Oligonucleotide Microarray Analysis of Chromosome-X Gene Expression in Ruman Epithelial Ovarian Cancer Cell Lines

By Marie-Helene Benoit

Department of Human Genetics McGili University December 2004

A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements of the degree of Master of Science

395 Wellington Street 395, rue Wellington Ottawa ON K1A ON4 Ottawa ON K1A ON4 Canada Canada

Your file Votre référence ISBN: 0-494-12400-8 Our file Notre référence ISBN: 0-494-12400-8

NOTICE: AVIS: The author has granted a non L'auteur a accordé une licence non exclusive exclusive license allowing Library permettant à la Bibliothèque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l'Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans loan, distribute and sell th es es le monde, à des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, électronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriété du droit d'auteur ownership and moral rights in et des droits moraux qui protège cette thèse. this thesis. Neither the thesis Ni la thèse ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent être imprimés ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.

ln compliance with the Canadian Conformément à la loi canadienne Privacy Act some supporting sur la protection de la vie privée, forms may have been removed quelques formulaires secondaires from this thesis. ont été enlevés de cette thèse.

While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. ••• Canada ABSTRACT

Microarray expression analysis was applied as an approach for identifying cancer related genes on chromosome-X (CHR-X) in epithelial ovarian cancer (EOC). The Hu6800 and U133A GeneChips® were used to evaluate the expression of 446 CHR-X genes in an in vitro EOC model system comprising 4 EOC cell lines and 12 primary cultures of normal ovary surface epithelia. Fifty-one new candidate CHR-X genes were identified in addition to 49 genes previously implicated in cancer. Many genes map to regions with frequent genetic aberrations in EOC tumours, or interact with the known EOC tumour suppressors BRCA 1 and BRCA2. Candidate genes described in this study may provide novel markers for histopathological subtypes, or the tumourigenic potential of EOC tumours. The X-inactive-specific-transcript (X/ST) was absent in two highly tumourigenic EOC ceillines, TOV21G and TOV112D. X/ST mRNA is important for the stability of X-chromosome-inactivation (XCI), as its absence destabilizes the silencing of genes on the inactive-X. Aberrant bi-allelic expression of FHL 1, a gene subjected to XCI was detected in the cell line TOV21G but not in the cell line TOV112D. Genotyping assays using polymorphie microsattelite markers suggested that TOV21G has retained heterozygosity of CHR-X. The majority of alleles tested for TOV112D were consistent with loss of heterozygosity of CHR-X. Taken together these findings are consistent with two proposed mechanisms mediating X/ST loss-of-expression in cancer: (1) Duplication of the active-X followed by loss of the inactive-X (TOV112D); or (2) Reactivation of the previously inactive-X (TOV21 G). RESUMÉ

Dans le but d'identifier des gènes localisés sur le chromosome-X (CHR-X) associés au cancer de l'ovaire d'origine épithéliale (COE), la technologie des biopuces à ADN (GeneChip® de la compagnie Affymetrix®) a été utilisée comme approche pour étudier l'expression génique de ce chromosome. Les biopuces Hu6800 et U133A ont permis d'évaluer l'expression de 446 gènes, situés sur le CHR-X, dans un système modèle du COE in vitro. Le système modèle comprenait quatre lignées cellulaires COE malignes et douze cultures de cellules normales dérivées d'épithélium de la surface de l'ovaire. Cette étude a identifié 51 nouveau gènes candidats probablement impliqués, soit directement ou indirectement, dans la tumorigènese du COE, en plus d'avoir identifié 49 gènes dont le rôle dans le cancer a déjà été décrit. Plusieurs candidats se situent dans une région chromosomique ou l'on retrouve fréquemment des lésions génétiques dans les tumeurs COE. D'autres candidats codent pour des protéines dont l'interaction avec les gènes suppresseurs de tumeur BRCA 1 et BRCA2 sont bien connus. Les gènes candidats identifiés dans cette étude représentent de plausible bio-indicateurs d'histopathologie et/ou du pouvoir tumorigène des tumeurs COE. L'expression génique du X-inactive-specific-transcript (X/Sn, dont la fonction est clé pour l'inactivation du CHR-X (ICX), étais absente dans deux des lignées cellulaires COE phénotypiquement tumorigènes, soit TOV21 G et TOV112D. Suivant l'établissement de l'ICX, la copie du CHR-X qui a été inactivé demeure pour toujours revêtue d'une fine couche d'ARN X/ST. Ainsi, dans des cellules somatiques la perte du X/ST mène à la déstablilisation de l'état réprimé du CHR-X inactif. Une anomalie, apparemment associée à l'absence du X/ST, a été observée dans l'expression du gène FHL 1 normalement assujetti à l'ICX. L'expression bi-allélique du FHL1 a été détectée dans la lignée TOV21G mais pas dans la lignée TOV112D. L'analyse du génotype, utilisant des indicateurs microsatellites, a établis que TOV21G a retenu l'hétérozygosité du CHR-X. La majorité des allèles dépistés pour TOV112D ont été consistantes avec la perte de l'hétérozygosité. Ces résultats sont dans les normes des deux mécanismes proposés régissant la perte d'expression du gène X/ST dans les cellules tumorales: (1) Dédoublement du CHR-X actif suivi de la perte du CHR-X inactive (TOV112D); ou bien (2) Réactivation du CHR-X inactivé (TOV21 G).

