Regulation of X-Linked Gene Expression During Early 3 Mouse Development by Rlim 4 5 6 Feng Wang1‡, Jongdae Shin1,2‡, Jeremy M

1 2 Regulation of X-linked gene expression during early 3 mouse development by Rlim 4 5 6 Feng Wang1‡, JongDae Shin1,2‡, Jeremy M. Shea3, Jun Yu1, Ana Bošković3, Meg Byron4, 7 Xiaochun Zhu1, Alex K. Shalek5,6,7, Aviv Regev6,8, Jeanne B. Lawrence4, Eduardo M. 8 Torres1 , Lihua J. Zhu1,9, Oliver J. Rando3, Ingolf Bach1* 9 10 1Department of Molecular, Cell and Cancer Biology, University of Massachusetts 11 Medical School, Worcester, MA 01605 12 2Department of Cell Biology, College of Medicine, Konyang University, Daejeon, 13 302-832, Korea 14 3Department of Biochemistry and Molecular Pharmacology, University of Massachusetts 15 Medical School, Worcester, MA 01605 16 4Department of Cell and Developmental Biology, University of Massachusetts Medical 17 School, Worcester, MA 01605 18 5Department of Chemistry and Institute for Medical Engineering & Science, 19 Massachusetts Institute of Technology, Cambridge, MA, 02139 20 6Broad Institute of MIT and Harvard, Cambridge, MA 02142 21 7Ragon Institute of MGH, MIT and Harvard, Cambridge, MA, 02139 22 8Howard Hughes Medical Institute, Department of Biology, MIT, Cambridge, MA 02140 23 9Program in Bioinformatics and Integrative Biology, University of Massachusetts 24 Medical School, Worcester, MA 01605 25 26 * Corresponding author 27 Tel: 508 856 5627 28 Fax: 508 856 4650 29 [email protected] 30 31 ‡ equal contribution 32 33 34 35 key words: preimplantation development, whole embryo RNA-seq, mouse genetics, X

36 chromosome, epigenetic gene silencing, X chromosome inactivation, X upregulation,

37 Rlim, Rnf12, Xist

39 1

40 Abstract

41 Mammalian X-linked gene expression is highly regulated as female cells contain two

42 and male one X chromosome (X). To adjust the X gene dosage between genders,

43 female mouse preimplantation embryos undergo an imprinted form of X

44 chromosome inactivation (iXCI) that requires both Rlim (also known as Rnf12) and

45 the long non-coding RNA Xist. Moreover, it is thought that gene expression from the

46 single active X is upregulated to correct for bi-allelic autosomal (A) gene expression.

47 We have combined mouse genetics with RNA-seq on single mouse embryos to

48 investigate functions of Rlim on the temporal regulation of iXCI and Xist. Our

49 results reveal crucial roles of Rlim for the maintenance of high Xist RNA levels, Xist

50 clouds and X-silencing in female embryos at blastocyst stages, while initial Xist

51 expression appears Rlim-independent. We find further that X/A upregulation is

52 initiated in early male and female preimplantation embryos.

62 Introduction

63 Most mammalian cells contain two transcriptionally active copies of autosomal

64 chromosomes but only one active X chromosome (X). This is due to the fact that female

65 cells inactivate one X in a process known as X chromosome inactivation (XCI), to correct

66 for male/female (F/M) gene dosage imbalances caused by the presence of two X

67 chromosomes. In addition, to adjust for X/autosomal (X/A) imbalances arising from

68 transcription of both autosomal copies of most genes, it is thought that male and female

69 cells upregulate gene expression from the single active X two-fold.

70 Beginning at the 4-cell stage in female mouse embryos, imprinted XCI (iXCI)

71 exclusively silences the paternally inherited X (Xp), and this pattern of XCI is maintained

72 in extraembryonic trophoblast cells. In contrast, epiblast cells in the inner cell mass

73 (ICM) of blastocysts that will give rise to the embryo reactivate the Xp and undergo a

74 random form of XCI (rXCI) around implantation (E5-E5.5) (Disteche, 2012, Payer and

75 Lee, 2014, Galupa and Heard, 2015). During XCI the long non-coding RNA Xist

76 progressively paints the X chromosome from which it is synthesized, thereby triggering

77 repressive histone modifications including H3K27me3 (Plath et al., 2003) and

78 transcriptional silencing of X-linked genes (Disteche, 2012, Payer and Lee, 2014, Galupa

79 and Heard, 2015). Xist is required both for iXCI and rXCI (Marahrens et al., 1997, Penny

80 et al., 1996). The X-linked gene Rlim encodes a ubiquitin ligase (Ostendorff et al., 2002)

81 that shuttles between the nucleus and cytoplasm (Jiao et al., 2013) and modulates

82 transcription via regulating nuclear multiprotein complexes (Bach et al., 1999, Gungor et

83 al., 2007). Rlim promotes the formation of Xist clouds both during iXCI in female mice

84 (Shin et al., 2010) and in female embryonic stem cells (ESCs) undergoing rXCI in culture

85 (van Bemmel et al., 2016). In mice, however, Rlim is dispensable for rXCI in epiblast

86 cells (Shin et al., 2014). While both Rlim and Xist play essential roles during iXCI in

87 mice (Marahrens et al., 1997, Shin et al., 2010), questions remain with regards to their

88 functions on the general kinetics of X-linked gene expression, their functional

89 interconnection and the contribution of maternally vs embryonically expressed RLIM for

90 iXCI. Moreover, while evidence for X/A upregulation was observed not only in adult

91 mouse tissues but also in mouse ES cells and epiblast cells at blastocyst stages (Deng et

92 al., 2013, Deng et al., 2011, Lin et al., 2007), details on the developmental X upregulation

93 are lacking.

94 We have carried out RNA-seq on single mouse embryos to investigate the regulation

95 of X-linked gene expression during pre- and peri-implantation development by Rlim.

96 Analyses of WT, Rlim-knockout (KO) or Xist-KO embryos reveal that Rlim is required for

97 maintenance of Xist clouds and iXCI in female embryos at blastocyst stages. In addition, our

98 data uncover that X dosage compensation via iXCI in female mice occurs concurrently with a

99 general X/A upregulation in both male and female preimplantation embryos. These results

100 represent a comprehensive view on the regulation of X-linked gene expression during

101 early mouse embryogenesis by Rlim and Xist.

102

103 Results

104 Elucidation of the mouse preimplantation transcriptome by single embryo RNA-seq

105 Several studies have investigated the dynamics of XCI and X-silencing in female ES cells

106 (Lin et al., 2007, Marks et al., 2015) or trophoblasts (Calabrese et al., 2012) using RNA-

107 seq. To assess the general dynamics of X-linked gene expression and iXCI in vivo, we

108 have adapted single cell RNA-seq technology (Shalek et al., 2013, Jaitin et al., 2014) to

109 elucidate the pre- and peri-implantation transcriptome using single mouse embryos

110 (Sharma et al., 2016). This is a valid strategy because 1) early embryos consist of a

111 limited number of cell types: essentially one totipotent cell type up to E3, and three cell

112 types at blastocyst stages - epiblast, trophoblast and primitive endoderm cells - that

113 express known marker genes 2) cells of preimplantation embryos undergo iXCI that

114 exclusively silences the Xp and 3) in mice there is only a relatively small number of

115 genes that escape XCI (Yang et al., 2010, Finn et al., 2014). Thus, using RNA-seq we

116 examined embryos at the 4- and 8-cell stages, early and late morula (E2.5 and E3.0), and

117 blastocyst stages (E3.5, E4.0 and E4.5), comparing global changes in gene expression.

118 We also included trophoblasts isolated from blastocyst outgrowths of cultured E4.0

119 embryos in our analyses. In contrast to previous studies on single cells of preimplantation

120 embryos that were performed in a mixed genetic background (Deng et al., 2014),

121 embryos were generated in a C57BL/6 background to exclude potential background

122 influences on the general kinetics of iXCI and/or X upregulation. Moreover, because the

123 known functions of Rlim during mouse embryogenesis are restricted to XCI in females

124 (Shin et al., 2010, Shin et al., 2014), RNA-seq experiments were performed on WT and

125 RlimKO embryos. Based on a mouse model allowing a conditional KO (cKO) of the Rlim

126 gene, we have previously generated females carrying a maternally transmitted Sox2-Cre-

Δ 127 mediated cKO allele and a paternally transmitted germline KO allele (RlimcKOm/ p-SC).

128 These females appear healthy, fertile and lack RLIM in all somatic tissues as well as their

129 germline (Figures 1A, B) (Shin et al., 2014). Thus, to efficiently generate male and

130 female germline Rlim KO embryos (Δ/Y, Δ/Δ) and to eliminate potential influences of

131 maternal RLIM in oocytes on the iXCI process, all Rlim KO embryos were generated by

Δ Δ 132 crossing RlimcKOm/ p-SC females with germline KO males (Rlim /Y) (Figure 1 – figure

133 supplement 1A). RNA was prepared and barcoded RNA-seq libraries were constructed

134 from 187 samples that were distributed between two 96-well plates, each with similar

135 numbers of embryos from each stage and mating. Libraries were pooled and sequenced to

136 an average read depth of 2.95 million reads. This read depth lies within the range

137 typically obtained by using single-cell technology (Shalek et al., 2013). The gender of

138 each embryo was determined by assessing expression of Y-linked genes, which occurs

139 only in male embryos, and Xist, which is expressed only in females (Figures 1C, D). 12

140 samples for which gender could not be assigned or displayed less than 280,000 total reads

141 were removed, leaving 175 samples for further analysis (Figure 1 – figure supplement

142 1B; Supplementary file 1). Mapping reads from WT and KO embryos to the Rlim locus

143 showed that the deleted region in KO embryos was not represented (Figure 1E; data not

144 shown), validating both the mating strategy and the specificity of the data obtained via

145 whole embryo RNA-seq. Because of expected differences in expression of X-linked

146 genes during preimplantation development between genders and between females WT

147 and KO for Rlim, each library was normalized to its total autosomal gene expression

148 rather than expression of all genes on chromosomes. As expected, comparing Log2-

149 transformed data of 10552 annotated genes that are expressed at all examined

150 developmental stages revealed no significant differences in gene expression at the

Δ 151 chromosome level between Rlim /Y and WT/Y males (Figure 1 – figure supplement 1C),

152 consistent with the finding that male mice lacking Rlim develop normally (Shin et al.,

153 2010). Analyses of WT embryos (pooled male and female embryos for each stage),

