as their only remaining natural réfugia (Fryer and lies, 1972, Greenwood, 1974; Kaufinan and Ochumba, 1993). Faced with such a risk there is urgent need to evaluate what is left of the two endemic tilapiine species of the Lake Victoria Region (LVR) with a goal of estimating how much genetic diversity exists among the surviving populations. There is also need to establish the genetic processes and underlying mechanisms responsible for the observed population structure. The population genetic structure of Oreochromis esculentus may be the key evidence in convincing managers and exploiters of these species of how urgent conservation efforts need to be imdertaken to save this species fi-om the looming extinction. In this paper, we report the 75 investigation of the genetic diversity in the remnant populations of O. esculentus using RAPD markers. We also discuss the implications of the findings as regards the management, conservation, and exploitation of this originally most important commercial species of the Lake Victoria basin. Detailed knowledge of the amoimt and distribution of genetic variation within a species/population is a prerequisite for scientific approaches to the conservation, exploitation, and management of that species, especially in the wild (Allendorf et al., 1987). Traditionally among the Tilapiine species, morphological, meristic, squamation, and/or behavioral characteristics have been employed to measure and characterize species diversity (Fryer and lies, 1972; Trewavas, 1983; Stiassny, 1991;). These traditional methods may be tedious requiring a lot of time for population level studies. This difficulty in employing traditional tools is because none of them may be used singly to unambiguously characterize the diversity among populations and/or species due to the high level of interpopulation and interspecies overlap in most of the traits used (Fryer and lies, 1972). In addition, these traits are prone to environmental influence and may therefore not reflect the true genetic differences or similarities between populations. To overcome the handicap of traditional methods, biochemical and molecular tools are increasingly being employed to study the genetic variability and phylogenetics among the Tilapiine populations and species (Komifield et al., 1979; McAndrew and Majumdar, 1984; Capili, 1990; Seyoum and Komfield, 1992; Franck etal., 1994; Bardakci and Skibinski, 1994, Naish et al., 1995; Mwanja, 1996). Isozymes have been used with little resolution at population level due to the low levels of polymorphism exhibited (McAndrew and Majiundar, 1984). The isozymes, though, have been successfully used for species and subspecies differentiation, and in phylogenetic studies of tilapiine species (Sodsuk and McAndrew, 1991, Oosthuizen et al.,1993; Poruyuard and Agnese, 1995; Oberst et al., 1996). The nuclear genomic and the mitochondrial DNA sequencing have been used to characterize species and subspecies of tilapiines (Seyoum and Komfield, 1992) but they may not be appropriate for extensive

76 population level studies and management of such species with several small isolated populations. The restriction fragment length polymorphisms (RPLPs) have been used extensively in other species (Avise et al. 1994). However, RLFP assay requires large quantities of relatively pure DNA, and the frequent use of radioisotopes in the detection method which makes it technically demanding and costly for population level questions with routine sampling (Chalmers et al., 1992; Dawson et al., 1993). The Random Amplified Polymorphic DNA (RAPD) offers another molecular tool that is a type of modified PCR technique (Williams et al., 1990; Welsh and McClelland, 1990). The RAPD technique has been used in many molecular ecology level questions to overcome the technical limitations of other conventional markers in population genetic structure studies. (Hadrys, 1992; Russell et al., 1993; Dawson et al., 1993). With the development of microsatellite markers applicable to tilapiine species this gives us the opportunity for analysis of populations using a molecular tool, more similar to conventional markers in analysis, but even better because of the higher variability of microsatellite markers (Cavilli-Sforza, 1998). In Chapter 3 & 4 microsatellite markers were used contrast the genetic structure of all the tilapiine species of the LVR. The RAPD technique has been used to characterize tilapiine species and subspecies (Bardakci and Skibinski, 1994, Naish et al., 1995), and has also been used to characterize population genetic structure of the whole assemblage of Lake Victoria basin tilapiine species (Mwanja, 1996). In this study, the RAPD technique revealed ample genetic variation for O. esculentus populations to differentiate populations, characterize the population genetic structure of this species, and cladistically estimate the phylogeography of the its remnant populations. The RAPD data is used to establish the effect of the occurrence of O. esculentus together with O. niloticus. The hypothesis investigated was that coexistence of O. esculentus with the closely related congeners such as O. niloticus has resulted in the hybridization between O. esculentus populations and the congeners, where the two

77 forms share waters in the LVR. This genetic interaction is thought to marginalize the remnant populations of O. esculentus into extinction through genetic swamping.

78 MATERIALS AND METHODS

Sample collection The samples were collected between 1992 and 1995 from a total o f seven lakes around Lake Victoria, East Africa (Figures 1.1 and 1.3 in chapter 1). Occurrence of O. niloticus withO. esculentus was included so as to assess the genetic impact of O. niloticus on the remnant populations of O. esculentus. O. niloticus was found to hybridizes with its sister species, O. esculentus as well as O. variabilis, the other native tilapiine species of the Lake Victoria region (Lowe-McConnell, 1959; Fryer and lies, 1972; Mwanja et al 1995). The tissue samples for DNA analysis were removed from the right epaxial musculature of each individual specimen. Each individual tissue sample of 2 to 3g was then placed in vials containing 95% ethanol. Afrer one hour the 95% ethanol was decanted and replaced, and the vials sealed and labeled until DNA extraction. Ten individuals per sample were used in this analysis except for Kijanebalola (was not included in allele frequency analyses) sample with only five individuals. A sample size of 10 individuals per population is small for detailed allele frequency analysis for population level questions - but the RAPD technique allows for an alternative analysis for relationship among individuals within and between populations. The alternative is based on analysis of individuals as independent taxa using presence/absence RAPD band data. The phylogenetic analysis of populations using individuals as independent taxa rather than the overall index, typical of phenetic approach in analysis of population structure, offers a good representation of the genetic distance of individuals within and between populations (Mwanja, 1996). Each presence or absence of an amplified product at locus is considered as a characteristic of an individual in a population. When individuals are analyzed as independent taxa, the data allows for cladistic analysis of the variation both within and among populations among constituent individuals.

79 Molecular methods The DNA extraction was performed using the standard phenoi/chloroform extraction method (Sambrooke et al., 1989). The RAPD bands were visualized after amplification by PCR. PCR reaction mixtures of 25 ul final volume containing 50 ng of genomic DNA, 25 uM final concentration of each of the four nucleotide bases (dATP, dTTP, dCTP, dGTP), 3.0 ul of 200 nM primer, 2.5 ul of a reaction buffer, and 0.1 ul of 5 units/ul Taq polymerase enzyme from BRL technologies. RAPD decamer primers (Operon Technologies, Alameda, California) were used in a Perkin-Elmer thermocycler at the following sequence: a hot start for 3 min at 94°C, then 45 cycles for 30 seconds at 94°C, 1 min at 35°C, and 2 min at 72°C, with a ten minutes delay at 72°C at the of the 45 cycles. Repeatability and potential contamination of reaction conditions were checked using both a positive and a negative control for every reaction set, for each primer. Amplifications were separated by 1.6% agarose synergel electrophoresis, and visualized under UV light after ethidium bromide staining.

Primer indexing and product (band) scoring The primers (Table 2.11) were indexed based on their source as 0PM (OP for Operon technologies, and M for the set used among various sets offered that are made of random sequences with sets differentiated by levels of G+C content, followed by a number specifying one of the random sequences within a primer set. The products were indexed using the primer code followed by a band number scored relative to the position of a standard DNA ladder marker bands (123 bp Ladder DNA from BRL Life technologies) electrophoresed together with each reaction set. Bands were matched to the corresponding position of migration of the standard ladder marker band, and scored as ‘ 1’ for present at that position, and 'O' if absent for each individual lane of each sample/population for every primer used. Each band position scored in all amplifications for each primer for all populations was taken as a single locus.

80 Primer Sequence

OPM2 S'acaacgcctcB' OPM7 S'ccgtgactcaS' O PM ll S’gtccactgtgS' OPM12 5'gggacgttgg3’ OPM14 5'agggtcgttc3' OPM15 5'gacctaccac3’ OPM17 5'tcagtccggg3' OPM19 5'ccttcaggca3'

Table 2.11. RAPD primer index: Oligodeoxynucleotide 10-mer sequences.

RAPD data analysis

The level of polymorphism was estimated as proportion of polymorphic loci (loci at an allele frequency of less than 0.95) in each population. All populations were assessed for private or population specific alleles. The estimates of similarity based on the number of shared amplification products were used to generate the similarity matrix (Nei, 1972). The genetic distances between-populations were estimated as Nei’s genetic distance following Lynch and Milligan (1994). To elucidate the ecological history and estimate the phylogenetic relationships of O. esculentus populations, we performed a cladistic analysis of the presence/absence RAPD data using PAUP software (Swofford, 1990). Two character states were

81 permitted T for presence of band, ‘0’ for absence of band. The characters were ordered by loci; no topological constraint was assumed and zero-length branches were allowed. A heuristic search was performed and minimal length trees were determined as rooted ciadogram. O. niloticiis, a sister species of O. esculentus, population was used as the outgroup in the analysis.

RESULTS

RAPD Band Amplification

The eight primers evaluated generated a total of 140 RAPD band markers for the seven O. esculentus populations (Table 2.12). The number of fragments produced per primer for each population ranged between 2-16 and a size range of 120 bp to 1700 bp. All eight primers evaluated generated bands of varying sizes that detected polymorphism within and among populations.

8 2 Lake/ Kachira Mburo Kanyaboli Kayugi Kayanja Manywa Kijanebalola

OPM2 8 6 9 8 4 4 5 OPM7 5 10 5 7 8 2 2 OPMll 13 13 7 3 13 3 8 OPM12 9 16 12 11 5 10 8 OPM14 7 6 7 8 3 4 5 OPM15 6 5 7 6 12 3 6 OPM17 2 14 5 9 7 5 8 OPM19 5 3 8 10 4 6 6 Total bands 55 63 60 62 56 37 48

Table 2.12. Number of RAPD bands that were amplified by specific primers for each population.

Polymorphism The proportion of polymorphic loci detected as well as the number of the unique bands identified with eight primers for O. esculentus is shown in Table 2.13. There were significant differences (X^ = 11.84, df = 6, P < 0.05) in number of unique alleles for each of the seven populations. There were also significant differences in the proportion of the polymorphic loci revealed (X2 = 17.89, df = 5, P < 0.01) among populations. The populations fi-om lakes in which O. esculentus was foimd to coexist with O. niloticus showed relatively higher levels of polymorphism (X^ = 12.52, d f= 3, P < 0.01) and had increased number of unique bands compared to lakes without O. niloticus or where O. niloticus was infrequent. There were no significant differences 83 ÇK} = 2.8, df = 1, P < 0.05) in level of polymorphism for populations in which O. niloticus was absent. The O. esculentus population from the lake where O. niloticus was the most dominant tilapiine, for example Lake Mburo, had the highest proportion of polymorphic loci whereas the population from the lakes with no or less dominant O. niloticus exhibited the lowest proportion of polymorphic loci (Lake Kanyaboli) as well as the least number of unique alleles (Lake Kayanja).

Lake Kachira Mburo Kanyaboli Kayugi Kayanja Manywa Kijanebalola Presence of

O. niloticus +++ +-H- «4" — 4" Specific allele. 5 13 6 9 2 4 4 Polymorphism 0.67 0.78 0.40 0.60 0.50 0.60 0.33** +-H- dominant, —+ rare, — absent.** estimate based on five individuals as comparée to 10 for the rest of populations - as such not included genetic diversity estimates.

Table 2.13: Number of population-specific (unique or private alleles) bands and proportion of polymorphic bands found in O. esculentus populations of Lake Victoria basin.

Band Sharing and population specific bands In general there was more band sharing within than between populations (Table 2.14). Neighboring populations were more similar to each other than geographically distant populations. Geographically there were three main sub-region groupings: the Koki lakes’ populations (Mburo, Kachera, and Kijanebalola); the Nabugabo lakes’ populations (Kayanja, Kayugi, Manywa); and the Lake Kanyaboli

84 population. Lake Kanyaboli population was found to be more similar to Nabugabo populations than it was to Koki populations. The Lake Mburo population had the highest within population band sharing followed by the Lake Kayugi population and the Lake Kanyaboli population. The Lake Kayanja population had the least band sharing (Table 2.14). The similarity indices derived from the band sharing proportions (Table 2.14) exhibited a similar trend like that shown by band sharing proportions. All populations showed close similarity ranging between 0.474 (Lake Kayanja and Lake Manywa populations) and 0.784 (for Lake Kijanebalola and Lake Kayugi populations). On averse the Koki lakes’ populations showed higher similarity indices amongst themselves than did Nabugabo populations, and similarly exhibited higher similarity indices with the Nabugabo lakes’ populations than those exhibited by Nabugabo lakes’ when compared amongst each other.

Kachira Mburo Kanyaboli Kayugi Kayanja Manywa Kijanebalola

Kachira 0.735 0.737 0.625 0.534 0.762 0.541 0.599 Mburo 0.376 0.562 0.605 0.604 0.684 0.600 0.531 Kanyaboli 0.433 0.327 0.882 0.554 0.588 0.623 0.601 Kayugi 0.262 0.246 0.397 0.722 0.574 0.544 0.784 Kayanja 0.551 0.386 0.450 0.356 0.840 0.474 0.549 Manywa 0.289 0.262 0.445 0.286 0.276 0.762 0.517 Kijanebalola 0.379 0.225 0.455 0.522 0.383 0.311 0.826

Table 2.14. Proportional band sharing (below the bold diagonal) and similarity indices (above the bold diagonal) derived from the band sharing proportions between individuals.

85 Population subdivision and differentiation On average populations of O. esculentus were doser together than they were to O. niloticus population (Table 2.15). The Lake Mburo O. esculentus population was the closest to O. niloticus and Lake Manywa was the most distant. The Cladistic analysis clearly differentiated individuals into their respective populations (Figure 2.5). Figure 2.5 also shows a phylogeographic pattern similar to that revealed by dendogram from Nei’s Genetic distances (Figure 2.6).

Kachira Mburo Kanyaboli Kayugi Kayanja Manywa Kijanebalola

Kachira 0.00 0.54 0.62 1.02 0.70 0.95 0.72 Mburo 0.00 0.77 0.95 0.58 0.92 1.11 Kanyaboli 0.00 0.73 0.65 0.61 0.63 Kayugi 0.00 0.78 0.95 0.39 Kayanja 0.00 1.07 0.77 Manywa 0.00 0.94 Kijanebalola 0.00 O. niloticus 0.85 0.78 1.19 1.02 1.03 1.63 1.02

Table 2.15. Genetic distances between O. esculentus populations of Lake Victoria basin estimated from band sharing proportions based on Nei (1973) with O. niloticus from Lake Victoria as the out group

86 i l e

Figure 2.5 1. A ciadogram ofOreochromis esculentus individuals form Lake Victoria Region based on presence/absence RAPD band data. The ciadogram was drawn using PAUP computer software (Swofford, 1991 ).

87 Lake Kanyaboli

Lake Manywa

Lake Kayugi

Lake Kijanebalola

Lake Kayanja

Lake Kachira

Lake Mburo

O.nlloticus

Figure 2.6 Dendogram based on Nei's genetic distance measure for Oreochromis esculentus populations in Lake Victoria region relative to Oreochromis nUtihcus from Napoleon gulf of Lake Victoria

88 DISCUSSION

The only exclusive work reported on biology and ecology of Oreochromis esculentus is that by Garrod (1959) and it’s taxonomy by Graham (1928). Lowe McConnell (1958, 1959) reported on the suspected hybridization between O. esculentus and the introduced Oreochromis niloticus but emphasis was on O. niloticus other than O. esculentus. Later, the ecological work only reported on the O. esculentus disappearance from the lakes Kyoga and Victoria, and its restriction to satellite lakes around the two lakes mentioned (Welcome, 1967; Fryer, 1972; Fryer and lies, 1972, Ogutu-Ohwayo, 1988, 1990, Balirwa, 1992, Kaufinan, 1992). Most recently Ogutu-Ohwayo’ s lab, at the Uganda Fisheries Research Institute, has been involved in re-evaluation of the ecological status o f O. esculentus in Ugandan waters. Our study, and now Ogutu-Ohwayo’ s group, represent the first attempt to salvage and study what is left of the once dominant and diverse species of Lake Kyoga and Lake Victoria basins. The study also takes on another dimension because of its molecular ecology nature as compared to earlier works that were mainly descriptive basic biology, behavioral and ecology of the species (Lowe- McConnell, 1958/59; Garrod, 1959, Fryer and lies, 1972; Balirwa, 1992. The study also attempts to initiate exploratory investigation of direct interaction of O. esculentus with the introduced tilapiine species especially the dominant O. niloticus as regards to the genetic effect of the latter on O. esculentus through hybridization between the two sister species. RAPD markers revealed ample genetic polymorphism in O. esculentus populations sufficient for genetic diversity analysis. Relatively higher levels of polymorphism were found in populations of O. esculentus that coexist withOreochromis niloticus. O. niloticus has been known to hybridize readily with congeners wherever it has been introduced (Lowe-McConnell, 1958, Fryer and lies, 1972, Mather and Arthington, 1991, Balirwa, 1992, Leveque, 1997). In Lake Victoria basin this has been a long held view with morphs intermediate between these two species found in the wild (Lowe-McConnell, 1958; Welcomme, 1966; Fryer and lies, 1972; Balirwa, 1992, Mwanja, 1996). The Lake Mburo O. esculentus population which coexists with O. niloticus, exhibited the highest genetic diversity with others showing varying levels

89 probably attributable to the relative population sizes of these two species in the respective lakes. We have embariced on further studies that will estimate the extent to Wiich O. esculentus genetic status has been impacted by the hybridization especially evaluation of the riskO. niloticus poses in genetically ‘swamping’ out O. esculentus through hybridization given the reduced population sizes of O. esculentus. The Oreochromis esculentus populations from Lake Manywa, Kayanja, Kayugi and Kanyaboli are suggested to be the most pure stocks of this species that are still surviving. However, the existence of Oreochromis niloticus in Lake Kanyaboli poses a threat to the integrity and perhaps survival of pure O. esculentus population in Lake Kanyaboli. Ways and means should be sought to enhance populations of O. esculentus either through selective cropping or supportive breeding to guard gainst the dominance of O. esculentus by the introduced species. Since populations of O. esculentus were found to be genetically subdivided, a management option for O. esculentus in Lake Victoria basin would be to treat respective populations as distinct evolutionary units. Transfer of any fish stocks for aquaculture or réintroduction purposes may have to be genetically evaluated to monitor and check unwarranted genetic exchanges between highly differentiated populations. The populations of O. esculentus which are coexisting withO. niloticus may have to be considered as hybrid stocks until extensive genetic testing is carried out. There is need to guard against unwarranted introductions of exotic tilapiine species in lakes with potentially pure O. esculentus populations. Stocks of O. esculentus in lakes with mixed species need to be enhanced through supportive breeding programs in such a way that maximizes the genetic variability within the existing population, especially, where hybridization and gene introgression is suspected such as in lakes Mburo and Kachera. The existence ofOreochromis esculentus in several isolated populations has played a big part in maintaining its genetic status undiminished. There still exists ample variation among populations to warrant further genetic analysis of the species. Studies directed at a genetic management model are needed for the effective conservation of O. esculentus. The development o f O. esculentus into an aquaculture species would give it enhanced population size and genetic variability to stem negative impacts from the

90 ample variation among populations to warrant further genetic analysis of the species. Studies directed at a genetic management model are needed for the effective conservation of O. esculentus. The development of O. esculentus into an aquaculture species would give it enhanced population size and genetic variability to stem negative impacts from the congeners. This study has revealed the species to be extant in genetic units that march with its geographical units, a structure that ought to be protected or managed as such. Care should be exercised in any transplants to match only closely similar populations as most of the populations have low within population genetic variation. In case of enhancement through limited gene flow between conspecifics genetic exchange should be done between populations of the same geographic group. For example the Koki populations ought to be guarded from mixing with Nabugabo populations and vice versa.

91 4. Genetic Signature of Past Introductions of Nile Tilapia {Oreochromis niloticus) into the Victoria-Kyoga System, East Africa.

SYNOPSIS

The RAPD technique was employed to analyze the population structure Nile tilapia {Oreochromis niloticus L.) within Lake Victoria at three geographical locations that were the major points of introduction of this species into the lake. Analysis also included two samples from the adjoining Victoria Nile River and the Lake Kyoga populations. The results indicated strong differentiation among the Lake Victoria populations, with the three within Lake Victoria populations collectively different from the Victoria Nile and Lake Kyoga populations. The sample from the northern part of Lake Victoria, Napoleon gulf, was genetically more polymorphic than either of the other two within Lake Victoria populations. The northern population probably resulted from the multiple introductions from varied sources and/or large and more diverse brood stock. The lower genetic diversity at the other two sites is probably due to a simpler stocking history. Evidently Nile tilapia is sufficiently sedentary with clearly distinct sub-populations, that in a lake the size of Lake Victoria, source population signatures are discernible for decades following a wave of introductions. Though Nile tilapia exhibited marked population differentiation, its polygamous breeding behavior and/or the varied sources of seed for the introduction may account for the 60-63 percent of the total gene diversity being accounted for by within-population differences.

92 INTRODUCTION

The fisheries of Lake Victoria, East Africa, are today dominated by two introduced species. Lates niloticus (L.), Oreochromis niloticus (L.), and one native species. Rastrineobola argentea (P.) (Ogutu-Ohwayo, 1990; Balirwa, 1992; Kaufman, 1992; Stiassny,1996). O. niloticus, commonly known as Nile tilapia is the principal source of fish protein for local consumption, as most of the Nile perch is exported. Lake Victoria once supported a vigorous fishery based on an endemic tiiapiine species, the ngege, Oreochromis esculentus (G.), complemented by a second endemic tiiapiine. the mbiru. Oreochromis variabilis (B.). The ngege fishery collapsed over a period of two to three decades after the inception of a commercial fishery due to the combined effects of overfishing and eutrophication. The coup-de- grace was predation by the introduced Nile perch, and by the late 1980’s the ngege was virtually extinct in Lake Victoria, and the mbiru was rare and localized (Kaufiuan & Ochumba. 1993, Balirwa, 1992).

Nile tilapia was introduced into Lake Victoria over several decades beginning in the 1930’s, but did not become fully established in the Lake until the late 1960s (Balirwa, 1992). The Nile tilapia is now by far the most abundant tiiapiine in the lake. Globalization of Nile perch industry, combined with commercial extinction of all other food fishes valuable for local consumption, has made the welfare and sustainability of the Nile tilapia fishery a fundamental human health issue. Balirwa (1992), Sanderson et al. (1995), and Batjakas et al. (1997) have elaborated on the reasons for the success of Nile tilapia in the context of ecological changes that have taken place in Lake Victoria since the establishment of this species. Understanding the reasons for the success of the Nile tilapia will assist in recovery efforts of the two native conspecifics, as well as generate information important for the aquaculture of this species in the LVR.

93 As a complement to our ecological work we have carried out a molecular analysis of the Tiiapiine assemblage in the LVR and started the exploratory phase of the recovery efforts for the native tiiapiine forms. In earlier reports (Mwanja et al., 1995, Mwanja, 1996) we foimd the introduced Oreochromis niloticus to be genetically more diverse than its conspecifics in the region both within Lake Victoria and in the surroimding water bodies. All species including the O. niloticus had rather highF st values when their populations from the different water bodies in the Lake Victoria Region were compared. This led us to speculate about the population structure of Nile tilapia within Lake Victoria, particularly among the three known localities at which major introductions occurred. This is especially interesting in light of the varied histories of these introductions, and the high fishing mortality to which the species is subjected. Included in this study also, are O. niloticus populations from the Victoria Nile river by the entry into Lake Kyoga and from Lake Kyoga. Victoria Nile and Lake Kyoga populations were cut off from Lake Victoria populations in 1954 with the completion of the hydropower dam at the exit of Lake Victoria into Victoria Nile, prior to the establishment of O. niloticus in Lake Victoria. The null hypothesis tested was that Lake Victoria O. niloticus populations are panmictic and there is little differentiation observed between offspring of the various introduced populations within the lake. Rejection of this hypothesis may be possible if behavioral characteristics of the Nile tilapia (such as its sedentary nature) have precluded the mixing of source populations. If this were the case we would expect to find high levels of genetic distinctness among samples drawn from disparate portions of the lake. So the three locations of Lake Victoria (Napoleon gulf in the north, Winam gulf in the east, and Kasensero bay in the west) that were seeded with brood stock from different origins, would have a structure reflecting the difference in source of the brood stock into the three locations.

94 MATERIALS AND METHODS

Study sites

Lake Victoria (East Africa) is nearly 69,000 km* in surface area. The three areas studied included: the Napoleon gulf found in the north most part of the lake; the Winam gulf, located on the east of the lake and comprising most of the Kenyan waters; and Kasensero Bay located on the extreme southwest portion of the lake (Figure 2.7). The two populations used as outgroups were from Lake Kyoga (which is found north of Lake Victoria in central Uganda) and from the Victoria Nile (at Namasagali near the entry of the river into Lake Kyoga). The Victoria Nile is a segment of the River Nile that connects Lake Victoria to Lake Kyoga.

95 UGANDA ^

ZAIRE

KENYA

RWANDA

TANZANIA

Figure 2.7. Sites sampled for within Lake Victoria Oreochromis niloticus population analysis. Three sites within Lake Victoria: Napoleon gulf (1), Winam gulf (2), Kasensero Bay (3); one in Victoria Nile river at Namasagali (4); and one in Lake Kyoga at Bukungu (S).

96 Tissue collections

Fish specimens were caught using gillnets and seine nets. Tissue samples for DNA analysis were taken from the right epaxiai musculature of each of the Nile tilapia specimen immediately after capture. Tissue (3g) of each individual specimen was put in a vial containing 95% ethanol. After one hour the ethanol was decanted and replaced with fresh ethanol of the same concentration, sealed and labeled for shipment to the laboratory for DNA extraction. 5 to 10 individuals per sample were used in the molecular analysis. A sample size of 10 individuals per population is small for detailed allele frequency analysis for population level questions. But the RAPD technique offers an advantage over conventional markers that allows for phylogenetic and phylogeographic analysis of populations based on individuals as independent taxa. The phylogenetic analysis of populations using individuals as independent taxa rather than the overall index, typical of phenetic approach in analysis of population structure can be done based on few individuals as longer as the number of characteristics (loci in this case) is large. The resultant phyletic analysis offers a good representation of the genetic distance of individuals within and between populations. Each presence or absence of an amplified product at locus is considered as a characteristic of an individual in a population. When individuals are analyzed as independent taxa, the data allows for cladistic analysis of the variation both within and among populations generated as a cladogram

Molecular analysis

DNA extraction was performed using the standard phenol/chloroform extraction method (Sambrooke et al., 1989). The molecular analysis was done using the RAPD technique (Mwanja, 1996). Nine RAPD primers from the M set of Operon Technologies were used for amplification. The bands were scored relative to the position of a standard 123 bp DNA ladder marker. Bands were matched with corresponding standard band positions of migration, and were scored as ‘ 1’ for

97 present at that position, and ‘0’ if absent from each individual. Each band position, scored in any amplification for each primer was assumed to represent a single locus.

Data analysis

All populations were surveyed for unique bands (bands that occurred exclusively in only one population). The polymorphic loci were taken as the proportion of bands within a population that had a frequency of less 0.95. The band sharing proportions, similarity indices, and genetic distances between populations were estimated according to Nei (1972) using the computer software RAPDistance Programs, version 1.04 for analysis of RAPD patterns (Armstrong et al., 1994). The heterozygosity estimates and distribution of genetic variation between and among populations was done following the Lynch & Milligan (1994) derivations which account for the bias in RAPD data due to the dominance nature of RAPD markers.

RESULTS

The nine RAPD primers produced a total of 124 RAPD band markers. Populations were characterized by 3.2% to 9.7% of private band markers (unique alleles). The polymorphism ranged between 7% to 23 % (Table 2.16). They were significant differences in polymorphism among the five populations (X^, P<0.05). The Napoleon gulf population exhibited the highest level of polymorphism followed by that from Victoria Nile. The Lake Kyoga population had the lowest polymorphism level. There were high significant differences (t-Test, P<0.05) among the five populations in the levels of gene diversity exhibited. The Lake Victoria populations though significantly different (t-Test, P<0.05) were less different when compared to each other than to the two populations from Lake Kyoga and the Victoria Nile.

98 Napoleon Gulf Kasensero bay Nyanza Gulf Victoria Nile Kyoga Sample size 10 9 10 10 5

Proportion of unique alleles 0.065 0.032 0.057 0.081 0.097

Proportion of polymorphic loci 0.230 0.140 0.150 0.200 0.070

Heterozygosity per locus, Hw 0.074 0.036 0.042 0.055 0.020

Standard error (Hw) 0.004 0.002 0.002 0.003 0.001

Table 2.16. Proportion of unique alleles and polymorphic loci, and the mean gene diversity per locus (heterozygosity) within-populations for five O. niloticus populations.

Comparison of the total genetic diversity of the three Lake Victoria populations to that of the five populations combined (Table 2.17) showed no significant differences (t-test, P < 0.05). Only 37% of the total gene diversity within Lake Victoria was found to be due to between population differences, a level near to that of mean between-population gene diversity for the five populations considered together (Table 2.18). The population from Napoleon gulf was the most different from any of the populations studied for all pairwise comparisons when considering between-population genetic diversity. The Winam gulf and the Kasensero Bay populations had the least between-population gene diversity. The highest level of differentiation was between the Kasensero Bay population and the two Lake Victoria adjoining populations. Lake Kyoga and Victoria Nile river (Table 2.17).

99 Napoleon Kasensero Nyanza Victoria Nile Lake Gulf Bay Gulf Nile Kyoga Napoleon Gulf 0 0.031 0.039 0.025 0.021 Kasensero Bay 0 0.020 0.040 0.047 Nyanza Gulf 0 0.024 0.022 Victoria Nile 0 0.029 Kyoga 0

Table 2.17. Estimated gene diversity (estimated heterozygosity) between populations.