11 ACKNOWLEDGEMENTS

This research was funded by the NSERC PGSA scholarship and operating funds from the Canadian Institute for Health Research (CIHR) and Fonds de Recherche en Santé du Québec (Réseau Cancer du Sein et de l'Ovaire). 1 would like to acknowledge Dr Anne-Marie Mes-Masson and the members of her laboratory for ail their work in the collection of clinical materials and the maintenance of tissue cultures. 1 thank Dr Jose Correa for his advice on statistical analyses. 1 am very grateful to the former and current members of my group; Dr Nadège Presneau, Dr Zhen Chen, Dr Emily Manderson, Suzanna Arcand, Kathleen Klein, Neal Cody, and Anna Breznan for their encouragement, helpful suggestions, and numerous thought-provoking discussions. 1 thank my supervisory Committee Dr Mario Chevrette and Dr Tom Hudson for their academic guidance and the many insightful ideas they contributed. 1am very grateful for the interest they showed in my project. 1would also like to acknowledge the members of my family as weil as my dear friends Henry Cheang, Peter Dutchak, Sandra Laberge, Janna Gowens, Samuel Truyens, Nick Brandon, and Lazlo Benak for their extensive support and encouragement over the last three years.

Above ail, 1 sincerely thank my supervisor Dr Patricia Tonin for the intellectual guidance, understanding, encouragement, and support she gave throughout the challenges and successes encountered in the completion of this degree. 1 am incredibly grateful to Patricia for the patience and understanding she showed, in addition to the editorial help, during the preparation of this manuscript.

111 TABLE OF CONTENTS

Abstract ......