154 showed that the developmental transcript profiles matched well with expression of

155 epiblast markers Pou5f1 (Oct4) (Rosner et al., 1990, Scholer et al., 1990) and Nanog

156 (Chambers et al., 2003, Mitsui et al., 2003) and trophoblast marker Krt8 (Troma1) (Brulet

157 and Jacob, 1982) (Figure 1F). The observed variations between replicates were well

158 within margins previously observed for single cell RNA-seq technology (Jaitin et al.,

159 2014, Shalek et al., 2013), and comparison of expression levels of these cell markers

Δ Δ 160 between Rlim / and WT/WT females suggested that the general cell type specification

161 events that occur at blastocyst stages were similar in embryos of both genotypes (Figure 1

162 – figure supplement 1D). Because Rlim is X-linked and its functions appear restricted to

163 females (Shin et al., 2010, Jiao et al., 2012), expression of this gene was evaluated in

164 female WT/WT embryos only. Rlim RNA levels decreased from the 4-cell to the 8-cell

165 stage, possibly due to depletion of maternal pools, then gradually increased up to E3.5,

166 and decreased thereafter (Figure 1F). High relative levels of Rlim were detected in

167 trophoblasts, suggesting that the cells of the ICM are mostly responsible for the

168 diminished Rlim levels in E4.5 embryos, consistent with a drop in RLIM protein levels

169 specifically in epiblast cells (Shin et al., 2014). Random subsampling of libraries to

170 200,000 reads per embryo (Robinson and Storey, 2014) showed similar results (Figure 1

171 – figure supplement 1E), indicating that the sequencing depth was not a limiting factor in

172 our data analyses.

173

174 Rlim is required for upregulation of Xist and maintenance of Xist clouds in female

175 embryos

176 Xist RNA levels were very low in males at all stages (Figure 2A), as expected. Much

177 higher levels of Xist were measured in females, although variations among replicates at

178 each stage were high relative to those obtained for Pou5f1 (Oct4), Nanog and Krt8, likely

179 reflecting biological variations in individual animals in addition to the technical

180 variability of single-embryo RNA-seq (compare Figures 1F and 2A). Because the Xist

181 gene is located within the Tsix gene, which is transcribed in the antisense orientation (Lee

182 and Lu, 1999), we examined the locations of reads mapping to this locus. We detected a

183 high read density located precisely within the Xist transcription unit (>90% of reads) and

184 very few reads in introns or exons specific to Tsix (Figure 2 – figure supplement 1A),

185 indicating that the detected reads mostly correspond to Xist RNA. Xist levels in WT

186 female embryos increased dramatically from the 4-cell to the 8-cell stages and peaked

187 around E3.5 (Figure 2A). Consistent with the detection of Xist transcription foci in early

188 Rlim KO female embryos (Shin et al., 2010), the developmental onset of Xist was similar

Δ Δ 189 in Rlim / females, but significantly lower levels of Xist were measured only after E3.5

190 (Figure 2A). Random subsampling of libraries to 200,000 reads per embryo (Robinson

191 and Storey, 2014) showed a similar Xist expression profile (Figure 2 – figure supplement

Δ Δ 192 1B). Moreover, strand-specific RT-qPCR confirmed that Rlim / females expressed

193 similar levels of Xist when compared to WT/WT at E2.5, but much lower levels at E3.5

194 and thereafter (Figure 2 – figure supplement 1C). These results prompted us to examine

Δ Δ 195 Xist clouds in females at E2.5 morula and E3.5 blastocyst stages, comparing Rlim / with

196 WT/WT embryos. This was done via RNA FISH, co-staining with probes against Rlim,

197 which recognizes both the WT and KO transcripts (Shin et al., 2010), and Xist. As

198 expected, Xist clouds were detected in WT embryos of both embryonic stages (Figures

199 2B-D). In these female embryos most/all cells exhibited clouds except those undergoing

200 mitosis. Xist clouds were also detected in a significant number of Rlim KO embryos at

201 both developmental stages. In contrast to WT/WT, however, in Xist cloud-positive

Δ Δ 202 Rlim / embryos at E2.5, the number of cells displaying clouds was highly variable,

203 ranging between 1 cell to most cells (Figures 2B, D). As few cells of 8-cell staged female

204 embryos lacking RLIM display Xist clouds (Shin et al., 2010), these results indicate that

Δ Δ 205 Rlim / females develop Xist clouds at morula stages, but likely with a slower kinetics

206 when compared to WT/WT females. As expected, at E3.5 the vast majority of cells

Δ Δ 207 exhibited transcription foci for Xist and only few cells displayed Xist clouds in Rlim /

208 embryos (Figures 2C, D). Combined, these data reveal that Rlim is dispensable for initial

209 Xist expression in 4-cell stage embryos but required for upregulation/maintenance of Xist

Δ Δ 210 expression after E3. They further show that Xist clouds transiently form in Rlim / female

211 morulae, which cannot be maintained at blastocyst stages.

212

213 Rlim regulates X-silencing during blastocyst stages

214 To examine the function of Rlim on global X-silencing during iXCI we compared

Δ Δ 215 normalized reads (FPKM) of all annotated X-linked genes from WT/WT or Rlim / 9

216 female embryos with all male embryos generated in this dataset. In female WT/WT

217 embryos the gene dosage was close to two-fold that of males at early developmental

218 stages (likely due to two active X chromosomes) and then, starting at morula stages,

219 gradually decreased to a gene dosage similar to that of males by late blastocyst stages,

220 consistent with Xp silencing (Figure 3A). These results are in agreement with recent data

221 obtained from allele-specific RNA-seq on single cells both from early mouse

222 preimplantation embryos with a mixed genetic background (Deng et al., 2014, Chen et

223 al., 2016) and human preimplantation embryos (Petropoulos et al., 2016). Consistent with

Δ Δ 224 the formation of transient Xist clouds (Figure 2) the X gene dosage in female Rlim /

225 embryos was not significantly different from that of WT/WT females up to E3, revealing

226 a partial silencing of X-linked genes at these early stages in the absence of RLIM.

227 However, the continued further silencing of X-linked genes observed in WT/WT during

Δ Δ 228 blastocyst stages was significantly inhibited in Rlim / females (Figure 3A). Again,

229 random subsampling of libraries for each embryo to 200.000 reads showed similar results

230 (Figure 3 – figure supplement 1A, and data not shown), demonstrating that these libraries

231 are sequenced to a depth sufficient to accurately measure X-silencing. Considering an

232 estimated average half-life of around 10h for mRNAs in mammalian cells (Yang et al.,

233 2003) including mouse preimplantation embryos (Kidder and Pedersen, 1982), the

234 detection of initial X-silencing at late morula/early blastocyst stages via RNA-seq on

235 whole embryos (Figure 3A) fits well with published data obtained by RNA FISH that

236 show diminished transcription foci of X-linked protein-encoding genes generally starting

237 between the 8-cell and morula stages (Patrat et al., 2009, Namekawa et al., 2010).

238 Moreover, the gradual X-silencing from the 8-cell stage to E4.5 in WT/WT females as

239 determined by whole embryo RNA-seq (Figure 3A) is consistent with the existence of

240 long-lived mRNAs in mouse preimplantation embryos (Kidder and Pedersen, 1982).

241 We next analyzed Log2-transformed data of 10552 annotated genes that are

242 expressed at all examined developmental stages. Comparing the developmental

Δ Δ 243 expression pattern between female Rlim / and male embryos revealed very few changes

244 in autosomal gene expression due to the Rlim mutation, suggesting that the main function

245 of Rlim in early embryonic gene regulation is in X-silencing (Figs. 3B, Figure 3 – figure

246 supplement 1B). Indeed, examination of the silencing pattern of 351 annotated X-linked

247 genes in WT females showed that gene silencing occurs within most regions on the X

248 chromosome both during the early (8-cell to E3) and late phase (E3 to E4.5) of iXCI

249 (Figure 3C). However, expression of several genes located in a region on the XqE3/F1

250 border is notably higher at early preimplantation stages in females WT and KO for Rlim

251 when compared to males. Interestingly, this region overlaps a 1.1 Mb region that has

252 been involved with meiotic regulation during spermatogenesis (Zhou et al., 2013).

253 Moreover, levels of genes known to escape X-silencing during rXCI including Kdm6a

254 and Kdm5c (Berletch et al., 2010) were also not significantly down-regulated during iXCI

255 (not shown). As we are not able to distinguish mRNAs transcribed from the Xm or Xp,

256 we cannot exclude the contribution of developmental transcriptional regulation and/or

257 effects of differential parental imprinting in these regions. To further examine X

258 expression profiles in females, we compared the distributions of female E3/8-cell and

259 E4.5/8-cell expression ratios of 755 X-linked genes that are expressed in at least 3

260 embryos. Results showed that there are little differences in expression profiles between

Δ Δ 261 E3/8-cell ratios of WT/WT and Rlim / females (Figure 3 – figure supplement 1C),

Δ Δ 262 whereas E4.5/8-cell ratios in Rlim / females are generally 2-fold higher when compared

263 to WT/WT (Figure 3 – figure supplement 1D). To verify global Xp silencing we

264 performed an independent RNA-seq experiment on 3 male and 3 female WT embryos

265 with a heterozygous C57Bl/6 (B6) and castaneus/Eij (CAST) background (Figure 3 –

266 figure supplement 2A) allowing a direct comparison of data processed via F/M or by an

267 allele-specific analysis. We chose embryos at E3.5 because at this stage about half of the

268 X is silenced in female embryos (Figure 3A; Figure 3 – figure supplement 2B). Indeed, in

269 B6m/CASTp embryos we measured only around 50% of X-linked CAST transcripts when

270 compared to transcripts originating from the B6 X chromosome (Figure 3 – figure

271 supplement 2C). These results provide independent confirmation that the decline in F/M

272 values of X-linked transcripts in females (Figure 3A) is due to Xp-silencing. These data

273 corroborate our previous results and are consistent with 1) partial silencing of overall X-

274 linked genes in female E3 embryos of both genotypes, and 2) the general silencing of one

Δ Δ 275 X chromosome in E4.5 WT/WT but not Rlim / females. Thus, our combined results

276 distinguish an early Rlim-independent phase of iXCI in totipotent cells up to around E3

277 that leads to partial Xp-silencing, and a late phase after E3 that is Rlim-dependent and

278 leads to robust Xp-silencing. These data further confirm that the process of iXCI

279 progressively adjusts the X-linked gene dosage from the 8-cell stage to E4.5 during early

280 female development.