Genetic indices 5 populations 3 populations within Lake Victoria

Mean within-population Heterozygosity 0.045 0.050

Mean between-population 0.030 0.030 Total heterozygosity 0.075 0.080

Fst 0.400 0.370

Table 2.18. Mean genetic diversity indices (standard error given in parenthesis) for the five populations compared to the mean of the three Lake Victoria populations.

100 A neighbor-joining tree for the five populations (Figure 2.8) shows that populations clustered by lakes. Populations from the three locations within in Lake Victoria were clearly differentiated from the Lake Victoria two adjoining populations. Individuals of these two populations clustered by location and the populations were closest to each other, differentiated from the Lake Victoria populations by twice the genetic distance that joins the within Lake Victoria populations. The Kyoga population was the most distant from the Lake Victoria populations of the two populations outside of Lake Victoria, the Lake Kyoga and the Victoria Nile populations.

1 0 1 0 .0 5 8 Namasagali (Victoria Nie River) 0 .0 8 7

0 .0 9 6 Lake Kyoga

0 .0 8 3 Napolean Gulf (Northern Lake Victoria)

0 .0 3 4 Kasensero Bay (SW Lake Victoria) 0 .0 3 3

0.041 Winam Gulf (Eastern Lake Victoria)

Figure 2.8. A dendogram of Oreochromis niloticus populations from three sites w ith in Lake Victoria (Napoleon Gulf, Winam Gulf and Kasensero Bay) and one from Victoria Nile at Namasagali, and one from Lake Kyoga at Bukungu.

102 DISCUSSION

The RAPD analysis of five O. niloticus populations in Lake Victoria Region revealed that they comprise of distinct, but closely related entities. Most obvious is a trenchant dichotomy between the two Victoria Nile and the Lake Kyoga populations, and the three from Lake Victoria. While this is unsurprising, it should be noted that the Victoria Nile sample was drawn from Namasagali Pool, located at the extreme northern end of the Victoria Nile, adjacent to Lake Kyoga. Haplochromine samples collected at the same site time at this site revealed a characteristically Nilotic assemblage (dominated by rock scrapers, especially undescribed Neochromis sp.), with a few specimens of Lake Kyoga endemics (e.g., Pyxichromis orthostoma). It would be very interesting to examine O. niloticus populations closer to the base of the Owens Falls Dam as well as fiuther north at several distant locations along the Nile toward Namasagali. This suggested experiment would investigate if significant numbers of fish might actually survive passage over the dam and maintain contiguity with the Victoria Nile population.

The marked distinction exhibited by all the five populations, even among the three Lake Victoria populations, may be a reflection of the ancestral polymorphism found in different sources of seed used in the introduction of O. niloticus at the different locations. Results suggest a founder effect and lack o f or restricted genetic exchange among these populations since the time of introduction. Our earlier work involving analysis of the different lake populations of the various species in Lake Victoria Region (Mwanja et al., 1995) revealed substantial genetic differences between the two main sources o f O. niloticus seed populations (Lake Albert and Lake Edward) into Lake Victoria. The two sources were characterized by high numbers of private alleles and marked difference in levels of polymorphism and between- 103 population gene diversity. The third source. Lake Turkana, which is thought to have been a major source for the introduction of Winam Gulf population (Balirwa, 1992), is envisioned to be genetically more differentiated from the Lake Albert and Lake Edward strains. These three populations have historically been separated geographically without gene flow amongst them.

Oreochromis niloticus in Lake Victoria has had from 40 to 70 years to find its way about the lake. Our data suggests that this period of time has not been sufficient to establish a single panmictic population. Populations from three points in the lake are genetically distinct, and appear to have retained marker alleles for their respective source populations. In our later analysis, source populations into the lake will be contrasted to the three Lake Victoria populations using microsatellite markers. Regional philopatry means that effective local fisheries management can yield good results, and can resist swamping from the effects of poor practices in other parts of the lake. The down side is that the rebound of a local population from overfishing will be mostly dependent upon the reproductive capacity of that resident population. Further sampling at more closer distances (say 10 Km apart) among the three locations will be needed to understand the hierarchical scaling of O. niloticus population structure within Lake Victoria.

Such an experiment would be extremely useful, however, in the large-scale experiment in adaptive management that has recently been put in place (LVEMP. 1998). A new regional fisheries management organization has been established (Lake Victoria Fisheries Organization, or LVFO), and a World Bank-funded ecological restoration project called the Lake Victoria Environmental Management Program (LVEMP, 1998) is currently under way. With close monitoring and regular resampling o f O. niloticus populations in the lake, there is good hope for the long­ term maintenance of sustainable fisheries for this large and fast-growing exotic food fish. Long-term genetic monitoring is also essential to the conservation and reestablishment of the two indigenous tiiapiine species, which surprisingly are capable of coexisting with O. niloticus under certain conditions (Kaufman &

104 Ochumba, 1993, Mwanja et al., 1996). The precise nature of those conditions awaits clarification. Meanwhile, it may be of great interest and value to closely monitor introgression between O. esculentus and O. niloticus as one measure of the nature and degree of their interaction.

105 CHAPTER 3

Genetic Population Structure using Microsatellite Loci Analysis

106 SYNOPSIS

Chapter 3 represents the central thesis of these studies. The aim of this chapter was to define the population genetic structure for each of the tiiapiine species in the Lake Victoria Region, and to obtain insights into the mechanisms responsible for varying genetic structures of the different species in these waters. The Lake Victoria Region consists of three major lake systems: (a) the Lake Victoria basin, made up of five subsystems (b) the Lake Kyoga system, with Lake Kyoga and a multitude of small satellite lakes surrounded by a vast swamp; (c) the Lake Ed ward/George system with a number of surrounding small water bodies, such as Lake Kabaleka and Lake Saka. The study sought to answer several basic population genetics questions about the tiiapiine fauna of these systems: what is the level of polymorphism, heterozygosity, population differentiation and subdivision, and gene flow among populations within each species. The study also attempted to establish the relationship between genetic relatedness and geographic association among populations in the three lake systems and within each of the Lake Systems. Comparisons were based on analysis of variation at ten microsatellite loci for the four species of Oreochromis, and on a subset of seven loci in case of the two species of Tilapia. (The PCR primers amplified the ten microsatellite loci for the four species of Oreochromis, but produced products, with slight modification of amplification conditions, for only seven of the ten loci for species of Tilapia. The PCR primers used were originally designed and developed fi-om a DNA library o f O. niloticus by Lee and Kocher (1996). The chapter presents the analysis of the population genetic structure of each tiiapiine species in the Lake Victoria Region as an independent paper/section. There 107 are five sections for the six species currently found in the Lake Victoria region. The region contains two endemic species. Oreochromis esculentus and O. variabilis; two introduced non-indigenous Oreochromis species, O. niloticus and O. leucostictus; and two non-indigenous species in the genus Tilapia, T. zilli and T. rendalli. The last two species were combined into a single section, including the analysis of the genetic interaction between the two species, because only one population of T. rendalli had sample sizes sufficient for genetic structure analysis. The papers were written in the following order: O. niloticus, O. esculentus, O. leucostictus, O. variabilis, and the last section considered the results from the two Tilapia species. All species were found to have populations with high microsatellite loci variability, wit high values for both allele diversity and heterozygosity. All species except O. variabilis were differentiated by sub-regional grouping of the water bodies and/or by basins. O. variabilis showed no particular trend and associated of its populations including those from within Lake Victoria. Comparison to T. rendalli showed clear differentiation between the two species and an indication of genetic interaction between the two species. Chapter 4 focuses on the contrasts of the genetic structures of the species.

1 0 8 1. Genetic evaluation of the ecological dominance of Lake Victoria Region by Oreochromis niloticus using microsatellite markers

INTRODUCTION

Oreochromis niloticus has become the most dominant tiiapiine species in the Lake Victoria region and is second to the Nile perch, Lates niloticus, in economic importance in the region (Ogutu-Ohwayo, 1990; Balirwa, 1992; Stiassny, 1996). O. niloticus has also taken global spotlight as the species of choice for fish farming and introduction into water bodies for purposes of augmentation of the natural fisheries. In 1996, the United Nations world food and agriculture organization (FAO) estimated the 'Tilapia culture’ to contribute over 600,000 metric tons of fish annually. In the Lake Victoria region, exploitation of this species is still largely from the natural waters. O. niloticus was initially introduced into Lake Victoria in the early 1900s and was first recorded in the lake in 1920s (Trewavas, 1983). Trewavas postulates that O. niloticus may have gotten in the lake through River Kagera via Lake Bunyonyi following the introduction into that lake fi'om Lake Edward. According to Fryer and lies (1972), intentional introduction of O. niloticus into the Lake Victoria basin was done in the late 1930s following the repeated failure of the attempt to introduce Tilapia {Oreochromis) spirulus nigra into the Koki lakes (Lake Victoria basin, southwest of the Lake Victoria). Tilapia {Oreochromis) niloticus was introduced in the Koki lakes and immediately became successfully established, and to date 109 flourishes and dominates the Koki lakes. This success was a lesson for the fisheries managers then, in versatility of O. niloticus, following which O. niloticus was introduced virtually into all water bodies in Uganda (Fryer, 1972; Fryer and lies, 1972). The records of the actual exercise of introduction of exotic species into Lake Victoria region waters are scanty and largely uninformative (EAFFRO, 1947-1966). The origin of the brood stock for introduction, number of individuals used, the number of times the stocking was done and the process of augmentation prior to the introduction are not known. Oreochromis niloticus is known to have come from multiple sources, and was deliberately introduced starting in the 1950s and repeatedly by massive stocking into Lakes Victoria and Kyoga up to mid 1960s (Welcomme, 1965, 1966, 1967). By late 1960s O. niloticus had become established and to date is the most ecologically and economically dominant tiiapiine species in the Lake Victoria region waters in both the main lakes and their surrounding satellite lakes (Balirwa, 1992). Its dominance, ecological versatility and trophic virtuosity together with the ability to withstand the dramatic limnological changes have made O. niloticus the mainstay of Lake Victoria region tiiapiine fishery (Balirwa, 1992; Sanderson et al., 1995; Mwanja, 1996). In this study the genetic structure of the established populations of Oreochromis niloticus in the Lake Victoria region was evaluated and contrasted to the genetic structure of the populations from the putative origins of this species (Lakes Albert, Edward and George) into the region. In chapter two we looked at the phylogeography of O. niloticus and concluded that the populations were largely to be closer to the Lake Edward population and while the Lake Kyoga basin populations were closer to Lake Albert. Here attempt was made to establish the exact allelic differences between the source and introduced populations using microsatellite loci. The codominant nature of microsatellite markers allows for quantification of the genetic differences at specific loci unlike in case of the RAPD analysis based on presence/absence of bands where only the dominant bands can are amplified in heterozygous conditions. The RAPD technique is useful though - with some 110 advantages over microsatellite markers and other conventional markers, especially, in use of individuals as independent taxa and alleles as characteristics in phylogenetic analyses (Chapter 2). Attempt was made to answer the question whether the rapid and large increase in population size of a species, established from a narrow brood stock, can overcome the effects associated with small populations and founder effects in population genetics (Fuerst and Maruyma, 1986). Does rapid increase in population size translate into diversity? Does rapid expansion and ecological dominance increase the chances of retention of the original polymorphism/diversity despite the small brood stock? In the first instance postulation was made that the increased breeding and high recruitment from the rapid expansion ensures that most genetic variation is retained and enhanced by the high rate of recombination resulting in equally or even more genetically diverse population compared to the brood stock. In the second instance, the rapid expansion and resultant ecological dominance (resultant large and panmictic population) minimize the effects of random genetic drift which greatly slows the rate of loss of the original polymorphism due to random fixation reducing the differentiation between the source and introduced populations. To reach answers to questions regarding distribution of the genetic variation and history of introduced species in natural populations, factors such as differences in stocking regimes and number of times the introductions were carried out, have to be taken into accoimt. Unfortimately such information is lacking but with the numerous small lakes, and the several main lakes and the different introduction histories in the LVR, there has been natural control for the many such factors. For example, in LVR we can compare populations in waters stocked 40 to 70 years back and repeatedly over several decades (Napoleon gulf - Lake Victoria) to populations from waters that where stocked only 30 years ago in a single regime (Kyoga lakes). And we can compare the above to those that have not had any non-indigenous species introductions at all. We can compare populations where hybridizing congeners were introduced in the same waters to populations where congeners don’t coexist. To explain the differential ecological success of the tiiapiine species in the LVR III following the long and the varied introduction history presents an academic challenge rarely found in any natural system. To untangle such a history, and begin to understand ecological and genetic mechanisms responsible for the resultant population structures, the genetic variation has to be assessable and easier to quantify across populations and the different species.

MATERIALS AND METHODS

Sample collection Fish were caught using gillnets and seine nets from 15 locations in three lake basins of the Lake Victoria Region (Kyoga, Victoria and Edward/George)(Table 3.1 and Figures 1.1, 1.2 and 1.3 in chapter 1) and from Lake Albert. For the purposes of this study, each sample was considered as representing a single panmictic population in that location, that is the entire lake expect for Lake Victoria where we had three samples (Figure 2.7 in chapter 2). Sample sizes ranged between 8 and 21 individuals (Table 3.1). For DNA analysis 2~3g of muscle tissue were taken from each individual specimen on the right epaxiai muscle of the fish specimen, placed in a vial with 95% ethanol for one hour, and after the ethanol was exchanged for fresh one, labeled and stored until DNA extraction. Detailed information about specimens and the individual specimens used in the study is archived in Professor Fuerst's Laboratory at Ohio State University, Columbus.

112 Lake Abbreviation Basin Sample size

Kyoga KON Kyoga 11 Lemwa LEM Kyoga 8 Napoleon Gulf NAP Victoria 21 Edward EDN Edward/George 11 Albert ABN Albert 18 Nyanza (Winam) gulf NGN Victoria 10 Kasensero (SW L. Victoria) KAS Victoria 9 Victoria Nile River NAG Victoria 18 Kachira KCN Victoria 20 Bisina BISN Kyoga 10 Mburo MBN Victoria 20 Nabugabo NAB Victoria 20 George GGN Edward/George 20 Nakuwa LWN Kyoga 19

Table 3.1. Populations sampled, basin of origin and the sample sizes.

Molecular analysis

DNA extraction was done using the standard proteinase K, phenol/chloroform protocol (Sambrook et al., 1989) and the NaOH extraction method (Zhang and Tiersch, 1993). A total of 45 pairs of microsatellite primers developed by Lee and Kocher (1996) from Oreochromis niloticus DNA library were screened, among which we chose a set of 10 primer pairs. The primers chosen were those that worked for all populations/species and generated clear and reproducible amplifications within a size

113 range scorable on 6% polyacrylamide gel. Choice of primer pairs was also dependent on their use in other tiiapiine species in the LVR since, in a later manuscript, we compare the genetic structures of all the tiiapiine species in LVR. The sequence, annealing temperature and number of cycles of amplification we used are shown in Table 3.2. For PCR analysis each forward primer was end-labeled with P32 radioisotope using T4 polynucleotide kinase (GIBCO BRL). PCR reactions were done in a final volume of 10 ul containing 25ng of genomic DNA, 0.3 mM of each primer, 100 mM of deoxynucleotide triphosphate (dATP, dTTP, dCTP, and dGTP), 3 mM of MgCb, and 0.375 units of Tag polymerase (GIBCO BRL). Amplification conditions were 5 minutes hot start at 95°C, 30 cycles at following sequence: 45 sec at 94°C, 30 sec at appropriate annealing temperature (Table 3.2), and 30 sec at 72®C. This was followed at the end of the 30 cycles by a 6 minutes extension at 72°C. Amplification products were electrophoresed in 6% polyacrylamide sequencing gels with 7M urea, dried and visualized using autoradiography. Sizing o f the amplification products was based on the sequencing of pUClS along with the microsatellite PCR products.

114 Locus Primer pair sequences annealing temp cycles

L1NH231 A: GCCTATTAGTCAAAGCGT 56°C 30 B: ATTTCTGCAAAAG l 1 1 ICC UNH222 A. CTCTAGCACACGTGCAT 54°C 30 B: TAACAGGTGGGAACTCA UNH104 A; GCAGTTATTTGTGGTCACTA 54°C 30 B: GGTATATGTCTAACTGAAATCC UNH118 A: CAGAAAGCCTGATCTAATATT 56°C 30 B: TTTCAGATACAl rriATAGAGGG UNH136 A: TGTGAGAATTCACATATCACTA 5I°C 30 B: TACTCCAGTGACTCCTGA UNH142 A: CTTTACGTTGACGCAGT 58°C 30 B: GTGACATGCAGCAGATA LTNH169 A: GCTCATTCATATGTAAAGGA 5TC 30 B: TATTITT IGGGAAGCTGA UNH176 A: GATCAGCTCTCCTCTACTTA 58°C 30 B: GATCTGATTTCTTATTACTACAA UNH178 A;GTCACACCTCCATCATC 58“C 30 B: AGTTGTTTGGTCGTGTAAG UNHI49 A; TTAAAACC.AGGCCTACC 58°C 30 B: GTTCTGAGCTCATGCAT

Table 3.2. Microsatellite primer sequences and reaction conditions for 10 loci.

Data analysis Microsatellite loci variability was measured by number of alleles amplified for each locus, allele size range and distribution within that range, allelic frequency

115 distribution and level of differentiation among individuals revealed by each set of locus markers based on both Fst and Rst models. The loci were also evaluated for the level of heterozygosity among all individuals at each locus and all loci combined. Markers generated were tested, using the probability test for significance in deviation from the Hardy-Weinberg equilibrium. Both the intra- and the interpopulation variability were assessed based on level of the observed heterozygosity, the proportion of private alleles and by testing for significance of genic and genotypic differentiation among individuals within and between populations. Population subdivision was estimated based on F statistics (Weir and Cockham, 1984). Comparison was made to the Fst analogue, Rst, which unlike the Fst based on the infinite allele model, was based on the stepwise mutation model (Slaktin 1995). Phyletic relationships among populations were estimated using three genetic distance measures based on Fst, Rst, and on the proportion of shared alleles (ps) standardized as 1-ps. Genetic distances were calculated using Microsat 1.5 computer software program developed by Minch E fhttp://stanfbrd.edu/mirosat). The dendograms were constructed using neighbor joining method (Saitou and Nei. 1987) using computer software program MEGA (Kumar et al., 1993).

RESULTS

Microsatellite loci variability All loci, except UNH178, were heterozygote deficient though they were all highly polymorphic with an average of 18 alleles per locus among the 15 populations (Table 3.3). The least polymorphic was locus UNH136 with seven alleles and the most polymorphic was UNH169 with 39 alleles. All loci combined had a mean of heterozygosity of 0.555. Locus UNH136 had significantly lower heterozygosity (0.044) compared to the rest. Among the rest locus UNH142 had the lowest heterozygosity (0.381) and UNHl 18 had the highest (0.836). Locus UNHl 18 and UNH222 were the least discriminating among individuals between populations based on Fst values, and locus UNHl36, UNH222, and UNHl76 were the least based on 116 Rst values (Table 3.3). In both cases the above mentioned loci had significantly lower values compared to the average of all loci (Microsat 1.5). Based on Genpop3.1 computer software, five of the loci showed negative values for Fwc(is) and the Fwc(is) was generally low for 10 loci combined (Table 3.4); locus UNH136 has the least Fwc(st) value which is significantly different from that of all loci together.

117 1.0CUS Fsl Var Fst Het Rst Sid Avg Hel Toi Hel Avg Var Tot Var Avg All Tot All Avg Ran Tot Ran A v g M a x Tot Max Avg Enl Tot Enl l/NH23t 0.197 0.191 0.141 0.491 0615 15.343 17.434 5.3 16 11.200 19 97.600 102 0.420 0.504 UNII222 0.060 0.014 0.071 0618 0751 7.185 7.803 6.3 19 9429 29 95.286 98 0.645 0.533 UNIII04 0.109 0.130 0.361 0.694 0798 21.159 36.074 5.7 17 13.600 33 79.600 97 0.611 0.554 tw ill IS 0045 0.079 0.227 0136 0.907 33.588 42.668 103 26 20214 39 103.000 IIS 0.676 0.720 UNIII36 0.017 0.202 0.014 0.044 0055 0.181 0.232 1.6 7 1 133 9 88.467 9 0 0.083 0.074 UNIIM2 0.457 0.445 0.231 0.311 0685 2.236 2.789 3.5 16 4.467 17 82.000 89 0.482 0.504 UNIII69 0.015 0.120 0.116 0129 0942 70.939 81.772 10.7 39 26.533 43 97.733 109 0.626 0.843 UNHl 76 0.069 0.142 0.097 0.549 0640 3.759 4.483 4.8 14 7.333 27 75.867 8 7 0.551 0.419 UNHl 71 0.256 0.239 0.141 0.497 0653 1.734 2.319 3.3 9 4 133 17 65.800 7 7 0.654 0.461 UNHI49 0.119 0.139 0.217 0.539 0.626 17.757 18.544 4.6 15 8714 32 80.143 84 0.499 0.436 A v e r a g e 0.141 0.177 0.171 0.555 0.667 17.388 21.412 5 .6 18 10.676 27 86.550 95 0.525 0.505

M Table 3.3. Diveraity indices for microsaleiiite loci of Ofeochtomis niloticus populations in Lake Victoria Region Locus Fwc(is) Fwc(st) Fwc(it) UNH231 0.095 0.194 0.271 UNH222 -0.034 0.064 0.032 UNH104 -0.036 0.110 0.078 UNH118 0.012 0.047 0.058 UNH136 0.342 0.008 0.347 UNHl 42 0.097 0.455 0.508 UNHl 69 0.154 0.081 0.222 UNHl 76 -0.028 0.070 0.045 UNHl 78 -0.231 0.261 0.091 UNH149 -0.103 0.123 0.033 All loci 0.002 0.150 0.152

Table 3.4. F-statistics are estimated (Fwc) as in Weir and Cockerham (1984). Genepop (Version 3.1b). Number of populations detected: 15, number of loci detected: 10.

Microsatellite population variability and differentiation All populations were polymorphic for all loci except locus UNHl36, with an average of 5.6 alleles per locus (Table 3.5). Using the probability test (Fisher’s method) for all loci and all populations, it showed that there was a significant deviation from Hardy-Weinberg equilibrium (All locus, all populations, X2 = infinity, df =214). Table 3.8 gives the unbiased estimates of the Hardy-Weinberg exact P- values using the Markov chain method. All populations were heterozygous with

119 mean within population heterozygosity of 0.55, the Lake Kyoga population had the lowest and Kasensero population (south west of Lake Victoria) had the highest (Tables 3.5 and 3.7). The test for heterozygote deficiency shows all populations, except that of Lake Bisina, to be deficient in heterozygotes. Based on Fisher's method (Genop3.1) Table 3.6, shows significant genic differentiation among populations. Populations had 30% of the alleles as private, with 13 populations having less than five private alleles. The two exceptions were the Lake George population with eight and the Lake Gigate population with 12 (Table 3.7). Table 3.9 shows the pairwise Fst values among populations. In general populations were more differentiated between lake basins than within lake basins. Of specific mention was the Fst value between Lake George and Lake Edward populations (0.074) and that between Lake George and Lake Albert populations (0.063).

120 Taxon Fsl Var Fsl Hel Rsi SidAvgHd Toi Hel Avg VarToi Var Avg Ail Toi AllAvg Ran Toi Ran Avg Max TdMaxAvg Enl Toi Enl KON 0.000 0.419 0.000 0439 0897 10.973 104.003 4.9 30 9.6 39 86.556 100 0.411 0 738 TEM 0000 0 464 0000 0492 0919 17707 107.18742 30 78 37 83 900 100 0 483 0 793 NAP 0000 0347 0000 0.603 0933 16 404 114 568 63 37 110 48 87 600 108 0 568 0 788 EDN 0.000 0.361 0.000 0.397 0934 1316 115.994 3.4 34 19 52 86200 115 DOM D 779 ABN 0.000 0.337 0.000 0.600 0933 10349 96.816 6.2 33 92 38 84.900 100 0618 0836 NGN 0.000 0.409 0.000 0.333 0939 16.907 126.964 4.2 28 97 42 83.800 103 0546 0 800 KAS 0.000 0.326 0.000 0.633 0943 16.171 132.978 56 34 101 42 86600 104 0595 0 841 NAG 0.000 0.431 0.000 0.519 0913 17.922 101.048 5.1 32 9 9 41 86 300 103 0504 0 759 KCN 0.000 0.361 0000 0.391 0936 17.362 123231 7.4 39 14.1 46 90.300 108 0548 0 806 BISN 0.000 0.411 0.000 0333 0 920 41226 162.763 4.7 32 117 57 86.200 109 0494 0713 MSN 0.000 0.420 0.000 0 325 0.903 14.774 94.041 6.2 28 99 37 82.873 100 0496 0 751 kJGAG 0.000 0.371 0.000 0.594 0944 29.053 100.488 7.6 38 155 41 89.000 103 0476 0 849 ~NAB 0000 0.441 0.000 0.314 0919 14701 III5I4 4.7 34 II 3 43 87.600 104 0471 0 760 GGN 0.000 0.379 0.000 0.380 0934 13 073 128.398 7.4 39 14.8 48 87.800 108 0491 0.792 LWN 0.000 0.473 0.000 0.476 0907 11.877123639 3.8 29 58 46 84000 106 0512 0718 Avg 0.000 0.404 0.000 0.552 0924 17 268 116 243 36 33 107 44 86.373 103 0 522 0782

Table 3.5 Diversity indices for populations of Oreockromis niioticus Locus P-value S.E.

UNH231 0.000 0.000 UNH222 0.000 0.000 UNHl 04 0.000 0.000 UNH118 0.000 0.000 UNH136 0.153 0.027 UNH142 0.000 0.000 UNHl 69 0.000 0.000 UNHl 76 0.000 0.000 UNH178 0.000 0.000 UNH149 0.000 0.000 Tests combination (Fisher’s method): CHI2 : Infinity, Df :20 Prob.: Highly significant.

Table 3.6. Genic differentiation testing, Genepop (Version 3.1b) using Markov chain parameters: dememorization as 1000, batches as 50, and iterations per batch as 1000.

122 Allele Alleles Private Observed Population Code Loci number per locus Alleles Heterozygosity Kyoga (KON) 9 43 4.9 1 0.46 Lemwa (LEM 10 42 4.2 1 0.49 Napoleon gulf (NAP) 10 63 6.3 5 0.60 Edward (EDN) 10 54 5.4 4 0.60 Albert (ABN) 10 62 6.2 4 0.60 Nyanza Gulf (NGN) 10 42 4.2 1 0.56 Kasensero (KAS) 10 56 5.6 3 0.64 Victoria Nile (NAG) 10 51 5.1 0 0.52 Kachera (KCN) 10 74 7.4 4 0.59 Bisina (BISN) 10 47 4.7 4 0.54 Mburo (MBN) 8 50 6.2 3 0.53 Gigate (GAG) 10 76 7.6 12 0.59 Nabugabo (NAB) 10 47 4.7 1 0.51 George (GGN) 10 74 7.4 8 0.58 Nakuwa (LWN) 10 38 3.8 3 0.48

Table 3.7. Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreockromis esculentus populations.

123 Results by population (test muiti>locus) P-val S.E. Kyoga (KON) 0.006 0.003 Lemwa (LEM) 0.870 0.017 Napoleon gulf (NAP) 0.283 0.047 Edward (EDN) 0.353 0.046 Albert (ABN) 0.409 0.041 Nyanza gulf (NGN) 0.080 0.009 Kansensero (KAS) OJ239 0.035 Victoria Nile (NAG) 0.005 0.004 Kachira (KCN) 0.141 0.032 Bisina (BISN) 0.998 0.001 Mburo (MBN) 0.001 0.000 Gigate (GAG) 0.004 0.004 Nabugabo (NAB) 0.259 0.026 George (GGN) 0.130 0.024 Nakuwa (LWN) 0.532 0.028

Table 3.8. Unbiased estimates of Hardy-Weinberg exact P-values using the Markov chain method. By Genepop (Version 3.1b) for Hardy-Weinberg test, P- vaiues are associated with Ho = Hardy-Weinberg equilibrium.

124 Table 3.8 continued

Results by locus (test multi-pop) UNH231 0.000 0.000 UNH222 0.819 0.024 UNHl 04 0.726 0.029 Ü N H II8 0.109 0.003 UNH136 0.001 0.000 UNHl 42 0.000 0.000 UNHl 69 0.000 0.000 UNHl 76 0.592 0.002 UNHl 78 1.000 0.000 UNHl 49 0.843 0.015

125 Pop KON LEM NAP EDN ABN NGN KAS NAG KCN BIS MBN GAG NAB GGN LWN _____

LEM 0.071 NAP 0.172 0.147 EDN 0.258 0.199 0.085 ABN 0.193 0.143 0.044 0.079 NGN 0.064 0.082 0.097 0.131 0.118 KAS 0.111 0.079 0.073 0.098 0.088 0.012 NAG 0.037 0.058 0.134 0.197 0.139 0.059 0.046 KCN 0.243 0.174 0.121 0.104 0.085 0.134 0.075 0.156 BIS 0.097 0.105 0.131 0.168 0.146 0.064 0.054 0.078 0.167 MBN 0.281 0.215 0.166 0.082 0.142 0.169 0.134 0.203 0.179 0.199 GAG 0.253 0.212 0.138 0.150 0.113 0.132 0.107 0.188 0.099 0.180 0220 NAB 0.201 0.197 0.110 0.195 0.167 0.131 0.115 0.154 0.215 0.194 0.258 0.206 GGN 0.224 0.177 0.084 0.074 0.063 0.120 0.072 0.147 0.024 0.146 0.156 0.115 0.181 LWN 0.098 0.101 0.181 0231 0.204 0.120 0.136 0.103 0 249 0.143 0.276 0.273 0.196 0230

Table 3.9. Fst is estimated as in Weir and Cockerham (1984) for all loci using Genepop (Version 3.1b): Pairwise IIS for population pairs.