Resumé ...... 11

Acknowledgements ...... 111

Table of Contents ...... IV

List of Tables...... Vll

List of Figures...... V111

List of Abbreviations...... IX

1. INTRODUCTION

1.1 Research objectives...... 1

1.2 Ovarian cancer: Clinical characteristics and biology ...... 1

1.3 Why study the x-chromosome? ...... 2

1.4 Identification of cancer-related genes: Current strategies and new approaches...... 4

1.5 The biology of Chromosome-X inactivation...... 5

1.6 Analysis of chromosome-X gene expression in an in vitro OC Model System ...... 6

2. MATERIALS AND METHODS

2.1 Description of clinical materials...... 8

2.2 Establishment of primary cultures and cel! lines ...... 8

2.3 Extraction of nucleic acids ...... 9

2.4 Affymetrix® oligonucleotide microarray experiments...... Il

2.4.1 Description of Affymetrix® GeneChips ...... 11

2.4.2 Microarray hybridization and scanning...... Il

IV 2.4.3 Microarray data set normalization ...... 12

2.4.4 Chromosome-X data subset generation ...... 12

2.4.5 Microarray data analysis...... 12

2.5 PCR-based studies ...... 14

2.5.1 RT-PCR analysis ...... 14

2.5.2 Allele-specific transcript detection assay ...... 15

2.5.3 Chromosome-X allelotyping studies...... 17

3. RESULTS

3.1 Representation of Chromosome-X genes on the Affymetrix GeneChips®...... 19

3.2 Chromosome-X gene expression profiles in NOSE primary cultures...... 19

3.3 Patterns of global Chromosome-X gene expression in four EOC cell lines ...... 23

3.4 Differentially expressed Chromosome-X genes identified in the EOC ceillines ...... 28

3.5 Investigation of differentially expressed Chromosome-X genes ...... 29

3.5.1 Investigation of GeneChip® probe set designs...... 29

3.5.2 Expression profiles of select genes in additional AffymetriX® data sets...... 30

3.5.3 RT-PCR analysis of selected candidate genes ...... 32

3.5.4 Localization of candidate genes on Chromosome-X relative to regions of interest in OC...... 35

3.6 Molecular signature of Chromosome-X in highly tumourgenic EOC ceillines...... 36

4. DISCUSSION

4.1 Chromosome-X transcriptome of the in vitro OC model system ...... 40

4.2 Differentiai expressed chromosome-X genes associated with OC or the tumourgenic potential of OC...... 43

4.3 Investigation of candidate Chromosome-X genes ...... 45

v 4.4 Molecular signature of chromosome-X gene expression in highly tumourgenic EOC cell lines ...... 46

4.5 Unique mechanism affecting chromosome-X genes in tumourgenesis ...... 49

4.6 Strengths and limitations of this study ...... 50

4.7 Future directions and further studies ...... 52

SUMMARY AND CONCLUSION...... 54

ONLINE RESOURCES...... 56

LlTERATURE CITED ...... 57

Appendix 1. Selected probe sets from Affymetrix GeneChips® with poor designs ..... 68

Appendix II. Correlation coefficient analysis of chromosomes 1 to 22...... 69

Appendix III. Selection of genes for the study of allele-specific gene expression in the EOC cell lines...... 70

Appendix IV. Ethics approval certificate ...... 71

Appendix V. Permit for use of radioisotopes ...... 72

VI LIST OF TABLES

Table 1. In vitro model of ovarian cancer...... 7

Table 2. Biological characteristics of epithelial ovarian cancer ceillines ...... 7

Table 3. Description of DNA samples used in the study ...... 9

Table 4. Description of RNA samples used in the study...... 10

Table 5. Primers for experiments A. RT -PCR studies...... 15 B. Chromosome-X allelotyping studies ...... 16 C. Allele-specific transcript detection assay...... 18

Table 6. Chromosome-X representation of Affymetrix® GeneChips...... 19

Table 7. Variably expressed Chromosome-X genes A. Represented on the Hu6800 GeneChip®...... 22 B. Represented on the HG-U133A GeneChip® ...... 23

Table 8. Correlation coefficient analysis of Chromosome-X gene expression A. 205 probe sets represented on the Hu6800 GeneChip®...... 24 B. 612 probe sets represented on the HG-U 133A GeneChip® ...... 25 Table 9. Global patterns of Chromosome-X gene expression in the EOC cell linel 27

Table 10. Differentially expressed Chromosome-X genes represented on the Hu6800 GeneChip®...... 28

Table 11. Differentially expressed Chromosome-X genes represented on the 28 HG-U 133A GeneChip® ......

Table 12. Allelotype analysis of the Chromosome-X content in the EOC ceillines.... 37

Table 13. Allele-specific detection of Chromosome-X gene transcripts...... 37

Table 14A. Description of over-expressed Chromosome-X genes...... 45

Table 14B. Description of under-expressed Chromosome-X genes ...... 45

vu LIST OF FIGURES

Figure 1. Distribution of Affymetrix® GeneChip probe sets relative to cytological bands on the X-chromosome ...... 20

Figure 2. Hierarchical clustering of global CHR-X gene expression profiles in the EOC cell lines and NOSE samples C. 205 probe sets represented on the Hu6800 GeneChip®...... 25 D. 612 probe sets represented on the HG-U133A GeneChip® ...... 26

Figure 3. Global patterns of Chromosome-X gene expression in the EOC cell lines. 27

Figure 4. Expression profiles of differentially expressed genes in borderline and malignant EOC tumours ...... 30

Figure 5. Investigation of differentially expressed genes in a published microarray data set for NCIC60 ovarian cancer-derived cell lines...... 31

Figure 6. RT-PCR analysis of differentially expressed Chromosome-X genes ...... 32

Figure 7. RT-PCR Analysis of X/ST expression in four EOC ceillines ...... 34

Figure 8. Schematic diagram depicting the positions of differentially expressed genes along Chromosome-X...... 35

