DOCSLIB.ORG

Galactose Metabolism in Human Ovarian Tissue

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Galactose Metabolism in Human Ovarian Tissue 003 1-399818912502-015 1 $02.00/0 PEDIATRIC RESEARCH Vol. 25, No. 2, 1989 Copyright O 1989 International Pediatric Research Foundation, Inc. Prinrc.d in (I.S. A. Galactose Metabolism in Human Ovarian Tissue Y-K. XU,' W. G. NG, F. R. KAUFMAN, R. A. LOBO, AND G. N. DONNELL Department of Pediatrics [Y.K.X., W.G.N., F.R.K., G.N. D.], Children's Hospital of Los Angeles, Los Angeles, Califi,rniu 90054, and Department of obstetric.^ and Gynecology, University of Southern California School of Medicine, Los Angeles Cozlnty/University of Sotlthern Califi~rniaWomen's Hospital, Los Angeles, California 90033 ABSTRACT. Galactose metabolism was studied in human treatment is begun in early infancy (1). The clinical symptoms ovarian tissue obtained from 14 women controls between of gonadal insufficiency have included partial or complete failure 21 and 72 y of age, and one 21-y-old galactosemic patient of secondary sexual development, primary amenorrhea, the post- with hypergonadotrophic hypogonadism. Tissue slices pubertal occurrence of oligomenorrhea, and secondary amenor- were incubated with l-'4C-galactose, and labeled interme- rhea. Although streak ovaries have been observed in two patients diates were analyzed by anion-exchange column chroma- (2, 3), the pathophysiology of the ovarian insult is unknown. It tography. Activities of enzymes related to the galactose has been hypothesized that metabolites of galactose, particularly pathway: galactokinase, transferase, epimerase, uridine di- galactose-I-phosphate, may be toxic to the ovarian parenchyma phosphoglucose (UDPGlc) and uridine diphosphogalactose during the prenatal state (4) or the perinatal period (1). The exact pyrophosphorylases, and UDPGlc and uridine diphospho- mechanism of this toxicity, however, has not been elucidated. galactose pyrophosphatases were measured in ovarian ho- To gain a better understanding of galactose metabolism in the mogenates using radioisotopic, spectrophotometric, and normal human ovary, galactose oxidation and its by-products fluorometric techniques. Incorporation of carbon label from were studied in ovarian tissue slices. In addition, the enzymes l-'4C-galactose into various galactose and glycolytic inter- involved in the metabolic process were assayed, including galac- mediates, as well as carbon dioxide and TCA-insoluble tokinase, galactose- 1-phosphate uridyl transferase, UDPGal-4- materials was demonstrated in samples from non-galacto- epimerase, UDPGal and UDPGlc pyrophosphorylases, and semic controls. In tissue from the galactosemic individual, UDPGal and UDPGlc pyrophosphatases. Preliminary results in no labeled carbon dioxide was produced and very little part have been presented (5). incorporation into TCA-insoluble material was found. La- beled galactose-1-phosphate was elevated. In normal ovar- ian tissue, specific activities of galactokinase, transferase, epimerase, and UDPGlc pyrophosphorylase are much MATERIALS AND METHODS higher than those found in the red cells and in testes. l-14C-~-galactose(1 5 mCi/mmol), and (U)-14C-a-~-galactose- UDPGlc pyrophosphorylase activity is about 50 times that 1-phosphate, potassium salt (8.2 mCi/mmol) were initially pur- of transferase, suggesting that uridine nucleotide sugars chased from Rosechem Products (Los Angeles, CA) and later have an important role in the normal development and from New England Nuclear Corp (Boston, MA). I-'4C-~-glucose function of the ovary. It is hypothesized that premature (5 mCi/mmol), UDP(U)-'4C-galactose (298.5 mCi/mmol) and ovarian failure. often observed in ~atientswith galactose- UDP(U)-14C-glucose(226.8 mCi/mmol) also were purchased mia, is due to interference with nucleotide sugar metabo- from New England Nuclear. lism and the synthesis of galactose containing glycoproteins Low EEO agarose (A-6013, type I), low gelling temperature and glycolipids consequent to the enzymatic defect in the agarose (A-40 18, type VII), UDPGlc, glucose- 1-phosphate, glu- major pathway of galactose metabolism. (Pediatr Res cose- l,6-diphosphate, adenosine-5 '-triphosphate, Triton X- 100. 