281

282 Embryonic Rlim is required for iXCI in female mice

283 Because RLIM protein is rapidly turned-over during early development (Becker et al.,

284 2003, Ostendorff et al., 2002), if RLIM is required for X-silencing only after E3, this

285 predicts that maternal stores of RLIM will not be sufficient for iXCI but that RLIM

286 synthesized by the embryo is required for later stages of the iXCI process. To confirm

287 that embryonic RLIM plays a crucial role for iXCI after E3 we targeted the maternally

288 transmitted conditional Rlim allele via a paternally transmitted Rosa26-Cre (R26C)

289 transgene (Soriano, 1999), from which Cre is induced after zygotic genome activation

290 (ZGA). Indeed, an R26C-mediated deletion of the Rlim allele on the Xm led to

291 embryonic lethality in a female-specific parent-of-origin effect (Figures 4A, B), similar to

292 the germline Rlim KO (Shin et al., 2010). This deletion proved highly penetrant, as a

293 maternally transmitted floxed Rlim allele was no longer detectable at early stages of the

294 second iXCI phase (E3.5; Figure 4C). RNA FISH experiments showed that Xist cloud

295 formation was strongly diminished in trophoblasts of female R26C-mediated cKOm

296 blastocysts isolated at E4 and cultured ex vivo for 2 days (Figure 4D). Moreover, the

297 detection of transcription foci of Xist adjacent to Rlim in these trophoblasts indicated

298 defects in Xp silencing (Figure 4E), consistent with previously published results (Shin et

299 al., 2010). These data provide genetic confirmation that embryonic RLIM expressed from

300 the maternal allele plays crucial roles for the maintenance of Xist clouds during iXCI.

301

302 Xist is crucial for iXCI throughout female preimplantation development

303 Our results show that cells of female preimplantation embryos that lack Rlim do not

304 upregulate Xist expression and cannot maintain Xist clouds around stage E3.5 (Figure 2),

305 and ultimately fail to silence X-linked genes at blastocyst stages (Figure 3). To

306 functionally connect Rlim and Xist during iXCI we next examined female embryos that

Δ 307 carry a germline Xist mutation on the paternally inherited X (XistWT/ p). These females are

308 devoid of functional Xist RNA because during iXCI, the Xp is exclusively silenced and

309 Xist is not expressed from the Xm. We used a floxed Xist mouse line (Csankovszki et al.,

310 1999) to generate males with a Sox2-Cre-mediated cKO of Xist (XistcKO/Y-SC). XistcKO/Y

311 males were mated with WT/WT females (Figure 5 – figure supplement 1A) and,

312 confirming the previously observed sex-specific parent-of-origin embryonic lethality

313 (Marahrens et al., 1997), only male but no female pups were born (Figure 5 – figure

314 supplement 1B). Using single embryo RNA-seq, we analyzed 141 embryos generated by

315 this cross in a similar manner as described for the RlimKO/WT dataset (Figure 5 – figure

316 supplement 1C; Supplementary file 2). Consistent with the fact that the floxed region in

317 these mice encompasses parts of the promoter, reads in Xist were low in all embryos of

318 all developmental stages (not shown). Therefore, the gender of each embryo was

319 determined by assessing expression of Y-linked genes (Figure 5A). Data obtained for

320 each embryo were processed and normalized to autosomal gene expression as described

321 for the WT/RlimKO dataset. The global F/M expression profiles of 8127 genes in this

322 dataset with mapped reads across all developmental stages, showed increased expression

Δ 323 specifically of X-linked transcripts in XistWT/ p embryos, while general gene expression

324 from autosomes was similar (Figure 5B). Confirming a central role for the Xist lncRNA

Δ 325 during iXCI, the F/M expression profiles of X-linked genes were high in XistWT/ p

326 embryos of all stages (Figure 5C). Comparisons with WT/WT revealed significant

Δ 327 defects in X dosage compensation in XistWT/ p females at around E3.5 blastocyst stages

328 (Figure 5D), consistent with published findings (Namekawa et al., 2010).

329

330 Regulation of X-linked gene expression in pre/peri-implantation embryos

331 Studies of various adult somatic cell types have revealed general X/A expression ratios of

332 around 1, indicating that gene expression from the active X is upregulated around two-

333 fold. Indeed, male mouse ES cells and epiblast cells in blastocysts display X/A values of

334 around 0.8 (Deng et al., 2013, Deng et al., 2011, Lin et al., 2007). While these results

335 indicate incomplete X upregulation they nonetheless suggest that this upregulation might

336 be initiated during preimplantation development. To assess alterations in the X/A ratio

337 during preimplantation development we calculated the average total expression (FPKM)

338 of X-linked versus total autosomal genes within each embryo. This approach removes the

339 possibility that low expressing genes, which are more frequent on the X chromosome

340 when compared to autosomes and vary in different cell types, influence or bias the results

341 (Deng et al., 2011). Because of XCI in females, this analysis was first carried out on

342 males. Our results revealed gradually increasing levels of transcription from the X the

343 relative to autosomes (Figure 6A) and the total increase between the 4-cell stages to E4.5

344 was 1.58 fold (P<10-11; Students t-test). Calculating X/A values using a previously

345 published RNA-seq dataset (GSE45719 in GEO repository) on single mouse

346 preimplantation cells (Deng et al., 2014), generally confirms these data (Figure 6 – figure

347 supplement 1). When we examined average expression from single chromosomes

348 (normalized against 4-cell stage levels) we observed that, among all chromosomes, gene

349 expression from the X displayed the highest increase during preimplantation development

350 (Figure 6B). Next, we compared the contribution of chromosomes towards total gene

351 expression in males of each developmental stage by taking into account the numbers of

352 annotated genes located on each chromosome. These analyses showed that, consistent

353 with the presence of one X chromosome, at the earliest time point measured, the

354 contribution of the X was much lower than that of any autosome, only around 0.5 fold of

355 the average autosome (Figure 6C). This contribution gradually increased during

356 preimplantation development to around 0.77 fold measured at E4.5, which was the 14th

357 most highly expressed of the 20 chromosomes. These results are in general agreement

358 with X/A levels previously measured in male murine ES cells as well as epiblast cells

359 (Lin et al., 2007), and indicate that X upregulation is initiated during preimplantation

360 development. Including female embryos in these analyses (Figure 6D), our data reveal

361 that X/A upregulation is initiated both during male and female preimplantation

Δ Δ Δ 362 development, as female Rlim / and XistWT/ p embryos, which are defective in iXCI,

363 display high E4.5/4-cell ratios of 1.58 and 1.75, respectively, similar to those of males

364 (Figure 6E). Upon examination of early developmental stages, we found that all females

365 start out with high X/A ratios compared to those measured in males (between 1.58 - 1.87

Δ Δ 366 at the 4-cell stage; Figure 6F). However, by E4.5, whereas X/A ratios of Rlim / and

Δ 367 XistWT/ p females are still high compared to males (around 1.8 fold), those of WT/WT

368 females have decreased to levels close to 1 (Figure 6F). Combined, these results indicate

369 that X upregulation occurs during preimplantation development in males and females. In

370 WT/WT females, X upregulation takes place concurrently with iXCI that compensates

371 the general X gene dosage to that of males.

372

373 Discussion

374 Accuracy of single embryo RNA-seq data

375 Based on single cell technology, we have used single embryo RNA-seq to elucidate the

376 mouse pre- and peri-implantation transcriptome. This approach has been recently

377 established (Sharma et al., 2016) and we provide several lines of evidence for high

378 accuracy of RNA-seq datasets at multiple levels including single genes as well as

379 chromosome-wide: 1) Mapping reads to single genes demonstrates high fidelity of reads

380 within the Rlim regions that are present on the genome (Figure 1E), as well as reads

381 within the Tsix/Xist genomic region which allows a quantitative distinction between

382 expression of Xist vs Tsix (Figure 2 – figure supplement 1A). 2) The developmental

383 expression profiles of single genes correspond to those published in the literature. This is

384 true for cell markers (Figure 1F) as well as for Xist that is highly expressed in females but

385 not males (Figure 2A). 3) Our results obtained by RNA-seq on Xist expression (Figure

386 2A) have been confirmed using alternative methods such as strand-specific RT-qPCR

387 (Figure 2 – figure supplement 1C) and RNA-FISH (Figures 2B, C). Analyzing

388 chromosome-wide gene expression of WT mouse embryos reveals that the X dosage in

389 females is around 2-fold that of males at early embryonic stages and is subsequently

390 adjusted to those in males at late stages (Figure 3A), in agreement with recent findings in

391 mouse and human embryos (Petropoulos et al., 2016, Chen et al., 2016). Analysis of

392 XistKO females that cannot undergo iXCI shows, as expected, around two-fold higher X-

393 linked gene dosages when compared to males throughout preimplantation development.

394 These data combined with results obtained by subsampling of library sizes (Figure 1 –

395 figure supplement 1E; Figure 2 - figure supplement 1B; Figure 3 – figure supplements

396 1A, B) and direct comparisons of various genotypes (WT vs RlimKO; female and male;

397 e.g. Figure 3 – figure supplements 1C, D; 2; not shown) confirm the high overall

398 robustness and accuracy of our RNA-seq data. However, likely reflecting technical

399 variability of single-embryo RNA-seq, variations of single gene expression levels among

400 replicates were generally higher when compared to those of chromosome/genome-wide

401 data, where hundreds/thousands of genes are averaged.

402

403 Chromosome-wide X-linked gene expression

404 While crucial functions of Rlim and Xist for iXCI in mice are known (Marahrens et al.,

405 1997, Shin et al., 2010), the influence of both genes on the general kinetics of X-linked

406 gene expression are not. To study iXCI, X upregulation and the effects of Xist and Rlim

407 on X-linked gene expression we have used embryos with congenic genetic background

408 because this approach allows for simpler mouse genetics and excludes influences of the

409 genetic background on X-linked gene expression. The facts that 1) females have two and

410 males have one X chromosome and 2) Xist is crucial for iXCI comparing females to

411 males combined with the inclusion of the XistKO mouse model allows for an overall

412 chromosome-wide assessment of the dynamics of X-linked gene expression by

413 comparing gene expression profiles between the genders and/or between females with

414 different genotypes. This is because XistKO female embryos display around two-fold

415 higher F/M levels throughout preimplantation development (Figure 5A), thereby

416 providing genetic evidence that the global X profile differences between XistKO and

417 WT/WT females is the direct consequence of iXCI and that there is no other, major

418 female-specific mechanism in preimplantation embryos that significantly influences the

419 global X-linked gene dosage. Concerning allele-specific X-chromosome-wide gene

420 expression, as males have a single maternally inherited X combined with the fact that

421 iXCI in females silences exclusively the Xp (Deng et al., 2014), indicates that the steady

422 decline in F/M values seen in WT/WT females is mostly due to decreased Xp expression

423 levels, and using B6m/CASTp hybrid embryos we have confirmed this for stage E3.5

424 (Figure 3 – figure supplement 2). However, in contrast to chromosome-wide X-linked

425 gene expression, at the gene level we cannot resolve the parental origin of single RNAs,

426 as our RNA-seq data do not reveal an allele-specific resolution.