Phyletic relationships among populations Figure 3.1 shows the dendogram based on Rst distance measure. Figure 3.2 is a dendogram based on Fst distance measure and Figure 3.3 is dendogram based on proportion of shared alleles (ps) standardized as I - ps (Microsat 1.5). In all the three dendograms the Kyoga populations are the most derived based on the Lake Albert

126 population as the outgroup. For the Rst dendogram (Figure 3.1), the Lake Victoria basin populations clustered together and closest to the Lake Edward and George populations while the Kyoga populations were divided into two distinct clusters. The majority of the Kyoga populations (including most of the satellite lakes’ populations) formed the most derived group. The Lake Kyoga population, the Victoria Nile population (that is in direct connection with Lake Kyoga and not Lake Victoria since the completion of the Owen Falls’ hydroelectric plant in 1954) and that of one of the Kyoga lakes. Lake Gigate were phyletically the closest to Lake Albert population. The latter were between the Lake Albert and Lake Victoria basin populations on the dendograms. The dendogram based on Fst (Figure 3.2) had nearly the similar pattern like that base don Rst only that the former had the putative populations (Lakes Edward, George and Albert) more distant from each other and closer to the introduced populations. In the dendogram based on proportion of shared alleles (Figure 3.3) Koki populations in the two dendograms above were closest to the Lake Edward and Lake George populations than to the rest of the Lake Victoria populations. What is a little different with dendogram in Figure 3.3 is that in this case the Lake Victoria populations were split into three. A number of them (Lake Victoria basin populations) cluster just outside the most derived Lake Kyoga basin group, followed by the Koki populations which as stated above cluster aroimd populations from Lake Edward and George. The third branch (split) of Lake Victoria populations was the Napoleon gulf population and was the closest to the outgroup (Lake Albert population), the only time in the three dendograms that Napoleon gulf was closely related to Albert and not with the rest of the Lake Victoria basin populations. The other notable observation was that the three within Lake Victoria populations (NAP, NGN, KAS) didn’t cluster together, and only in two of the dendograms (Figures 3.2 and 3.3) did at least two out of the three appear closest to each other.

127 LEM - Lemwa

NGN - Winam Gulf BIS - Bisina

LWN - Nakuwa

NAP - Napoleon Gulf NAB - Nabugabo

KAS - Kasensero

EDN - Edward

MBN - Mburo

GGN - George

KCN - Kachira

GAG - Giagate

NAG - Victora Nile

KON - Kyoga

ABN - Albert

Figure 3.1. Pyhletic relationships among Oreochromis niloticus populations of Lake Victoria region based on Rst distance measure. Distances were calculated using MICROSATl.S compute progran and the dendogram was drawn using MEGA.

128 KON - Lake Kyoga

LWN - Lake Nauwa

LEM - Lake Lemwa

NAG - Victoria Nile

BIS - Lake Bisina

NGN - Lake Victoria (Winam Gulf)

KAS - South west Lake Victoria NAP - Lake Victoria (Napoloen gulf)

NAB - Lake Nabugabo

KCN - Lake Kchira

GGN - Lake George

GAG - Lake Gigate

EDN - Lake Edward

MBN - Mburo

• ABN - Lake ALbert

Figure 3.2. Phyletic relationships among Oreochromis niloticus introduced populations of Lake Victoria region relative to the putative origin populations from Lakes Edward, George and Albert based on Fst distance measure using Lake Albert population as the root. Distances were calculated using Microsat 1.5 and phylogram was drawn by MEGA computerprograms.

129 ABN- Lake Albert

NAP - Lake Victoria (Napoleon Gulf)

GAG - Lake Gigate

NAB - Lake Nabugabo

NAG - Victoria Nile

LWN - Lake Nakuwa

KON - Lake Kyoga

LEM - Lake Lemwa

BIS - Lake Bisina

NGN - Lake Victoria (Winam gulf)

KAS - Southwest Lake Victoria

EDN - Lake Edward

MBN - Lake Mburo

KCN - Lake Kachira

GGN - Lake George

Figure 3.3. Phyletic relationships among Oreochromis niloticus introduced populations of Lake Victoria region relative to the putative origin populations of Lakes Edward, George and ALbert based on proportion of shared alleles. 130 DISCUSSION

This study is a complement to the various theories that have been put forward (Ogutu-Ohwayo, 1990; Balirwa, 1992; Sanderson et al., 1995; Stiassny, 1996; Mwanja, 1996; Batjakas, 1997) for the ecological dominance of Oreochromis niloticus in Lake Victoria region. All the theories given so far seem very plausible and may explain the dominance of O. niloticus in Lake Victoria region waters. Most of the theories above have essentially been from the ecological, and especially the trophic, point of view. In here we extend the argument to include explanation based on genetic viability and variability among populations of O. niloticus in the LVR waters. The postulation was that the higher genetic variability due to the rapid expansion, repeated and multiple sources of seed, and genetic interaction with the native congeners has offers O. niioticus better evolutionary flexibility to establish where congeners have failed. The higher genetic variability, together with the ecological versatility, are attributes not shared with any other tilapiine species in the region. By exclusion then, the combination of higher genetic variability and ecological versatility were the main factors that led to the ecological dominance of O. niloticus in LVR waters. Its hard, like in all population genetics studies, to directly link the success of a species to its genetic diversity, but ecological success of a species in such diverse aquatic system may be reflected in the genetic diversity of its populations in the system. So in this study comparison of diversity within and among populations should reflect the ecological performance of O. niloticus. Higher genetic variability, low population subdivision and high rate of gene flow between populations, are some of the attributes that may be directly linked to the ecological dominance of a species. We looked at 15 populations of Oreochromis niloticus in the Lake Victoria region using microsatellite markers at 10 loci. All loci were found to be polymorphic among all populations save for locus UNHl 36 which although with seven alleles was 131 largely monomorphic within populations. The deviation from Hardy-Weinberg equilibrium was to varying degrees among populations due to null alleles. Rerun of primers with less stringent PCR conditions in most cases didn’t improve the situation. New design of less stringent primers and simulation of hyper populations would address concerns for the deviation from Hardy-Weinberg equilibrium, but for the purposes of this study standardization and automation of reaction conditions allowed us to compare populations without under or over representing any of them in allele frequencies. All populations, both introduced and those from the putative origins were heterozygous with high allelic diversity (3.8 to 7.6 alleles per locus on average). Five of the 10 loci indicated outbreeding as revealed by the negative values of Fis and Fwc (is) and the low value (0.002) for Fis for all loci combined. The populations had Fwc (st) value of 0.15 and a significant proportion of private alleles. They were no marked differences in heterozygosity between the introduced populations and the populations from Lakes Albert, George and Edward. Comparison between the populations from the main lakes (Victoria, Kyoga, Albert, George and Edward) to the populations from their satellite lakes showed nearly similar level of heterozygosity but some of the satellite lakes had significantly higher allelic diversity compared to the main lakes. This was especially so with the Kyoga lakes, a region in which we found the highest incidence of intermediate morphs between tilapiine species (impublished data). The higher allelic diversity found in some of the satellite lakes was thought to be a result of introgressive hybridization between Oreochromis niloticm and native species. Changes in genetic diversity immediately following introduction will be most noticeable in allelic diversity, normally it takes several generations before noticeable differences in heterozygosity levels arise between the source and the introduced populations (Fuerst and Maruyma, 1986). In case of the LVR O. niloticus populations, allele diversity of introduced populations increased more than populations lost alleles, as the case would have to be for small founder populations. The rapid expansion and genetic interaction between O. niloticus and native tilapiine

132 species may be the two most important factors responsible for the current population genetic structure exhibited by O. niloticus. Comparison of the two putative populations clearly distinguished the two groups (Lake Albert and Lake Edward/George populations), though Lake George had a lower pairwise value of Fst with the Lake Albert population than with that from Lake Edward. This peculiarity like in our past studies using RAPD markers (Fuerst, 1997) was associated with the introduction fervor of the 1950s when the Oreochromis niloticus was transplanted from Lakes Albert, George and Edward to nearly every water body in the region. The close similarity between Lake George and Lake Albert populations may be explained by this introduction frenzy, more than likely the Lake Albert strain was introduced into Lake George. Using the three distance measures allowed for the various views on evolution of microsatellites markers (Slatkin, 1995). Fst distance measure is more of the convention method based on the infinite allele model (Wright, 1951). Rst distance measure was developed following the stepwise mutation model (Slaktin, 1987) that is thought to reflect a more exact nature of the mutation of microsatellite markers (Slaktin, 1995). Use of a genetic distance measure based on proportion of shared alleles allowed us to maintain use of allele diversity, and presence or absence of particular alleles reflects the exchange between populations compared to differences in allele frequencies and overall heterozygosity. So whereas the first two genetic distance measures were used because of the difference in underlying models on which they two were based, the genetic distance by proportion of shared alleles was used to discern the genetic interaction between populations and species. In the analysis, the three distance measures were consistent in overall phyletic relationship among the four groups: Lake Kyoga basin populations. Lake Victoria basin populations. Lake Edward/George populations and Lake Albert population. Using Lake Albert population as an outgroup in all the three measures, the Lake Kyoga populations were the most derived, while the Koki lakes’ populations were phyletically closer to the Lake Edward/George populations than they were to the Lake Albert population. Differences between Lake Kyoga and Lake Kyoga satellite lakes 133 may be a reflection of the accelerated differentiation as a result of the introgressive hybridization in the satellite lakes. Hybridization is no longer a factor in Lake Kyoga with the displacement of the native species out of the lake following the establishment of O. niloticus and the Nile perch. Among the Lake Victoria basin populations, the populations of Lake Kyoga, Victoria Nile and Napoleon gulf were closer to the Lake Albert population than to Lake Edward/George populations. Both the Nabugabo lakes’ populations and the Koki lakes’ populations were closer to Lake Edward/George populations than to the Lake Albert population. The same is true for the population from the Southwest part of Lake Victoria (Kansenero population) but not so for Napoleon Gulf. The differences in quality and quantity of the brood stock into the respective waters could be exhibited in the allelic diversity. Multiple sources of the brood stock would result in populations with higher allelic diversity in the short term before equilibrium is established. Unfortimately, this study as only the second one to follow genetic population structural changes in the course of evolution of the Lake Victoria region fishery, the other being: the RAPD analysis of genetic variability of LVR tilapiine species ( Mwanja, 1996). The earlier ecological work (Fryer and lies, 1972; Lowe-McConnell, 1987; Ogutu-Ohwayo, 1990; Balirwa, 1992) stipulated to the dominance of Oreochromis niloticus giving reasons as to why the species did so well despite the iimnological changes, heightened fishing pressure, and especially in waters where congeners had failed. But comparison of the population structures was not as detailed and the role o f genetic diversity in the success of O. niloticus was only hypothesized. Certainly high genetic diversity has come to bear on or at least to reflect the ecological dominance of O. niloticus in Lake Victoria region waters. The relation between ecological dominance and genetic variability will become more evident when we compare and contrast the genetic population structures of all tilapiine species in the region (chapter 4).

134 2. Genetic Population Structure of Remnant Populations ofOreochromis esculentus of Lake Victoria Region based on Microsatellite markers

INTRODUCTION

The ecological dominance of alien species coupled with the change in the Iimnological conditions and increase in human settlement in the riparian lands resulted in the marginalization of the native tilapiine species in the LVR. Oreochromis esculentus was completely displaced from the two larger lakes (Victoria and Kyoga) while Oreochromis variabilis shrunk to small pockets of individuals in Lake Victoria (Mwanja 1996). Fortunately, in both the Lake basins. Lake Kyoga and Lake Victoria, there are several satellite water bodies surrounding the larger lakes that still contain evolutionary significant population sizes of the native tilapiine species. In a few of these satellite lakes native tilapiines occurred naturally but in a majority of the satellite lakes native species were transplanted into them in an effort to expand the fishery (Fryer and lies, 1972). The problem with this situation is that several of these introduced populations, both the alien and transplanted natives of the LVR, were introduced from a small parental base after multiplication of a few individuals in the augmentation ponds (EAFFRO 1947 - 1966; Balirwa, pers. comm). In addition, the native species shared the waters with their non-indigenous congeners, a situation that put the native species at increased risk of depletion due to congeneric competition, hybridization, in addition to the fishing pressure.

135 As part of the recovery effort of the original native commercial species of LVR. the objective was to establish the ecological and genetic status of Oreochromis esculentus remnant populations. In order to enhance the ecological status of O. esculentus, there is need to establish how genetic variation o f the remnant populations is shared amongst populations and the levels of within population genetic variability. Assessment of the extant genetic diversity would highlight the importance of the satellite water bodies in preserving the remnant biodiversity of the native tilapiine species. In the first part of these studies (chapter two) using the RAPD markers, O. esculentus populations were foimd to be subdivided along basins, and with measurable genetic differences between populations that were and those that were not coexisting with Oreochromis niloticus. To follow the changes and differences in the genetic structure and phylogeography of O. esculentus populations at a more finite and quantifiable level we chose to use the microsatellite markers. Microsatellite markers have all the advantages of RAPD markers to a fair degree and do overcome nearly all the drawbacks of the RAPD technique. Microsatellite markers are codominant in nature and highly polymorphic. The allele frequencies and distribution of microsatellite markers are much easier to follow and compare across labs. The variation among alleles is numerable and thus easier to score. Statistical analysis of microsatellite markers, unlike RAPDs, is not different from that of conventional markers used in population genetics (Cavilli-Sforza, 1998). Prior to the inception of a commercial fishery on Lakes Victoria and Kyoga its said that a scoop of water by the shoreline with a fishing basket was sufficient to bring ashore a load of table size ngege, Oreochromis esculentus, and/or its native congener Oreochromis variabilis. The rosy picture of the fishery was at the turn of the last century. This rosy picture led to establishment of a large-scale commercial fishery that was instituted on the Lakes Victoria and Kyoga with the introduction of fibre gillnets and later on nylon gillnets and seines starting in the early 1900s. Such decisions turned the traditional fishery in Lake Victoria Region (LVR), though still largely artisanal, into a commercial fishery (Graham, 1927). At first the largest tropical freshwater lake promised to bear the ever increasing pressure that resulted 136 from the expansion of the fish market at time of the completion of the first railway network in the East African region. But the increase in demand and ultimate increase in fishing pressure collapsed the native tilapiine fishery prompting the management then to introduce non indigenous species that included not only close relatives of the native tilapiine species but also the voracious predator Nile perch. Lates niloticus. Species introductions were done in an effort to both augment the traditional fishery and to fill the ecological niches that were thought to be imder utilized. Piscivory on the abundant haplochromine fishes that were of no direct economic value and herbivory on the abundant aquatic macrophytes and other higher plant material were the two kinds of niches which were largely imexploited (Flyer and lies, 1972; Balirwa 1992; Ogutu Ohwayo 1990, 1988). The major draw back of microsatellite markers is that in some cases, depending on the primer design, some alleles fail to amplify resulting in what is generally referred to as the null alleles problem (Valsecchi et al., 1997). The technique also requires more time and is relatively more expensive than the RAPD technique, especially, in case of routine sampling and analysis as may be the case in management of a wild fishery such as that of LVR. The major drawback of the RAPD technique is the dominant nature of the markers generated, in that only one of the two alleles at a heterozygous locus gets amplified. As such the markers don’t fit the traditional analysis used in population analysis. Efforts have been made to correct for the RAPD marker dominance (King et al., 1993, Lynch and Milligan, 1994) allowing for analysis of natural populations.

MATERIALS AND METHODS Sample collection Fish were caught using gillnets and seine nets from 11 water bodies of three lake basins of the Lake Victoria Region (Kyoga, Victoria and Edward/George)(Figure 1.1 in chapter 1). For the purposes of this study, each sample was considered as representing a single panmictic population in the entire lake. On average each sample had 18 individuals (Table 3.10). For DNA analysis a piece of muscle tissue was 137 taken from each individual specimen on the right epaxiai muscle of the fish specimen, placed in a vial with 95% ethanol for one hour, and after the ethanol was exchanged for fresh one, labeled and stored until DNA extraction. Detailed information about specimens and the individual specimens used in the study was archived Fuerst’s Laboratory at Ohio State University, Columbus.

Lake Abbreviation Basin Sample size

Nyaguo NYE Kyoga 11 Nawampasa NWE Kyoga 20 Lemwa LME Kyoga 17 Mburo MBE Victoria 21 Kanyaboli KNE Victoria 20 Manywa MME Victoria 20 Kayugi KGE Victoria 11 Kayanja KJE Victoria 20 Kawi KWE Kyoga 20 Edward EDE Edward/George 11 Bisina BIS Bisina 9

Table 3.10. Populations and basin of origin together with the sample sizes used in the study

138 Molecular analysis DNA extraction was done using the standard proteinase K, phenol/chloroform protocol (Sambrook et al., 1989) and the NaOH extraction method (Zhang and Tiersch. 1993). A total of 45 pairs of microsatellite primers developed by Lee and Kocher (1996) from Oreochromis niloticus DNA library were screened, among which we chose a set of 10 primer pairs for genetic population structure analysis of Oreochromis esculentus populations. The primers chosen were those that gave a clear and reproducible amplifications, within a size range that could be run and read on 6% polyacrylamide gel, and that worked for all populations all the time. Choice of primer pairs was also dependent on their use in other tilapiine species in the LVR since, in a later manuscript, we compare the genetic structures of all the tilapiine species in LVR. The sequence, annealing temperature and number of cycles of amplification we used are shown in Table 3.2. For PCR analysis each forward primer was end-labeled with P32 radioisotope using T4 polynucleotide kinase (GIBCO BRL). PCR reactions were done in a final volume of 10 ul containing 25ng of genomic DNA, 0.3 mM of each primer, 100 mM of deoxynucleotide triphosphate (dATP, dTTP, dCTP, and dGTP), 3 mM of MgClz, and 0.375 units of Taq polymerase (GIBCO BRL). Amplification conditions were 5 minutes of hot start at 95oC, 30 cycles at following sequence: 45 sec at 94oC, 30 sec at appropriate annealing temperature (Table 3.11), and 30 sec at 72oC. This was followed at the end of the 30 cycles by a 6 minutes extension at 72oC. Amplicons were electrophoresed in 6% polyacrylamide sequencing gels with 7M urea, dried and visualized using autoradiography. Sizing of the amplification products was based on the sequencing of pUCl 8 along with the microsatellite PCR products.

139 Locus Primer pair sequences annealing temp cycles

UNH231 A: GCCTATTAGTCAAAGCGT 56oC 30 B: ATTTCTGCAAAAGTTTTCC UNH222 A: CTCTAGCACACGTGCAT 54oC 30 B: TAACAGGTGGGAACTCA UNHl04 A: GCAGTTATTTGTGGTCACTA 54oC 30 B: GGTATATGTCTAACTGAAATCC UNHl 18 A: CAGAAAGCCTGATCTAATATT 56oC 30 B: TTTCAGATACATTTTATAGAGGG UNH136 A: TGTGAGAATTCACATATCACTA 51oC 30 B: TACTCCAGTGACTCCTGA UNHl42 A: CTTTACGTTGACGCAGT 58oC 30 B: GTGACATGCAGCAGATA UNHl69 A: GCTCATTCATATGTAAAGGA 57oC 30 B: TATTTTTTGGGAAGCTGA UNHl76 A: GATCAGCTCTCCTCTACTTA 58oC 30 B: GATCTGATTTCTTATTACTACAA UNHl78 A: GTCACACCTCCATCATC 58oC 30 B: AGTTGTTTGGTCGTGTAAG UNH149 A: TTAAAACCAGGCCTACC 58oC 30 B: GTTCTGAGCTCATGCAT

Table 3.11. Microsatellite primer sequences and reaction conditions for 10 loci used for Oreochromis esculentus. 140 Data analysis Microsatellite loci variability was measured by the number of alleles amplified for each locus, allele size range and allelic frequency distribution, and level of differentiation among individuals revealed by each set of locus markers based on both Fst and Rst models. The loci were also evaluated for level of heterozygosity, and were tested using the probability test for significance on deviation from Hardy- Weinberg equilibrium. Both the Intra- and interpopulation variability were assessed based on level of observed heterozygosity, proportion of private alleles and degree of differentiation. Population subdivision was estimated based on F statistics (Weir and Cockham. 1984). Comparison was made to the Fst analogue, Rst, which unlike the Fst based on the infinite allele model, was based on the stepwise mutation model (Slaktin 1995). Phyletic relationships among populations were estimated using three genetic distance measures based on Fst, Rst, and on the proportion of shared alleles (ps) standardized as 1-ps. Genetic distances were calculated using Microsat 1.5 computer software program developed by Minch E fhttr>://stanford.edu/mirosat ). The dendograms were constructed using neighbor joining method (Saitou and Nei, 1987) using computer software program MEGA (Kumar et al., 1993).

RESULTS

Microsateliite variability A total of 274 alleles were generated using 10 primer pairs at 10 loci. All loci were highly polymorphic with an average of 27 alleles per locus. Locus UNHl 36 had the least number of alleles while locus UNHl 18 had the highest number of alleles (Table 3.12). Allele sizes ranged between 104 bp to 270 bp. Locus UNHl36 had the smallest range of 9 repeats while UNHl 18 had the largest range with 81 motif repeats. The rest had size ranges above 20 repeats, with and average of 39 repeats overall. Locus UNHl36 had the least heterozygosity and UNHl78 had the highest. Overall the loci had an average heterozygosity of 0.583 and a mean of 0.729 141 total heterozygosity per locus. Table 3.12 also shows the ten loci Fst and Rst values, estimated using Microsat 1.5d computer software program. Fst based on heterozygosity shows locus UNH222 as the most varied among individuals of Oreochromis esculentus. Locus UNHl36 had the only negative Fst value indicating more close similarity and lack of segregation among individuals at this locus. Same trend in powers of differentiation for the various loci is revealed by Fst based on variance among alleles at the each locus, only that all loci have positive Fst value. Similar abilities of the various sets of loci markers to delineate among populations are revealed by the Genepop3.1 computer software program (Table 3.13) only the values are not similar to those of Microsat l.Sd. Based on standardized Rst values, locus UNHl36 still showed the least value, while locus UNHl04 revealed the highest value followed by locus UNHl42.

142 Locus Fst Var Fst Het Rst Std Avg Het Tot ltd Avg Vv Tot Var Avg All Tot AllAvg Ran Toi Ran Avg MaxTot Max Avg Em TolEnI U23I 0.222 0.230 0.259 0.664 0.863 35.723 46.258 7.2 26 18.5 41 105.7 124 0.499 0.653 U222 0SI5 0501 0.406 0.331 0663 7.496 9.958 3.3 16 6.5 20 84.7 94 0325 0.510 UI04 0.181 0.156 0.583 0.799 0 947 127.509 280.449 10.7 43 29.4 58 108.5 122 0.616 0.810 U lll 0.204 0.177 0.471 0.745 0.906 120.802 207.711 tl.4 54 350 81 132.3 137 0.546 0.712 UI36 0.008 -0.132 0.030 0.030 0027 0.523 0.556 1.3 3 12 9 89.2 97 0066 0035 UM2 0 265 0.232 0.547 0.544 0709 8.989 18.767 5.7 21 8.4 22 82.4 95 0 531 0592 UI69 0.266 0.294 0.355 0.429 0.607 9810 15.527 5.6 25 10.2 39 79.0 99 0461 0434 UI76 0.142 0.145 0.296 0.721 0.843 15.683 18.626 7.4 23 138 33 85.8 93 0.623 0.662 UI7I 0.081 0.091 0.213 0.846 0930 47.186 52.101 II 4 37 21 4 47 88.3 107 0.703 0.778 UI49 0.081 0.097 0.317 0.717 0.794 17.981 24.162 7.3 26 10.9 42 84.8 106 0.756 0.568 Avg 0.204 0.179 0.348 0.583 0.729 39.170 67.412 7.1 27 15.5 39 94.1 107 0.512 0.575

- Table 3.12 Diversity indices of at microsateliite loci for Oreochromis escuientus populations in Lake Victoria region t Locus Fwc(is) Fwc(st) Fwc(it) UNH231 0.143 0.211 0.324 UNH222 -0.076 0.608 0.578 UNHl 04 0.034 0.164 0.193 UNHl 18 0.125 0.204 0.303 UNHl 36 -0.022 0.016 -0.006 UNH142 0.122 0.262 0.352 UNHl 69 0.099 0.264 0.337 UNHl 76 -0.014 0.143 0.131 UNH178 0.024 0.081 0.102 UNHl 49 0.004 0.079 0.083 All loci 0.054 0.216 0.258

Table 13. F-statistics estimated as in Weir and Cockerham, Fwc (1984) using computer software program Genepop (Version 3.1b). Number of populations detected; 11 Number of loci detected: 10.

Population structure and variability Ail populations were highly polymorphic with a mean of 7.3 alleles per locus. Lake Nawampasa population had the largest number of alleles with a mean of 13.2 alleles per locus. Lake Kayanja population had the least allele number with 3.5 alleles per locus. Populations had significant differentiated (Fisher’s exact test, Genepop3.1) by both genic and genotypic variation, and were highly heterozygous (Table 3.14) with a mean of 0.596 observed heterozygosity within populations. Lake

144 Kayanja population had the least heterozygosity (0.339) while Lake Nawampasa population had the most heterozygosity (0.840). 39.1 % of the alleles are private alleles (Table 3.15). The Overall Fst values at each locus and for all loci are given in Table 3.13. Population pairwise Fst values are shown in Table 3.13. At loci UNH222. UNHl36 and UNHl76 populations had negative values for Fis (Table 3.13). The mean between population Fst is 0.21. The subdivision of O. esculentus along basins was not discernable but geographically close populations in general were less differentiated from each other than distant populations. Differentiation along basins was clearly so when comparing populations from the Kyoga lakes (NYE, NWE, LME, KWE, BSE) to populations from Nabugabo lakes (MNE, KJE, KGE). Nubagabo lakes had a mean pairwise Fst of 0.12 while that for Kyoga populations is 0.14. Within the same lake basin, populations of Nabugabo lakes compared to Lake Mburo population of the Koki lakes (Southwest of Lake Victoria) had a mean pairwise Fst of 0.33, and 0.24 when compared to the population of Lake Kanyaboli, Yala system (East of Lake Victoria). The Kyoga populations were less subdivided from the Kanyaboli population (Mean pairwise Fst = 0.16) than they were from Lake Mburo population (Mean pairwise Fst = 0.22).

145 Taxon Fsl Var Fsl HelRsl Sid Avg Hel Toi Hel Avg Var Toi VarAvg All Toi All Avg Ran Toi RanAvg Max Toi Max Avg Enl Toi Enl NYE 0.000 0.299 0.000 0.660 0.942 72.127 275.158 7.100 43 20.100 76 95200 136 0 524 0.742 NWE 0.000 0.130 0.000 0.840 0.965 49.816 172.110 13.222 50 24.444 68 96000 128 0701 0.845 LME 0.000 0.328 0.000 0.631 0.939 22.770 277.201 8.300 50 16.100 73 97.200 137 0.552 0755 MBE 0.000 0530 0.000 0.433 0.922 49.589226.757 5.300 37 16.900 72 91.100 132 0.366 0.673 KNE 0.000 0.340 0.000 0.611 0.926 64.177 200.105 8.800 54 23 200 74 94.800 130 0483 0.723 MNE 0.000 0.432 0.000 0.528 0.930 24.830 286.669 6.100 43 12 400 62 93.800 133 0473 0.744 KGE 0.000 0.434 0.000 0.526 0928 15.773 252.368 4.600 32 7300 60 92.000 133 0.504 0.723 KJE 0.000 0.624 0.000 0.339 0.904 9.402 317.312 3.500 20 6.900 60 91.900 132 0.361 0.603 KWE 0.000 0.355 0.000 0.602 0934 17.947 318.138 6.700 44 10.000 68 92.700 137 0615 0.727 EDE 0.000 0.283 0.000 0681 0950 36.403 152.108 9.333 43 17.333 61 96.444 128 0.600 0.817 BSE 0.000 0.255 0.000 0.704 0.944 76555 207.533 7.400 39 19.900 67 95.000 129 0576 0.771 Avg 0.000 0.365 0.000 0.596 0.935 39.945 244.133 7.305 41 15.871 67 94.195 132 0.523 0.738

^ Table 3.14. Diversity indices for Oreochromis escuientus populations from Lake Victoria population based on MICROSATl.S (Minch, 1996) computer software Allele Alleles Private Observed Population Loci number per locus Alleles Heterozygosity

Nyaguo (NYE) 10 71 7.1 5 0.66 Nawampasa (NWE) 9 119 13.2 39 0.84 Lemwa (LME) 10 83 8.3 9 0.63 Mburo (MBE) 10 53 5.3 6 0.43 Kanyaboli (KNE) 10 88 8.8 14 0.61 Manywa (MNE) 10 61 6.1 2 0.53 Kayugi (KGE) 10 46 4.6 0 0.53 Kayanja (KJE) 10 35 3.5 1 0.34 Kawi (KWE) 10 67 6.7 3 0.60 Edward/George (EDE) 9 84 9.3 20 0.68 Bisina (BSE) 10 74 7.4 8 0.70

Table 3.15 Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis esculentus populations.

147 NYENWE LME MBE KNE MNEKGE KJE ]KWE EDE BSE Nyaguo - Nawampasa 0.132 Lemwa 0.109 0.176 Mburo 0.264 0.285 0.162 Kanyaboli 0.155 0.186 0.091 0.189 Manywa 0.164 0.250 0.234 0.282 0.211 Kayugi 0.151 0.230 0.218 0.282 0.194 0.004 Kayanja 0.277 0.360 0.350 0.414 0.325 0.147 0.209 Kawi 0.120 0.190 0.106 0.143 0.118 0.123 0.113 0.232 Edward/George 0.223 0.180 0.245 0.339 0.239 0.282 0.270 0.429 0.237 Bisina 0.123 0.086 0.145 0.242 0.167 0.238 0.225 0.390 0.164 0.124 -

Table 3.16; Intra class correlation using allele frequency for Oreochromis esculentus populations (F-statistics) based on Genepop (3.1) computer software. F-statistics are estimated (Fwc) as in Weir and Cockerham ( 1984).