25:151-155,1989) UTP, cysteine, galactose-1-phosphate and UDPGlc dehydrogen- ase were obtained from Sigma Chemical Co. (St. Louis, MO). Abbreviations NAD, 2(N-morpholino) ethane sulfonic acid, sodium salt mono- hydrate (Mes, ~a),and DTT were from Calbiochem (San Diego. transferase, galactose-1-phosphate uridyl transferase CA). G6PD and PGM were from BoehringerlMannheim (Indi- epimerase, uridine diphosphogalactose-4-epimerase anapolis, IN). DE 81 was from Whatman Co. (Clifton, NJ). G6PD, glucose-6-phosphate dehydrogenase Spectrafluor PPO/POPOP concentrate was from Amersham (Ar- PGM, phosphoglucomutase lington Heights, IL). Beta Blend was from West Chem Products TCA, trichloroacetic acid (San Diego, CA). UDPGlc, uridine diphosphoglucose Ovarian tissue was obtained from a 21-y-old galactosemic UDPGal, uridine diphosphogalactose patient with incipient ovarian failure during laparoscopy and UTP, uridine triphosphate from 14 nonealactosemic adults. between 21 and 72 v of age. undergoing tital abdominal hysterectomy and bilateral salprn- goophorectomy- - for uterine disease, breast cancer, and unilateral Premature ovarian failure has been found with high frequency ovarian cancer, in which case, based on histology, the nonpath- in female patients affected with galactosemia, even when dietary ologic ovary was used. Nine patients were premenopausal with normal ovarian function. and five were ~ostmeno~ausal.One Received April 19, 1988; accepted September 23, 1988. postmenopausal woman was receiving estrogen-progestin ther- Reprint requests W. G. Ng. Division of Medical Genetics, Children's Hospital apy at the time of oop~orectomy~~h~ postmenopausa~tissue of Los Angeles, P.O. Box 54700, Los Angeles, CA 90054. I Yan-Kang Xu is a research fellow in the Division of Medical Genetics, CHLA, was, aS expected, fibrotic and relatively devoid of follicles. from Sun-Yat Sen University of Medical Sciences. Guangzhou, China. Testicular tissue was obtained from men undergoing gonadec- 151 T AL. tomy for prostatic or testicular cancer, in which case the non- dioactive method similar to transferase except that UTP was pathologic gonad was studied. Informed consents were obtained used intead of UDPGlc and MgC12 (6.14 mM) was also added. before surgery. Tissues, once removed, were placed immediately 6) UDPGal pyrophosphatase activity was assayed by measur- in cold Krebs-Ringer bicarbonate glucose (KRB-glucose, 100 ing the amount of labeled galactose-I-phosphate formed from mg/100 ml) buffer, pH 7.4, before biochemical analysis. UDPGal during incubation (1 I). The incubation mixture (total Incubation studies. Ovarian tissue slices were prepared by vol, 50 p1) contained 2 (N-morpholino) ethane sulfonic acid hand, using sections of potato for grips. Each slice weighed buffer, pH 6.8, 123 mM; Triton X-100, 0.05%, UDP (I4C) Gal, approximately 1 mg. The slices were washed in KRB-glucose 0.14 mM, and 20 p1 tissue supernate (about 200 pg protein). At ( 100 mg/ 100 ml) buffer, pH 7.4 several times to free away any the end of 15 min at 37"C, the reaction was stopped by adding contaminated potato. Slices were incubated with either 1 pCi of 25 p1 of ethanol containing 5% acetic acid. After centrifugation galactose or 1 pCi of glucose in counting vials as previously (1000 x g, for 3 min), 25 p1 of supernate was spotted on DE 81 described (6). At the end of 2 h of incubation, labeled C02was paper and chromatographed as for transferase, UDPGal, galac- liberated upon addition of acid, collected, and counted. The tose-1-phosphate and galactose were separated. The amount of incubation mixture was subsequently treated with 10% TCA. UDPGal hydrolyzed is based on the sum of galactose-l-phos- The TCA-soluble and TCA-insoluble fractions were separated. phate, and galactose produced as tissue also contains hexose The TCA-insoluble fraction was then extracted with chloroform- phosphatase converting