427 In agreement with published results (Deng et al., 2014, Marks et al., 2015), we

428 show that silencing of X-linked genes in females occurs across the entire X chromosome

429 (Figure 3C). Such spatial concordance of silencing is consistent with studies in ESCs

430 which show that Xist does not spread linearly along the X chromosome, but rather

431 spreads to multiple loci on the X simultaneously, due to the three dimensional folding of

432 the chromosome (Engreitz et al., 2013). The finding that the average F/M ratios of

Δ Δ Δ 433 females of all genotypes (WT/WT, Rlim / and XistWT/ p) remained below 2 even at early

434 developmental stages (Figures 2A; 5C) is likely explained by a previously reported Xist-

435 independent partial silencing of some X-linked transcripts (Kalantry et al., 2009). Thus,

436 by integrating X upregulation and iXCI, our results represent a comprehensive view on

437 X-linked gene expression in early mouse embryos, and its regulation by Rlim and Xist.

438 Our results reveal that the general pre/peri-implantation profile of X dosage

439 compensation between genders as observed in WT female mice (Figure 3A) is

440 remarkably similar to that measured in early female human embryos (Petropoulos et al.,

441 2016), even though mice but not humans undergo iXCI (Okamoto et al., 2011). This

442 suggests strong evolutionary pressure on X dosage compensation before implantation. It

443 is thus surprising that unlike in mice (Figure 6) there is no sign of X upregulation in

444 human preimplantation embryos (Petropoulos et al., 2016) (not shown). Because X/A

445 values in adult human somatic tissues are close to 1 (Deng et al., 2011), this suggests that

446 X-linked gene expression is upregulated at post-implantation stages.

447

448 Regulation of iXCI by Rlim

449 Our analyses of global gene expression profiles in females shows that the KO of Rlim or

450 Xist affects global expression levels of X-linked transcripts but not those expressed from

451 autosomes (Figures 3B; 5B). This combined with the fact that males lacking either Xist or

452 Rlim appear healthy and are fertile indicates that crucial roles for both genes are restricted

453 to X dosage compensation in females. Indeed, our results reveal that high levels of Xist,

454 the maintenance of Xist clouds and X-dosage compensation in female blastocysts depend

455 on Rlim. Combined, these results imply that RLIM’s function on iXCI is exerted through

456 regulation of Xist. Moreover, because only iXCI globally and significantly influences X-

457 linked gene expression specifically in females, the development of temporary Xist clouds

458 in RlimKO females (Figure 2) and a similar silencing pattern at E3 between WT/WT and

459 RlimKO females (Figure 3; Figure 3 – figure supplement 1C) suggests that initiation of

460 the iXCI process occurs normally at early stages in RlimKO females. However, at

461 blastocyst stages X-silencing and iXCI cannot be maintained leading to a failure in X

462 dosage compensation (Figure 3; Figure 3 – figure supplement 1D). This is further

463 corroborated by our results targeting the Rlim cKO via Rosa26-Cre early during female

464 embryogenesis (Figure 4), confirming crucial roles for the maintenance of iXCI in

465 blastocyst-staged female embryos. In this context, it is important to note that RLIM

466 protein levels are down-regulated specifically in epiblast cells of E4.5 blastocyst embryos

467 (Shin et al., 2014), at a time point when these cells start to reactivate the Xp (Mak et al.,

468 2004, Okamoto et al., 2004) before undergoing rXCI. Thus, because RLIM is crucial for

469 the maintenance of iXCI at peri-implantation stages (Figures 2-4), this down-regulation

470 provides an attractive molecular mechanism for triggering the Xp reactivation process.

471 In summary, by elucidating the mouse pre- and peri-implantation transcriptome, this

472 study provides a comprehensive view on X linked gene expression during early mouse

473 development. Our analyses uncover that upregulation of X-linked transcripts is initiated

474 in early male and female mouse embryos. In females X upregulation occurs concomitant

475 with iXCI, which progressively leads to X gene dosage compensation between genders in

476 an Rlim and Xist-dependent manner.

477

478 Materials and Methods

479 Mice

480 Mice used in this study and genotyping have been described; Rlim fl/fl (Shin et al., 2010),

481 Xist fl/fl (Csankovszki et al., 1999), Sox2-Cre (Hayashi et al., 2002, Shin et al., 2014) and

482 Rosa26-Cre (Soriano, 1999). The Xistfl/fl mouse strain 129-Xisttm2Jae/Mmnc,

483 identification number 29172-UNC, was obtained from the Mutant Mouse Regional

484 Resource Center, a NIH funded strain repository, and was donated to the MMRRC by

485 Rudolf Jaenisch, Ph.D., Whitehead Institute. CAST/Eij mice were purchased from The

486 Jackson Laboratories. Rlimfl/fl mice were generally bred and maintained on a C57BL/6

487 background. All mice were housed in the animal facility of UMMS, and utilized

488 according to NIH guidelines and those established by the UMMS Institute of Animal

489 Care and Usage Committee.

490

491 Single-embryo RNA-seq

492 All embryos were generated by natural mating. Whole embryos were dissected at the

493 indicated time points and the correct stage was verified under the binocular. Single-

494 Embryo RNA-seq was essentially performed as described (Sharma et al., 2016). Briefly,

495 single embryos/trophoblast cells were placed in 10ul TCL Buffer (Qiagen) supplemented

496 with 1% BME, and snap frozen. A total of 187 samples representing WT and RlimKO

497 embryos were distributed on two 96-well plates (plus 5 mock wells) and thawed at RT for

498 10 minutes prior to RNA purification using Ampure RNA beads (Beckmann-Coulter).

499 RNA samples were resuspended in solution containing 3’ RT primer (5’-

500 AAGCAGTGGTATCAACGCAGAGTACT(30)VN-3’) and dNTPs. Reverse

501 transcription was performed with SSII (Life Technologies), whose terminal transferase

502 activity allows incorporation of a PCR binding site at the 3’ end of the cDNA using a

503 template-switching oligonucleotide (5’-

504 AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3’; custom synthesized from

505 Exiqon) as a template. Subsequently, cDNA was amplified using 12 cycles of PCR,

506 followed by tagmentation with Nextera kit (Illumina). Final libraries were amplified by

507 12 cycles of PCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’) and sequenced on a

508 NextSeq 500. Single-embryo RNA-seq of XistKO or B6/CAST hybrid embryos was

509 performed as described above.

510

511 RNA-seq data analyses

512 Reads (paired end 35 bp) were aligned to the mouse genome (mm10) using TopHat

513 (version 2.0.12) (Trapnell et al., 2009), with default setting except set parameter read-

514 mismatches to 2, followed by running HTSeq (version 0.6.1p1) (Anders et al., 2015),

515 Bioconductor packages edgeR (version 3.10.0 ) (Robinson et al., 2010, Robinson and

516 Smyth, 2007) and ChIPpeakAnno (version 3.2.0) (Zhu, 2013, Zhu et al., 2010) for

517 transcriptome quantification, differential gene expression analysis, and annotation. For

518 edgeR, we followed the workflow as described in (Anders et al., 2013), except that the

519 library size of each embryo was set as the total number of the effective counts of the

520 autosomal genes. Specifically, edgeR was used for the removal of the unmapped,

521 ambiguous, and not annotated reads as well as reads in rRNA, the filtering out of low

522 expression genes after regrouping samples according to developmental stage. In

523 particular, as the X chromosome contains many reproduction-related genes that are not

524 expressed in somatic tissues (Khil et al., 2004, Mueller et al., 2008) and genes with no or

525 low expression may influence the X/A expression ratios (Deng et al., 2011). Therefore,

526 genes that were not expressed or lowly expressed genes as determined for embryos at

527 each stage were filtered out before normalization, and removed genes without at least 1

528 read per million in n of the samples, where n is the size of the smallest group of

529 biological replicates within each developmental stage (Anders et al., 2013). The library

530 size was then reset as the total number of the effective counts of autosomal genes. The

531 TMM method (Trimmed Mean of M-value) was used to calculate normalization factors

532 between samples of the same stage (Robinson and Oshlack, 2010). Fragments per

533 kilobase of exon per million reads mapped (FPKM) (Tables S1, S2) and LogFC were

534 calculated using edgeR. For gender assessment counts per million (cpm) of mapped reads

535 in Xist and the seven Y-linked genes Ddx3y, Eif2s3y, Kdm5d, Usp9y, Uty, Zfy1 and Zfy2

536 were evaluated. 12 samples out of 187 sequenced in the combined RlimKO/WT RNA-seq

537 experiment, and 33 samples out of 174 sequenced in the XistKO RNA-seq experiment

538 were disregarded due to low reads or because gender could not be clearly determined.

539 Random subsampling of library sizes to 200.000 reads per embryo was performed as

540 described (Robinson and Storey, 2014). Analyses of the subsampled datasets were carried

541 out as described above. F/M analyses were carried out by averaging ratios per gene

542 within each developmental stage using females of defined genotype and pooled males

543 (WT and KO). For calculations in Figure 3 – figure supplement 1C, D, 755 X-linked

544 genes with cpms>1 (before normalization) in at least three embryos at each stage were

545 included. The dataset was then normalized against autosomal gene expression and Log2

546 fold change was calculated using edgeR. For the allele-specific expression analysis of X-

547 linked transcripts in B6/CAST heterozygous females, the SNPs were called with mpileup

548 and bcftools in the SAMtools package (Li, 2011) using the aligned BAM files. A python

549 program allelecounter was used to obtain the allele counts

550 (https://github.com/secastel/allelecounter). SNPs called in females were verified by

551 comparisons to sequences in males (C57BL/6). Data analysis was carried out by

552 comparing SNPs with reference genomes C57BL/6 (mm10; UCSC) and CAST/Eij

553 (http://csbio.unc.edu/CCstatus/index.py?run=Pseudo).