Phyletic relations The relation among populations based on three distance measures is shown in Figures 3.4, 3.5, and 3.6 respectively. In general relationships between populations are consistent in the three dendrograms, though sub regional groupings tend to breakdown among the three. The distance measure by proportion of bandsharing (ps) standardized as 1-ps (Figure 3.4) shows clear segregation between the Lake Kyoga basin and the Lake Victoria basins populations, as well as division among populations

148 from the Nabugabo lakes (KJE, MNE & KGE), the Yala system (KNE) and the Koki lakes (MBE). The Nabugabo populations in all the three distance measures cluster together. Populations from Lake Edward/George system (EDE), Lake Nawampasa (NEW from Kyoga lakes). Lake Bisina (BSE from Kyoga lakes), and Lake Nyaguo (NYE from Kyoga lakes) cluster together and at longer genetic distance (though not in a consistent order) relative to the rest of populations clusters in the three dendrograms. The Lake Kawi (KWE from Kyoga lakes) population consistently clustered next to the populations from the Nabugabo lakes. The positions of Lake Mburo (MBE of the Koki lakes) population and that of Lake Lemwa (LME of the Kyoga lakes) are not consistent in the three dendrograms but tend to be between populations from the Nabugabo lakes and the rest of the Kyoga lakes.

149 NWE - Lake Nawampasa

EDE - Lake Edward

BSE - Lake Bisina

NYE - Lake Nyaguo

LME - Lake Lemwa

KNE - Lake Kanyaboli

MNE - Lake Manywa

KGE - Lake Kayugi

KWE - Lake Kawi

MBE - Lake Mburo

KJE - Lake Kayanja

Figure 3.4. Phyletic relationships among remnant populations of Oreochromis esculentus populations in Lake Victoria region based on proportion of shared alleles (ps) standardized as l-(ps).

150 NWE - Lake Nawampasa

BSE - Lake Bisina

EDE - Lake Eward (Kazinga channel) NYE - Lake Nyaguo

MBE - Lake Mburo

KNE - Kanyaboli

LME - Lake Lemwa

MNE - Manywa

KGE - Kayugi

KWE - Lake Kawi

KJE - Lake Kayanja

Figure 3.5. Phyletic relationships among the remnant Oreochromis esculentus populations of Lake Victoria region based on Rst genetic distance measure.

151 EDE - Lake Edward Kazinga channel

BSE - Bisina

NWE - Lake Nawampasa

NYE - Lake Nyaguo

MNE - Lake Manywa

KGE - Lake Kayugi

KWE - Lake Kawi

LME - Lake Lemwa

KNE - Lake Kanyaboli

MBE - Lake Mburo

KJE - Lake Kayanja

Figure 3.6. Phyletic relationships among remnant populations of Oreochromis esculentus based on Fst genetic distance measure.

152 DISCUSSION

Though sizeable populations of Oreochromis esculentus still exist in the wild, the argument was whether this species is vulnerable, threatened or endangered (lUCN, 1984, 1988). O. esculentus was driven out of its natural range as recorded by Garrod (1959) and Greenwood (1966), and was severely reduced in population size to the current several isolated small populations in the satellite lakes (Mwanja, 1996). Ecologically O. esculentus is not endangered because of the significant population size in a niunber of the satellite lakes. But the species is rare and perhaps vulnerable to extinction as some of the conditions that led to its demise in the main lakes, such as competition and hybridization by the introduced congeners, were common in many of the satellite lakes withO. esculentus (Mwanja et al., 1995). In addition, most of the current O. esculentus populations didn’t occur in the satellite lakes naturally but were introduced from a small brood stock (Balirwa, 1992), meaning that only minor component of the original genetic diversity was preserved after the collapse of the species in the main lakes. Can we guarantee the continued existence of Oreochromis esculentus out of its natural range? Of course the satellite lakes in many cases are an extension of the main lakes to fair degree, especially when considering geographical situation of the lakes. But we also know that satellite lakes offer reasonably different physiochemical and biotic conditions to those offered by the large lakes (Kaufman and Ochumba, 1993). Such conditions favor the continued existence of O. esculentus only if we keep the non-indigenous species out of the waters in which O. esculentus exists. In case where we cannot get rid of the non-indigenous tilapiine species we need to enhance the population size of O. esculentus and have the non-indigenous species as the minor component at all the time. How viable, both ecologically and genetically, are the remnant populations of O. esculentus to warrant priority redress and allocation of the already stretched resources for protection and conservation of this species? In chapter two the peril of O. esculentus as a result of coexisting with one of congeners,

153 Oreochromis niloticus. Among satellite lakes the factor that is likely to lead to disappearance o f O. esculentus is genetic swamping by the introduced congeners, a factor thought to have driven the species out of lakes like Nabugabo (Mwanja, 1996). Thus given the eminent threat of expansion of O. niloticus and O. leucostictus to all the satellite lakes efforts need to made right now to design protected reserves of native tilapiine species in the LVR. Populations were significantly differentiated from each other containing up to 39.1% private alleles. Significant differentiation among populations was especially so with populations of the Kyoga lakes and that from the Lake Edward/George system. The high proportion of private alleles may be indication of lack of gene flow between populations since many of them are largely isolated from each other. It may also be a result of influx of alien genes from introgressive hybridization with the dominant congeners in these waters. The latter thinking is Justified by the low number or absence of private alleles in the Nabugabo lakes that remain as the only representatives of this species not coexisting with the non-indigenous congeners. Since the main lakes’ populations have disappeared we could not know whether the unique polymorphism of the various remnant populations was a reflection of the historical polymorphism or a result of genetic drift due to reduced population sizes and lack of genetic mixing among these populations. O. esculentus populations were found to be significantly subdivided into sub regional groupings not necessarily along basins. This phenomenon may be a reflection of the difference in origin of seed into the satellite lakes, or time of seeding of these lakes. Certainly as expected there was lack of continuity between the Nabugabo lakes and the Koki lakes populations, or among populations of the Yala basin and the Kyoga lakes or any two of the sub regional groupings since the main lakes’ populations which would have linked these populations have been knocked out From the discussion above, the Nabugabo lakes’ populations may be the only ‘pure’ representatives of this species in the wild. The Lake Edward/George system. Lake Nawampasa, Lake Nyaguo, and Lake Bisina populations of O. esculentus were found to be the most genetically similar to the introduced congeners. The Lake Kanyaboli 154 population in the Yala basin. Lake Kawi and Lake Lemwa of the Kyoga lakes, and Mburo may only be surviving the intense swamping as a result of having a larger population size in these waters. In fact at first we believed some of these lakes such as Lake Kanyaboli to have only O. esculentus but with extensive Oreochromis niloticus was found to occur in this lake too. Thus selectively augmentation of O. esculentus especially in waters where the specie is marginalized will stem the threat to the survival of such populations. Generally, if differences in genetic structure among the sub-regions were any indication of genetic interference with the gene pool of Oreochromis esculentus, then continuous monitoring and drastic measures will have to be used to ensure survival of this species in the LVR. Use ofO. esculentus in aquaculture has been looked at as an option to augment the threatened species in the LVR. The danger here is that the motive of the farmer is production and will selectively culture only fish strains that are high yielding which under represents the extant biodiversity or skews it in a particular direction. Scientific management of the fry production for aquaculture can reduce such fears and enhance the representation of the wild genetic diversity in the farmed populations (Ryman and Utter, 1987). In chapter four the case is made for genetic interaction among species and correlation of the factors thought responsible for the changes in the genetic structure of Oreochromis esculentus to the presence of introduced congeners. In summary the populations of O. esculentus were polymorphic but highly structured largely because of the physical separation of populations. Though the population sizes were low, individual units were significant in sizes relative to other species. Genetically populations appeared diverse but threats from genetic swamping, genetic drift as well as lack of gene flow among populations may endanger O. esculentus in the wild.

155 3. Analysis of the Genetic Population Structure ofOreochromis leucostictus populations in the Lake Victoria Region

INTRODUCTION

Oreochromis leucostictus together with Tilapia zilli were the first two species to proliferate immediately after their introduction into Lake Victoria (Fryer, 1961). The two species were always found to dominate the native species, Oreochromis esculentus and Oreochromis variabilis, in the inshore waters and their numbers were on a steady increase in the tilapiine catches from Lake Victoria. However, following the establishment ofOreochromis niloticus and Nile perch, coupled with the continued dramatic changes in the aquatic environment, O. leucostictus and T. zilli together with the two native species collapsed and the ecologically versatile O. niloticus took over. O. niloticus became the most abundant and dominant tilapiine of Lake Victoria Region. O. leucostictus was especially frequent inshore by the swampy edges and in satellite lakes in marshy or swampy environs. O. leucostictus, as with O. niloticus, and T. zilli, were introduced from Lake Albert and Lake George in the mid of the last century (20th) following the collapse of the native tilapiine fishery. O. Leucostictus is the swampy form among the LVR Oreochromis species, and has been found to be tolerant to hypoxia associated with marshy habitats. In addressing the question why the earlier proliferation of O. leucostictus subsided and instead the LVR waters became dominated by O. niloticus, a species from the same putative origin, we found it necessary first to understand the current population structure of this species in Lake Victoria region. 156 Certainly factors that may have led to differential success of the introduced tilapiines are important in the continued management of Lake Victoria Region Fishery. Unfortunately past management decisions that dramatically altered the fishery of Lake Victoria Region were not based on scientific findings. Many of the direct influences on the fishery by the managers were not documented. For example, there was only scanty data on the introductions of alien species into Lake Victoria Region (LVR). In this section the genetic population structure of introduced Oreochromis leucostictus is compared to that of its conspecific from the putative origin. The object of the study was to establish how close the different populations of the two lake basins (Lake Kyoga and Lake Victoria) are to each other and to the populations from the putative origins (Lakes Edward/George and Albert). The study also looks at the subdivision of the genetic variation of O. leucostictus into the populations o f the different basins and water bodies in LVR. The goal was to establish how much genetic variation existed uniquely within individual populations and in each of the two lake basins, and how much is shared by all subdivisions of O. leucostictus in Lake Victoria Region compared to the putative origin of this species into the two lake basins. Analysis of the population genetic structure of O. leucostictus and comparison to those of other tilapiine species in LVR (Chapter four) will reveal the genetic impact of the differential ecological success of tilapiine species in the LVR.

MATERIALS AND METHODS

Sample collection A total of 149 individuals of Oreochromis leucostictus from 10 locations in Lake Victoria region from 10 different lakes were sampled (Table 3.17, Figure 1.1- chapter 1). The collections were done in the two lake basins of Lake Victoria Region (Lake Kyoga and Lake Victoria basin) as well as from the origins of these populations into Lake Victoria Region (Lake George and Lake Albert populations). For this study, each sample was considered as representing a single panmictic 157 population of the entire lake. On average each sample had 15 individuals (Table 3.17). Tissue was collected &om each individual specimen on the right epaxial muscle of the fish specimen, placed in a vial with 95% ethanol for one hour, and after the ethanol was exchanged for fresh ethanol, labeled and stored until DNA extraction. Detailed information about specimens and the individual specimens used in the study was archived Fuerst’s Laboratory at Ohio State University, Columbus.

Lake Abbreviation Basin Sample size

Mburo MBL Victoria 16 Nawampasa NWL Kyoga 11 Gigate ‘ GAG Kyoga 16 Victoria Nile River VNR Victoria 8 George GGL Putative origin 20 Albert ABL Putative origin 19 Napoleon Gulf VIL Victoria 20 Kachera KCL Victoria 20 Nakuwa LWL Kyoga 19

Table 3.17. Populations and basin of origin together with the sample sizes used in the study

158 Molecular analysis DNA extraction was done using the standard proteinase K, phenol/chloroform protocol (Sambrook et ai., 1989) or the NaOH extraction method (Zhang and Tiersch, 1993). A total of 45 pairs of microsateliite primers developed by Lee and Kocher (1996) from Oreochromis niloticm DNA library were screened, among which a set of 10 primer pairs was chosen for further analysis of Oreochromis leucostictus populations. The primers chosen were those that gave clear and reproducible amplicons, within a size range that could be run and read on 6% polyacrylamide gel, and that worked for all populations all the time. The sequence, annealing temperature and number of cycles of amplification used are shown in Table 3.18. For PCR analysis each forward primer was end-labeled with P32 radioisotope using T4 polynucleotide kinase (GIBCO BRL). PCR reactions were done in a final volume of 10 ul containing 25ng of genomic DNA, 0.3 mM of each primer, 100 mM of deoxynucleotide triphosphate (dATP, dlTP, dCTP, and dGTP), 3 mM of MgClz, and 0.375 units of Taq polymerase (GIBCO BRL). Amplification conditions were 5 minutes of hot start at 95oC, 30 cycles at following sequence: 94oC for 45 sec, 30 sec at appropriate annealing temperature (Table 3.18), and 30 sec at 72oC. This was followed at the end of the 30 cycles by a 6 minutes extension at 72oC. Amplicons were electrophoresed in 6% polyacrylamide sequencing gels with 7M urea, dried and visualized by exposing it to X-ray film using autoradiography. Sizing of the amplicons was based on the sequencing of pUC 18 along with the microsateliite PCR products.

159 Locus Primer pair sequences annealing temp cycles

UNH231 A: GCCTATTAGTCAAAGCGT 56oC 30 B: ATTTCTGCAAAAG111 ICC UNH222 A: CTCTAGCACACGTGCAT 54oC 30 B: TAACAGGTGGGAACTCA UNHl 04 A: GCAGTTATTTGTGGTCACTA 54oC 30 B; GGTATATGTCTAACTGAAATCC UNHl 18 A: CAGAAAGCCTGATCTAATATT 56oC 30 B; TTTC AGATAC A1 i l l ATAGAGGG UNH136 A: TGTGAGAATTCACATATCACTA SloC 30 B: TACTCCAGTGACTCCTGA UNH142 A: CTTTACGTTGACGCAGT 58oC 30 B: GTGACATGCAGCAGATA UNH169 A: GCTCATTCATATGTAAAGGA 57oC 30 B: TATTTTTTGGGAAGCTGA UNH176 A: GATCAGCTCTCCTCTACTTA 58oC 30 B: GATCTGATTTCTTATTACTACAA UNH178 A: GTCACACCTCCATCATC 58oC 30 B: AGTTGTTTGGTCGTGTAAG UNHl 49 A: TTAAAACCAGGCCTACC 58oC 30 B: GTTCTGAGCTCATGCAT

Table 3.18. Microsateliite primer sequences and reaction conditions for 10 loci of Oreochromis leucostictus.

160 Data analysis Microsateliite loci variability was measured by number o f alleles amplified for each locus, allele size range, allelic frequency and level of differentiation among individuals within and between populations. Analysis of loci markers was based on both Fst and Rst models. Loci were also tested for level of heterozygosity revealed among all individuals, and the extent of deviation from Hardy-Weinberg equilibrium. Both Intra- and interpopulation variability was assessed based on the level of observed heterozygosity, proportion of private alleles and degree o f differentiation. Population subdivision was estimated based on F statistics (Weir and Cockham, 1984). Comparison was made to the Fst analogue, Rst, which unlike the Fst is based on the stepwise mutation model (Slaktin 1995). Phyletic relationships among populations were estimated using three distance measures, that based on Fst, Rst, and on the proportion of shared alleles (ps) standardized as 1 -ps. Genetic distances were calculated using Microsat 1.5 computer software program developed by Minch E (http://stanford.edu/mirosati. The dendograms were constructed using neighbor joining method (Saitou and Nei, 1987) using computer software program MEGA (Kumar et al., 1993).

RESULTS

Microsateliite marker Variability

A total of 219 alleles were generated at 10 loci among 10 Oreochromis leucostictus populations (Table 3.19), with an average allele number of 21.9 alleles per locus. All loci were highly polymorphic except locus UNHl 36. Locios UNHl36 had the least number of alleles (7) while locus UNHl 78 had the most (42). Locus 136 had the smallest average size range (4.6 repeats) while UNHl 78 had the largest average size range (37 repeats). Locus UNH222 had the smallest total range (12 repeats) while UNH149 had the largest total range in allele size (57 repeats). The

161 allele frequencies are shown in appendix 3c.2. Probability test revealed the populations to have high significant (Chi2, df = 126, P= 0.05) deviation from Hardy- Weinberg equilibrium. Overall locus UNH231 had the least average and total heterozygosity while UNHl78 had the most for both categories (Table 3.19).

162 tXKU* FslVar FslHel RslStd AvgHel TolHel AvgVv Toi Var Avg All ToiAII AvgRan TolRinAvgMax TolMaxAvgEnI 1'olEnt U23I O.OSI 0.141 0.079 0.136 0.159 8.577 9.173 2.700 13 7 000 29 91.700 III 0.118 0.138 U222 0.126 0154 0.099 0.576 0.681 1.760 2.130 4300 12 5.700 12 87.300 91 0.646 0.567 UI04 0.086 0.112 0.200 0.806 0907 49.979 58.0729.200 22 21 500 39 105.600 107 0.637 0.716 UIIS 0.106 0.140 0.154 0.808 0939 42.352 50.961 9.500 28 21.700 41 110.200 115 0625 0.792 UIJ6 0.576 0.545 0.055 0.189 0.415 4.215 4.373 2.200 7 4 600 21 90.800 97 0.227 0.272 UI42 0.423 0.400 0332 0.428 0.713 4.201 6.215 3.800 14 6.700 21 81.600 89 0.438 0.544 UI69 0.216 0.194 0.167 0.679 0842 50.083 61 132 8.200 27 22.200 30 89.100 96 0.496 0.710 UI76 0096 0.121 0.328 0.801 0.912 21.143 30.681 9.300 24 15.700 28 88.800 95 0.675 0.810 UI7I 0 054 0.091 0.349 0873 0.960 173.001 254.318 13.429 42 37.000 53 105.000 115 0.645 0.862 UI49 0.043 0.078 0.164 0.848 0.920 35.827 42.302 10.300 30 23.100 57 97.800 120 0.6950.699 Avg 0.614 7.293 22

A Table 3.19 Oiveisity indices for microsateliite loci of Oreochromis leucostictus populations in Lake Victoria region based on MICROSATl.S computer software program (Minch, 1996) The mean observed within-population heterozygosity per locus based on the microsat computer software program was 0.614. The standard Rst of locus UNH136 revealed the least differentiation (0.055) while locus UNHl 78 revealed the most (0.349). Based on the Fst statistics locus UNHl49 revealed the least differentiation while locus UNH136 showed the highest level of differentiation (Table 3.20).

Locus Fwc(is) Fwc(st) Fwc(it)

UNH231 0.211 0.075 0.270 UNH222 -0.014 0.120 0.107 UNH104 0.241 0.078 0.300 UNH118 0.130 0.102 0.219 UNH136 0.157 0.570 0.637 UNH142 0.137 0.384 0.469 UNH169 0.121 0.212 0.308 UNH176 0.115 0.092 0.197 UNH178 0.125 0.065 0.182 UNH149 0.125 0.038 0.158 All loci 0.130 0.156 0.266

Table 3.20. F-statistics (Fwc) estimated as in Weir and Cockerham (1984) for Oreochromis leucostictus populations based on intra class correlation using allele frequency by Genepop (3.1) computer software.

164 Population variation and differentiation Ail populations were highly polymorphic with an average of 7.2 alleles per loci (Table 3.21). 32% of the alleles were found to be population specific with a mean frequency of 5.1% private alleles per population. Allele number, number of private alleles of each population, and observed heterozygosity are shown in Table 3.22. Victoria Nile River was found to be the least polymorphic and had the lowest observed heterozygosity. All populations had high levels of within population heterozygosity. Lake Victoria basin samples (Napoleon Gulf and Victoria Nile River) exhibited the lowest polymorphism as well as low heterozygous levels. The putative origin populations (Albert and George) were among the most polymorphic and were relatively more differentiated from the Lake Kyoga and Lake Victoria basin populations as shown by the high number of private alleles contained in each of these two. O. leucostictus populations had an overall Fst of 0.16, and Fis and Fit of 0.13 and 0.27 respectively. All populations together had a mean within-population heterozygosity level of 0.61. Table 3.23 shows the pairwise Fst. The Lake Victoria basin populations (VIL, VNR, MBL, and KCL) had lower Fst between respective pair combinations as compared to Lake Kyoga populations (KOL, NWL, LWL, and GAG). In general all populations were less differentiated from the Lake Albert population than from the Lake George population.

165 Taxon FstVar FslHet AvgHel TolHel AvgVar TolVar AvgAII TolAII AvgRan TolRan AvgEnI Toi EmI MBL 0.000 0.309 0.644 0.931 36.672 77.449 6.100 33 16.200 47 0.546 0.777 NWL 0.000 0.313 0,641 0.933 17.023 47.224 3.889 31 12.333 38 0.381 0.813 GAG 0.000 0.309 0633 0.941 41.693 123.923 9.200 46 21 300 52 0.348 0.831 VNR 0.000 0.412 0.344 0 923 16.933 87.723 4 111 23 9.111 43 0.487 0.751 GGL 0.000 0.362 0.600 0.941 31.390 113.006 8.900 43 16.900 50 0.341 0.812 ABL 0.000 0332 0.6IS 0926 31.133 103.393 9.100 43 13.200 47 0.360 0,796 VIL 0.000 0.396 0.360 0.927 27.666 68.236 3.800 31 11.800 38 0.312 0.801 KCL 0.000 0.230 0.6M 09IS 77.794 86.993 7.444 33 20.778 46 0.309 0.762 KOL 0.000 0.394 0.363 0.932 37.300 102.909 7.667 39 22.667 32 0.414 0.769 LWL 0.000 0.3(6 0.372 0.933 29.220 84.327 6.900 31 13.800 49 0.471 0.739 Avg 0.609 7.1 II 36

& Table 3.21 Diversity indices for Oreochromis leucostictus populations in Lake Victoria region based on MICR0SATI.5 computer software (Minch, 1996) Pop/ Allele Private Observed Loci number Alleles Heterozygosity Mburo (MBL) 10 62 6 0.64 Nawampasa (NWL) 9 53 3 0.64 Gigate (GAG) 10 92 12 0.66 Victoria Nile (VNR) 9 38 0 0.54 George (GGL) 10 89 15 0.60 Albert (ABL) 10 92 9 0.62 Napoleon Gulf (VIL) 10 56 3 0.56 Kachera (KCL) 10 75 5 0.69 Kyoga (KOL) 9 67 12 0.57 Nakuwa (LWL) 10 70 6 0.64

Table 3.22. Observed heterozygosity, private alleles, allele number and number of loci studied for the 10 Oreochromis leucostictus populations.

167 pop MBL NWLGAGVNR GGL ABL VIL KCL KOL LWL

MBL NWL 0.106 GAG 0.115 0.166 VNR 0.017 0.133 0.110 GGL 0.119 0.204 0.121 0.157 ABL 0.094 0.151 0.117 0.090 0.137 NAP O.lOl 0.106 0.146 0.068 0.201 0.143 KCL 0.046 0.086 0.052 0.020 0.101 0.081 0.083 KOL 0.116 0.149 0.201 0.116 0.245 0.139 0.142 0.108 LWL 0.148 0.177 0.254 0.198 0.271 0.214 0.230 0.138 0.266 -

Table 3.23: Intra class correlation using allele frequency (F-statistics) for Oreochromis leucostictus populations based on Genepop (3.1) computer software. F- statistics were estimated (Fwc) as in Weir and Cockerham (1984).

Phyletic relations among populations Figures 3.7, 3.8, and 3.9 are dendograms derived from genetic distances using Rst, Fst, and proportion of shared alleles (ps) standardized as l-(ps), respectively. All distance measures give dendrogams showing clear separation between the recently established introduced populations of Oreochromis leucostictus and its populations of the putative origin of the introduced populations in Lake Victoria and Lake Kyoga basins. In all the three dendograms the Kyoga populations (KOL, GAG, NWL,

168 LWL) are closer to those of the putative origin (Lake George and Lake Albert populations) than Lake Victoria basin populations (VNR, VIL, MBL, KCL). Another constant among the three dendograms was that Lake Gigate population was closest to the populations from Lakes Albert and George. The Fst and Rst distance measures gave clear separation between Lake Kyoga basin and Lake Victoria basin populations, though the two groups are largely undifferentiated in all the three dendograms more so in the dendogram based on the distance measure using the proportion of shared alleles.

169 VNR - Victoria Nile River

LWL - Lake Nakuwa

MBL - Lake Mburo

NWL - Lake Nawampasa

VIL - Lake Victoria (Napoleon gulf)

KCL • Lake Kachira

KOL - Lake Kyoga

GAG - Lake Gigate

GGL - Lake George

ABL - Lake Albert

Figure 3.7. Phyletic relationships of the introduced Oreoc/iromû populations relative to their putative origin populations from Lakes Albert and George, based on Rst genetic distance measure.

170 MBL - Lake Mburo

VNR - Victoria Nile River

VIL - Lake Victoria (Napoleon Gulf) KOL - Lake Kyoga

NWL - Lake Nawampasa

LWL - Lake Nakuwa

KCL - Lake Kachira

GAG - Lake Gigate

GGL - Lake George

ABL - Lake Albert

Figure 3.8. Phyletic relationships of the introduced Oreochromis leucostictus populations of Lake Victoria region relative to conspecifics of their putative origins in Lakes George and Albert.

171 MBL - Lake Mburo

VNR - Victoria Nile River

LWL - Lake Nakuwa

KCL - Lake Kachira

NWL - Lake Nawampasa

VIL - Lake Victoria (Napoleon gulf)

KOL - Lake Kyoga

GAG - Lake Gigate

GGL - Lake George

ABL - Lake Albert

Figure 3.9. Phyletic relationships among introduced Oreochromis leucostictus populations of Lake Victoria region relative to conspecifics from their putative origins of Lakes George and Albert based on proportion of shared alleles.

172 DISCUSSION

Microsatellite markers are currently the choice for genetic population structure studies. The genome wide availability and high polymorphism across most biological taxa coupled with the easy of amplification and the fit to conventional genetic population structure statistics analysis tools, have contributed greatly to the wide acceptance of microsatellite markers for population structure analysis. In addition most of the primers developed and currently on market have cross amplification ability across species and within genera but sometimes across higher taxonomic levels. Microsatellite markers have in increasing number of studies revealed polymorphism and genetic variation among populations and species that were previous known to be depaurate of genetic variation (Wu, 1999). In this study we used microsatellite primers developed by Kocher’s lab (1996) from Oreochromis niloticus genomic DNA library to establish the genetic population structure of Oreochromis leucostictus. All primers successfully generated markers at the same reaction conditions as those we used for analysis of O. niloticus populations and generally resulted in the same trend of polymorphism across the 10 loci used (later in this chapter). For O. leucostictus all markers were highly polymorphic across populations, resulting in an average of approximately 22 alleles per locus. The variation revealed within and among populations was sufficient to analyze the structure of O. leucostictus populations in Lake Victoria region. All loci were heterozygous but showed significant deviation from Hardy-Weinberg equilibrium. The deviation may have been an indication of inbreeding or genetic drift as a result of the history of these populations (Valsecchi et al., 1997), but it might also have been due to failure to amplify one of the alleles in heterozygous situation (Callen et al., 1993; Allen et al, 1995; Wu, 1999). In the latter situation primers have to be remade so as to amplify all the alleles (Wu, 1999), while in the former comparison of the genetic structure of the targeted population has to be made to the original diversity of such a population before the history that led to inbreeding and genetic drift. 173 Unfortunately this study was the first to examine the genetic structure of Oreochromis leucostictus in the L VR. Thus the lack of information on genetic structure of historical populations o f O. leucostictus in LVR made it impossible to verify whether deviation from Hardy-Weinberg equilibrium was due to the history of the species in the region. This situation was made worse by the lack of data concerning the introduction practices of O. leucostictus into the LVR. From our current analysis it was clear that the introduced populations have diverged from the putative origins. Such divergence is expected in cases where the broodstock used was small and inbred during the argumentation phase prior to introduction into the respective lakes. The danger of such a study is that it would be speculative in conclusion as to how the current genetic structure diverged from the original structure since the time of introduction. So in this study our discussion and conclusions were limited to a comparison of the current genetic structure of the introduced populations of O. leucostictus with the current populations of its origin into Lake Victoria and Lake Kyoga basins (Lake George and Lake Albert populations).

We found Lake Kyoga basin populations to be genetically closer than Lake Victoria basin populations to the populations from Lakes George and Albert. For much of the early work and management policies were closer to Lake Victoria and were first implemented in Lake Victoria basin before Lake Kyoga basin (EAFFRO, 1947-1967). The relative closeness of Lake Kyoga basin populations to those from the origin is likely a reflection of a more recent introduction history of O. leucostictus into Lake Kyoga basin compared to Lake Victoria basin. Lake Victoria populations have certainly drifted from the putative origin further than have Lake Kyoga populations. Earlier studies (Lowe-McConnell, 1959, Fryer, 1961) reported finding morphotypes between O. leucostictus and Oreochromis esculentus. This appearance of hybridization was confirmed in pond trials and field reports (Fryer and lies, 1972; Trewavas, 1983; Leveque, 1997) and in our recent field surveys in the LVR. Gene flow across species has the effect of homogenizing congeners but serves to increase 1 7 4 divergence among conspecifics. Gene flow between O. leucostictus and native congeners in Lake Victoria basin might have increased the genetic divergence between the populations of O. leucostictus from Lake Victoria basin and those of Lakes George and Albert. All populations of Oreochromis leucostictus were polymorphic with a mean within-population heterozygosity of 0.61 that was partly attributed to the polymorphic nature of microsatellite markers. The high proportion of private alleles among populations was a reflection of the lack or reduced level of gene flow among disjunct populations, and a history of long separation. The difference in allelic diversity (number of alleles and proportion of private alleles) was a reflection of founder population effects associated with most species introductions. Normally the heterozygosity level remains high - at almost same level among introduced populations and between introduced and parent populations. The allelic diversity is known to decrease sooner and most times only a few generations after introduction (Fuerst and Maruyma, 1986).