galactose-1-phosphate to galactose. methanol mixture (3: 1) for glycolipids, and the radioactivity was 7) UDPGlc pyrophosphatase activity was assayed by using an counted. The TCA in the TCA-soluble fraction was removed incubation mixture containing Tris buffer (pH 8.0), 400 mM; with ether, and the aqueous fraction was chromatographed on a I4C-UDPGlc, 0.14 mM; Triton X- 100, 0.05% and 20 11 tissue Dowex-1-formate column eluted with an ammonium formate extract (about 150-200 pg protein) in a total volume of 50 p1. gradient (7). At the end of 30 min of incubation, the reaction was stopped by Preparation of tissue homogenate for enzyme studies. Tissue heating at 100°C for 2 min. After centrifugation (10,000 x g, 3 samples of 200-400 mg were blotted with tissue paper and min), 20 p1 of supernate was spotted on DE 81 paper. The homogenized in 1.0 ml of a solution composed of 1 part of 0.1 chromatographic procedure and calculation for activity are sim- M DTT, 2 parts of 1.0 M glycine buffer, pH 8.7, and 7 parts of ilar to that of UDPGal pyrophosphatase. water in a tissue homogenizer (Kontes Co., Vineland, NJ) in an Protein concentration was determined by the method of Lowry ice water bath for 5 min. The preparation was then centrifuged et al. (12) with BSA as standard. UDPGlc and UDPGal levels at 12,000 x g for 15 min at 4"C, and the supernatant was used were determined by modified methods of Fujimura et al. (13). for enzyme assays and protein determinations. Enzyme assays. All enzyme activities were expressed in terms RESULTS of products formed, pmollhlg protein. Each enzyme assay has been standardized for linearity in the rate of product formation Table I compares the results of I4CO2 production and of the and concentrations of protein used. incorporation of carbon label into TCA-insoluble material from 1)Galactokinase activity was determined by a modification of labeled galactose and glucose in the ovarian tissue slices from the method of Ng et al. (8). The incubation mixture contained the galactosemic patient and nongalactosemic controls. With Tris buffer (pH 7.0), 100 mM; MgSO,, 40 mM; NaF, 5 mM; galactose as the substrate, no labeled C02was produced by the ATP, 4 mM; 14C-galactose,0.555 mM and 50 p1 tissue extract tissue from the patient with galactosemia.
Load more

Recommended publications
  • Molecular Characterization of Galactokinase Deficiency In
    J Hum Genet (1999) 44:377–382 © Jpn Soc Hum Genet and Springer-Verlag 1999377 ORIGINAL ARTICLE Minoru Asada · Yoshiyuki Okano · Takuji Imamura Itsujin Suyama · Yutaka Hase · Gen Isshiki Molecular characterization of galactokinase deficiency in Japanese patients Received: May 19, 1999 / Accepted: August 21, 1999 Abstract Galactokinase (GALK) deficiency is an autoso- Key words Galactosemia · Galactokinase (GALK) · Muta- mal recessive disorder, which causes cataract formation in tion · Genotype · Phenotype children not maintained on a lactose-free diet. We charac- terized the human GALK gene by screening a Japanese genomic DNA phage library, and found that several nucle- otides in the 59-untranslated region and introns 1, 2, and 5 in Introduction our GALK genomic analysis differed from published data. A 20-bp tandem repeat was found in three places in intron Galactokinase (GALK: McKUSICK 230200) is the first 5, which were considered insertion sequences. We identified enzyme in the Leloir pathway of galactose metabolism; it five novel mutations in seven unrelated Japanese patients catalyzes the phosphorylation of galactose to galactose- with GALK deficiency. There were three missense muta- 1-phosphate. GALK deficiency, first described in 1965 tions and two deletions. All three missense mutations (Gitzelmann 1965), is an autosomal recessive genetic disor- (R256W, T344M, and G349S) occurred at CpG dinucle- der with an incidence of 1/1,000,000 in Japan (Aoki and otides, and the T344M and G349S mutations occurred in Wada 1988) on newborn mass screening and an incidence of the conserved region. The three missense mutations led to a 1/1,000,000 in Caucasians (Segal and Berry 1995).