554

555 Blastocyst outgrowths, RNA fluorescence in situ hybridization (RNA FISH),

556 Immunohistochemistry and RT-qPCR

557 All embryos were generated by natural mating and harvested at the indicated embryonic

558 stages. For blastocyst outgrowths, embryos were harvested at E4, cultured for 48h and

559 genotyped after image recording. RNA FISH was performed essentially as previously

560 reported (Shin et al., 2010, Byron et al., 2013). For the synthesis of specific Xist probes,

561 we used plasmids containing mouse Xist exon 1 and 6 that recognize Xist and Tsix

562 (Panning, 2004). For the Rlim probe, we used a plasmid containing genomic Rlim

563 sequences upstream of the KO site that detects specific Rlim mRNAs transcribed from

564 both wild type and KO alleles (Shin et al., 2010). Ovaries of three 8-weeks old WT/WT

Δ 565 and SC-RlimcKO/ females each were dissected, fixed and stained with an RLIM antibody

566 as described previously (Shin et al., 2010). RT-qPCR on whole embryos using primers

567 that detect RNA transcribed from Xist and actin as control, were performed as previously

568 reported (Shin et al., 2010).

569

570 Author contributions

571 F.W., J.S. and I.B. designed experiments, J.M.S, A.B. and O.J.R. carried out the RNA-

572 seq on single embryos, J.Y., E.M.T, L.J.Z. and I.B. analyzed RNA-seq datasets. M.B.,

573 X.Z. and J.B.L. carried out the RNA FISH experiments and F.W. and J.S. performed

574 mouse genetics, harvesting of preimplantation embryos, immuno-stainings and RT-qPCR

575 analyses and analyzed results. I.B. wrote the paper.

576

577 Acknowledgments

578 We thank T. Fazzio, L. Hall and S. Jones for reading of the manuscript and/or advice and

579 discussion and S. Kalantry for the Rosa26-Cre mice. RNA-seq data have been deposited

580 with the GEO repository (GSE71442). I.B. is a member of the University of

581 Massachusetts DERC (DK32520). This work was supported from NIH grants

582 R01CA131158 to I.B., R01HD080224 and DP1ES025458 to O.J.R., and R01GM053234

583 to J.B.L.

584

585 References

586 ANDERS, S., MCCARTHY, D. J., CHEN, Y., OKONIEWSKI, M., SMYTH, G. K., HUBER, W. & 587 ROBINSON, M. D. 2013. Count-based differential expression analysis of RNA sequencing data 588 using R and Bioconductor. Nat Protoc, 8, 1765-86. 589 ANDERS, S., PYL, P. T. & HUBER, W. 2015. HTSeq--a Python framework to work with high-throughput 590 sequencing data. Bioinformatics, 31, 166-9. 591 BACH, I., RODRIGUEZ-ESTEBAN, C., CARRIERE, C., BHUSHAN, A., KRONES, A., ROSE, D. W., 592 GLASS, C. K., ANDERSEN, B., IZPISUA BELMONTE, J. C. & ROSENFELD, M. G. 1999. 593 RLIM inhibits functional activity of LIM homeodomain transcription factors via recruitment of 594 the histone deacetylase complex. Nat Genet, 22, 394-9. 595 BECKER, T., BOSSENZ, M., TURSUN, B., SCHLUTER, A., PETERS, M. A., BECKER, C. G., 26

596 OSTENDORFF, H. P. & BACH, I. 2003. Comparing protein stabilities during zebrafish 597 embryogenesis. Methods Cell Sci, 25, 85-9. 598 BERLETCH, J. B., YANG, F. & DISTECHE, C. M. 2010. Escape from X inactivation in mice and 599 humans. Genome Biol, 11, 213. 600 BRULET, P. & JACOB, F. 1982. Molecular cloning of a cDNA sequence encoding a trophectoderm- 601 specific marker during mouse blastocyst formation. Proc Natl Acad Sci U S A, 79, 2328-32. 602 BYRON, M., HALL, L. L. & LAWRENCE, J. B. 2013. A multifaceted FISH approach to study 603 endogenous RNAs and DNAs in native nuclear and cell structures. Curr Protoc Hum Genet, 604 Chapter 4, Unit 4 15. 605 CALABRESE, J. M., SUN, W., SONG, L., MUGFORD, J. W., WILLIAMS, L., YEE, D., STARMER, J., 606 MIECZKOWSKI, P., CRAWFORD, G. E. & MAGNUSON, T. 2012. Site-specific silencing of 607 regulatory elements as a mechanism of X inactivation. Cell, 151, 951-63. 608 CHAMBERS, I., COLBY, D., ROBERTSON, M., NICHOLS, J., LEE, S., TWEEDIE, S. & SMITH, A. 609 2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem 610 cells. Cell, 113, 643-55. 611 CHEN, G., SCHELL, J. P., BENITEZ, J. A., PETROPOULOS, S., YILMAZ, M., REINIUS, B., 612 ALEKSEENKO, Z., SHI, L., HEDLUND, E., LANNER, F., SANDBERG, R. & DENG, Q. 2016. 613 Single-cell analyses of X Chromosome inactivation dynamics and pluripotency during 614 differentiation. Genome Res. 615 CSANKOVSZKI, G., PANNING, B., BATES, B., PEHRSON, J. R. & JAENISCH, R. 1999. Conditional 616 deletion of Xist disrupts histone macroH2A localization but not maintenance of X inactivation. 617 Nat Genet, 22, 323-4. 618 DENG, Q. L., RAMSKOLD, D., REINIUS, B. & SANDBERG, R. 2014. Single-Cell RNA-Seq Reveals 619 Dynamic, Random Monoallelic Gene Expression in Mammalian Cells. Science, 343, 193-196. 620 DENG, X., BERLETCH, J. B., MA, W., NGUYEN, D. K., HIATT, J. B., NOBLE, W. S., SHENDURE, J. 621 & DISTECHE, C. M. 2013. Mammalian X upregulation is associated with enhanced transcription 622 initiation, RNA half-life, and MOF-mediated H4K16 acetylation. Dev Cell, 25, 55-68. 623 DENG, X. X., HIATT, J. B., NGUYEN, D. K., ERCAN, S., STURGILL, D., HILLIER, L. W., 624 SCHLESINGER, F., DAVIS, C. A., REINKE, V. J., GINGERAS, T. R., SHENDURE, J., 625 WATERSTON, R. H., OLIVER, B., LIEB, J. D. & DISTECHE, C. M. 2011. Evidence for 626 compensatory upregulation of expressed X-linked genes in mammals, Caenorhabditis elegans and 627 Drosophila melanogaster. Nature Genetics, 43, 1179-U28. 628 DISTECHE, C. M. 2012. Dosage compensation of the sex chromosomes. Annu Rev Genet, 46, 537-60. 629 ENGREITZ, J. M., PANDYA-JONES, A., MCDONEL, P., SHISHKIN, A., SIROKMAN, K., SURKA, C., 630 KADRI, S., XING, J., GOREN, A., LANDER, E. S., PLATH, K. & GUTTMAN, M. 2013. The 631 Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. 632 Science, 341, 1237973. 633 FINN, E. H., SMITH, C. L., RODRIGUEZ, J., SIDOW, A. & BAKER, J. C. 2014. Maternal bias and 634 escape from X chromosome imprinting in the midgestation mouse placenta. Dev Biol, 390, 80-92. 635 GALUPA, R. & HEARD, E. 2015. X-chromosome inactivation: new insights into cis and trans regulation. 636 Curr Opin Genet Dev, 31, 57-66. 637 GUNGOR, C., TANIGUCHI-ISHIGAKI, N., MA, H., DRUNG, A., TURSUN, B., OSTENDORFF, H. P., 638 BOSSENZ, M., BECKER, C. G., BECKER, T. & BACH, I. 2007. Proteasomal selection of 639 multiprotein complexes recruited by LIM homeodomain transcription factors. Proc Natl Acad Sci 640 U S A, 104, 15000-5. 641 HAYASHI, S., LEWIS, P., PEVNY, L. & MCMAHON, A. P. 2002. Efficient gene modulation in mouse 642 epiblast using a Sox2Cre transgenic mouse strain. Mech Dev, 119 Suppl 1, S97-S101. 643 JAITIN, D. A., KENIGSBERG, E., KEREN-SHAUL, H., ELEFANT, N., PAUL, F., ZARETSKY, I., 644 MILDNER, A., COHEN, N., JUNG, S., TANAY, A. & AMIT, I. 2014. Massively parallel single- 645 cell RNA-seq for marker-free decomposition of tissues into cell types. Science, 343, 776-9. 646 JIAO, B., MA, H., SHOKHIREV, M. N., DRUNG, A., YANG, Q., SHIN, J., LU, S., BYRON, M., 647 KALANTRY, S., MERCURIO, A. M., LAWRENCE, J. B., HOFFMANN, A. & BACH, I. 2012.