175 4. Genetic Population Structure ofOreochromis variabilis of Lake Victoria Region, East Africa, based on microsatellite markers

INTRODUCTION

Understanding the mechanisms driving the evolution and knowledge of historical distribution of key species such as O. variabilis is important in elucidating changes that have driven the evolution of cichlid fishes in the region. Tilapiine fishes may have missed out in the explosive radiation we have come to leam of in haplochromine fishes in the LVR (Greenwood, 1981), but they may be the key evolutionary species, as they are ecologically, that explain the historical events that shaped the evolution of cichlid species. Unlike most haplochromine cichlids, tilapiine species are widely distributed, evolutionary stable, and clearly distinct from related species though they may share a wide range of morphological and trophic attributes. The contrary is true of the haplochromine complex with vast species, ecological and trophic radiation, fast evolution, varied specialized niches but genetically undifferentiated. Evolution of cichlids in the LVR is largely tied to the desiccation and reflooding events that characterized much of the region’s past, and that have of course shaped the distribution of aquatic species in the region (Kaufman and Ochumba, 1993; Johnson et al, 1996). Another dynamic to the Lake Victoria region fish fauna evolution was the direct human influence through the introduction of alien species that led to displacement of several fish species and extinction of hundreds of haplochromine fishes (Fryer, 1972; Trewavas, et al. 1985; Barel et al.,

176 1985; Ogutu-Ohwayo, 1990; Balinva, 1992; Kaufinan, 1992). Among species that were adversely affected by recent dramatic changes in Lake Victoria region were the two endemic tilapiine species of the region, Oreochromis esculentus and O. variabilis. O. esculentus has been completely displaced out of the main lakes (Kyoga and Victoria) and O. variabilis has been broken up into isolated small populations in Lake Victoria (Mwanja, 1996). The two species also exist with introduced congeners in the satellite lakes around Lakes Kyoga and Victoria. The goal of the study was to establish the genetic population structure of Oreochromis variabilis and the extent of genetic differentiation following the severe decrease in population size and subsequent population subdivision. Oreochromis esculentus was the major fisheries species whileOreochromis variabilis formed a major complement to (Graham, 1927, Garrod, 1959, Lowe McConnell, 1958, 1959). The two species were decimated two to three decades after the inception of a commercial fishery in LVR at the turn of the last century (Fryer and lies, 1972). Overfishing, change in aquatic environmental conditions, and introduction of alien species are thought to be the major reasons for displacement of native tilapiines (Ogutu-Ohwayo, 1990, Balirwa, 1992). The introduction of alien species was believed to have curtailed the recovery of the native species since many of introduced species were either ecologically similar (tilapiine species) or a major predator (Nile perch) to the native forms. Following the establishment of the alien species, the two native tilapiines and scores of haplochromine species were displaced and, in case of haplochromines, driven to extinction (Kaufinan, 1992, Kaufinan and Ochumba, 1993). Oreochromis variabilis belongs to subgenus Nyasaplasa. It’s a maternal mouth brooder. Nyasaplasa species are distinguished from other Oreochromis species by the presence of a genital papilla organ in the males, which they use to cast milt over the eggs during fertilization (Trewavas, 1983). In addition, among the LVR Oreochromis species O. variabilis is the only one that develops an orange coloration of the hyaline part of the dorsal fin in sexually mature males during breeding season. O. variabilis currently exists as small pockets of individuals, especially, around river 177 mouths and protected inshore areas (Mwanja, 1996). O. variabilis is also found in a number of satellite lakes where unfortunately it coexists with non-indigenous tilapiines. In all these satellite lakes O. variabilis is the minor component in population size as well as ecological function - a situation which makes its existence precarious. Following the drastic ecological and environmental changes in the LVR, Oreochromis variabilis was subdivided into disjimct units and is currently of vulnerable status due to the severe reduction in population size and continued isolation of remnant populations. Genetic drift and lack of gene flow have acted to drive the populations to increased differentiation, putting the original genetic variation at a peril. Confoimding the precarious situation of the original genetic variation of O. variabilis is the genetic exchange between O. variabilis and the alien species {Oreochromis niloticus and Oreochromis leucostictus'). Genetic swamping increased the polymorphism and heterozygosity of the renmant populations of native species coexisting with the introduced non-indigenous species was a result of hybridization between the two forms.

MATERIALS AND METHODS

Sample collection Fish were caught using gillnets and seine nets from six water bodies in two lake basins of Lake Victoria Region (Lake Kyoga and Lake Victoria basin). For this study, each sample was considered as representing a single panmictic population in the entire lake. On average each sample had 10 individuals (Table 3.24). For DNA analysis a piece of tissue was taken from each individual specimen on the right epaxial muscle of the fish specimen, placed in a vial with 95% ethanol for one hour, then exchanged for fresh ethanol, labeled and stored imtil DNA extraction. Detailed information about specimens and the individual specimens used in the study is archived Fuerst’s Laboratory at Ohio State University, Columbus.

178 Lake Abbreviation Basin Sample size Gigate GAG Kyoga 14 Nawampasa NWV Kyoga 11 Kansensero/Dimu KAD Victoria 9 Napoleon Gulf v rv Victoria 13 Bisina BIS Bisina 9 Victoria Nile FLiver VNV Victoria 7

Table 3.24. Oreochromis variabilis populations and basin of origin together with the sample sizes used in the study.

Molecular analysis DNA extraction was done using the standard proteinase K, phenol/chloroform protocol (Sambrook et al., 1989) or the NaOH extraction method (Zhang and Tiersch, 1993). A total of 45 pairs of microsatellite primers developed by Lee and Kocher (1996) from Oreochromis niloticus DNA library were screened, among which a set of 10 primer pairs was chosen for further analysis of Oreochromis variabilis populations. The primers chosen were those that gave clear and reproducible amplicons, within a size range that could be run and read on 6% polyacrylamide gel, and that worked for all populations all the time. Choice of primer pair was also dependent on its use in other tilapiine species in the LVR since, in a later manuscript, we compare the genetic structures of all the tilapiine species in LVR. The sequence, annealing temperature and number of cycles of amplification used are shown in Table 3.25. For PGR analysis each forward primer was end-labeled with P32 radioisotope using T4 polynucleotide kinase (GIBCO BRL). PGR reactions were done in a final volume of 10 ul containing 25ng of genomic DNA, 0.3 mM of each primer, 100 mM 179 of deoxynucleotide triphosphate (dATP, dTTP, dCTP, and dGTP), 3 mM of MgCh, and 0.375 units o f Taq polymerase (GIBCO BRL). Amplification conditions were 5 minutes of hot start at 95oC, 30 cycles at following sequence: 45 sec at 94oC, 30 sec at appropriate annealing temperature (Table 3.25), and 30 sec at 72oC. This was followed at the end of the 30 cycles by a 6 minutes extension at 72oC. Amplicons were electrophoresed in 6% polyacrylamide sequencing gels with 7M urea, dried and visualized using autoradiography. Sizing of the amplicons was based on the sequencing of pUClS along with the microsatellite PGR products.

180 Locus Primer pair sequences annealing temp cycles

UNH231 A: GCCTATTAGTCAAAGCGT 56oC 30 B: ATTTCTGCAAAAGi l riCC UNH222 A: CTCTAGCACACGTGCAT 54oC 30 B: TAACAGGTGGGAACTCA UNHI04 A: GCAGTTATTTGTGGTCACTA 54oC 30 B: GGTATATGTCTAACTGAAATCC UNH118 A: CAGAAAGCCTGATCTAATATT 56oC 30 B: TTTCAGATACAi IT IATAGAGGG UNH136 A: TGTGAGAATTCACATATCACTA 51oC 30 B; TACTCCAGTGACTCCTGA UNH142 A: CTTTACGTTGACGCAGT 58oC 30 B: GTGACATGCAGCAGATA UNH169 A: GCTCATTCATATGTAAAGGA 57oC 30 B: TATTTTTTGGGAAGCTGA UNH176 A: GATCAGCTCTCCTCTACTTA 58oC 30 B: GATCTGATTTCTTATTACTACAA UNH178 A: GTCACACCTCCATCATC 58oC 30 B: AGTTGTTTGGTCGTGTAAG UNH149 A: TTAAAACCAGGCCTACC 58oC 30 B: GTTCTGAGCTCATGCAT

Table 3.25. Microsatellite primer sequences and reaction conditions for 10 loci of Oreochromis variabilis in Lake Victoria Region populations.

181 Data analysis

Variability of markers among the 10 microsatellite loci was measured by number of alleles amplified, allele size range and allelic frequency distribution, and the level of polymorphism among individuals revealed by each set of locus markers. Analysis was based on both Fst (Wright, 1951) and Rst models (Slaktin, 1995) of allele changes in a natural population. Loci were also tested for level of heterozygosity revealed among all individuals, and the extent of deviation from Hardy-Weinberg equilibrium. Both Intra- and interpopulation variability was assessed based on level of observed heterozygosity and proportion of private alleles. Population subdivision was estimated based on F statistics (Weir and Cockham, 1984). Comparison was made to the Fst analogue, Rst, which unlike the Fst based on the infinite allele model, was based on the stepwise mutation model (Slaktin, 1987, 1995). Phyletic relationships among populations were estimated using three distance measures, that based on Fst, Rst, and on the proportion of shared alleles (ps) standardized as 1-ps (MICROSAT computer software). Genetic distances were calculated using Microsat 1.5 computer software program developed by Minch E (Tittp ://stanford.edu/mirosat>. The dendograms were constructed using neighbor joining method (Saitou and Nei, 1987) using computer software program MEGA (Kumar et al., 1993).

RESULTS

Microsatellite amplification and variability Ten microsatellite loci were amplified successfully using primers and reaction conditions similar to those used for Oreochromis niloticus, the species from whose DNA library the primers for the 10 loci were developed. The statistics generated using Microsat computer software program (version 1.5) for the respective loci markers are shown in Table 3.26. All loci were highly polymorphic with an average

182 of 19.7 alleles per locus. Locus UNH136 had the least allele number (5 alleles) >^iile Locus UNH104 had the highest (27 alleles). Locus UNH136 had the least allele size range (11 repeats) while Locus UNHl 18 had the largest (58 repeats). Locus UNH104 showed the highest level of polymorphism among individuals within populations and UNHl36 exhibited the least. However, UNHl36 showed the highest variability among populations while UNHl49 revealed the least. Overall locus UNHl04 showed the least variable among all individuals combined while UNHl36 exhibited the highest level of polymorphism among all individuals studied (Table 3.27). All loci were heterozygous with an average of 0.85 total heterozygosity, and a mean within-population heterozygosity of 0.71.

183 Toi Ran Avg MaxToi Max AvgEnI Tot Ent AvgVarTolVar Avg All TolAII Avg Ran Locus FstVar FslHct Rst Sid AvgHel TolHel 110.833 116 0.666 0.820 61.113 13.545 9J33 25 21.167 31 U23I 0056 0.091 0.294 0.135 0.919 90.167 96 0,696 0819 7.296 10.397 6.000 17 8.000 17 U222 0.172 0.173 0.372 0.721 0810 100.000 110 0.669 0.789 79.404 10.167 27 26167 14 UI04 0.077 0.114 0.157 0.133 0.940 69.184 114.667 134 0.624 0.736 123.028 9.167 26 28500 8 Ullt 0.063 0.113 0.115 0.134 0.940 101.525 89.800 97 0.389 0.481 3.466 2.000 5 2.800 II UI36 0.610 0.660 0.214 0.218 0.642 3.032 91.000 94 0.619 0.830 28.120 8.167 22 14.500 3 UI42 0.070 0.103 0.311 0.107 0.900 20.781 81.600 101 0.655 0.783 36.697 52.893 9.600 21 19.800 5 UI69 0.013 0.173 0.309 0.761 0.929 76.333 85 0.415 0.409 5.385 3.500 10 6.000 7 UI76 0.115 0.114 0.027 0.423 0.518 5.593 80.400 102 0.621 0.641 40.441 47.613 8.000 20 19.600 7 UI7I 0.014 0.106 0.139 0.719 0.883 103.333 III 0646 0,753 168.171 13.000 24 37.000 UI49 •0.041 0.035 0.003 0.114 0.935 150.921 94.513 105 0 607 0 706 60.202 7.793 20 18.353 Avg 0.143 0.177 0.201 0.712 0.848 49.665

' T.ble3,26 W k . . k , W . f p.pul.k«,i. W.V k W . ..

MICR0SATI.5 computer software program (Minch, 1996) Locus Fwc(is) Fwc(st) Fwc(it) UNH231 0.236 0.043 0.269 UNH222 0.086 0.168 0.239 UNHl 04 -0.007 0.072 0.065 UNH118 0.212 0.051 0.252 UNHl 36 0.412 0.676 0.810 UNH142 0.134 0.063 0.188 UNH169 0.023 0.095 0.116 UNHl 76 0.341 0.170 0.453 UNH178 -0.018 0.095 0.079 UNH149 0.056 0.030 0.084 All loci 0.116 0.133 0.234

Table 3.27. F-statistics estimated as in Weir and Cockerham, Fwc, (1984) for Within Lake Victoria Region Oreochromis variabilis analysis using Genepop (Version 3.1b) Number of populations: 6; Number of loci: 10

Population microsatellite variability and differentiation All populations were highly polymorphic with a mean of 7.6 alleles per locus (Table 3.28). The Victoria Nile River population had the least number of alleles per locus while Lake Gigate population had the highest (Table 3.29). Populations had significant (Fisher’s test using Chi2 - Genepop3.1 computer software) genic and genotypic differentiation, with 41.2% of the alleles being private alleles. Lake Gigate population and Lake Victoria Kansensero/Dimu (southwest of

185 the lake) had the highest number of private alleles while Victoria Nile River had the least. Lake Nawampasa population the most heterozygous while Lake Bisina and Victoria Nile River populations had the least observed heterozygosity (Table 3.30). Pairwise comparisons using Fst (Table 3.29) showed the Lake Gigate population and that of Lake Nawampasa to be the least differentiated. The highest subdivision was between the Lake Bisina and Lake Victoria (Kansensero/Dimu) populations. The two populations within Lake Victoria had higher Fst relative to a number of other pairwise comparisons between each of the two Lake Victoria populations and the four populations outside Lake Victoria. In general there was no discernable pattern to the degree of subdivision along the Lake basins (Lake Kyoga basin and Lake Victoria basin populations ).

186 h tfaKKgraBraMHilUfcl

Taxon FstVar FslHet RstStd Avg Met TolHel AvgVar TotVar Avg AU Tot Ail AvgRan TolRan Avg MaxToi Max AvgEnI TolEni GAG 0.000 0.241 0.000 0.716 0.932 34.726 163.310 9.700 47 11.400 56 93.100 III 0.641 0840 NWV 0.000 O.ISI 0.000 O.lll 0963 63.103 224 219 9.000 44 22 286 69 99000 134 0637 0824 KAD 0.000 0.231 0.000 0.709 0 946 43.073 124.427 7.300 40 19600 48 93 100 no 0 340 0847 VIV 0000 0.213 0.000 0.730 09J0 44 901 120.699 7.200 43 17 300 32 94 200 113 0 646 0813 BIS 0.000 0.291 0.000 0.660 0 940 23.811 174.396 6.771 40 13 000 72 93.333 129 0369 0748 VNV 0.000 0 309 0000 0641 0929 40.654 141146 3730 29 13000 48 90873 116 0 603 0 761 Avg 0.000 0.247 0.000 0711 0 943 43723 131.043 7.621 41 17 398 38 94 601 119 0.609 0.8(Ki

Table 3.28 Diversity indices for Oreochromis variabilis populations in Lake Victoria region based on MICROSAT I 5 " computerSoftware program (Minch, 1996) Pop/ Allele .Alleles Private Observed Loci number per locus Alleles Heterozygosity Gigate (GAG) 10 97 9.7 23 0.72 Nawampasa (NWV) 7 63 9.0 11 0.81 Kansensero/Dimu (KAD) 10 73 7.3 22 0.71 Napoleon Gulf (VIV) 10 72 7.2 10 0.73 Bisina (BIS) 9 62 7.0 9 0.66 Victoria Nile River (VNR) 8 46 5.8 7 0.64

Table 3.29. Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis variabilis populations.

188 GAG NWV KAD VIV BIS VNR Lake Gigate (GAG) -

Lake Nawampasa (NWV) 0.037 - Kansensero/Dimu (KAD) 0.123 0.122 - Napoleon Gulf (VIV) 0.148 0.062 0.166 - Lake Bisina (BIS) 0.153 0.055 0.235 0.106 - Victoria Nile River (VNR) 0.095 0.039 0.152 0.198 0.205 -

Table 3.30; Oreochromis variabilis populations intra class correlation using allele frequency (F-statistics) based on Genepop (3.1) computer software. F-statistics were estimated (Fwc) as in Weir and Cockerham (1984).

Phyletic relations among populations All the three distance measures used revealed largely consistent relationship among populations, though distance measures by Fst and proportion of shared alleles (ps), standardized as 1-ps, revealed nearly the same pattern of clustering among populations. The two measures (Fst and 1-ps) show the two Lake Victoria populations to be closer to other populations than to each other (Figure 3.10 and 3.11), while the Rst distance measure (Figure 3.12) maintains the two Lake Victoria populations closest to each other. The Rst distance measure shows a clearer separation of populations along Lake Basins. The Victoria Nile River population though geogr^hically closer to Niqx>leon gulf population (VTV) was shown to be genetically closer to Kansensero/Dimu (KAD- Southwest of Lake Victoria) population in the dendograms from two of the distance measures (Fst and 1-ps).

189 GAG - Lake Gigate

KAS - Southwest Lake Victoria (Kaosensero)

VNV - Victoria Nile River

NWV - Lake Nawampasa

BIS - Lake Bisina

v r v - Lake Victoria

Figure 3.10. Phylogram of the remnant Oreochromis variabilis populations in Lake Victoria region based on Fst genetic distance measure.

190 , GAG - Lake Gigate

, KAV - Southwest Lake Victoria (Kasensero)

, VNV - Victoria Nile River

, NWV - Lake Nawampasa

BIS - Lake Bisina

, VIV - Lake Victoria

Figure 3.11. Phyiogram of remnant populations of Oreochromis variabilis in Lake Victoria region based on proportion of shared alleles.

191 , GAG - Lake Gigate

, BIS - Lake Bisina

, KAS - Southwest Lake victoria

, NWV - Lake Nawampasa

, VNV - Vivtoria Nile River

, VTV - Lake Victoria (Napoleon Gulf)

Figure 3.12. Phyiogram for the remnanat Oreochromis variabilis populations in Lake Victoria region based on Rst genetic distance measure

192 DISCUSSION

Microsatellite primers developed using Oreochromis niloticus genomic DNA library successfully amplified microsatellite loci for Oreochromis variabilis populations. All loci were highly polymorphic and clearly differentiated among individuals and populations of O. variabilis. However, the significant deviation from Hardy-Weinberg equilibriiun might be attributed to the null allele problem associated with microsatellite markers (Callen, 1993), and/or small sample sizes. Unfortunately O variabilis is currently a rare species and sufficient sample sizes were hard to come by, as such we had to make the best of what we were able to catch in the field. The “null" allele problem could be addressed by design of new set of primers that are less stringent to allow amplification of all the alleles at the targeted locus (Wu, 1999). The problem of less stringent markers, though, is that the less stringent the primers the more likely that they will attach to wrong sites resulting in amplification of artifacts instead. Deviation from the norm may be a reflection of the historical polymorphism of O. variabilis with the disjimct populations carrying different portions of the original genetic variation, or due to hybridization with the alien species. Given the two, the best explanation was that deviation from Hardy-Weinberg equilibrium, despite the small sample sizes, was due to factors such as genetic interaction between O. variabilis and the alien species, and the genetic drift associated with small populations. Hybridization between Oreochromis variabilis and the introduced Oreochromis species resulted in high j^lymorphism and heterozygosity. The nearly 42% proportion of private alleles was evidence to how quickly and far apart the remnant populations drifted from each other, which further proves that the polymorphism revealed by microsatellite markers was not a result of gene flow between those populations but likely hybridization. Reduced gene flow and low population sizes resulted in high differentiation among populations of O. variabilis.

193 Each set of locus markers showed significant differentiation among individuals and between populations, and significant levels of polymorphism within populations. High polymorphism despite reduced population sizes and little or no gene flow between populations could also be explained by the polymorphic nature of microsatellite markers and their unusually high mutation rate. Microsatellite markers seem less likely to be under selection (Schlotterer and Pemberton, 1994). Due to the lack of constraints and fast mutation rate, the microsatellite markers generated may not reflect the rapid allele fixation associated with genetic drift in small populations. But may instead reflect increase in unique polymorphism among respective populations due to random allele assortments and/or differentiation in non-mixing populations.

There was no discernable pattern between geographical location and phyletic relations among populations studied. This result was a reflection of how quickly the populations have drifted from each other or the history of how the remnant populations were stocked, especially among satellite lakes. Both native tilapiine species of LVR, Oreochromis variabilis and Oreochromis escidentus, were moved into satellite lakes around the time of establishment of alien species in the LVR, in an effort to protect them (EAFFRO, 1947-1967). The process of moving these species to the satellite lakes may have began long after the original population within Lake Victoria had been subdivided as the two populations within Lake Victoria, used in this study, were more subdivided than when each of the two is compared to the other populations. Unfortunately like most of the past management policies of that time little is documented (EAFFRO reports 1947-1967). As for the future of Oreochromis variabilis, attention should be paid to exploitation in satellite lakes at least to manage or control fishing mortality. If there was a way selective cropping would boost its chances against alien species, an alternative to this would be to selective augmentation to boost the populations of O. variabilis remnant populations against those of the alien tilapiine species. Genetic swamping would subdue the species to extinction even with managed restrictions on 1 9 4 exploitation of this species. The other solution would be to ‘revitalize’ the species through aquaculture and fish farming. The potential here is great if conducted with a plan to maximize the extant genetic biodiversity.

195 5. Microsatellite Analysis ofTitapia ziiU and Tilapia rendalli Populations of Lake Victoria Region, East Africa

INTRODUCTION

Tilapia zilli was among the first species that were deliberately introduced into Lakes Victoria and K.yoga and their surrounding satellite lakes. T. zilli was introduced from Lake Albert to fill the unutilized trophic niches in the two lake basins, the aquatic macrophytes and other higher plant material (Fryer, 1961). Tilapia zilli is known to feed predominantly on higher plant material, especially aquatic macrophytes and filamentous algae (Fryer and lies, 1972; Trewavas, 1983). According to Fryer (1961) T. zilli established quickly, and together with Oreochromis leucostictus were the first non-indigenous species to peak in abimdance, especially inshore (bays), after the collapse of the native tilapiine fishery. Early dominance of the two species was short lived as Oreochromis niloticus, another of the introduced tilapiine species that was ecologically more versatile, replaced both the native and other introduced tilapiines (Balirwa, 1992; Mwanja, 1996). Tilapia zilli was found to be frequent but non-dominant. Tilapia rendalli, the second species in the genus Tilapia that occurs in waters of Lake Victoria region, was introduced in an effort to diversify the tilapiine fishery and augment the collapsing native tilapiine fishery. T. rendalli was introduced from Zambezi region via the Congo ponds (Fryer and lies 1972; Trewavas, 1983/ T. rendalli is known to share a high affinity of similar ecological traits with Tilapia zilli,

196 and the two species hybridize readily in the wild (Fryer and lies, 1972). T. rendalli is currently rare in the large lakes and has been often been mistaken for dwarf Oreochromis niloticus because of its deep body and relatively short standard length. T. rendalli was more Sequent in Nabugabo and Kyoga satellite lakes. The hybrids between T. rendalli and T. zilli have a characteristic head shape of T.zilli and the deep body of T. rendalli, these morphs are locally known as ‘Butomezi’ around Nabugabo lakes. In this study we sought to establish how independent populations of T. zilli are from those of T. rendalli. The eventual goal is to find the genetic evidence that supports the hybridization between the two species and what mechanism may be driving the evolution of the two species in Lake Victoria region waters. Given the above suppositions on hybridization, the small population sizes, and patchy disjunct distribution of T. zilli, we were interested to know how the introduced populations compare to each other and how genetically divergent they were from the population in Lake Albert, the origin of T. zilli into the LVR. In the study we used microsatellite markers based on primers developed from Oreochromis niloticus genomic DNA library (Lee and Kocher, 1996) in an attempt to answer the above mentioned questions. Microsatellite markers offer advantages over other tradition genetic markers basically because of the easy of the technique, codominant nature of the markers and the numerical nature that allows for statistical analysis in a maimer similar to conventional population genetics analysis (Wu et al., 1999). Choice of the specific primer pairs used to generate markers at the seven loci studied was based on the search for universal markers that would allow us later to compare the genetic structure of all the tilapiine species in Lake Victoria region (Chapter four). We wanted to get markers that could work for all populations across species and genera, since the region contains significant representative populations of all the three major tilapiine genera.

197 MATERIALS AND METHODS

Sample collection Fish were caught using gillnets and seine nets from 7 locations in two lake basins of the Lake Victoria Region (Lake Kyoga and Lake Victoria basin) and from Lake Albert (Figure 3.1 in chapter 1). For the purposes of this study, each sample was considered as representing a single panmictic population in that location. On average each sample had 15 individuals (Table 3.31). For DNA analysis 2~3g of muscle tissue were taken from each individual specimen on the right epaxial muscle of the fish specimen, placed in a vial with 95% ethanol for one hour, and after the ethanol was exchanged for fresh one. labeled and stored until DNA extraction. Detailed information about specimens and the individual specimens used in the study was archived in Professor Fuerst’s Laboratory at Ohio State University, Columbus.

Lake Species Abbreviation Basin Sample size

Nabugabo T. zilli NABTZ Victoria 19

Albert T. zilli ABTZ Albert 2 0 Kyoga T. zilli KOTZ Kyoga 10 Bisina T. zilli BISTZ Kyoga 10

Napoleon Gulf T. zilli VICTZ Victoria 2 0 Nakuwa/Kasudho T. zilli LKTZ Kyoga 14

Nabugabo T. rendalli NBTR Victoria 12

Table 3.31. Lake Victoria region and Lake Albert populations of Tilapia zilli and Tilapia rendalli and their sample sizes.

198 Molecular analysis DNA extraction was done using the standard proteinase K, phenoi/chloroform protocol (Sambrook et al., 1989) and the NaOH extraction method (Zhang and Tiersch, 1993). A total of 45 pairs of microsatellite primers developed by Lee and Kocher (1996) from Oreochromis niloticus DNA library were screened, among which we chose a set of 7 primer pairs. The primers chosen were those that gave clear and reproducible amplifications, within a size range that could be nm and read on 6% polyacrylamide gel, and that worked for all populations all the time. Choice of primer pairs was also dependent on their use in other tilapiine species in the LVR since, in a later manuscript (Chapter 4); we compare the genetic structtires of all the til^iine species in LVR. The sequence, annealing temperature and number of cycles of amplification we used are shown in Table 3d.2. For PCR analysis each forward primer was end-labeled with P32 radioisotope using T4 polynucleotide kinase (GIBCO'BRL). PCR reactions were done in a final volume of 10 ul containing 25ng of genomic DNA, 0.3 mM of each primer, 100 mM of deoxynucleotide triphosphate (dATP, dlT P , dCTP, and dGTP), 3 mM of MgClz, and 0.375 units of Taq polymerase (GIBCO BRL). Amplification conditions were 5 minutes hot start at 95"C, 30 cycles at following sequence; 45 sec at 94°C, 30 sec at appropriate annealing temperature (Table 3.32), and 30 sec at 72®C. This was followed at the end of the 30 cycles by a 6 minutes extension at 72"C. Amplification products were electrophoresed in 6% polyacrylamide sequencing gels with 7M urea, dried and visualized using autoradiography. Sizing of the amplification products was based on the sequencing of pUC18 along with the microsatellite PCR products.

199 Locus Primer pair sequences annealing temp cycles

UNH231 A: GCCTATTAGTCAAAGCGT 5 4 T 30 B: ATTTCTGCAAAAGl 11 ICC UNH222 A: CTCTAGCACACGTGCAT 52®C 30 B: TAACAGGTGGGAACTCA UNH118 A: CAGAAAGCCTGATCTAATATT 54“C 30 B: TTTCAGATACAl 11 lATAGAGGG UNH142 A: CTTTACGTTGACGCAGT src 30 B: GTGACATGCAGCAGATA ÜNH169 A; GCTCATTCATATGTAAAGGA 56"C 30 B: TATTTTTTGGGAAGCTGA UNH178 A: GTCACACCTCCATCATC src 30 B: AGTTGTTTGGTCGTGTAAG UNH149 A: TTAAAACCAGGCCTACC src 30 B: GTTCTGAGCTCATGCAT

Table 3.32. Microsatellite primer sequences and reaction conditions for 7 loci of Tilapia spp

Data analysis

Microsatellite loci variability was measured by niunber of alleles amplified for each locus, allele size range and distribution within that range, allelic frequency differences and level of differentiation among individuals revealed by each set of 200 locus markers based on both Fst and Rst models. Loci were also evaluated for level of heterozygosity among all individuals at each locus and all loci combined. Markers generated were tested, using the probability test, for significance in deviation from Hardy-Weinberg equilibrium. Both intra- and interpopulation variability were assessed based on level of observed heterozygosity, proportion of private alleles and by testing for significance of genic and genotypic differentiation among individuals within and between populations. Population subdivision was estimated based on F statistics (Weir and Cockham, 1984). Comparison was made to the Fst arudogue, Rst, which unlike the Fst that was based on the infinite allele model, Rst was based on the stepwise mutation model (Slaktin 1995). Phyletic relationships among populations were estimated using Fst, Rst, and the proportion of shared alleles (ps) genetic distance measures. Genetic distances were calculated using Microsat 1.5 computer software program developed by Minch E (http://stanford.edu/mirosatL The dendograms were constructed by neighbor joining method (Saitou and Nei, 1987) using computer software program MEGA (Kumar et al., 1993).