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Hereditary Galactokinase Deficiency J
    Arch Dis Child: first published as 10.1136/adc.46.248.465 on 1 August 1971. Downloaded from Alrchives of Disease in Childhood, 1971, 46, 465. Hereditary Galactokinase Deficiency J. G. H. COOK, N. A. DON, and TREVOR P. MANN From the Royal Alexandra Hospital for Sick Children, Brighton, Sussex Cook, J. G. H., Don, N. A., and Mann, T. P. (1971). Archives of Disease in Childhood, 46, 465. Hereditary galactokinase deficiency. A baby with galactokinase deficiency, a recessive inborn error of galactose metabolism, is des- cribed. The case is exceptional in that there was no evidence of gypsy blood in the family concerned. The investigation of neonatal hyperbilirubinaemia led to the discovery of galactosuria. As noted by others, the paucity of presenting features makes early diagnosis difficult, and detection by biochemical screening seems desirable. Cataract formation, of early onset, appears to be the only severe persisting complication and may be due to the biosynthesis and accumulation of galactitol in the lens. Ophthalmic surgeons need to be aware of this enzyme defect, because with early diagnosis and dietary treatment these lens changes should be reversible. Galactokinase catalyses the conversion of galac- and galactose diabetes had been made in this tose to galactose-l-phosphate, the first of three patient (Fanconi, 1933). In adulthood he was steps in the pathway by which galactose is converted found to have glycosuria as well as galactosuria, and copyright. to glucose (Fig.). an unexpectedly high level of urinary galactitol was detected. He was of average intelligence, and his handicaps, apart from poor vision, appeared to be (1) Galactose Gackinase Galactose-I-phosphate due to neurofibromatosis.
    [Show full text]
  • Induction of Uridyl Transferase Mrna-And Dependency on GAL4 Gene Function (In Vitro Translation/Immunoprecipitation/GAL Gene Cluster/Positive Regulation) JAMES E
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 6, pp. 2878-2882, June 1978 Genetics Regulation of the galactose pathway in Saccharomyces cerevisiae: Induction of uridyl transferase mRNA-and dependency on GAL4 gene function (in vitro translation/immunoprecipitation/GAL gene cluster/positive regulation) JAMES E. HOPPER*, JAMES R. BROACHt, AND LUCY B. ROWE* * Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02154; and t Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Communicated by Norman H. Giles, April 10,1978 ABSTRACT In Saccharomyces cerevisiae, utilization of Genetic control of the inducible galactose pathway enzymes galactose requires four inducible enzyme activities. Three of involves the four structural genes GALI, GAL10, GAL7, and these activities (galactose-l-phosphate uridyl transferase, EC genes, GAL4, GAL81 (c), GAL80 2.7.7.10; uridine diphosphogalactose 4-epimerase, EC 5.1.3.2; GAL2 and four regulatory and galactokinase, EC 2.7.1.6) are specified by three tightly (i), and GALS.* Mutations in GALl, GAL10, GAL7, and GAL2 linked genes (GAL7, GALlO, and GALI, respectively) on chro- affect the individual appearance of galactokinase, epimerase, mosome II, whereas the fourth, galactose transport, is specified transferase, and galactose transport activities, respectively (6). by a gene (GALS) located on chromosome XIL Although classic Mutations defining the GALl, GAL10, and GAL7 genes have genetic analysis has revealed both positive and negative regu- invariably been recessive, and they map in three tightly linked latory genes that coordinately affect the appearance of ail four complementation groups near the centromere of chromosome enzyme activities, neither the basic events leading to the ap- pearance of enzyme activities nor the roles of the regulatory II (6, 9, 10).
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides
    catalysts Review α-Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides Jun-ichi Kadokawa Department of Chemistry, Biotechnology, and Chemical Engineering, Graduate School of Science and Engineering, Kagoshima University, 1-21-40 Korimoto, Kagoshima 860-0065, Japan; [email protected]; Tel.: +81-99-285-7743 Received: 9 October 2018; Accepted: 16 October 2018; Published: 19 October 2018 Abstract: As natural oligo- and polysaccharides are important biomass resources and exhibit vital biological functions, non-natural oligo- and polysaccharides with a well-defined structure can be expected to act as new functional materials with specific natures and properties. α-Glucan phosphorylase (GP) is one of the enzymes that have been used as catalysts for practical synthesis of oligo- and polysaccharides. By means of weak specificity for the recognition of substrates by GP, non-natural oligo- and polysaccharides has precisely been synthesized. GP-catalyzed enzymatic glycosylations using several analog substrates as glycosyl donors have been carried out to produce oligosaccharides having different monosaccharide residues at the non-reducing end. Glycogen, a highly branched natural polysaccharide, has been used as the polymeric glycosyl acceptor and primer for the GP-catalyzed glycosylation and polymerization to obtain glycogen-based non-natural polysaccharide materials. Under the conditions of removal of inorganic phosphate, thermostable GP-catalyzed enzymatic polymerization of analog monomers occurred to give amylose analog polysaccharides. Keywords: analog substrate; α-glucan phosphorylase; non-natural oligo- and polysaccharides 1. Introduction Oligo- and polysaccharides are widely distributed in nature and enact specific important biological functions in accordance with their chemical structures [1].