648 Paternal RLIM/Rnf12 is a survival factor for milk-producing alveolar cells. Cell, 149, 630-41. 649 JIAO, B., TANIGUCHI-ISHIGAKI, N., GUNGOR, C., PETERS, M. A., CHEN, Y. W., RIETHDORF, S., 650 DRUNG, A., AHRONIAN, L. G., SHIN, J., PAGNIS, R., PANTEL, K., TACHIBANA, T., 651 LEWIS, B. C., JOHNSEN, S. A. & BACH, I. 2013. Functional activity of RLIM/Rnf12 is 652 regulated by phosphorylation-dependent nucleocytoplasmic shuttling. Mol Biol Cell, 24, 3085-96. 653 KALANTRY, S., PURUSHOTHAMAN, S., BOWEN, R. B., STARMER, J. & MAGNUSON, T. 2009. 654 Evidence of Xist RNA-independent initiation of mouse imprinted X-chromosome inactivation. 655 Nature, 460, 647-51. 656 KHIL, P. P., SMIRNOVA, N. A., ROMANIENKO, P. J. & CAMERINI-OTERO, R. D. 2004. The mouse 657 X chromosome is enriched for sex-biased genes not subject to selection by meiotic sex 658 chromosome inactivation. Nat Genet, 36, 642-6. 659 KIDDER, G. M. & PEDERSEN, R. A. 1982. Turnover of embryonic messenger RNA in preimplantation 660 mouse embryos. J Embryol Exp Morphol, 67, 37-49. 661 LEE, J. T. & LU, N. 1999. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell, 99, 47- 662 57. 663 LI, H. 2011. A statistical framework for SNP calling, mutation discovery, association mapping and 664 population genetical parameter estimation from sequencing data. Bioinformatics, 27, 2987-93. 665 LIN, H., GUPTA, V., VERMILYEA, M. D., FALCIANI, F., LEE, J. T., O'NEILL, L. P. & TURNER, B. 666 M. 2007. Dosage compensation in the mouse balances up-regulation and silencing of X-linked 667 genes. PLoS Biol, 5, e326. 668 MAK, W., NESTEROVA, T. B., DE NAPOLES, M., APPANAH, R., YAMANAKA, S., OTTE, A. P. & 669 BROCKDORFF, N. 2004. Reactivation of the paternal X chromosome in early mouse embryos. 670 Science, 303, 666-9. 671 MARAHRENS, Y., PANNING, B., DAUSMAN, J., STRAUSS, W. & JAENISCH, R. 1997. Xist-deficient 672 mice are defective in dosage compensation but not spermatogenesis. Genes Dev, 11, 156-66. 673 MARKS, H., KERSTENS, H. H., BARAKAT, T. S., SPLINTER, E., DIRKS, R. A., VAN MIERLO, G., 674 JOSHI, O., WANG, S. Y., BABAK, T., ALBERS, C. A., KALKAN, T., SMITH, A., JOUNEAU, 675 A., DE LAAT, W., GRIBNAU, J. & STUNNENBERG, H. G. 2015. Dynamics of gene silencing 676 during X inactivation using allele-specific RNA-seq. Genome Biol, 16, 149. 677 MITSUI, K., TOKUZAWA, Y., ITOH, H., SEGAWA, K., MURAKAMI, M., TAKAHASHI, K., 678 MARUYAMA, M., MAEDA, M. & YAMANAKA, S. 2003. The homeoprotein Nanog is required 679 for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113, 631-42. 680 MUELLER, J. L., MAHADEVAIAH, S. K., PARK, P. J., WARBURTON, P. E., PAGE, D. C. & 681 TURNER, J. M. 2008. The mouse X chromosome is enriched for multicopy testis genes showing 682 postmeiotic expression. Nat Genet, 40, 794-9. 683 NAMEKAWA, S. H., PAYER, B., HUYNH, K. D., JAENISCH, R. & LEE, J. T. 2010. Two-step 684 imprinted X inactivation: repeat versus genic silencing in the mouse. Mol Cell Biol, 30, 3187-205. 685 OKAMOTO, I., OTTE, A. P., ALLIS, C. D., REINBERG, D. & HEARD, E. 2004. Epigenetic dynamics of 686 imprinted X inactivation during early mouse development. Science, 303, 644-9. 687 OKAMOTO, I., PATRAT, C., THEPOT, D., PEYNOT, N., FAUQUE, P., DANIEL, N., 688 DIABANGOUAYA, P., WOLF, J. P., RENARD, J. P., DURANTHON, V. & HEARD, E. 2011. 689 Eutherian mammals use diverse strategies to initiate X-chromosome inactivation during 690 development. Nature, 472, 370-4. 691 OSTENDORFF, H. P., PEIRANO, R. I., PETERS, M. A., SCHLUTER, A., BOSSENZ, M., SCHEFFNER, 692 M. & BACH, I. 2002. Ubiquitination-dependent cofactor exchange on LIM homeodomain 693 transcription factors. Nature, 416, 99-103. 694 PANNING, B. 2004. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol, 695 376, 419-28. 696 PATRAT, C., OKAMOTO, I., DIABANGOUAYA, P., VIALON, V., LE BACCON, P., CHOW, J. & 697 HEARD, E. 2009. Dynamic changes in paternal X-chromosome activity during imprinted X- 698 chromosome inactivation in mice. Proc Natl Acad Sci U S A, 106, 5198-203. 699 PAYER, B. & LEE, J. T. 2014. Coupling of X-chromosome reactivation with the pluripotent stem cell

700 state. RNA Biol, 11, 798-807. 701 PENNY, G. D., KAY, G. F., SHEARDOWN, S. A., RASTAN, S. & BROCKDORFF, N. 1996. 702 Requirement for Xist in X chromosome inactivation. Nature, 379, 131-7. 703 PETROPOULOS, S., EDSGARD, D., REINIUS, B., DENG, Q., PANULA, S. P., CODELUPPI, S., 704 PLAZA REYES, A., LINNARSSON, S., SANDBERG, R. & LANNER, F. 2016. Single-Cell 705 RNA-Seq Reveals Lineage and X Chromosome Dynamics in Human Preimplantation Embryos. 706 Cell. 707 PLATH, K., FANG, J., MLYNARCZYK-EVANS, S. K., CAO, R., WORRINGER, K. A., WANG, H., DE 708 LA CRUZ, C. C., OTTE, A. P., PANNING, B. & ZHANG, Y. 2003. Role of histone H3 lysine 27 709 methylation in X inactivation. Science, 300, 131-5. 710 ROBINSON, D. G. & STOREY, J. D. 2014. subSeq: determining appropriate sequencing depth through 711 efficient read subsampling. Bioinformatics, 30, 3424-6. 712 ROBINSON, M. D., MCCARTHY, D. J. & SMYTH, G. K. 2010. edgeR: a Bioconductor package for 713 differential expression analysis of digital gene expression data. Bioinformatics, 26, 139-40. 714 ROBINSON, M. D. & OSHLACK, A. 2010. A scaling normalization method for differential expression 715 analysis of RNA-seq data. Genome Biol, 11, R25. 716 ROBINSON, M. D. & SMYTH, G. K. 2007. Moderated statistical tests for assessing differences in tag 717 abundance. Bioinformatics, 23, 2881-7. 718 ROSNER, M. H., VIGANO, M. A., OZATO, K., TIMMONS, P. M., POIRIER, F., RIGBY, P. W. & 719 STAUDT, L. M. 1990. A POU-domain transcription factor in early stem cells and germ cells of 720 the mammalian embryo. Nature, 345, 686-92. 721 SCHOLER, H. R., RUPPERT, S., SUZUKI, N., CHOWDHURY, K. & GRUSS, P. 1990. New type of 722 POU domain in germ line-specific protein Oct-4. Nature, 344, 435-9. 723 SHALEK, A. K., SATIJA, R., ADICONIS, X., GERTNER, R. S., GAUBLOMME, J. T., 724 RAYCHOWDHURY, R., SCHWARTZ, S., YOSEF, N., MALBOEUF, C., LU, D. N., 725 TROMBETTA, J. J., GENNERT, D., GNIRKE, A., GOREN, A., HACOHEN, N., LEVIN, J. Z., 726 PARK, H. & REGEV, A. 2013. Single-cell transcriptomics reveals bimodality in expression and 727 splicing in immune cells. Nature, 498, 236-240. 728 SHARMA, U., CONINE, C. C., SHEA, J. M., BOSKOVIC, A., DERR, A. G., BING, X. Y., 729 BELLEANNEE, C., KUCUKURAL, A., SERRA, R. W., SUN, F., SONG, L., CARONE, B. R., 730 RICCI, E. P., LI, X. Z., FAUQUIER, L., MOORE, M. J., SULLIVAN, R., MELLO, C. C., 731 GARBER, M. & RANDO, O. J. 2016. Biogenesis and function of tRNA fragments during sperm 732 maturation and fertilization in mammals. Science, 351, 391-6. 733 SHIN, J., BOSSENZ, M., CHUNG, Y., MA, H., BYRON, M., TANIGUCHI-ISHIGAKI, N., ZHU, X., 734 JIAO, B., HALL, L. L., GREEN, M. R., JONES, S. N., HERMANS-BORGMEYER, I., 735 LAWRENCE, J. B. & BACH, I. 2010. Maternal Rnf12/RLIM is required for imprinted X- 736 chromosome inactivation in mice. Nature, 467, 977-81. 737 SHIN, J., WALLINGFORD, M. C., GALLANT, J., MARCHO, C., JIAO, B., BYRON, M., BOSSENZ, 738 M., LAWRENCE, J. B., JONES, S. N., MAGER, J. & BACH, I. 2014. RLIM is dispensable for 739 X-chromosome inactivation in the mouse embryonic epiblast. Nature, 511, 86-9. 740 SORIANO, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet, 21, 70- 741 1. 742 TRAPNELL, C., PACHTER, L. & SALZBERG, S. L. 2009. TopHat: discovering splice junctions with 743 RNA-Seq. Bioinformatics, 25, 1105-11. 744 VAN BEMMEL, J. G., MIRA-BONTENBAL, H. & GRIBNAU, J. 2016. Cis- and trans-regulation in X 745 inactivation. Chromosoma, 125, 41-50. 746 YANG, E., VAN NIMWEGEN, E., ZAVOLAN, M., RAJEWSKY, N., SCHROEDER, M., MAGNASCO, 747 M. & DARNELL, J. E., JR. 2003. Decay rates of human mRNAs: correlation with functional 748 characteristics and sequence attributes. Genome Res, 13, 1863-72. 749 YANG, F., BABAK, T., SHENDURE, J. & DISTECHE, C. M. 2010. Global survey of escape from X 750 inactivation by RNA-sequencing in mouse. Genome Res, 20, 614-22. 751 ZHOU, J., MCCARREY, J. R. & WANG, P. J. 2013. A 1.1-Mb segmental deletion on the X chromosome

752 causes meiotic failure in male mice. Biol Reprod, 88, 159. 753 ZHU, L. J. 2013. Integrative analysis of ChIP-chip and ChIP-seq dataset. Methods Mol Biol, 1067, 105-24. 754 ZHU, L. J., GAZIN, C., LAWSON, N. D., PAGES, H., LIN, S. M., LAPOINTE, D. S. & GREEN, M. R. 755 2010. ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC 756 Bioinformatics, 11, 237. 757

758 Figure legends

759

760 Figure 1 Elucidating the transcriptome of preimplantation development via RNA-seq of

761 single mouse embryos WT and KO for Rlim. All Rlim germline KO (Δ) embryos were

Δ Δ 762 generated by RlimcKO/ -SC x Rlim /Y crosses. Embryonic stages are indicated, troph =

Δ 763 trophoblasts. A, B) Lack of RLIM in oocytes of SC-RlimcKO/ females.