Figure 9. Schematic representation of the allele-specific detection assay...... 38

Figure 10. Allele-specific expression of Chromosome-X genes in the EOC ceillines... 39

Figure 11. Mechanisms altering the dosages of cancer-related genes subjected to X-chromosome inactivation (XCi)...... 50

Vl11 List of Abbreviations

cDNA Coplementary DNA cSNP Coding Single Nucleotide Polymorphism

CHR-X Chromosome-X

E Escapes XCI

EOC Epithelial Ovarian Cancer gDNA Genomic DNA

HTG Heterogeneous XCI

HMZ Homozygous

HTZ Heterozygous

MAX HTZ Maximum Heterozygosity

ND No Data

NOSE Normal ovarian surface epithelium

OC Ovarian cancer

SNP Single Nucleotide Polymorphism

S Subjected to XCI

Temp Temperature

X-CHR X-Chromosome

XCI X-Chromosome Inactivation

Xa Active chromosome-X

Xi Inactive chromosome-X

Xma X-CHR maternai

Xpa X-CHR paternal

IX INTRODUCTION

1.1 Research objectives

This study addresses the role of chromosome-X (CHR-X) gene expression in epithelial ovarian cancer (EOC). Large-scale oligonucleotide microarray expression analysis (Affymetrix®) was applied as an approach for identifying candidate X-linked genes implicated in ovarian tumourgenesis. Differentially expressed genes described here may provide new markers for early diagnosis, indicators of the tumourgenic potential of EOC tumours, and/or novel therapeutic targets for the treatment of EOC.

1.2 Ovarian cancer: Clinical characteristics and biology ln Canada, an estimated 2,300 women will be diagnosed with ovarian cancer (OC) in 2004. Approximately 1,550 women will die from the disease, accounting for five percent of deaths due to cancer (Canadian Cancer Statistics, National Cancer Institute of Canada, 2004). Ovarian carcinomas are the most lethal gynaecologic malignancy. Over seventy percent of cases are diagnosed at stages III or IV because patients are rarely symptomatic. The chance of survival with advanced stages of the disease is less than twenty percent. Survival increases dramatically (80-90%) when the diagnosis is made early [Auersperg et al., 2001]. Advances in treatment and early detection methods are key to decreasing the morbidity and mortality from ovarian cancer.

Evidence suggests that most ovarian tumours arise from the surface epithelium of the ovary or epithelial cells that line inclusion cysts [Auersperg et al., 2001]. OC is classified according to the potential for malignancy (benign, borderline, or malignant), as weil as stage, grade, and histopathology. The stage considers the extent of the disease and spread to other sites, whereas the grade indicates the degree of differentiation of tumours. A grade from I-IV is given, reflecting the extent of deviation from benign counterparts; grade 1 represent a tumour with minimal deviation while a grade IV tumour is poorly differentiated and highly malignant. Histopathological subtypes are designated in accordance to characteristics shared with epithelia derived from Mullerian ducts, such as the oviduct, endometrium, and endocervix. Five subtypes of epithelial ovarian

1 carcinomas are currently recognized: mucinous carcinomas (endocervical-like), serous carcinomas (fallopian tube-like), endometrioid carcinomas (endometrium-like), clear cell carcinomas (mesonephros-like), and undifferentiated tumours.

1.3 Why study the X-Chromosome?

Several lines of evidence support a role for CHR-X in ovarian tumourgenesis. Pathologists in the early 1950's reported frequent losses of Barr bodies in female cancers. Various associations were established between Barr body counts and several clinical parameters including angiogenesis, prognosis, and survival [Borah et al., 1980; Ghosh and Shah, 1981; Ghosh et aL, 1979; Ghosh et aL, 1983; Rajeswari et aL, 1977]. Chromosome transfer experiments carried out in the early 1990's provide the first evidence supporting the existence of X-linked tumour suppressor genes (TSG). The studies found that transferring the CHR-X into a nickel-transformed Chinese-hamster ovary cel! line harbouring a deletion of this chromosome, rendered the otherwise immortal cells senescent [Klein et al., 1991; Wang et al., 1992]. Hereditary disorders implicate CHR-X genes in cancer susceptibility, as weil as in ovarian development and/or maintenance. Dyskeratosis Congenita, a rare X-linked syndrome caused by defects in the gene DKC1, predisposes individuals to cancers of epithelial origin [Jacobs et aL, 1984]. Men with XXV genotypes (Klinefelter's) are more predisposed to developing breast cancer [Hultborn et al., 1997]. Abnormal ovarian development is characteristic of the Turner phenotype, a syndrome that results from monosomy of the X-CHR [Turner et aL, 1963; Jones et aL, 1966]. An association between Turner's syndrome and certain cancers has been described [Kratzert-Adams et al., 1992; Matsui et al., 1997]. X-linked genes have also been involved in premature ovarian failure [Simpson and Rajkovic, 1999; Zinn, 2001] and several other cancers including non Hodgkin's Iymphoma [McDonald et aL, 2000], leukemias [Klein, 1981; Furuya et aL, 1989] and hereditary prostate cancer [Xu et aL, 1998; Kim et aL, 2003].