    [Show full text]
  • Role of Glucokinase and Glucose-6 Phosphatase in the Nutritional Regulation of Endogenous Glucose Production G Mithieux
    Role of glucokinase and glucose-6 phosphatase in the nutritional regulation of endogenous glucose production G Mithieux To cite this version: G Mithieux. Role of glucokinase and glucose-6 phosphatase in the nutritional regulation of endogenous glucose production. Reproduction Nutrition Development, EDP Sciences, 1996, 36 (4), pp.357-362. hal-00899845 HAL Id: hal-00899845 https://hal.archives-ouvertes.fr/hal-00899845 Submitted on 1 Jan 1996 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Review Role of glucokinase and glucose-6 phosphatase in the nutritional regulation of endogenous glucose production G Mithieux Unité 197 de l’Inserm, faculté de médecine René-Laënnec, rue Guillaume-Paradin, 69372 Lyon cedex 08, France (Received 29 November 1995; accepted 6 May 1996) Summary ― Two specific enzymes, glucokinase (GK) and glucose-6 phosphatase (Gic6Pase) enable the liver to play a crucial role in glucose homeostasis. The activity of Glc6Pase, which enables the liver to produce glucose, is increased during short-term fasting, in agreement with the enhancement of liver gluconeogenesis. During long-term fasting, Glc6Pase activity is increased in the kidney, which con- tributes significantly to the glucose supply at that time.
    [Show full text]
  • Biochemistry Entry of Fructose and Galactose
    Paper : 04 Metabolism of carbohydrates Module : 06 Entry of Fructose and Galactose Dr. Vijaya Khader Dr. MC Varadaraj Principal Investigator Dr.S.K.Khare,Professor IIT Delhi. Paper Coordinator Dr. Ramesh Kothari,Professor UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. S. P. Singh, Professor Content Reviewer UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. Charmy Kothari, Assistant Professor Content Writer Department of Biotechnology Christ College, Affiliated to Saurashtra University, Rajkot-5, Gujarat-INDIA 1 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Description of Module Subject Name Biochemistry Paper Name 04 Metabolism of Carbohydrates Module Name/Title 06 Entry of Fructose and Galactose 2 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose METABOLISM OF FRUCTOSE Objectives 1. To study the major pathway of fructose metabolism 2. To study specialized pathways of fructose metabolism 3. To study metabolism of galactose 4. To study disorders of galactose metabolism 3 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Introduction Sucrose disaccharide contains glucose and fructose as monomers. Sucrose can be utilized as a major source of energy. Sucrose includes sugar beets, sugar cane, sorghum, maple sugar pineapple, ripe fruits and honey Corn syrup is recognized as high fructose corn syrup which gives the impression that it is very rich in fructose content but the difference between the fructose content in sucrose and high fructose corn syrup is only 5-10%. HFCS is rich in fructose because the sucrose extracted from the corn syrup is treated with the enzyme that converts some glucose in fructose which makes it more sweet.
    [Show full text]
  • Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome
    Pediatr. Res. 17: 157-161 (1983) Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome M. BRIVET,"" N. MOATTI, A. CORRIAT, A. LEMONNIER, AND M. ODIEVRE Laboratoire Central de Biochimie du Centre Hospitalier de Bichre, 94270 Kremlin-Bicetre, France [M. B., A. C.]; Faculte des Sciences Pharmaceutiques et Biologiques de I'Universite Paris-Sud, 92290 Chatenay-Malabry, France [N. M., A. L.]; and Faculte de Midecine de I'Universiti Paris-Sud et Unite de Recherches d'Hepatologie Infantile, INSERM U 56, 94270 Kremlin-Bicetre. France [M. 0.1 Summary The patient's diet was supplemented with 25-OH-cholecalci- ferol, phosphorus, calcium, and bicarbonate. With this treatment, Carbohydrate metabolism was studied in a child with atypical the serum phosphate concentration increased, but remained be- glycogen storage disease and Fanconi syndrome. Massive gluco- tween 0.8 and 1.0 mmole/liter, whereas the plasma carbon dioxide suria, partial resistance to glucagon and abnormal responses to level returned to normal (18-22 mmole/liter). Rickets was only carbohydrate loads, mainly in the form of major impairment of partially controlled. galactose utilization were found, as reported in previous cases. Increased blood lactate to pyruvate ratios, observed in a few cases of idiopathic Fanconi syndrome, were not present. [l-14ClGalac- METHODS tose oxidation was normal in erythrocytes, but reduced in fresh All studies of the patient and of the subjects who served as minced liver tissue, despite normal activities of hepatic galactoki- controls were undertaken after obtaining parental or personal nase, uridyltransferase, and UDP-glucose 4epirnerase in hornog- consent. enates of frozen liver.