764 Immunohistochemical stainings of representative ovarian sections of adult RlimWT/WT (A)

Δ 765 and RlimcKO/ -SC (B) females (n=3, each) using antibodies directed against RLIM. Scale

766 bars, 60 μm. Boxed regions are shown in higher magnification below. Note the lack of

767 RLIM immunoreactivity in nuclei and pronuclei of both somatic cell types and oocytes in

Δ 768 RlimcKO/ -SC females, respectively. C, D) Gender determination of embryos in RNA-seq

769 on whole preimplantation embryos WT and KO for Rlim. As example, the distributions

770 of reads at the 8-cell stage normalized to autosomes of Y-linked genes (C) and Xist (D)

771 are shown in box-plots. Note that embryos with high levels of Y-linked genes display low

772 levels of Xist and were therefore categorized as males, whereas those with low and high

773 levels of Y-linked genes and Xist, respectively, were categorized as females. cpm =

774 counts per million mapped reads. E) Modified from the UCSC Genome Browser:

775 Cumulative mapped raw reads on the Rlim locus of pooled embryos WT/WT or Δ/Δ for

776 Rlim (females only) at all developmental stages (variable scales). Structure of the Rlim 30

777 gene is shown below in blue with boxed exon regions. Protein coding regions are

778 indicated in thicker stroke. Arrow indicates direction of transcription. Floxed area deleted

Δ Δ 779 in the Rlim cKO is indicated. Note the lack of reads in the floxed area of Rlim / females.

Δ 780 This was also true for male Rlim /Y embryos (data not shown). F) Developmental profile

781 of relative expression of selected single genes in WT embryos. Data representing

782 Oct4/Pou5f1 and Nanog (ES cell markers) and Krt8 (trophoblast) were pooled from WT

783 females and males. Rlim data were collected from WT/WT females only. Reads were

784 normalized to those at stage E3.5, because all of the selected genes are expected to be

785 active at this stage.

786

787 Figure 1 – figure supplement 1 Details of RNA-seq experiments on single embryos WT

788 and KO for Rlim. A) Parental genotypes used for generating WT and germline Rlim KO

789 embryos. B) Summary of genotypes, embryonic stages, and sample numbers of embryos

790 used for whole embryo RNA-seq experiments. C) No significant differences in overall

Δ/Y WT/Y 791 gene expression between Rlim and Rlim males. Heat map representing Log2-

792 transformed data comparing global mRNA expression level ratios. Chromosomes are

Δ Δ 793 indicated. D) Similar expression of cell markers between female Rlim / and RlimWT/WT

794 embryos at blastocyst stages. Data representing Oct4/POU5F1 and Nanog (ES cell

795 markers) and Krt8 (trophoblast) were pooled from RlimWT/WT females and compared to

Δ Δ 796 those of Rlim / females. E) Random downsizing each library to 200.000 reads does not

797 significantly change/affect results obtained by RNA-seq (see also Figure 2 – figure

798 supplement 1B and Figure 3 – figure supplement 1A, B). Representative results (n=3) 31

799 obtained from the WT/RlimKO dataset with each library randomly adjusted to 200k

800 reads: Analysis of Oct4/Pou5f1, Nanog, Krt8 and Rlim expression profiles in WT

801 embryos.

802

803 Figure 2 Rlim is required for the maintenance of Xist expression and Xist clouds at

804 blastocyst stages. A) Expression profiles from the Xist locus in preimplantation embryos

805 WT and KO for Rlim. Error bars indicate standard error of the mean (SEM). Significant

806 differences of Xist levels in WT and KO females P<0.01 are indicated (Student’s t-test).

807 B) WT and RlimKO embryos at E2.5 were co-stained with probes recognizing Xist (red)

Δ Δ 808 and Rlim (green) via RNA FISH. Two representative Rlim / embryos are shown. The

809 boxed area is magnified in the right panel. Arrows point at Xist cloud and Rlim

810 transcription focus. C) RNA FISH on WT and RlimKO embryos at E3.5. The boxed area

811 is magnified in the right panels. Arrows point at Xist and Rlim transcription foci. D)

812 Tabular summary of Xist clouds detected in B and C.

813

814 Figure 2 – figure supplement 1 Rlim regulates Xist levels and Xist clouds at blastocyst

815 stages. A) Modified from the UCSC Genome Browser: Cumulative mapped raw reads of

816 pooled E4.5 female embryos WT/WT (blue) or Δ/Δ (red) for Rlim on the Tsix/Xist gene

817 locus (variable scales). Structure of the Tsix and Xist genes is shown below in blue.

818 Exons are boxed. Arrows indicate direction of transcription. Two alternatively spliced

819 forms of Xist are shown. Note that >90% of reads in the locus map within the Xist

820 transcription unit. B) Random downsizing each library to 200.000 reads does not

821 significantly change/affect Xist expression profiles. Representative results (n=3) obtained

822 from the WT/RlimKO dataset with each library randomly adjusted to 200k reads. C) RT-

Δ Δ 823 qPCR analysis of Xist expression in RlimWT/WT and Rlim / at E2.5, E3.5 and E4.5. Data

824 represent values obtained from three embryos for each stage and genotype. Gender of

825 each embryo was determined via Zfy. Xist values were normalized against actin and are

826 shown relative to WT/WT control. Error bars indicate SEM.

827

828 Figure 3 Rlim is required for X-silencing in females during blastocyst stages. Female

Δ Δ 829 expression data collected from RlimWT/WT or Rlim / were compared with those of male

830 (pooled KO and WT) embryos (F/M). Embryonic stages are indicated, troph =

831 trophoblasts. A) Developmental profile of X-silencing during iXCI in vivo as determined

832 by comparing mean female/male (F/M) expression ratios of X-linked transcripts (minus

833 Xist; in Fragments per kilobase of exon per million reads mapped (FPKM)). Error bars

834 indicate SEM. Significant P values P<0.01 are indicated (Student’s t-test). B) Heat map

835 representing Log2 transformed data comparing global F/M mRNA expression level ratios

836 from chromosomes (excluding the Y) of WT and KO embryos. Chromosomes

837 corresponding to gene expression are indicated. C) Gene silencing during iXCI occurs

838 within most regions on the X chromosome. Log2 F/M ratios of 351 X-linked genes at the

839 8-cell stage, E3 and E4.5 in WT and RlimKO are shown (values within 4.5 and -2).

840 Horizontal dotted lines indicate Log2 values of 1. The mouse X chromosome is shown

841 below. Arrowheads indicate locations of the most centromeric (Nudt11) and most

842 telomeric (Med1) genes included in this analysis. Expression and location of Xist is

843 indicated. Expression of genes within a region indicated by vertical black lines is silenced

844 late at blastocyst stages during iXCI.

845

846 Figure 3 - figure supplement 1 A, B) Random downsizing each library to 200.000 reads

847 does not significantly change/affect results obtained by RNA-seq. Representative results

848 (n=3) obtained from the WT/RlimKO dataset with each library randomly adjusted to

849 200k reads. F/M profile of X-linked gene expression (A). Heat map F/M of Log2

850 transformed data (B). Error bars indicate SEM. C, D) Expression ratio distributions of

Δ Δ 851 755 X-linked genes in WT/WT and Rlim / females. 755 X-linked genes with cpms >1 in

Δ Δ 852 at least 3 samples of 8-cell, E3.0 and E4.5 stages of WT/WT and Rlim / female embryos

853 were selected, normalized to autosomal gene expression prior to calculating the Log2

854 fold-changes of E3 versus 8-cell (C) and E4.5 versus 8-cell stages (D).

855

856 Figure 3 - figure supplement 2 Comparison of X dosage compensation using F/M or

857 allelic approach. Analyses of whole embryo RNA-seq data of B6/cast heterozygous

858 embryos in B,C were carried out on 3 male and 3 female embryos at E3.5. A) Parental

859 genotypes, all WT for Rlim, used for generating embryos with B6/B6 congenic genetic

860 background and B6/CAST heterozygous genetic background. B) Similar F/M values for

861 B6/B6 and B6/CAST at E3.5. B6/B6 values (blue) were taken from Fig. 3A. F/M values

862 for B6/cast animals were calculated as those described in Fig. 3A. C) Analysis of allelic

863 expression of X linked transcripts in B6/CAST heterozygous females. Note that in female

864 embryos transcripts originating from Xp are silenced to about 50% when compared to the

865 Xm.

866

867 Figure 4 Embryonically expressed RLIM is required for iXCI in female mice. The cKO

868 of Rlim in female embryos was targeted via a paternally transmitted Rosa26-Cre (R26C)

869 transgene. A, B) Schematic diagram of born pups generated via indicated mating

870 schemes. Parental genotypes with respect to Rlim and R26C are shown. For each mating,

871 the total number (n) of F1 offspring is indicated. Numbers of female and male pups and

872 their genotypes with respect to Rlim are indicated. The Rlim cKOm allele in pups is

873 indicated in red. Percentages of cKOm to fl distribution in female or male pups are shown

874 below. Note no female offspring with an R26C-induced cKO of the maternal Rlim allele.

875 C) Robust deletion in E3.5 embryos via a paternally transmitted R26C transgene.

876 Parental genotypes and genotypes of embryonal littermates are indicated. A slightly

877 slower migrating band in PCRs using primers that for the Y-linked gene Zfy is

878 unspecific. Note that the maternally transmitted floxed allele is no longer detectable in

879 Cre-positive embryos. Positive control (P); negative control (N). The last two bands in

880 Zfy (P; N) originate from the same gel but have been inverted to reflect the general

881 loading pattern. D, E) Inhibition of Xist clouds and X-silencing in trophoblasts of E4

882 female blastocyst outgrowths with an R26-Cre induced deletion of maternally transmitted

883 Rlim. RNA-FISH experiments on representative R26C-Rlim cKOm female embryos using

884 Xist (green) and Rlim (red) probes. Note lack of Xist clouds in cKO/Δ trophoblasts (D)

885 accompanied by X-silencing defects in most trophoblast cells as indicated by side-by-side

886 Rlim and Xist transcription foci (E). Inner cell mass, ICM; trophoblasts, troph.

887

888 Figure 5 Xist is crucial for X dosage compensation throughout preimplantation

Δ 889 development. All embryos were generated by crossing WT/WT females with Xist /Y

890 males. A) Gender determination of embryos via Y-linked gene expression. As example,

891 the distributions of reads at the 8-cell stage of Y-linked genes are shown in a box-plot. B)

892 Heat map representing Log2 transformed data comparing the mRNA expression level

893 ratios from chromosomes (excluding Y) between female and male embryos during

894 pre/peri-implantation development. Chromosomes are indicated. C) Developmental

Δ 895 profile of X-silencing during iXCI in XistWT/ p females as determined by comparing F/M

896 expression of X-linked transcripts. Data were processed as described for those obtained

897 for the WT/RlimKO dataset which were incorporated for comparison as dotted lines (see