Cytogenetic analyses and molecular genetic mapping studies have established a high frequency of structural and numerical CHR-X anomalies in ovarian carcinomas. Recurrent losses from both the large (Xq) and small (Xp) arms of CHR-X have been reported. Loss-of-heterozygosity (LOH) of the pseudoautosomal region Xp22.2-22.3 occurs frequently in OC, most often involving the active allele [Iwabuchi et al., 1995].

2 This region is also deleted in breast cancers and gastrinomas [Choi et aL, 1998; Chen et aL, 2004]. LOH of Xp22 has been implicated with Cisplatin resistance in ovarian tumours. Loss of this region has also been associated with a negative hormone receptor status in breast cancer [Wasenius et aL, 1997]. These studies suggest that a TSG, which is not subjected to X-inactivation, is localized within the Xp22 interval. The putative TSG may also be important in BRCA 1-mediated tumourgenesis since LOH of this interval was observed twice as frequently in tumours from women harboring a BRCA1 mutation [Buekers et aL, 2000].

LOH of Xq25-q26 was found to be correlated with a higher nuclear grade in advanced ovarian carcinomas [Cheng et aL, 1996; Piao and Malkhosyan, 2002]. In infiltrating ductal breast carcinomas, the deletion of Xq25 was also associated with a higher grade, as weil as a larger tumour size and auxiliary Iymph-node metastases [Piao and Malkhosyan, 2002]. Deletions occurred preferentially from the inactive allele in these tumours. The findings of these studies are consistent with a putative TSG that escapes X-inactivation mapping within the Xp25 interval. Allelotyping analyses implicated CHR-X in the progression of gastroenteropancreatic (GEP) endocrine tumours towards a more aggressive phenotype. Extensive allelic deletion of this chromosome was detected in malignant forms of GEP tumours (metastasizing type III carcinoids & carcinomas) and

not in the benign forms (type 1 carcinoids) [D'Adda et aL, 1999; Pizzi et aL, 2002]. High frequencies of CHR-X loss (60%) were associated with the malignant evolution of pancreatic endocrine tumours [Pizzi et aL, 2002]. In papillary renal cell carcinomas Xp loss predicts a poor prognosis with a short patient survival time [Jiang et aL, 1998]. Allelic imbalance of Xp11.2, Xq11.2-q12, and Xq22 has also been reported in ovarian tumours [Cheng et aL, 1996; Edelson et aL, 1998; Iwabuchi et aL, 1995; Osborne and Leech, 1994; Yang-Feng et aL, 1992; Yang-Feng et aL, 1993].

The interpretation of these results is complicated by the phenomenon of X-chromosome inactivation (XCI), as losses may involve the active (Xa) or inactive (Xi) homologue. Most studies do not address whether the active or inactive allele is retained. Further compounding this difficulty are X-linked genes that escape X-inactivation (-17%), as weil as the increasing numbers of genes (5-10%) exhibiting heterogeneous XCI - subjected in some female cells and escaping in others - (Carrel et al. 2003, ASHG conference

3 abstract). These challenges have greatly slowed the identification of X-linked genes in ovarian cancer using the traditional molecular genetic approach.