    [Show full text]
  • Terminal Deoxynucleotidyl Transferase Protocol
    Certificate of Analysis Terminal Deoxynucleotidyl Transferase, Recombinant: Part No. Size (units) Part# 9PIM187 M828A 300 Revised 4/18 M828C 1,500 Description: This enzyme catalyzes the repetitive addition of mononucleotides to the terminal 3´-OH of a DNA initiator accompanied by the release of inorganic phosphate. Single-stranded DNA is preferred as an initiator. Polymerization is not template-dependent. The addition of 1mM Co2+ (as CoCl2) in the reaction buffer allows the tailing of 3´-ends with varying degrees of efficiency. Enzyme Storage Buffer: Terminal Deoxynucleotidyl Transferase, Recombinant, is supplied in 50mM potassium phosphate *AF9PIM187 0418M187* (pH 6.4), 100mM NaCl, 1mM β-mercaptoethanol, 0.1% Tween® 20 and 50% glycerol. AF9PIM187 0418M187 Source: Recombinant E. coli strain. Storage Conditions: See the Product Information Label for storage recommendations. Avoid multiple freeze-thaw cycles and exposure to frequent temperature changes. See the expiration date on the Product Information Label. Terminal Transferase 5X Buffer (M189A): 500mM cacodylate buffer (pH 6.8), 5mM CoCl2 and 0.5mM DTT. Unit Definition: One unit of activity catalyzes the transfer of 0.5 picomoles of ddATP to oligo(dT)16 per minute at 37°C in 1X Terminal Transferase Buffer. The resulting oligo(dT)17 is measured by HPLC. Usage Notes for 3´-End Labeling Reaction 1. Not all dNTPs are tailed with the same efficiency. Actual concentration of dNTP will depend on the individual application. 2. The provided buffer (5X) is to be used in the tailing reaction. The recommended reaction conditions are as described under Quality Control Assays, 3´-End Labeling Reaction, and in Section III overleaf.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Commentary Tracking Telomerase
    Cell, Vol. S116, S83–S86, January 23, 2004 Copyright 2004 by Cell Press Tracking Telomerase Commentary Carol W. Greider1 and Elizabeth H. Blackburn2,* neous size of the fragments in gel electrophoresis was 1Department of Molecular Biology and Genetics the first suggestion of unusual behavior of telomeric Johns Hopkins University School of Medicine DNA. A similar telomere repeat sequence, CCCCAAAA 725 North Wolfe Street was soon found on natural chromosome ends in other Baltimore, Maryland 21205 ciliates (Klobutcher et al., 1981). Another very unusual 2 Department of Biochemistry and Biophysics finding regarding these repeated sequences came in University of California, San Francisco 1982: David Prescott found that these repeated sequences Box 2200 are added de novo to ciliate chromosomes during the San Francisco, California 94143 developmental process of chromosome fragmentation (Boswell et al., 1982). This was the first hint that a special mechanism may exist to add telomere repeats. The Telomere Problem The next clue came from work in yeast. In a remarkable The paper reprinted here, the initial identification of telo- example of functional conservation across phylogenetic merase, resulted from our testing a very specific hypoth- kingdoms, Liz and Jack Szostak (Szostak and Black- esis: that an enzyme existed, then undiscovered, that burn, 1982) showed that the Tetrahymena telomeric se- could add telomeric repeats onto chromosome ends. quences could replace the yeast telomere entirely. A We based this hypothesis on several unexplained facts mini-chromosome with these foreign telomeres main- and creative questions being asked by people who were tained its linear structure and replicated and segregated trying to understand those facts.
    [Show full text]