Δ Δ Δ 898 Fig. 3A). D) Comparison of F/M values for XistWT/ p and Rlim / with those obtained for

899 WT/WT (set to 1). P values of P<0.05 are indicated (paired t-test).

900

901 Figure 5 – figure supplement 1 Details of RNA-seq analyses of single embryos lacking

902 Xist at pre/peri-implantation stages. A) Parental genotypes used for generating female

903 embryos carrying a paternal germline KO of Xist. B) Embryonic lethality of female

Δ 904 XistWT/ p embryos. Shown are genotypes of born pups from a total of 13 litters. C)

905 Genotypes, embryonic stages, and sample numbers of embryos used for whole embryo

906 RNA-seq.

907

908 Figure 6 Dynamics of X-linked gene expression in preimplantation embryos. A) X/A

909 expression profile in males. Male data were collected from males of RlimKO/WT and

910 XistKO datasets. For each embryo, the total FPKM expression of X-linked genes was

911 divided by the total FPKM expression of autosomal genes. Shown is the average X/A

912 values for each developmental stage. The increase of 1.58-fold in X/A values from the 4-

913 cell stage to E4.5 is highly significant (P<10-11; Student’s t-test). B) Comparison of gene

914 expression profiles from chromosomes 1 to 19 and X during male pre/peri-implantation

915 development. Data were collected from male embryos of both datasets. At each

916 developmental stage the total FPKM expressed from each chromosome was divided by

917 the total FPKM expression of all autosomal genes. Values obtained for each chromosome

918 at the 4-cell stage are set to 1. C) Dynamics of the relative gene expression expressed

919 from single chromosomes in male embryos. The total FPKM/total number of annotated

920 genes of each chromosome was divided by the total FPKM of all autosomal genes/total

921 number of autosomal genes. Male data were collected from all males of both datasets.

922 Note that expression from the X is markedly lower at early stages (around x0.5),

923 increasing to x0.77 to that of the average autosome (1.0; dotted line) by E4.5. D) Female

924 and male X/A expression profiles normalized to annotated genes. The total FPKM/total

925 number of annotated genes on the X was divided by the total FPKM of all autosomal

926 genes/total number of annotated autosomal genes. Female genotypes are indicated. E)

Δ Δ Δ 927 The E4.5/4-cell stage ratios of X/A values are shown for WT/WT, XistWT/ and Rlim /

928 females as well as males. P values (Student’s t-test) are indicated; n.s. = not significant.

929 F) Comparison of X/A values according to gender: F/M ratios of X/A values at the 4-cell

Δ Δ Δ 930 and E4.5 stages are shown for WT/WT, XistWT/ and Rlim / . Error bars indicate SEM.

931

932 Figure 6 – figure supplement 1 X/A profile in male mouse embryos comparing data

933 obtained by single embryo RNA-seq (see Fig. 6A) with data obtained by single-cell

934 RNA-seq (Deng et al., 2014). Total FPKM of X-linked genes were divided by total

935 autosomal FPKM. For the Deng et al. dataset, to ensure male gender only cells with high

936 total Y-linked gene expression >5 FPKM (late 2-cell and 4-cell stages) and >50 (8-cell to

937 E4.5) were considered. Early, mid and late blastocyst stages (Deng et al., 2014) were

938 incorporated at E3.25, E3.75 and E4.25, respectively. Note the similar upregulation of X-

939 linked genes in both datasets.

940

941 Supplementary file 1 RlimKO/WT dataset: List of FPKM for all embryos at all stages

942 (4-cell, 8-cell, E2.5, E3, E3.5, E4, E4.5 and troph)

943

944 Supplementary file 2 XistKO dataset: List of FPKM for all embryos at all stages (4-cell,

945 8-cell, E2.5, E3, E3.5, E4, E4.5 and troph)

946

Wang et al., Fig. 1

A RLIM C E 150 RlimWT/WT

100 4-cell Rlim∆/∆

50 RlimWT/WT

Y-linked genes (cpm) Y-linked 0 8-cell Rlim: WT KO WT KO Rlim∆/∆ Male Female WT/WT D RlimWT/WT Rlim 5000

4000 E2.5 Rlim∆/∆ 3000

Xist (cpm) 2000 RlimWT/WT 1000 E3 0 Rlim∆/∆ Rlim: WT KO WT KO Male Female WT/WT B RLIM F Rlim

Pou5f1 ♂+♀ E3.5 ∆/∆ Nanog ♂+♀ Rlim WT Krt8 ♂+♀ Rlim ♀ WT/WT 3 Rlim E4 Rlim∆/∆

2 RlimWT/WT cKO/ ∆ -SC E4.5 Rlim Rlim∆/∆

1 RlimWT/WT relative expression (normalized to E3.5) troph Rlim∆/∆ 0

E3 E4 Rlim 4-cell 8-cell E2.5 E3.5 E4.5 troph floxed Wang et al., Fig. 2

A B E2.5 C E3.5 ♀ 6000 WT ♂ ♀ Rlim KO ♂

4000 RlimWT/WT

RlimWT/WT Xist / Rlim DAPI

2000 expression of Xist (cpm)

p<0.001 Rlim∆/∆ -8 p<10 p<0.0001

p<0.001 Xist / DAPI 0

E3 E4 4-cell 8-cell E2.5 E3.5 E4.5 troph Rlim∆/∆

D Xist / DAPI embryonic stage E2.5 E3.5

genotype WT Rlim KO WT Rlim KO total 5 18 6 12 embryos

# embryos with Rlim / DAPI 4 7 3 4 Xist clouds Rlim∆/∆

# of cells with Xist clouds most/all* most/all* few (1-3) variable (1-most) Xist / Rlim DAPI Xist / Rlim DAPI * except mitotic cells Wang et al., Fig. 3

A RlimWT/WT C Xist ∆ ∆ Rlim / p<0.03 4

2 n (F/M) 2.0 -8 0

i o p<10 WT 8-ce ll s p<0.01 -2 re s 4 ex p

n e 1.5

g e 0 WT E 3 d e

k -2

4 X-li n 5

1.0 . 2 l l .5 3 .5 4 .5 2 E 3 E 4 0 -cel -cel oph WT E 4 4 8 E E E tr -2 B RlimWT/WT Rlim∆/∆ 4

2 4-cell8-cellE 2.5E 3.0E 3.5E 4.0E 4.5troph 4-cell8-cellE 2.5E 3.0E 3.5E 4.0E 4.5troph 1 0 KO 8-ce ll

2 -2 3 4 4 2 5 6

KO E 3 0 7 -2 8 9 4 5 10 . 2 ratio

2 11 0

12 KO E 4 Log 13 1.40 14 -2 0.93 15 Nudt11 Xist Med1 0.47 16 0.00 17 -0.47 -0.93 18 -1.40 19 qA5 qC1 qC3 qE1 qE3 qF2 qF4 X qA1.1 qA1.3 qA3.1qA3.3 qA7.1qA7.3 Wang et al., Fig. 4

A B C D E ♀ Rlim: fl/fl ♀ Rlim: fl/fl fl/fl x cKO/Y-R26C Xist/DAPI Xist/RLIM/DAPI troph X X E3.5 littermates troph 1 2 3 4 5 P N Rlim: WT/Y Rlim: cKO/Y ♂Rosa26-Cre: R26C/WT ♂ Rosa26-Cre: R26C/WT fl F1: n=67 F1: n=152 ICM ♀ ♂ ♀ ♂

50 100 fl /∆ ∆ m p flm/ p 40 80

s s KO

p p 32 u u troph p p 30 60 f f o o

# # Cre 20 40 troph ICM 10 20 Zfy 25 22 10 55 65

fl /WT fl/Y fl /∆ fl/Y p p p m m p /∆ /∆ /∆ fl/Y cKO /WT cKO /Y cKO /∆ cKO /Y m fl m fl m m m m p m cKO/Y cKO /∆ -R26C cKO /∆ -R26C (%) 0/100 (%) 48/52 (%) 0/100 (%) 33/67 cKO m p m p Wang et al., Fig. 5

A C XistWT/∆p Rlim∆/∆ RlimKO/WT dataset 150 WT/WT

n (F/M) 2.0 100 i o s re s genes (cpm)

50 ex p

1.5 n e -linked Y g e d

0 e k XistWT/Y XistWT/∆p

Male Female X-li n 1.0

WT/∆p l l B Xist .5 3 5 4 5 E . E . -cel -cel 2 3 4 oph 4 8 E E E tr

4-cell8-cellE 2.5E 3.0E 3.5E 4.0E 4.5troph 1 D XistWT/∆p 2 Rlim∆/∆ 3 WT/WT 4 2.0 p<10-9 5

6 P<0.03 7 P<0.0002 P<0.003 p<10-8

8 1.5 P<0.02 9 10 P<0.01 (normalized to WT/WT)

ratio 11 o 2 i 12 1.0 ra t

Log 13 1.70 14 1.13 15 F/M 0.57 16 0.00 17 0.5 -0.57 18 l l -1.13 19 .5 3 .5 4 .5 2 E 3 E 4 oph -1.70 X 4-cel 8-cel E E E tr Wang et al., Fig. 6

A B 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 X C chr males 1.6 0.040 1.5 1.5

stage ) 1.4

l l e

c 1.3

0.035 - 4

y annotated genes )

b 1.2 1.0 y

ze d

i 1.1 l ratio

x 1.58 ze d

a i 0.030 -11 l

P<10 a m A

/ 1.0 m X no r (

0.9 no r ( o

i 0.5 t o i

0.8 t 0.025 r a

r a

/ 0.7 A r / h r c h

0.6 c

0.020 0.5 0.0 l l .5 3 .5 4 .5 l l l l 2 E 3 E 4 .5 3 .5 4 .5 .5 3 .5 4 .5 -cel -cel oph 2 E 3 E 4 2 E 3 E 4 4 8 E E E tr -cel -cel -cel -cel 4 8 E E E 4 8 E E E

D E X/A ratios 2.0 WT/WT genotype E4.5/4-cell (P) Rlim∆/∆ ∆ ♀ 0.95 (n.s.) XistWT/ p -5 males 1.58 (<10 ) 1.75 (<10-8) 1.5 1.58 (<10-11)

F X/A ratios (F/M) 1.0 genotype 4-cell E4.5 (normalized by annotated genes)

1.80 1.07 o i 1.87 1.83 ra t 1.58 1.81

X/ A 0.5

l l .5 3 .5 4 .5 2 E 3 E 4 -cel -cel 4 8 E E E