RESULTS

Microsatellitc variability

All seven loci were polymorphic with more than two alleles for any locus in every population. Ninety four alleles were generated with an average of 13.4 alleles per locus among the seven populations. There were no significant differences (X2, P< 0.05, df = 6) in allele diversity among the seven loci. Locus UNH149 was most polymorphic with 30 alleles followed by locus UNH178 with 18 alleles and locus UNH231 with 17. Locus UNH222 and UNH142 had significantly lower heterozygosity levels than the other five loci (Table 3.33). Locus UNH149 had the highest heterozygosity followed by UNH231. Locus UNHl 18 showed the lowest Fst followed by locus UNH149. Locus UNH142 had the lowest Rst again followed by

201 locus UNHl49. Locus UNH231 had the highest Rst value while UNH222 had higheiff Fst. Using Genepop3. 1 inter class correlation analysis based on allele ôequencies (F- statistics), locus UNHl 18 and UNH178 showed negative Pis values while UNH142 and UNHl49 had positive but very low Fis values (Table 3.34). Overall the seven loci had a negative Fis value but relatively high Fst.

202 Locus Fst Var Fst Met R slSid Avg Her To* ltd Avg Var Tot Var Avg All Tot All Avg Kan To* Ran Avg Max To* Max Avg Enl I'ol Fn U 2 3 I O i l # 0 .1 4 4 0 . 4 0 2 0 .7 4 4 0 .1 6 9 43.494 63.846 7.1 17.0 2 0 .7 1 4 2 7 .0 I I I 4 2 9 1 1 4 .0 0 5 ) 4 0 .6 7 2 U 2 2 2 0 .6 2 0 0 ) 2 0 0 .1 6 1 0 .2 1 7 0 5 9 8 2433 2.109 2.2 7 .0 3 1 6 7 no 8 1 3 3 3 8 8 0 0 4 7 2 0 4 8 3 U llt -0.031 0 .0 0 1 0 . 0 8 9 0 .5 1 8 0 .5 1 9 14735 15.055 2 .6 6 .0 7000 370 81.000 I I I 0 0 5 8 8 0220 U I 4 2 0 .1 9 9 0 .2 0 6 0 .0 1 1 0 .2 9 3 0369 6.860 4.613 2.6 7.0 5 5 7 1 21.0 7 7 .5 7 1 93.0 0 4 6 7 0 2 2 3 U I 4 9 0 .0 4 4 0 .0 6 7 0 . 0 2 0 0 .1 4 3 0 .9 0 4 78.020 74.505 1 0 .4 300 30143 400 1 1 6 .5 7 1 1 1 9 0 0 6 0 8 0 7 4 2 U I 6 9 0 .3 1 7 0 .3 5 1 0.371 0411 0741 3919 5.543 4.0 9.0 6 0 0 0 I S O 7 2 .2 1 6 8 1 .0 0 4 8 6 0 5 6 3 U I 7 I 0 .1 1 7 0.142 0.341 0.624 0.727 40.741 65.818 5.0 1 8 0 1 6 4 2 9 4 2 0 6 9 .4 2 9 8 9 .0 0 5 2 0 0 4 7 1 A v g 0 2 0 1 0 .2 0 5 0 . 2 0 0 0 .5 4 1 0 6 7 5 2 7 .1 7 2 3 3 .0 7 0 4 .8 1 3 4 1 2 .7 1 8 2 7 .6 8 7 .0 8 8 99.0 0525 0482

Table 3.33 Diversity indices for mkrosalelliie loci ofTikpia xiili from Lake Victoria region. Locus Fwc(is) Fwc(st) Fwc(it) UNH231 0.031 0.129 0.156 UNH222 0.246 0.596 0.695 UNH118 -0.921 0.002 -0.917 UNH142 0.004 0.235 0.238 UNH149 0.005 0.046 0.051 UNHl 69 0.029 0.405 0.422 UNHl 78 -0.147 0.126 -0.002 All loci -0.123 0.215 0.119

Table 3.34. F-statistics for Tilapia ziili populations estimated (Fwc) as in Weir and Cockerham (1984).

Population structure and differentiation All populations were polymorphic with an average o f 4.9 alleles per locus per population, and mean heterozygosity within populations o f 0.548 (Table 3.35). Table 3.36 shows the various population attributes including number of private alleles for each population. In all 55% of the alleles were private with significant differences (X2, P<0.05) differences in numbers of private alleles among the seven populations. The Lake Nawampasa T. zilli population had the highest number of private alleles followed by Lakes Nabugabo (T. zilli) and Victoria populations respectively. The Lake Nabugabo T. rendalli population had only six private alleles. The probability test for deviation from Hardy-Weinberg equilibrium was highly significant (X2, d f= 82, GenepopS.l). Even among T. zilli populations alone there was significant deviation (X2, df = 68, GenepopS.l) from Hardy-Weinberg equilibrium. Lakes

204 Kyoga and Nawampasa T. zilli populations had lower Fst pairwise values ag«ip«t T. rendalli population of Lake Nabugabo compared to pairwise values between non- Kyoga T. zilli populations and Lake Nabugabo T. rendalli population. The Lake Nabugabo T. zilli population had relatively high pairwise Fst values when compared to the each of the other populations.

205 Taxon Fsl Var Fst MetRst Sid Avg Net Toi I Id Avg Var Tot Var Avg All Tot AllAvg Kail Tot Ran Avg MaxTot Max Avg Enl I'ol Enl NABTZ 0.000 0.362 0.000 0.601 0.942 22.351 184.659 4.7 30.0 10.6 55.0 85.429 116 0.684 0.756 ABTZ 0.000 0534 0000 0423 0909 10 599 216.451 3.7 23.0 69 580 85 571 119 0471 0649 KOTZ 0.000 0.351 0.000 0.603 0 929 47621 426.066 4.8 26.0 178 720 89000 119 0467 0.667 BISTZ 0000 0526 0.000 0.435 0918 20.659 286.519 36 240 II 1 720 83 857 119 0 427 0636 VICTZ 0.000 0.405 0.000 0.553 0930 37379 226.834 5.9 34 0 14 6 670 87 857 114 0 528 0 705 LKTZ 0.000 0.325 0.000 0.626 0927 32.702 255841 6.7 380 194 580 95.571 119 0462 0 739 NBTR 0.000 0.367 0.000 0.592 0 936 25.339 252 841 4.9 32.0 107 65.0 83.429 112 0 633 0,720 g Average 0.000 0.410 0.000 0.541 0927 21.094 274 173 4.9 29.6 130 63.9 87.245 117 0525 0.696

Table 3.35 Divenity indices for TiU^ia zilli and Tih^iarendalli populations in Lake Victoria region based on MICR0SATI.5 computer soAware program (Minch, 1996) Allele Alleles Private Observed Population species number per locus Alleles Heterozygosity

Nabugabo (NABTZ) T. zilli 33 4.7 10 0.60 Albert (ABTZ) T. zilli 26 3.7 3 0.42 Kyoga (KOTZ) T. zilli 34 4.8 4 0.60 Bisina (BISTZ) T. zilli 25 3.6 I 0.44 Victoria (VICTZ) T. zilli 41 5.9 9 0.55 Nawampasa (LKTZ) T. zilli 48 6.7 19 0.55 Nabugabo (NBTR) T rendalli 34 4.9 6 0.59

Table 3.36. Number of loci, allele number, private alleles, observed heterozygosity for Lake Victoria Region Oreochromis esculentus populations.

207 Estimates for ail loci: Pop NABTZ•\BTZ KOTZ BISTZ VICTZ LKTZ NBTR NABTZ - ABTZ 0.250 KOTZ 0.213 0.154 BISTZ 0.311 0.225 0.127 VICTZ 0.155 0.132 0.066 0.264 LKTZ 0.236 0.245 0.118 0.164 0.218 NBTR 0.217 0.290 0.064 0.253 0.148 0.096

Table 3.37. Fst for Tilapia spp populations estimated as in Weir and Cockerham (1984) using Genepop (Version 3.1b): Pairwise IIS for population.

Phyletic relationship among populations

The Fst and Rst distance measures gave in the phylograms that are generally consistent in their groupings of the populations. The two distance measures clearly separated Lake Victoria basin and Lake Kyoga basin populations (Figures 3.13 and 3.14). In both Fst and Rst genetic distance phylograms, the population from the putative origin of Tilapia zilli (Lake Albert) is between Lake Victoria and Lake Kyoga basin T. zilli populations, with Victoria basin populations as the most derived and Kyoga populations closest to the to T. rendalli. The Lake Nabugabo population of T. zilli is the most distant from T. rendalli of the same lake. Using the proportion of shared alleles genetic distance measure (Figure 3. IS), T. zilli populations from

208 Lakes Nabugabo and Victoria were phyletically closest to T. rendalli population from Lake Nabugabo. This distance measure, as in the Fst and Rst genetic distance measures, also segregated the Lake Victoria basin populations from those of Lake Kyoga basin. The Kyoga populations were closer to the putative origin population (Lake Albert) than were Lake Victoria basin populations.

209 , NABTZ ' Lake Nabugabo Tilapia zilli

, VICTZ - Lake Victoria r. zilli

ABTZ - Lake Albert T. zilli

, BISTZ - Lake Bisina T. zilli

, KOTZ - Lake Kyoga T. zilli

, LKTZ - Lake Nawampasa T. zilli

, NBTR - Lake Nabugabo Tilapia rendalli

Figure 3.13. A phyiogram of Tilapia zilli populations in Lake Victoria region togrther with their conspecific from their putative origin (Lake Albert) in relation to Tilapia rendalli population from Lake Nabugabo. The p h y io g ra m was based on Fst genetic distance measure.

210 , NABTZ - Lake Nabugabo Tilapia zilli

, VICTZ - Lake Victoria T. zilli

, ABTZ - Lake Albert T. zilli

, LKTZ - Lake Nawampasa T. zilli

, KOTZ - Lake Kyoga T. zilli

, BISTZ - Lake Bisina T. zilli

, NBTR - Lake Nabugabo Tilapia rendalli

Figure 3.14. A phyiogram of populations oiTilapia zilli in Lake Victoria region and a conspecfic from their putative origin of Lake Albert in relation to Tilapia rendalli from Lake Nabugabo. The phyiogram is based on Rst genetic distance measure.

211 . ABTZ - Lake ALbert

, BISTZ - Lake Bisina

, LKTZ - Lake Nawampasa

, KOTZ - Lake Kyoga

, NABTZ - Lake Nabugabo

, VICTZ - Lake Victoria

, NBTR - Lake Nabugabo

Figure 3.15. A phyiogram of populations of Tilapia zilli from Lake Victoria region and their conspecific from their putative origin of Lake Albert in relation to Tilapia rendalli from Lake Nabugabo. Genetic distances were based on proportion of shared alleles (ps) standardized as 1- (ps).

212 DISCUSSION

The primers woriced but the annealing temperature had to be adjusted by a degree or two lower than for that used in analysis Oreochromis populations using the same microsatellite primers. The primers used were developed from Oreochromis niloticus DNA library (Lee and Kocher, 1996). Seven out of the 10 used for the Oreochromis species gave clear reproducible and scorable amplicons. All the seven loci were polymorphic and generated stifficient variation and differentiated among individuals within and between populations. There were differences in the values of parameters generated by the two methods, R- and F-statistics. This difference was because the two are based on different mutation models, F-statistics are assessed using the infinite allele model (Weir and Cockerham, 1984) while the R-statistics are based on the stepwise mutation (Slaktin, 1995). In general though both statistical derivations agree in the resolution among individuals at each locus or with all the loci combined. Two of the loci showed outbreeding based on the F-statistics (negative Fis values); four loci had a positive but low Fis value, and for all loci combined the F- statistics indicated outbreeding. They also showed a relatively high Fst value indicating high population subdivision between populations. 55% of the alleles were private, again attesting to the high population subdivision between populations. Populations in general were polymorphic at the seven loci studied. They were found to be heterozygous and differentiated. Pairwise population subdivision Fst values showed the Kyoga populations o f Tilapia zilli to be less subdivided from Tilapia rendalli of Nabugabo than T. zilli fix>m Nabugabo is from the same population. This fact was interesting because of the likely genetic interaction between Nabugabo T. zilli and T. rendalli populations we would expect the two to be less subdivided from each other than there were compared to other T. zilli populations. The explanation was that the two might be reflecting the increased 213 divergence due to elevated heterozygosity but share relatively higher proportion of alleles between the two than between any of them and the other T. zilli populations due to allelic exchange through hybridization. Thus the Fst would show the two geographically distant populations or species (Kyoga populations versus Nabugabo populations) to be less subdivided while analysis based on allele diversity would reflect the better estimate of the phyletic relationship among geographically close and genetically interacting populations/species. One handicap to the study though was the significant deviation from Hardy- Weinberg equilibrium that we tested and found to be due to deficiency in heterozygotes. This could be a result of one or several factors including null alleles (alleles not amplified because of the stringency of the primers) and small population size. Given the polymorphic nature of microsatellite loci, the generated alleles might not be represented proportionally in the sizes of samples used in the study. On the other hand the small base from which populations were augmented prior to introduction and the small sizes of the established introduced populations could easily skew the allele frequencies. A thorough study based on primers developed from either Tilapia zilli or Tilapia rendalli DNA library, and sample sizes of over 20 individuals in each population could address some of the shortcomings of this study.

The phyletic relationships revealed showed that the Lake Nabugabo Tilapia zilli population was the most derived of all those studied. Lake Nabugabo was where we found intermediates, ‘butomezi’, that were abundant and clearly distinct from either of the two Tilapia species in the lake. The postulation is that hybridization which is known to occur readily between these two species (Fryer and lies, 1972; Leveque, 1997), resulted in accelerated divergence between the two as well as between the Nabugabo T. zilli populations and other T. zilli populations. Based on the Fst and Rst distance measures there was a clear distance between Lake Nabugabo T. zilli population and the rest of the populations. Clearly separated were the two-T. zilli and T. rendalli populations from the Lake Nabugabo, when the latter was used as the root the former was the most derived among the populations studied. But 2 1 4 hybridization between the two was clearer when considering the distance measure based on proportion of shared alleles. This measure put the two Lake Nabugabo Tilapia populations closest to each other than they were to other populations. The study also revealed a closer relationship of the Lake Kyoga basin T. zilli populations than Lake Victoria basin populations to ±e Lake Albert population. This may be a reflection of recent introduction history in Kyoga lakes but a relatively earlier introduction in the Lake Victoria basin. Despite the apparently genetically viable populations of Tilapia zilli and T. rendalli in Lake Victoria region, the low population sizes and high subdivision between populations is a major cause for concern. To assess the exact impact of the rarity of these species in Lake Victoria region would require a thorough ecological evaluation of what is established in the wild and genetic analysis o f most of the existing populations of the two species. Non natural rarity in wild populations is always a major cause of concern for conservation biologist as it normally indicates disintegration of genetic diversity of such populations. On the other hand naturally rare populations may face detrimental effects without realization until when the populations are completely lost. This is the case with many fishery species in Lake Victoria and elsewhere where the fishery may be thriving, denying attention to the species that may not be the mainstay for the fishery. In Lake Victoria region concern has been focused on Nile perch and Nile tilapia among fishery managers, and on haplochromines for their evolutionary and ecological significance, yet tens of other species are imperiled and remain largely unnoticed Tile^ia species, though originally abundant when first introduced, became increasingly rare and relegated to isolated small pockets of individuals within both the main lakes and satellite lakes. The species are trophically in no competition with other tilsq)iine and/or any other fish species in the region. In fact the macrophytes, the resource they were meant to utilize, are instead a menace due to being under utilized and explosive expansion in the main lakes. Reasons for the rarity o f these species are not easy to decipher because there has been only one other study in ecological genetics done to evaluate these two species in the region (Mwanja, 1996). This study 215 represents the first population genetic structure analysis of these species in LVR and fuller understanding of the population structure of the two species, T. zilli and T. rendalli, in Lake Victoria region waters will require complimentary ecological evaluation and continued monitoring of changes in their genetic structure.

216 CHAPTER 4

Genetic Variability and Genetic Interaction among Species

217 1. Comparison of the Genetic Population Structures of Lake Victoria Region Tilapiine species using microsatellite markers

INTRODUCTION

Lake Victoria region is a zoogeographical area with water bodies containing similar cichlid faunal groups that have repeatedly evolved throughout the region, and are known for their relatively recent explosive radiation’ (Fryer and lies, 1972). The region includes Lakes Victoria, Kyoga, Edward, George and their surrounding minor water bodies known as satellite lakes (Kaufman and Ochumba, 1993). Interest in the fish fauna of this region has been high since the first recording of the occurrence of cichlid species flocks in Lake Victoria aroimd the turn of the last century. The story of the evolution of cichlid fishes in LVR has changed to one of outcry and call for conservation (Kauônan, 1992). A series of drastic changes (both natural and human induced) resulted in hundreds of the haplochromine species disappearing (Barel et al., 1985; Trewavas et al., 1985; Goldshmidt and Witte, 1992). One of the changes involved introduction of alien species into the LVR including Nile perch, Lates niloticus, and several Tilapiine species. Deliberate introduction of alien species started around the 1930s, in response to the collapse of the native tilapiine fishery of the region. Following these changes a new commercial fishery was established. Nile perch and Nile tilapia, the two dominating exotic species, form the mainstay of the 218 remade fishery. The two are believed to have had detrimental effects on the regions native species including the curtailing the recovery of the two native tilapiine species (Ogutu-Ohwayo, 1990; Balirwa, 1992; Stiassny, 1996). Of the several tilapiine species that were introduced in the LVR only one has come to dominate the waters throughout the region. Three other introduced non- indigenous species, together with the two native tilapiine species, remain in the wild but as minor components in most waters (chapter one). Species such as Oreochromis spirulus nigra and Oreochromis homorium have not been recorded since the earlier records of establishment or introduction (Fryer and lies, 1972). Several arguments and explanations have been given as to the success of Nile Oreochromis niloticus in waters where congeners failed (Balirwa, 1992; Sanderson et al.. 1995; Batjakas. 1997). The arguments have centred on the ecological versatility of O. niloticus. But the other argument was put forward in the first part of these studies (Mwanja et al., 1995; Mwanja, 1996) was that of the genetic differences and interaction among the tilapiines species in the region. One of the species that has not been recorded since the earlier establishment,Oreochromis spirulus nigra, is now believed to have been lost due to genetic swamping through hybridization with the Nile'tilapia {Oreochromis niloticus) and another of the introduced species, Oreochromis leucostictus (Fryer and lies 1972; Leveque, 1997). We have come to believe that genetic swamping may also be playing a major role in the demise of some of the remnant populations of the native tilapiine species especially where the latter are the minor component. From the fishery survey it was apparent that intermediate morphs between various combinations of the extant tilapiine species in the region exist. In this study, as part of the cichlid conservation genetics project on the LVR cichlids, our goal was to assess the genetic impact of introduced species on the survival of the native species. Attempt was made to establish the reasons why there has been a differential success among introduced tilapiine species in the region, by comparing and contrasting the genetic structures of the surviving tilapiine species in the region using microsatellite markers. The molecular method that is appropriate for study of population genetic structure of closely related species such as the tilapiines 219 has to be able to generate highly polymorphic markers for sufficient variation to discriminate among individuals within and between taxa. Primers used have to be universal (to populations and species that may not be taxonomically closely related) in application under uniform reaction conditions. The markers generated have to be inherited in strictly co-dominant Mendalian fashion (Schlotterer and Pemberton, 1994). Microsatellite markers developed from DNA library of Oreochromis niloticus for cichlid species (Lee and Kocher, 1996) have been shown to work across genera and including working in haplochromine species (Wu, 1999). Such attributes allow for analysis of population structure including phenomenon, such as hybridization, which is a common occurrence among tilapiine fishes (Fryer and lies, 1972; Trewavas. 1983). Microsatellites have been used to analysis the genetic population structure of tilapiine regional strains in Southern California including analysis of hybrids between the introduced species into water bodies throughout the region (Costa-Pierce and Doyle, 1997). We have used microsatellite markers for genetic population structure study of Astatoreochromis allaudi (Wu et al., 1999), and in estimating phylogenetic relationships among haplochromine species groups (Wu, 1999).

MATERIALS AND METHODS

Population analysis of the respective species studied was described elsewhere (chapter 3). Ten microsatellite loci were analyzed using primers designed and developed from Oreochromis niloticus DNA library (Kocher and Lee, 1996). Analysis of the data was by Microsatl.5 (Minch, 1996) and Genepop3.1 (Raymond and Rousset, 1995) computer software programs. Means of statistics used in analysis of the population genetic structure for each species are summarized and used in the comparison of the species structures in the region. Genetic distances were calculated according to Nei (1972). Phyletic relationships among selected populations of species thought to be hybridized were estimated based on the proportion of shared alleles (ps) standardized as the negative natural log, -In (ps). The genetic distance 220 measure based on proportion of shared alleles reflects the exchange of alleles between species that are not compounded as a frequency. Change in allele frequency may well be due to hybridization but is less appropriate as a definite indicator of hybridization compared to proportion of shared alleles.

RESULTS

MicrosatcUite population variability There were no statistical differences (X2, P

Species/ Alleles/locus Avg. Het/locus % Private alleles Oreochromis esculentus 27 0.583 39.1 Oreochromis variabilis 20 0 712 41.2 Oreochromis leucostictus 22 0.614 51.0 Oreochromis niloticus 18 0.555 30.0 Tilapia zilli 13 0.541 55.0

Table 4.1. Microsatellite loci variability for Lake Victoria region tilapiine populations.

221 Species/ No. pop. Alleles.. Avg. HeL /locus/pop. /locus Oreochromis esculentus 11 7.3 0.596 Oreochromis variabilis 6 7.6 0.711 Oreochromis leucostictus 10 7.2 0.610 Oreochromis niloticus 15 5.6 0.552 Tilapia zilli 6 4.9 0.548

Table 4.2 Microsatellite population variability for Lake Victoria region Tilapiine populations.

Species subdivision and population differentiation Measures of inbreeding. Fis and Fit, showed the native species to have relatively higher levels compared to the introduced species (Table 4.3). Oreochromis niloticus had the lowest values among the species of genus Oreochromis while Tilapia r/lli had a negative value. O. niloticus had the biggest proportion of loci with negative Fis and Fit values. The measure for population subdivision showed T. zilli and O. esculentus to be most subdivided while O. niloticus, O. leucostictus and O. variabilis were the least subdivided.

222 Species/ No. loci Fwc(is) Fwc(st) Fwc(it) Loci with Neg. Fis values Oreochromis esculentus10 0.054 0.216 0.258 3/10 Oreochromis variabilis 10 0.116 0.133 0.234 2/10 Oreochromis leucostictus10 0.130 0.156 0.266 1/10 Oreochromis niloticus 10 0.002 0.150 0.152 5/10 Tilapia zilli 7 -0.123 0.215 0.119 2/7

Table 4.3. F-statistics for Lake Victoria region tilapiine species estimated (Fwc) as in Weir and Cockerham (1984).

Gene flow among populations within species Table 4.4 shows the estimated level of migration within species between of the four Oreochromis species and that for Tilapia zilli. Oreochromis leucostictus had the highest number of migrants followed by Oreochromis niloticus. Oreochromis esculentus had nearly the same number of migrants as O. niloticus. but much higher than that ofOreochromis variabilis, which was less than that ofTilapia zilli. There was no significant difference in the mean frequency of private alleles between any two among O. niloticus, O. leucostictus, O. esculentus and T. zilli but there were slight significant differences when any of the foiv above was compared to O. variabilis

223 Mean Mean frequency, Number of Sample size of private alleles migrants

Tilapia zilli 14.5 0.08 1.50 O. variabilis 9.83 O.ll 1.17 O. esculentus 15.44 0.06 2.13 O. niloticus 14.88 0.06 2.34 O. leucostictus 14.62 0.05 3.46

Table 4.4. Number of migrants estimated using private allele method after Barton and Slatkin (1986). Values are corrected for sample sizes.

Phyletic relationships among populations Figures 4.1 and 4.2 show the phyletic relationship among populations of Oreochromis species from Lake Victoria and Lake Kyoga basins in relation to the putative origin populations of the introduced species. Figure 4.1 was based on Fst genetic distance measure and Figure 4.2 was based on Nei’s standard genetic distance measure, Gst (Microsatl.5). Genetic interaction between species was investigated by comparing pure representatives of the species involved to their populations that are thought to be of hybrid status. Hybrid status, especially of the native species, is postulated to depend on the abundance of the exotic species relative to the native species (Table 4.5).

224 The hypothesis was that the less the relative abundance of the native species compared to the exotic species the more significant was hybridization between the two forms of tilapiine species. This hypothesis was based on the fact that non- indigenous tilapiine species in the LVR comprise of species known to be ecologically versatile and aggressive, while the two native species tend to be specialized and submissive (Batjakas et al., 1997). The aggression and versatile nature allows species as the non-indigenous species to dominate the submissive species ecologically and interfere with the fertilization of eggs. In case the non-indigenous species was a minor component, large number of the submissive species diminished aggression toward its congeners. As mentioned above the analysis of genetic interaction among species was based on proportion of shared alleles using Microsatl.5 computer software. Figure 4.3 shows the relationship of Oreochromis variabilis species in comparison to Oreochromis n/Voticus from Lake Albert. The relationship between O. niloticus and Oreochromis esculentus, and among O. leucostictus, O. esculentus and O. niloticus are show in Figures 4.4 and 4.5 respectively. Figure 4.6 shows the relationship between populations of Tilapia zilli and the population of Tilapia rendalli from Lake Nabugabo.

225 Location/lake Congeners present Most dominant species Oreochromis esculentus Nabugabo lakes Kayanja - O. esculentus Manywa - O. esculentus Kayugi - O. esculentus Koki lakes Mburo O. niloticus and O. niloticus O. leucostictus Kachira O. niloticus and O. niloticus O. leucostictus Yala basin Kanyaboii O. niloticus O. esculentus Kyoga lakes Nawampasa O. niloticus, equally abundant O. variabilis and O. leucostictus Lemwa O. niloticus O. niloticus Kawi O. niloticus O. esculentus Nyaguo O. niloticus and Not clear O. variabilis Bisina O. niloticus, O. niloticus O. leucostictus and O. variabilis Oreochromis variabilis Lake Victoria O. niloticus and O. niloticus O. leucostictus Kyoga lakes Nawampasa O. niloticus, equally abundant O. esculentus and O. leucostictus Gigate O. niloticus and O. niloticus O. leucostictus Victoria Nile O. niloticus and O. niloticus O. leucostictus Bisina O. niloticus O. niloticus O. leucostictus and O. esculentus Tilapia rendalli Lake Nabugabo T. zilli T. zilli Lake Victoria T zilli T zilli Lake Kyoga T zilli T. zilli Kyoga lakes T. zilli T. zilR

Table 4.5. Oreochromis esculentus, Oreochromis variabilis and the exotic Tilapia rendalli populations and their congeners with which they coexist, and the most dominant of the congeners.

226 MBL - L. Mburo O . leucostictus VNL - Victoria Nile " VIL - L. Victoria " ■NWL - L. Nawampasa " LWL - L. Nakuwa " KOL - L. Kyoga " ABL - L. Albert EDE - L. Edward - O. esculentus GGL - L. George - O. leucostictus AGL - L. Gigate " KCL - L. Kachira MBE - L. Mburo - O. esculentus KJE - L. Kayanja " KWE - L. Kawi KNE - L. Kanyaboii " LME - L. Lemwa " MNE - L. Manywa KGE- L. Kayugi ’NYE - L. Nyaguo " VTV - L. Victoria - O. variabilis BSV - L. Bisina NWV - L. Nawampasa " NWE-L. Nawampasa- O. esculentus AGV- L. Gigate - O. variabilis ■VNV - Victoria Nile " BSE - L. Bisina - O. esculentus KAV- SW L. Victoria - O. variabilis ON - L. Kyoga - O. niloticus WN - L. Nakuwa " VNN - Victoria Nile " MN - Lemwa " BSN - L. Bisina ■NGN - Winam gulf " KAS-SW L. Victoria i-NAP - Victoria Nap. gulf " ^NAB - L. Nabugabo " .CN- L. Kachira JT-G(GN - L. George " T — G iAG - L. Gigate " |-EDN - L Edward " ' “MBN- L. Mburo -A B N - L. Albert Figure 4.1. A phylogram o f Oreochromis species populations from Lake Victoria region and a conspecifics from Lake Albert based on Fst genetic distance measure.

227 EDE - L. Edward - O. esculentus LWL- L. Nakuwa - O. leucostictus NWL- L. Nawampasa ” MBL - L. Mburo " VNL - Victoria Nile VIL - L. Vitoria " KCL - L. Kachira GAGL-L. Gigate ” GGL - L. George ABL - L. Albert L . K y o g a M B E - L . M b u r o O. esculentus L. Kayanja KWE - L. Kawi LME - L. Lemwa " KNE - L.Kanyaboii MNE - L. Manywa " KGE - L. Kayugi NYE - L. Nyaguo " NW V - L. Nawampasa- O.■variabilis L. Bisina L. Victoria " NWE - L. Nawampasa- O. esculentus G AG V - L. G igate O.variabilis VNV - Victoria Nile BSE - L. Bisina O. esculentus KADV - SW L. Victoria - O.variabilis KON - L. Kyoga O. niloticus LWN - L. Nakuwa " LEMN- L. Lemwa " NAGN- Victoria Nile " BISN - L. Bisina " NGN - L. Victoria (W inum) " KASN - SW L. Victoria NAPN - L. Victoria (Napoleon) NABN - L. Nabugabo " KCN - L. I^chira " GGN - L. George " t e AGN- L.Gigate " EDN - L. Edward " MBN - L. Mburo " ' ABN - L. Albert

Figure 4.2. A phylogram of populations of Oreochromis species in Lake Victoria region and conspecifics from Lake A lbert based on N ei's genetic distance m easure, Gst.

2 2 8 , VIV - Lake Victoria (Naopoleon Gulf)

, BIS - Lake Bisina

, NWV - Lake Nawampasa

, VNV - Victoria Nile River

, GAG • Lake Gigate

.KAD-SW Lake Victoria

, ABN - Lake Albert (O niloticus)

Figure 4.3. Phyletic relationships among Oreochromis variabilis populations of Lake Victoria region in relation to a 'pure' representative population of Oreochromis niloticus from Lake Albert, based on on proportion of shared alleles (ps) standardized as '-In (ps)'.

229 MBE • L. Mburo - O. esculentus KJE -L. Kayanja " KGE - L. Kayugi " KWE. L Kawi LME - L. Lemwa " . NYE - L. Nyaguo " . KNE * L. Kanyaboii " . EDE - L. Edward " . BSE. L. Bisina " . NWE - L. Nawampasa " , MBN - L. Mburo - O. niloticus _ GAG - L. Gigate . KCN - L. Kachira LEM • L. Lemwa BIS • L. Bisina NAP - L. Victoria (Napoleon gulf) NAB • L. Nabugabo ABN * L. Albert

Figure 4.4. Phylogram of populations of Oreochromis esculentus and Oreochromis niloticus from Lake Victoria region and Lake Albert based on proportion of shared alleles (ps) standardized as '-In (ps)'.

230 KJE - L. Kayanja - O. esculentus KWE - L. Kawi MBE - L. Mburo " LME - L. Lemwa " KNE - L. Kanyaboii NYE - L. Nyaguo " BSE - L. Bisina " NWE - L. Nawampasa MBL - L. Mburo - O. leucostictus KCL - L. Kachira - " NWL - L. Nawampasa " EDE - L. Edward - O. esculentus ABL - L. Albert - O. leucostictus GAGL - L. Gigate " KCN - L. Kachira - O. niloticus cMBN - L . Mburo " LEMN - L. Lemwa " cBISN. L. Bisina ABN - L. Albert

Figure 4.5 A phylogram of select sample o f pure' and "hybrid" populations of Oreochromis niloticus, Oreochromis leucostictus and Oreochromis esculentus from Lake Victoria region and Lake Albeit, based on proportion of shared alleles between populations.

231 , ABTZ - Lake ALbert

, BISTZ - Lake Bisina

, LK.TZ - Lake Nawampasa

, KOTZ - Lake Kyoga

, NABTZ - Lake Nabugabo

, VICTZ - Lake Victoria

, NBTR - Lake Nabugabo

Figure 4,6. A phylogram of populations of Tilapia zilli from Lake Victoria region and their conspecific from their putative origin of Lake Albert in relation to Tilapia rendalli from Lake Nabugabo. Genetic distances were based on proportion of shared alleles (ps) standardized as 1- (ps).

232 DISCUSSSION

Cross amplification

Primers chosen for the study worked for ail Oreochromis spp populations under uniform reaction conditions. In some populations background bands were observed. Where such extraneous bands resulted in difficulty in scoring of alleles, reactions were rerun at a degree or two higher. This gave reproducible products and resulted in clearer autoradiograms eliminating or greatly reducing the extraneous bands. The same primers were used with Sarotherodon galilaeus population from Lake Albert and worked for all loci under the same conditions as in case of Oreochromis populations (results not presented here). For genus Tilapia only seven out of 10 loci were amplified successfully with reproducible alleles. The seven worked after altering the temperature profile for the reaction conditions by three or more degrees. The remainder of the primer pairs for the three loci worked sporadically, amplifying the three loci after alteration of temperatures by more than four degrees or more. In the few populations where the rem a in in g three loci were amplified it was for portion of the individuals in the sample and with background bands in the autoradiograms. This is likely a reflection of evolutionary differences given the phylogenetic distances between the two genera, Tilapia and that of Oreochromis. But to a great extent the primers are universal and optimization of reaction conditions for the other primers made by Kocher and Lee out of the same O. niloticus DNA library could yield more universal primers usable in analysis of the genetic population structure of species across genera. Wu (1999) has used these very primers in analysis the phylogenetic structure of haplochromine species and in analysis of the genetic population structure of Astatotilapia allaudi.

233 Microsatellite loci variability The markers generated for ail the 10 loci were highly polymorphic and heterozygous. There was variation among species in allele sizes and allele size ra n g e s (Chapter 3). Within species populations had significant proportions of private alleles. Significant proportions of species private alleles and genus specific alleles marked the 10 loci. Microsatellite markers have been found to be generally highly polymorphic and distributed throughout genomes of many eukaryotic organisms (Cavilli-Sfoiza, 1998). Because of their polymorphic nature and selectively neutral evolution of the markers generated the microsatellite technique provides an important tool for analysis of genetic population structure (Schlotterer and Pemberton, 1994; Guillermo et al., 1997). In tilapia research, microsatellite primers offer an alternative to allozyme markers where variation in enzymes within and among populations and among species was found to be limited (McAndrew and Majumdar. 1983).

Population variability

Though all species were highly polymorphic and heterozygous at the 10 microsatellite loci analyzed, the majority of the species were highly subdivided as shown by the high proportions of private alleles and Fst values. Oreochromis niloticus on the other hand was relatively less subdivided with the lowest proportion of private alleles and lowest Fst values. Tilapia zilli and O. niloticus were the only two species with negative or negligible Fis values. Fis positive value are a measure of inbreeding (Wright, 1951). The rapid expansion, multiple sources of seed, and repeated introduction may have given O. niloticus edge over the rest of the tila p iin e species in Lake Victoria region. Certainly the labile ecology and versatility of O. niloticus have ensured the continued dominance of this species in Lake Victoria Region despite the immense fishing pressure. When the genetic population structures of Oreochromis species were contrasted, Oreochromis esculentus and Oreochromis variabilis showed the highest

234 subdivision. Oreochromis leucostictus though exhibiting higher Fis and Fit values, was less subdivided than Oreochromis niloticus. O. leucostictus is known to use lagoons and swamps by the lake edges effectively allowing exchange between populations in such vast swampy areas such as Kyoga lakes. The ability to use swamps by O. leucostictus is thought to lower the genetic subdivision among populations compared to its congeners that are not associated with swampy waters. Experiments by the Chapman et al (1995) have shown that all tilapiine species in the LVR have almost same level of tolerance to hypoxia, a situation typical of swamps and swampy waters around most satellite lakes in the region. Other factors certainly may be contributing to the ability of O. leucostictus to use swamps more effectively than its congeners.

Phyletic relationships Mostly populations were differentiated by species except for some of the populations of the native species, Oreochromis esculentus and Oreochromis variabilis. Notable on the dendograms were the questionable sister relationship, using both Fst distance measure and Nei’s genetic distance (Gst) measure, of O. esculentus and Oreochromis niloticus as observed by Trewavas, 1983. Among the species studied O. esculentus is apparently closer to Oreochromis leucostictus than to O. niloticus. The phyletically,O. variabilis populations were closer to populations of O. niloticus than to those of other congeners. In general O. variabilis populations are small and have been found to undergo hybridization with O. niloticus (Fryer and lies, 1972) which may explain the closer phyletic relationship of populations of these two species. Indeed there is now believed that O. variabilis is endangered not only as a result of the severe decline in population size but also as a result of interaction with O. niloticus. Among the Oreochromis niloticus populations, the Kyoga populations are the most derived. The three within Lake Victoria populations (NAP, NGN, KAS) cluster together. Populations of O. niloticus from Koki lakes were found to be closer to the putative origin population of Lake Edward than to that of Lake AlberL Again, 235 as observed in Fuerst et ai. (1997) based on RAPD markers, the Lake George population was phyletically further away from the geographically closer population of Lake Edward than it was from the Lake Albert population. Such a phenomenon could best be explained by the introduction craze of the tilapiines in the last century in Uganda.

Genetic interaction

All populations of Oreochromis that were coexisted with populations of congeners were found to be more differentiated and more derived from the ‘pure’ representatives of either species in the mixed pools. The pure representatives were found to be not coexisting with congeners or as the most dominating in abundance of the congeners. This fact was true for both native tilapiine species, Oreochromis esculentus and Oreochromis variabilis, when existing with any or in combination with Oreochromis niloticus or Oreochromis leucostictus both of which are introduced non-indigenous species. The evidence for hybridization is the phyletic relationships among populations within species as shown in respective dendograms. Minor components, especially, of native species in waters where they coexist with the non- indigenous species are closer to the introduced non-indigenous species than the dominant conspecifics are to the congeners they share waters with. Of special mention are the Kyoga populations of all the tilapiine species, both native and non- indigenous, because of their highly derived nature arguably due to genetic interaction between species. The Nabugabo lakes’ populations or Oreochromis esculentus remain the only extant pure representatives of this species. The danger though is that in Lake Nabugabo Oreochromis niloticus and Oreochromis leucostictus are abundant and close to the rest of the Nabugabo lakes populations and as may result in tainting of these remnant pure representatives through deliberate introductions. For now, traditional beliefs have managed to protect and conserve these populations but this may some day be abandoned, as they are not backed by law or gazzetted regulations. 236 Elsewhere O. esculentus populations especially those of Lake Kyoga and the one from Lake Edward/George system have essentially been genetically swamped and may be on their way out. The only population of Kyoga lakes that is like the Nabugabo lakes’ populations is that of Lake Kawi (KWE). Lake Kawi was dominated by O. esculentus with O. niloticus as a very minor component- the reason why O. esculentus population in this lake survives in less pure’ form. Of the two til^ia species, Tilapia zilli was the more abundant and by far the most frequently encountered species than Tilapia rendalli. The occasional nature of T. rendalli in Lake Victoria Region makes its continued survival precarious given that it has been found to readily hybridize with T. zilli. In Lake Nabugabo the two species were at a stage where the hybrids of the two were more frequent than either species - a final phase in knocking out of one of the parent species, especially the minor component. Such a phenomenon has been reported for Oreochromis spirulus nigra in Lake Naivasha (Leveque, 1997), Koki lakes (Fryer and lies, 1972) and in Lake Bunyonyi (Lowe-McConnell, 1958) while hybridizing with Oreochromis niloticus and/or Oreochromis leucostictus.

237 CHAPTER 5

Molecular Biotechnology and Fishery Resources Management

238 1. Adopting molecular biotechnology in management of Lake Victoria Region Fisheries Biodiversity

thus, a complete molecular reanalysis of the biological world is unnecessary. Molecular markers are used most intelligently when they address controversial areas or when they are employed to analyze problems in natural history and evolution that have proven beyond the purview of traditional non-molecular observation. (Avise. 1994, on why not employ molecular genetic markers?*)

History of molecular analysis in natural populations

Before the 1960's, genetic studies of natural populations were based on distinctive and visible polymorphisms. The traits of choice for study of the distribution and frequency of genetic variation among natural populations were unusual or visible morphological characteristics, factors such as lethal mutations, or unique or rare polymorphisms. Such traits, however, were not able to reveal sufficient genetic variation in most natural populations to answer contentious questions of the time regarding genetic variation and evolution. At that time, the debate concerning the occurrence and extent of genetic variation within natural populations was driven by two schools of thought; the classical school versus the balanced view (Lewontin, 1974). With the use of biochemical, and more recently molecular methods, increasing evidence of widespread genetic variation within populations caused the debate to evolve into one centered on the adaptive significance of genetic variability in natural populations (Kimura, 1968, King and Jukes, 1969). These debates drove the continued development in methods for the analysis of genetic variation in natural populations, attempting to determine whether or not the variation

239 within natural organisms was of adaptive significance or was instead the result of mutation and genetic drift of neutral mutations (Avise, 1994). Development of electrophoresis was groundbreaking in this regard and for the first time provided insight into the exact extent of variation within and among natural populations. By the mid I960's genetic variation could be essayed at 20 or more enzyme loci giving a clear indication of the levels of variation that exist in natural populations (Lewontin, 1974). Protein electrophoresis revealed patterns of variation in individual species and/or in pooled data from many species that could be compared with the predictions derived from the various genetic theories concerning how natural populations maintain genetic variation. Having proven the existence of large amounts of genetic variation in natural population the debate returned to considerations similar to those that led to the original classical versus balanced viewpoints, that is, the adaptive significance of the observed variation. Individual polymorphisms were studied in detail to search for the functional relevance of genetic variation - a question that continues to drive genetic research both in natural populations and in the laboratory. This search for a functional role has intensified with the economic and medical importance of genetic research. Development of recombinant DNA technologies in the late 1970's and early I980's made possible significant advances in techniques of protein and DNA sequencing. Applications of these new technologies for analysis of genetic variation in natural populations was, however, slow to catch on. This tardiness was due to a number of reasons: the number of individuals that could be analyzed by the new technologies was much smaller than could be done using protein electrophoresis; preparation of DNA samples for these techniques was time consuming and originally required the cloning of the DNA fi-om each individual into some vector before sequencing; finally, a combination of these factors made the use of the new technologies initially prohibitively costly for the analysis of genetic variation in natural populations. Newer technologies, starting with the advent of PCR and its

240 automation, and now the introduction of automated DNA sequencing, have made it possible to generate more data that is more detailed and at more reasonable costs.

Geneticists have used protein and DNA electrophoresis to analyze the genetic structure of populations, estimate migration and hybridization rates in natural populations, and resolve taxonomic controversies in systematics and evolution. Analysis of genetic variation has been conducted and is being done for evolutionary studies, management and conservation of biodiversity. Pressures on natural resources 6om increasing human populations, and pursuit of economic well being, especially in developing countries, require that we monitor the health of natural populations even more effectively. Monitoring and understanding population changes requires complimentary ecological and genetics studies, and being aware of the importance of the other disciplines such as taxonomy and organismal biology. Unfortunately the importance of such studies has only recently been acknowledged, and has rarely been directly used in decisions on the management of biodiversity in the developed countries. Resources for management of aquatic resources based on the best scientific information in Africa have been dwindling since the transition from foreign to local management of natural resources, and the subsequent decline of the well funded exploratory studies of Africa's aquatic resources by western scientists (IBP, HEST, IFAN) that characterized the first three quarters of the 20* century. Recently, however, with the global environmental interests of the World Bank, funds have been made available for comprehensive scientific studies and management of key aquatic resources in Africa, among which is the Lake Victoria Management Program (LVEMP). Certainly various studies by international scientists of African aquatic resources are still on going, but many of them play little or no role in the immediate management of local biodiversity. In fret, a large proportion of such studies by western scientists are responses to imminent extinction or studies of already endangered species, rather than the routine monitoring or surveys that are needed for

241 effective management of regional natural resources. Collaborative studies and increased training will be needed to fill the void, and may be the only effective way to transfer appropriate technology for management of natural resources. The L VR fisheries can serve as a case study in management of Africa's aquatic resources, while also representing a key site for basic ecological and evolutionary studies. There is a need for increased genetic studies as part of the proper management of the Lake Victoria region fisheries. We considered what questions need to be answered and how this relates to genetic studies that have been initiated. Emphasis has been put on question of technology transfer that is not only appropriate to the questions being answered but also feasible and applicable in the infrastructure settings of the region. In the Lake Victoria region, efforts have been underway since the start of the Lake Victoria Environment Management Program (LVEMP) to include the evaluation of genetic biodiversity of fish fauna as part of the larger biodiversity component of LVEMP.

Appropriate molecular technologies in management of Lake Victoria region fisheries

The choice of appropriate molecular technology to assist effective management of a resource is determined by the circumstances of change for each specific natural resource. The status of each natural resource has been affected by different and sometimes unique set of factors. The Lake Victoria region has been marked by unique circumstances, especially since the beginning of the 20“* century (Kaufman, 1992). The region has several main water bodies each surrotmded by a group or groups of minor satellite water bodies, with repetitive but highly diverse cichlid species fauna in the various lakes (Kaufrnan and Ochumba, 1993). The LVR has seen volatile evolutionary history, with the lakes imdergoing a series of desiccation and reflooding events (Johnson et al., 1996). High cichlid species diversity and endemism characterize the region, in parallel with the two other African

242 Great Lakes (Lake Malawi and Lake Tanganyika). The LVR is the youngest of the three Great Lakes’ regions. It contains bodies such as Lake Victoria, thought to have undergone a severe desiccation period lasting nearly 2000 years before reflooding only 12,000 years ago (Johnson et al, 1996), but yet producing an estimated nearly 600 species of cichlid species (Seehausen, 1999). More disturbing story, however, are limnologicai and human induced changes over the last half century that have led to the extinction or displacement of nearly 200 species of fish (Barel et al., 1984; Trewavas et ai., 1985; Kudhogania and Chitamweba, 1993; Witte et al, 1992a, 1992b, 1995). Of the estimated 600 endemic flsh species, less than one himdred had been described scientifically and only a fraction of the described species had been named before the recent extinctions began (Greenwood, 1981). It is possible that more species have been lost than previously estimated, since many cichlid species were undescribed and unrecorded at the time of the ecological changes that led to extinction (Kaufman, 1992). Among the most needed tools are ones that would help resolve the taxonomic uncertainties, markers that will assist in the identification and classification of the existing fish species in the LVR. The importance of such tools cannot be imderestimated, since they are required to convince skeptics that the cichlid flsh of Lake Victoria represent not one or a small number of widely distributed polymorphic species in the LVR, but hundreds, perhaps as many as 600 of them. This area is one where direct input from the west is mgently needed, especially since much of the earlier taxonomic work for the flsh of the LVR was performed by foreign scientists and many of the type species are located in museums outside of the region. In addition, modem techniques required for taxonomic work of that magnitude such as large volume DNA sequencing and only already established labs in developed countries could currently handle analysis. Currently, experts on the Lake Victoria cichlid fishes are found at Boston University under Les Kauflnan and the HEST group at the University of Liden. Our laboratory at Ohio State University, under Paul Fuerst in collaboration with Les Kauânan's group, Makerere University and the

243 fisheries research institutes of the three riparian states of the LVR, has for nearly 10 years been actively involved in gathering molecular data important for taxonomic and phylogenetic studies of cichlid fishes. However, the cichlid fishes are not the only group, which are in need of more intense studies. Among other groups in the LVR affected by dramatic ecological changes are the original commercial species of the lakes, such as the native tilapiines, lungflsh. bagrids, Labeo victorianus, Barbines especially Barbus alitenalis, and many other catfishes such asClarias spp and Schlibe mytus. Populations of all these fish have been severely reduced in size and the fish are only occasionally caught (Ogutu- Ohwayo, 1990). To develop conservation programs for these species, as envisioned in the LVEMP project, we need first to establish how much genetic diversity is found in the remnant surviving populations, and understand the connections among populations which are possibly now isolated from one another. Though short-term goals might be to conserve as much of the extant genetic diversity as possible, the ultimate scientific goal is to understand and protect the evolutionary processes of the different species, a goal that would preserve these species in their natural habitats. Such a venture would necessitate analysis of the various populations, the level that evolution takes place, rather than examining a few representative individuals, as normally is the case when dealing with macroevolutionary taxonomic questions. Population differences are rarely discerned by morphological differences, and molecular techniques that are able to differentiate among individuals and reveal recent evolutionary changes would have to be employed. What is important is that this kind of work currently can be done locally with relatively minimal investment. Commonly used measures of generic diversity include the level of polymorphism (simply the occurrence of two or more alleles at a particular locus), and heterozygosity (determined by the relative allele frequencies at a locus within or between populations). Assessing these two attributes in a manner that would be useful for guiding management decisions for closely related taxa requires molecular tools that are highly polymorphic, inherited in a Mendelian manner (codominant) and

244 that are easily aud reliably scorable, to allow comparison of data among populations, species, and between laboratories. O f the current markers that have been developed, microsatellite DNA markers appear to be the most appropriate for the study of LVR fishes. A number of other molecular techniques have been evaluated for their potential in studying the fishes of the LVR. Allozyme analysis has failed to generate sufficient polymorphism to allow for discrimination among populations and/or species (MeAndrew and Majiundar, 1983; Sage et al., 1984). Some other DNA markers, such as mitochondrial DNA and nuclear ribosomal RNA and ITS sequences also show low levels of polymorphism (Meyer et al., 1990; Booton et al., 1999). Another important characteristic of an appropriate marker is the universal nature of the reaction conditions for visualizing the marker. A system developed for one species should work in others - allowing comparison across species, genera and, sometimes, higher levels. Such attributes make microsatellite markers ideal for genetic analysis, to determine the occurrence of factors such as hybridization - a phenomenon rife among LVR cichlid fishes (Fryer and lies, 1972; Mwanja, 1995, 1996; Seehausen, 1999).

A typical finding in exploited wild fisheries is that geographical differentiation between populations of the species results due to exploitation of the resource, ecological displacement and erection of barriers to fish movement. In the LVR the original dominant fishery species have been depleted or severely reduced, limited now to several disjunct populations and/or in geographically isolated satellite lakes. To estimate the extent of population subdivision among such populations, in order to plan adequately for reestablishment and conservation, we need to use genetic markers that allow the identification and differentiation of closely related populations at a low cost. The marker required for this purpose should be able to quickly and inexpensively generate distinct genetic profiles for the minimum number of individuals which could be considered at least representative of the genetic structure in a given water body. Multi-locus DNA fingerprinting and DNA RAPD markers

245 may be more appropriate for analysis that is based on individual generic profiles, with the latter allowing for better population statistical analysis than the multi-locus fingerprinting. Following the same reasoning as above, the same molecular methods can be evaluated for the phylogeograpicai analysis of the subdivided populations. Phylogeography allows us to estimate the level of divergence between and among populations, often providing the equivalent of a pedigree inter-relating natural populations. This tool is especially appropriate in the LVR, since some species have seen fish repeatedly moved and transplanted into new waters without clear documentation of the introduction process. RAPD markers may be especially useful in this regard because of the high number of bands (alleles) which can be generated for an individual profile. RAPD markers, when scored as binary presence/absence data, give bands that can be regarded as independent molecular characters. Presence/absence RAPD band data can allow the cladistic analysis of individuals and populations, with each single individual handled as an independent taxa. For example, using the PAUP (phylogenetic analysis using parsimony) program (Swofford, 1991) individuals in a population can be analyzed as independent taxa with each presence or absence of a band at electrophoretic band position for a specific a primer as a characteristic for each individual or taxon (Mwanja, 1996). In contrast, microsatellite markers, though highly polymorphic, do not represent as many genetic loci, and must be scored in many individuals to obtain accurate allele frequency estimates with which to compare populations. Transplantation of fish and introduction of exotic species has already resulted in a situation in the LVR that has been dubbed by some scientists working in the region as an 'ecological catastrophe,' due to the large number of species lost following the establishment of Nile perch and Nile rilapia, and the dramatic limnologicai changes in the region. To be able to monitor and evaluate the impacts of such actions we have to be able to classify individuals and identify populations accurately. One group of fishes in the LVR at increasing risk of extinction is the riverine fishes. Of

246 particular interest are the two original commercial riverine fishes of the region. Labeo victorianus and Barbus alitenalis. Because of population declines, these two species are no longer part of the commercial fishery and are only occasionally caught. A major question about the species concerns the genetic status of the remnant populations, given the severe reduction in population size. In our first part of the analysis in this studies (chapter 2), we found L. victorianus to still retain substantial genetic variability, but also to have highly subdivided populations. Could the various sub-populations be restricted to specific rivers because of the reduced overlap in population resulting from overfishing and limited migratory potential, or do individuals of this species show natal stream fidelity? Again RAPD markers appear to be the appropriate choice for analysis of such questions, because of the ability to generate a large number of markers quickly and relatively inexpensively. In the future, however, it appears that the most serious problem the LVR fishery will face will be the increased artificial movement of fish, with farm releases and inadvertent escapes into the wild. Currently, even though they possess some of the most prolific native fish species in the tropics and subtropics, Uganda and Kenya are widely using alien species such as grass carp, common carp and mirror carp for aquaculture trials, and have already supplied these to farmers. Perhaps these species will not affect the genetic diversity of the indigenous fish species? However, information is not available and it is a source of serious concern if monitoring programs are not put in place to check for possibly imwarranted and unplanned fish releases and introductions. Historically, tilapias were introduced in an unplanned manner. Very soon it is possible that, in an attempt to increase fisheries productivity, 'super strains' of tilapia may be imported into the region. For now, we can only speculate about the impact of such strains on native strains. Could adopting a molecular system of analysis help stem such practices? Perhaps not, but they would greatly assist our ability to monitor any changes in the aquatic systems as they happen, and, armed with such data, we can hopefully devise new management recommendations before the native species are severely impacted.

247 On the macroevolutionary level, the LVR fish fauna continues to provide us the opportunity to test various evolutionary theories. Using molecular phylogenetics based on DNA sequencing, microsatellite variation, and RAPD, combined with morphological and anatomical analysis, we can now begin to look at the theories put forward to explain the rapid radiation and vast species number which have occurred in only 12.000 years. Such questions for now will not be answered locally in the LVR because the facilities are not in pace locally to generate such data. But by working in close collaboration with laboratories in Europe and North America, we can begin to transfer technology. This is already underway through the training of Afiican scientists to handle aspects of these work. Although sometime viewed as esoteric, macroevolutionary questions have direct bearing on the management of the fishery, especially when it comes to issues like restoration and conservation. Deciding on which of the himdreds of species to include in such efibrts does require deep understanding of the evolutionary history and of the mechanisms that have shaped the colonization and extinction of cichlid species prior to the past century’s human induced extinction events. Contentious questions exist concerning the spéciation mechanism(s) that could adequately explain the rapid generation of haplochromine cichlid species in similar manners in the several water bodies in a system characterized by a volatile environmental history. Our understanding of these mechanisms is pivotal in allocating conservation status to specific water bodies among the multitude of water bodies that make up the Lake Victoria region. Of course this further raises the question why other species groups in the region, including the sister tilapiine assemblage, did not share in the success of the haplochromine assemblage? For now, answers to such questions can only be adequately answered if we can use tools that can extract evolutionary history contained in extant forms - and such tools for now are largely molecular.

248 LIST OF REFERENCES

Abban, E. K. 1988. Taxonomy and Biochemical Genetics of some AAican Freshwater Fish Species. PhD. Thesis, University of Wales, Cardiff, UK.

Agnese, J. F., B. Adepo-Gourene, E. D. Abban and Y. Fermon. 1997. Genetic differentiation among natural populations of the Nile tilapia Oreochromis niloticus (Teleostei, Cichiidae). Heredity, 79, 88-96.

Allendorf, F.W. and R. F.Leary, 1986. Heterozygosity and fitness in natural populations of animals. In M.E. Soule (ed), Conservation Biology: The Science o fScarcity and Diversity, pp. 57-76. Sinauer ssociates, Stmderiand, MA.

Allen, P. J., W. Amos, P. P. Pomeroy and S. D. Twiss, 1995. Microsatellite variation in grey Seals (Halichoerus grypus) shows evidence of genetic differentiation between two British breeding colonies. Mol. Ecol., 4,653-662.

Allendorf, F., N. Ryman and F. Utter, 1987. Genetics and fishery management: past, present, and future. In (Ed.) N.Ryman and F.Utter, Population Genetics and Fishery Management. Washington Sea Grant Publications, University of Washington Press, Seattle Washington.

Amstrong, J. S., A. J. Gibbs, R. Peakall and G. Weiller, 1994. The RAPDistance

computer software package. ftp://life.anu.edu.au/pub/software/RAPPistaiice.

Avise, J. C., 1994. Molecular Markers, Natural History and Evolution. C h a p m a n and Hall, New York.

Balirwa, J.S. 1992. The evolution of the fishery of Oreochromis niloticus (Pisces: Cichiidae) in Lake Victoria. Hydrobiologia 232, 58-89.

249 Bardakci. F. and D. O. F. Skinbinski, 1994. Application of RAPD technique in tikq)ia fish: species and subspecies identification. Heredity, 73, 117-123.

Barnard. K. H. 1948. Report on a collection of Fishes from the Okavango River, with notes on Zambezi fishes. Ann.S.Afr.Mus., 36(5), 407-458.

Barel, C. D. N., R. Dorit. P. H. Greenwood, G. Fryer, N. Hughes, P. B. N. Jackson, H. Kawanabe, R. H. Lowe-McConnell, M. Nagoshi. A. J. Ribbink, E. Trewavas. F. Witte, K. Yamaoka, 1985. Destruction of fisheries in Afiica’s lakes. Nature 315, 19-20.

Barton. N. H. and M. Slatkin, 1986. A quasi-equilibrium theory of the distribution of rare alleles in a subdivided populaation. Heredity, 56,409-415.

Batjakas. 1. E., R. K. Edgar, and L. S. Kaufinan, 1997. Comparative feeding efficiency of indigenous and introduced phytoplantivores from Lake Victoria. Experimental studies on Oreochromis esculentus and Oreochromis ni7or/cus.Hydrobiologia

Ber, R. and V. Daniel, 1993. Sequence-analysis suggests a recent duplication of the growth hormone encoding gene in Tilapia nilotica. Gene 125(2), 143-150,

Beveridge, M. C. M., D. J. Baird, S. M. Rahmatullah, L. A. Lawton, K. A. Beattie and G. A. Codd, 1993. Grazing rates on toxi and non-toxic strains of cyanobacteria by Hypophthalmichthys nolitrix and Oreochromis niloticus. J. Fish Biology, 43,901-907.

Booton, G.C., L. Kaufman. M. Chandler, R. Oguto-Ohwayo, W. Duan and P. Fuerst 1999. Evolution of the ribosomal RNA internal transcribed spacer one (ITS-1) in cichlid fishes of the Lake Victoria region. Molecular Phylogenetics and Evolution 11: 273-282.

Cadwalladr, D A. 1964. Investigations of the biology of Labeo victorianus Boulenger in relation to its fishery. East Afr.Freshw.Fish.Res.Org.Ann.Rep., 1962/63, Appendix H, 63-74.

Cadwalladr, D A. 1965a. The decline in Labeo victorianus Boulenger (PiscesrCyprinidae) fishery of Lake Victoria and an associated deterioration in some indigenous fishing method in Nzoia River, Kenya. East Afr.Agric.For.J., 30,249-258.

250 Callen. D. F., A. D. Thompson. Y. Shen. H. A. Phillips, R. I. Richards, J. C. Mull«y, and G. R. Sutherland, 1993. Incidence and origins of “null” alleles in (AC)n microsatellite markers. Am. J. Hum. Genet., 52, 922-927.

Capili. J.B. 1990. Isozyme and Mitochondrial DNA Restriction Endonuclease Analysis of Three Strains of O. niloticus. Dissertation. University of Wales, Wales. UK.

Carvalho, G. R., and L. Hauser, 1995. Genetic impacts of fish introductions: an African perspective. In: T.J. Pitcher and P. Hart (eds.). Species Changes in African la

Cavalli-Storfea, L. L., 1998. The revolution in population genetics. Trends Genet., 14,60-66.

Chalmers. K.J.; R. Waugh, J. I. Simons. W. Powell. 1992. Detection of genetic variation between and within populations of Gliricidia sepium and G. maculata using RAPD markers. Heredity 69, 465-472.

Chapman, L. J., L. S. Kaufrnan, C. A. Chapman and P. E. McKenzie, 1995. Hypoxia tolerance in twelve species of East African cichlids: potential for low oxygen réfugia in Lake Victoria. Conservation Biology, 9(5): 1274-1288.

Costa-Pierce, B. A. and J. E. Rakocy, 1997. (Eds.) Tilapia Aquacultiue in the Americas. World Aquaculture Society, Baton Rouge, Louisiana, United States, 1,1-17.

Craig, J. F.1992. Human induced changes in the composition of fish commimities in the Afiican Great Akes. Rev. Fish Biol. Fish. 2,93-124

Cruz, T. A., J. P. Thorpe and R. S. V. PuUin, 1982. Enzyme electrophoresis in Tilapia zilli: a pattern for determining biochemical genetic markers for use in tilapia stock identification, aquaculture, 29, 311-329.

Dî^et, J., 1960. Remarques sur la systématique des Tilapia. A propos de quelques especes intéressant la pisciculture. Notes et Doctunents sur la Peche et la Pisci-culture, C.T.F.T., (Nogent-sur-Marine; France) Ser. D. G ., No 9, 1-12 (in firench).

Dawson, I.K., K. J. Chambers, R. Waugh, W. Powell, 1993. Detection of genetic variation in Hordeum spontaneum population of Israel using RAPD markers. Molecular Ecology, 2, 151-159.

251 Dobzhansky, T. 1955. A review of some fundamental concepts and problems of population genetics. Cold Spring Harbor Gropu Symp. Quant Biol. 20, 1-15.

Dobzhansky, T. and Pavlovsky, 1953. Indeterminate outcome of certain experiments on Drosophila populations. Evolution, 11, 198-210.

Duan. W.. G.C. Booton. L. Kaufman, M. Chandler and P.A. Fuerst. 1996. Phylogenetic analysis of haplochromine cichlid taxa utilizing DNA heteroduplex separation techniques. In: E.M. Donaldson and D.D. MacKinlay (eds.). Aquaculture Biotechnology, Symposium Proceedings o f the International Congress on the Biology o f Fishes, American Fisheries Society, p. 95-101.

EAFFRO 1947 - 1967. East African Freshwater Fisheries Research Organization Annual Reports 1947/67.

Erkki, J. S. 1995. The introduced Oreochromis niloticus is spreading on the Kafue floodplain. Zambia. Hydrobiologia 315, 143-147.

F AO Fisheries Statistics, 1997. Food and Agriculture Organization of the United Nations,Rome.

Feresu-Shonhiwa, F. and J. H. Howard, 1998. Electrophoretic identification and phylogenetic relationships of indigenous tilapiine species of Zimbabwe. J. Fish Biol., 53, 1178-1206.

Franck, J.P.C., 1. Komfield and J. M. Wright, 1994. The utility of SATA DNA sequences for inferring phylogenetic relationships among the three major genera of Tilapiine cichlid fishes. J. Mol. Evol., 3, 10-16.

Fryer, G. 1961. Observations on the biology of the cichlid fish Tilapia variabilis Boulenger in the northern waters of L. Victoria (East Africa). Rev. Zool.Bot.Afr., LXIV, 1-2.

Fryer, G. 1972. Conservation of the Great Lakes of East Africa: A lesson and a warning. Biological Conservation, 4 (4), 256-262.

Fryer, G., and T. D. Isles, 1972. The Cichlid Fishes of the Great Lakes of Africa. Oliver and Boyd, Endinburgh.

Fuerst, A. P. and T. Maruyama, 1986. Considerations on conservation of alleles and genic heterozygosity in small managed populations. Zoo Biol., 5, 171-179. 252 Fuerst. P., W. Mwanja, L. Kaufman and G. C. Booton. 1997. Genetic Phylogeography of introduced Oreochromis niloticus (Pisces: Cichiidae) in Uganda. In: K. Fitzsimmons (ed.) TILAPIA AQUACULTURE', Proceedings o fthe Fourth International Symposium on Tilapia in Aquaculture (ISTA IV). Volume 1, pp 87-96, Northeast Regional Agricultural Engineering Service, Ithaca.

Futuyma, D. J. 1986. (Ed ). Evolutionary Bilogy. Sinauer Associates, Inc. Sunderland, Massachusetts, pp 194-195.

Garrod, D. J. 1959. The growth of Tilapia esculenta Graham in Lake Victoria. Hydrobiologia, 12,268-298.

Goldshmidt, T and Witte F. 1992. Explosive spéciation and adaptive radiation of haplochromine cichlids from Lake Victoria: An illustration of the scientific value of a lost species flock. M itt Internat. Verein. Limnolol., 23, 101-107.

Graham, M. 1929. The Victorian Nyanza and its fisheries. A report on the survey of Lake Victoria 1927-1928 and appendices. Crown Agents for Colonies, London, England.

Greenwood, P.H, 1965. The cichlid fishes o f Lake Nabugabo, Uganda. Bull. Br. Mus. Nat Hist Zool., 12,315-357.

Greenwood, P.H. 1966. Fishes of Uganda. Kampala Society, Uganda.

Greenwood, P H., 1974. The cichlid fishes of Lake Victoria, East Africa: the biology and evolution of species flock. Bull. Br. Mus. Nat. hist, Zool., Suppl. 6: 1-134.

Greewood, P. H. 1981. The lu^lochromine fishes of East African lakes. Kraus Thomson Organization GmbH, Munich, Germany.

Greenwood, P. H. 1991. Spéciation, pp 86-102. In (Ed) M.W.A Keenleyside, Cichlid Fishes. Chapman and Hall, London.

Gregorius, H. R., 1991. On the concept of effective number. Theor. Popul. Biol., 40,269-283.

Hadrys, H., M. Balick and B. Schierwater, 1992. Application of randomly amplified polymorphic DNA analysis in molecular ecology. Molecular Ecology, 1,55-63.

253 Haiti. D. L. and A. Clark, 1997. Principles of population Genetics. Sinauer Associates nc. pp 61-94.

Hecky, R. E. and F.W.B. Bugenyi, 1992. Hydrology and chemistry of the African Great Lakes and water quality issues; problems and solutions. Mitt Int Verein. Limnol. 23:45-54.

Hedrick, P. 1992. Shooting RAPDs. Nature 355, 679-680.

Herzberg, A. 1978. Electrophoretic esterase patterns of the surface mucus for the identification of tilapia species. Aquaculture, 13,81-83. lUCN. 1984. Categories, objectives and criteria for protected areas. In J. A. McNeeiy and K.R. Miller (eds.). National Parks, Conservation and Development, pp. 47 -53.Smithsonian Institution Press. Washington. D C.

lUCN. 1988. 1988 lUCN Red List of Threatened Animals. lUCN, Gland, Switzerland.

lUCN (1990). 1990 lUCN Red list of threatened Animals. lUCNPubUcations, 192pp. Geneva.

lUCN, 1991. Regional office Eastern Africa: Triennial Report. lUCN. lUCZN Regional office Eastern Africa: Triennual Reports.

Johnson, T. C., C. A. Schulz, M. A. Talbot, K. Kelts, R. D. Ricketts, G. Ngobi, K. Beuning, I. Ssemannda and J. W. M cGill, 1996. Late Pleistocene desiccation of Lake Victoria and rapid evolution of cichlid fishes. Science 273, 1091-1093.

Kaufman L., 1992. Catastrophic change in Species-Rich Freshwater Ecosystems. Bioscience, 42 (11), 846-858.

Kaufrnan, L. and P. Ochumba (1993). Evolutionary and conservation biology of cichlid fishes as revealed by faunai remnants in northern Lake Victoria. Conservation Biology 7, 632-633.

Kaufrnan, L. S. 1997. Asynchronous taxon cycles in haplochromine fishes o f the greater Lake Victoria region. S. Afr. Jour. Science. 93:601-606.

254 Kaufinan, L. S.. C. A. Chapman and L. J. Chapman. 1997. Evolution in fast forward; haplochromine fishes of the Lake Victoria region. Endeavour (London) 21(l):23-30.

Kimura, M 1968a. Evolutionary rate at the molecular level. Nature 217, 624-626.

Kimura, M. 1968b. Genetic variability maintained in afinite population due to mutational production of neutral and nearly neutral isoalleles. Gent. Res. 11, 247-269.

Kimura, M. and J. F. Crow, 1963. The measurement of effective population numbers. Evolution, 17,279-288.

King, J. L. and T. H. Jukes, 1969. Non-Darwanian evolution: random fixation of selectively neutral mutations. Science, 164, 788-798.

King, L.S. and B. A. Schaal, 1989. Ribosomal DNA variation and distribution in Rudneckia missouriers. Evolution, 43, 1117-1119.

Kocher, T. D., W. Lee, H. Sobolewska, D. Penman, and B. J. McAndrew, 1998. A genetic linkage map of a cichlid fish, the tilapia {Oreochromis niloticus). Genetics 148, 1225-1232.

Kumar, S., K. Tamura, and M. Nei, 1993. MEGA: molecular evolutionary genetic analysis, version 1.01. University College. Pennsylvania State University Press, Happy valley.

Komifield, L, U. Ritte, C. Richler and J. Wahrman, 1979. Biochemical and cytological dififerentiation among fishes o f the sea of Galilee. Evolution, 33,1-14.

Kudhongaztia, A. W. and D. B. R. Chitamweba, 1995. Impact of environmental change, species introductions and ecological interactions on the fish stocks of Lake Victoria. In T.J. Pitcher and P. Hart (eds.). Species Changes in African lakesy Ch^man and Hall, London pp 20-44.

Lande, R. and G. F. Bairaowclough, 1987. Efifective population size, genetic variation, and their use in population management. In M. E. Soule (ed.), Viable populations for Conservation, Cambridge University Press, New York, pp. 86-123.

255 Lee. W.-J. and T.D. Kocher. 1996. Microsateilite DNA markers for genetic mapping in the tilapia, Oreochromis niloticus. Fish J. Biology 49:169-171.

Leveque, C. 1997. Biodiversity dynamics and conservation: the fieshwater fish of tropical Africa. Cambridge University Press. Cambridge UK, pp 1-90.

Lewontin, R. C. 1974. The genetic basis of evolutionary change. Columbia Univ. Press, New York.

Liem. K. P., 1980. Adaptive significance of intra and interspecific differences in the feeding repertoires of cichlid fishes. American Zoologist 20,295-314

Lowe, R. H. (McConnell) 1955. Species of Tilapia in East African dams, with a a key for their identification. East Afr.Agric.J.. 20(4), 256-262.

Lowe-McConnell. R. H. 1958. Observations on the biology of Tilapia nilotica (Pisces: Cichiidae) in East African waters. Revue Zool. Bot. Afr., 57, 129-170.

Lowe, R. H. (McConnell) 1959. Breeding behaviour patterns and ecological differences between species and their significance for evolution within the genus Tilapia (Pisces, Cichiidae). Proc.Zool.Soc.London, 132(1), 1-30.

Lowe-McConnell, R. H. 1975 (Ed.). Fish communities in Tropical Waters. L o n g m an Group Ltd., London, 337 pp.

Lowe-McConnell, R. H. 1987. Ecological studies in tropical fish communities. Cambridge University Press, Cambridge.

Lowe-McConnell. R. H. 1996. Fish communities in the African Great Lakes. Env. Biol. Fish. 45, 219-235.

Lynch, M. and B. G. Milligan, 1994. Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3,91-99.

Macaranas, J. M., N. Taniguchi, M. J. R. Pante, J. B. Capili,and R. S. V. Pullin, 1986. Electrophoretic evidence of extensive hybrid gene introgression into commercial Oreochromis niloticus (L.) stocks in the Philippines. Aquaculture and Fisheries Management, 17,249-258.

Macaranas, J. M., L. Q. Agustin, C. A. Ablan, J. R. Pante, A. E. Eknath, and R. S. V. Pullin, 1995. Genetic improvement of farmed tilsq)ias: biochemical characterization of strain differences in Nile tilapia. Aquaculture International, 3, 43-54. 256 Mather, P B. and Arthington, 1991. An assessment o f genetic differentiation among feral Australian Tilapia populations. Australian Journal of Marine and Freshwater Research

McAndrew, B. J. and K. C. Msyumdar, 1984. Evolutionary relationdnps within three tilapiine genera (Pisces: Cichiidae) Zoological Journal of the Linnean Society, 880,421-435.

Meyer, A., T. D. Kocher, P. Basasibwaki, and A. C. Wilson, 1990. Monophyietic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature 347,550 - 553.

Minch, E.1996. MICROSAT computer software:

Moriarty, D. J. W. and C. M. Moriarty, 1973. Quantitative estimation of the daily ingestion rate of phytoplankton by Tilapia nilotica (Oreochromis niloticus) and Haplochromis nigipinnis in Lake George, Uganda. Journal of Zoology, London, 171,41-55.

Mwanja, W. and P. Fuerst, 1995. Conservation and development o f Lake Victoria Fishery: biodiversity and genetics. In (ed.) J.E Haldeman, Sustainable Agriculture Research in Uganda. Agriculture Reseach and Training Program (ART?) Symposium, Cornell International Institute for Food, Agriculture and Development, Cornell University, Ithaca New York, pp 7-14.

Mwanja, W., L. Kaufinan and A. P. Fuerst, (1995). A note on recent advances in the genetic characterization of Tilapia stocks in Lake Victoria Region. Afi'i. J. Trop. Hydrobiol. Fish. 6, 51-53

Mwanja, W.W. 1996. Genetic Variability and Population Structure ofTilcgJiine Fauna o f Lake Victoria Basin (Uganda) in Relation to Exotic Species Introductions. Master of Science Thesis, The Ohio State University, Columbus, Ohio

Mwanja, W. W., G. C. Booton, L. Kaufinan, A. P. Fuerst, 1996. Population and stock characterization of Lake Victoria til*q)iine fishes based on RAPD markers. In E.M.Donaldson and D.D.MacKinlay, Aquaculture Biotechnology Symposium Proceedings o fthe International Congress on the Biology o f Fishes, pp 115-124.

257 Mwanja, W., P. A. Fuerst and L. Kaufinan, 1999. Lake Victoria region; large lakes and their surrounding minor water bodies as natural laboratories for speciatio and evolution. International Lakes in Crisis, North American t Management Society, LakeLine, 19(2), 12-24.

Mwanja, W. and P. Fuerst. 1999 (Accepted). How issues of genetic diversity affect management of African Inland water fisheries; the example of Lake Victoria Region (LVR) fishery. In L. Chapman and C. Chapman (eds ), A Symposium on Aquatic Conservation and Management in Africa, University of Florida, Gainsville, FL.

Mwanja, W. W, A. S. Armoudlian, S. B. Wandera, L. Kaufinan, L. Wu, G. C. Booton,and P. A. Fuerst. 2000 (Accepted). The bounty of minor lakes; the role of small satellite water bodies in evolution and conservation of fishes. Hydrobiologia.

Naish K. -A., M. Warren, F. Bardakci, D. O. F. Skibinski, G. R. Carvalho, G. C Mair, 1995. Multilocus DNA fingerprinting and RAPD reveal similar genetic relationships between strains of Oreochromis niloticus (Pisces: Cichiidae). Molecular Ecology 4, 271-274.

Nei, M. 1972. Genetic distance between populations. Am. N at 106,283-292.

Nei, M. and W. H. Li, 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of National Academic of Science o f USA 76, 5269-5273.

Nei, M., F. Tajima and Y. Tateno. 1983, Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data. J. Mol. Evol., 19, 153-170.

Nelson, J. S. 1994. (3"* ed.) Fishes of the world. J. Wiley, New York.

Oberst S., E. K. Abban and W. Villwock, 1996. Biochemical and immunological markers for the discrimination of three Tilapia species; T. zilli Gervais, T. guineensis Bleeker and T. dageti Thys v. d. Audenaerde (Pisces; Cichiidae) from West Africa.

Northcott M. E., M. C. M. Beveridge and L. G. Ross, 1991. A laboratory investigation of the filtration and ingestion rates of the Tilapia, Oreochromis niloticus, feeding on two species of blue green algae. Environ. Biol. Fish., 31 (1), 75-85.

258 Nunney, L. and D. R. Elam, 1994. Estimating of population size of conserved populations. Conservation Biology, 8(1), 175-184.

Ochumba, P.B.O and D.I. Kibara, 1989. Observations on blue-green algal blooms in the open waters of Lake Victoria, Kenya. African Journal of Ecology, 27, 23-34.

Ogutu Ohwayo, R. 1988. Contribution of introduced fish species especially Lates n niloticus (L.) and Oreochromis niloticus (L.) to the fisheries of Lakes Victoria and Kyoga. FAG Fish. Rep., 388,61-71.

Ogutu-Ohwayo, R. 1990. The decline of the native fishes of lakes Victoria and Kyoga (EastAfrica) and the impact of introduced species, especially the Nile perch,Lates niloticus^ and the Nile tilapia Oreochromis niloticus. Envir. Biol. Fish., 27, 81-96.

Ogutu-Ohwayo, R., R E. Hecky, A.S. Cohen, and L. Kaufrnan. 1997. Human impacts on the African Great Lakes. Environmental Biology o f Fishes 50:117-131.

Orti, G., D. E. Pearse and J. C. Avise, 1997. Phylogenetic assessment of length variation at a microsatellite locus. Proc. Natl. Acad. Sci. USA, 94, 10745 10749

Pouyard, L. and J. F. Agnese, 1995. Phylogenetic relationships between 21 species of three tilapiine genera Tilapia^ Sarotherodon and Oreochromis using allozyme data. J. Fish Biol. 47,26-38

Primack, R. B., 1993. (Ed.) Essentials of Conservation Biology. Sinauer Associates, Sunderland, MA, pp. 277-295.

Raymond, M. and Rousset, 1995. Genepop: population genetics software for exact tests and ecomeniscism. J. Hered., 86,248-249

Regan, C. T. 1920. The classification of the fishes of the family Cichiidae. I. The Tanganyikan genera. Ann. Mag. Nat. hist., 9 (5), 33-53.

Regan, C. T. 1922a. The cichlid fishes of Lake Victoria. Pro. zool. Soc. Lond., 1922, 157-191.

Regan, C. T. 1992b. The classification of the fishes of the family Cichiidae. II. On African and Syrian genera not restricted to Great Lakes. Ann. Mag. Nat. Hist, 9 (10), 249-264.

259 Reid, G. McG. 1982. The form, function, and phylogenetic significance of the vomeropalatine organ in cyprinid fishes. J. Nat. Hist, 16,497-510.

Reid, G. McG. 1985. A revision ofAfrican fishes of Labeo (Pisces: Cyprinidae) and redefinition of the genus. Theses Zoologicae, 6, 322 pp.

Rieseberg, L. H., S. Zona, L. Aberbom and T. D. Martin, 1989. Hybridization in the island endemic, Catalina Mahogany. Conservation biology, 3,58.

Russell, J.R., E. Hosein, R. Waugh, J. Powell, 1993. Genetic differentiation of cocoa (Theobroma cacoa L.) Populations revealed by RAPD analysis. Molecular Ecology, 2, 89-97.

Ryman. N. and F. Utter, 1987. Population Genetics and Fishery Management. Univ. Washington Press, Seattle.

Sage, R.D., P. V. Loiseile, P. Basasibwaki and A. C. Wilsott 1984. Molecular versus morphological change among cichlid fishes of Lake Victoria. Pp. 185-201, In A. A. Echelle and I. Komfield (eds.). Evolution o f Fish Species Flocks. University of Main at Orono Press, Orono.

Saitou, N. and M. Nei, 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4,406-425.

Sambrooke, J., E. F. Fritsch, T. Maniatis, 1989. (2 Ed.) Molecular cloning: a laboratory manual, Ed 2. Cold Spring Press, Cold Spring Habor, NY.

San Oosthuizen, F. H., Van der Bank and J. T. Ferreira, 1993. Genetic distances between evolutionary relationships for Tilapia guinasana, T. rendalli and Tsparrmanii. Biochem. Syst. and Eco. 21(3), 351-362

Sanderson, S. L., M. C. Stebar, L. L. Ackermann, S. H. Jones, I. E. Batjakas and L. Kaufinan 1996. Mucus entrapment of particles by s suspension-feeding tilapia (Pisces: Cichiidae). J. Expt. Biol., 199, 1743-1756.

Schlotterer, C. and J. Pemberton, 1994. The use o f microsatellites for genetic analysis of natural populations. Molecular Ecology, 203-209.

Schwank, E. J. 1995. The introduced Oreochromis niloticus is spreading on the Kafiie floodplain, Zambia. Hydrobiologia 315, 143-147.

Seehausen, O. 1996. (Ed.)Lake Victoria cichlids, taxonomy, ecology, and distribution. Verduijn Cichlids, Zevenhuizen, Netherlands, 304 pp.

260 Seyoum, S. and I. Komfield, 1992. Identificafion o f the subspecies of Oreochromis niloticus (Pisces: Cichiidae) using endonuclease analysis of mitochondrial DNA. Aquaculture 102,29-42.

Shaffer, M. L. 1987. Minimum viable populations: coping with uocertainity. In M.E.Soule (ed.). Viable Populations for Conservation, pp. 69-86. Cambridge University Press, Cambridge.

Siddiqui, A. Q. 1979. Changes in fish composition in Lake Naivasha, Kenya. Hydrobiologia, 64,131 -138.

Slatkin, M., 1987. Gene flow and geographic structure o f natural populations. Science, 236, 787-792.

Slatkin, M., 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics, 139(3), 1463-1463.

Skelton, P H., D. Tweddle, P. B. N. Jackson, 1991. Cyprinids of Africa. In (Ed.) I.J.Winfield and J.S Nelson, Cyprinid Fishes: Systematics. biology, and exploitation. Chapmans and H^l, Fish and Fisheries Series 3, London, UK.

Stiassny, M. 1996. An overview of freshwater biodiversity: with some lessons from African fishes. Fisheries, 21(9), 7-13.

Sodsuk, P. and B. J. McAndrew, 1991. Molecular systematics of 3 tilapiine genera: Tilapia, Sarotherodon and Oreochromis using Allozyme data J. Fish. Biol. 39, 301-308.

Sodsuk, P. K., B. J. McAndrew and G. F. Turner, 1995. Evolutionary relationships of the Lake Malawi Oreochromis species - evidence from AUozymes. J. Fish. Biol., 47 (2), 321-333.

Soltz, D. L. and R. J. Naiman. 1978. The natural history of native fishes in the Death Valley system. Serial Publications of the Natural History Museum of Los Angeles County, Science Series 30.

Soule, M. E. 1980. Thresholds for survival: Maintaining fitness and evolutionary potential. In M. E Soule and B.A Wilcox (eds.). Conservation Biology: An Evolutionary-Ecological Perspective, pp. 151-170. Sinauer Associates, Sunderland, MA.

Stiassny, M.L.J. 1991. Phylogenetic interrelationships of the family Cichiidae: an overview. In (Ed) MHAKeenleyside, Cichiidae fishes: Behavior, Ecology, and Evolution. Chapman & Hall, New York, pp. 1-35. 261 Stiassny, M.L.J. 1996. An overview of Freshwater Biodiversity with some lessons from African Fishes. Fisheries 21(9), 7-13.

Sugg, D. W. and R. K. Chesser, 1994. Effective population sizes with multiple paternity. Genetics, 137,1147-1155.

Swofford, D.L. 1991. Phylogeny analysis using parsimony (PAUP) version 3.1. Illinois Natural History Survey, Champaign, Illinois.

Tanaguchi, N., J. M. Macaranas and R. V. S. Pullin, 1985. Introgressive hybridization in cultured tilapia stocks in the Philippines. Bulletin of the Janpanese Society of Fisheries 51 (8), 1219-1224.

Trewavas, E. 1983. (ed.) 1983. Tilapiine fishes o f Genera Sarotherodon, Oreochromis, and Danakila. British Museum (Natural History) publication. No. 878.

Trewavas, E., F. Witte, K. Yamaoka, 1985. Destruction of fisheries in Africa’s lakes. Nature 315, 19-20.

Turner, G. F and M. T. Burrows, 1995. A model of Sympatric spéciation by sexual selection. Proceedings of the Royal Society of London, B 260,287-292.

Valsecchi, E., P. Palsboll, P. Hale, D. Glockner-Ferrari, M. Ferrari, P. Clapham, F. Larsen, D. Mattila, R. Sears, J. Siguqonsson, M Brown, P. Corkeron, and B. Amos, 1997. Microsatellite genetic distances between oceanic populations of the humpback whale(Megaptera novaeangliae)

Wapples, R. S. 1991. Genetic methods for estimating the effective size of Cetacean populations. In A.R. Hoelzel (ed.) Genetic ecology of whales and dolphins. Special issue No. 13 International Whaling Commission,Cambridge.

Wapples, R. S. and D. J. Teel, 1990. Conservation genetics of pacific salmon. I. Temporal changes in allele frequency. Conservation Biology, 4, 144-156.

Welcomme, R. L. 1964a. Diagnoses and key to the juveniles of Tilapia (Pisces, Cichiidae) in Lake Victoria. East Afr.Agric.FonJ., 30(2), 129-136.

Welcomme, R. L. 1964b. Note on the present distribution and habitats of the non-endemic species of Tilapia which have been introduced into Lake Victoria. East Afr.Freshw.Fish.Res.Org., Annual Report for 1962/63, Appendix D, 36-39. 262 Welcomme, R. L. 1965a. Further observations on the biology of the introduced Tilapia species. East Afr.Freshw.Fish.Res.Org., Annual Report for 1964, Appendix B, 18-31.

Welcomme, R. L. 1965b. Recent changes in Tilapia stocks of Lake Victoria. Journal of Applied Ecology, 2(2), 410.

Welcomme, R.L. 1966. Recent changes in the stocks of Tilapia in Lake Victoria. Nature 212, 52-54.

Welcomme, R. L. 1967. Observations on the biology of introduced species of Tilapia in Lake Victoria. Rev.Zool.BotAfr., 76 (3-4), 249-279.

Welcomme, R. L. 1988. International introductions of inland aquatic species. F AO Fish. tech. pap. 294,318 pp.

Welsh, J. and M. McClelland, 1990. Fingerprinting genomes using PGR with arbitrary primers. Nucleic Acids Research, 18 (24), 7213-7218.

Williams, J. E., A. Kubelik, A. Kivak, J. Rajalski and S. Tingey, 1990. DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nuclei Acids Research, 18,6531-6535.

Witte, F., T. Goldschmidt, P. C. Goudswaard, W. Ligtvoet, M. P. J. van Oijen, and J. H. Watmik,1992a. Species extinction and concomitant ecological changes in Lake Victoria. Neth. J. Zool. 42,214-232.

Witte, F., T. Goldschmidt, J. H. Wannik, M. J. P. van Oijen, P. C. Goudswaard, E. Witte-Maas, and N. Bouton,1992b. The destruction of an endemic species flock: quantitative data on the decline of the haplochromine cichlids of Lake Victoria. Env. Biol. Fishes. 23, 1-28.

Witte F., T. Goldschmidt, and J. H. Wanink, 1995. Dynamics of the haplochromine cichlid fauna and other ecological chnages in Mwanza gulf of Lake Victoria. In TJ.Pichter and PJ.B.Hart (eds.). The impact o f Species Changes in AJncan lakes. Ch^man and Hall, pp 83-110.

Wright, S. 1931. Evolution in Mendalian populations. Genetics, 16, 97-159.

Wright, S., 1938. Size of population and breeding structure in relation to evolutioiL Science, 87,430-431.

Wright, S., 1951. The genetical structure of populations. Arm. Eugen., 15, 323-354. 263 Worthington, E. B., 1929. A report on the fîshing survey of Lakes Albert and Kyoga Crown Agents, London, 1-136.

Worthington, E. B., 1932. A report on the fisheries of Uganda. Crown Agents, London, 1-88

Worthington, E. B., 1937. On the evolution of fish in the Great Lakes of Africa. In t Rev. ges. Hydrobiol. Hydrog., 35:305-317.

Wu, L., G. C. Booton, L. S. Kaufman, M. Chandler, & P. A. Fuerst 1996. Use of DNAmicrosatellite loci to identify populations and species of Lake Victoria haplochromine cichlids. In: E. M. Donaldson & D. D. Mackinlay (eds.). Aquaculture Biotechnology, Symposium Proceedings of the International Congress on Biology of Fishes, American Fisheries Society, pp 105 - 114.

Wu, L., L. Kaufinan and P. A. Fuerst. 1999. Isolation of microsatellite markers in Astatoreochromis alluaudi and their cross species amplification in other African cichlids. Molecular Ecology.

Wu, L. 1999. Molecular Population Genetic Analyses o f Lake Victoria Cichlid Fishes Using Microsatellites. Thesis, Ohio State University, Columbus OH.

Wright S. 1931. Evolution in Mendalian populations. Arm. Eugen., 15,323-354.

Wright S. 1951. The genetic structure of populations. Annals of Eugenics, 323-354.

Wright S. 1978. Evolution and the Genetics of Populations. Volume 4. Variability within and among Natural Populations. University of Chicago Press, Chic%o.

Yu, K. F, A. V. Deynze and P. Pauls, 1993. Random amplified polymorphic DNA (RAPD) analysis. Methods in Plant Molecular Biology and Biotechnology, 578-581.

264