1.4 Identification of cancer-related genes: Current strategies and newapproaches

Historically, a molecular genetic approach has been used to identify genes implicated in cancer. This technique was pioneered in the 1980'5 when the Retinoblastoma (RB1) TSG was discovered through the characterization of recurrent deletions of chromosome 13 (13q14) in retinoblastoma tumours [Fukushima et al., 1987; Motegi et al., 1983]. The MYC oncogene implicated in Burkitt's Iymphoma, was similarly localized from the breakpoints of translocations involving CHR 8 and chromosomes 2, 14, or 22 [Klein, 1981]. In both cases the disruption of normal gene expression resulted directly from a genetic aberration. The genetic approach has proven to be very useful and has become the standard for the discovery of cancer-associated genes.

It has become evident that epigenetic mechanisms also play an integral role in neoplasia. Tumour cells are marked by increased DNA-methyltransferase activity, regional hypermethylation, and overall genomic hypomethylation. Altered DNA methylation is now thought to occur early in tumourgenesis and is likely to play an important role in tumour formation. Known TSG such as p15, p16, RB, ER, and VHL, are down regulated in certain cancers by methylation of their CpG islands. In the context of ovarian cancer, there is now compelling evidence for the role of aberrant methylation in tumour genesis and/or progression [Baylin et al., 1998; De Smet et al., 1999]. For example, hypermethylation of the putative X-linked TSG GPC3, resulting in 1055 of expression, has been implicated in the excessive growth of ovarian cancer cell lines [Lin et al., 1999]. O'Doherty and colleagues reported that in a significant proportion of OC's, CpG hypermethylation silenced the expression of the oestrogen receptor alpha gene [O'Doherty et al., 2002]. A recent study revealed that 28% of ovarian tumours showing BRCA 1 dysfunction were attributable to promoter hypermethylation [Geisler et al., 2002]. Furthermore, differential methylation hybridization array analysis showed CpG hypermethylation to be associated with OC progression and non-response to chemotherapy [Ahluwalia et al., 2001]. Demethylation of CpG islands can also result in over-expression of oncogenes that are normally silenced in adult somatic tissue by methylation. Over-expression of the

4 survivin and c-erbB-2 oncogenes is induced by high activity levels of the DNA demethylase MBD2 in ovarian tumours due to pramoter hypomethylation [Hattori et aL, 2001]. In view that the X-chromosome is inherently responsive to changes in DNA methylation, epigenetic mechanisms like aberrant demethylase/ methyltransferase activity may prove more important for CHR-X genes than for autosomal genes in tumourgenesis [Shapiro and Mohandas, 1983].

Using conventional molecular genetic mapping techniques for the identification of genes associated with CHR-X anomalies in ovarian tumours poses an interesting challenge because this chromosome is subject to inactivation. A different approach based on the large-scale analysis of gene expression would facilitate the identification of cancer-related genes on CHR-X. Microarray technology (Affymetrix®) is weil suited for the study of CHR-X genes in ovarian tumourgenesis as it can identify candidate X linked genes altered by epigenetic and/or genetic aberrations in ovarian tumours.

1.5 The biology of Chromosome-X inactivation

The biology of the X-chromosome distinguishes it fram the autosomes. Very early in the development of ail female mammals one of the two CHR-X homologues is randomly selected in each cell to undergo X-CHR-inactivation (XCI) [Lyon, 1986]. XCI achieves functional equivalency in the gene dosage between XX females and XY males. On average, half of ail cells inactivate the maternai CHR-X (Xma) while the other half inactivates the paternal CHR-X (X pa ), resulting in females that are mosaics for XCI. The inactivated CHR-X is stably inherited by daughter cells during successive cell divisions. Appraximately 70% of genes on CHR-X escape silencing and are expressed from both the active-X (Xa) and inactive-X (Xi) [Carrel et aL, 1999]. An additional five to ten percent of genes show heterogeneous inactivation and are expressed bi-allelically in some females and mono-allelically in other females [Carrel and Willard, 1999].

X-inactivation can be divided into four steps: (1) counting, (2) choice, (3) initiation, and (4) maintenance [Boum il and Lee, 2001]. A counting mechanism ensures that ail but one CHR-X copy undergoes inactivation in each cell. In murine cells, counting is accomplished by the expression of an anti-sense mRNA (TS/X) fram the future Xa to achieve transcriptional repression of the X/ST gene [Lee et al., 1999]. For humans, the

5 importance of TS/X in counting remains unclear [Shibata and Lee, 2004; Shibata and Lee, 2003]. Prior to XCI, an unstable form of X/ST mRNA is expressed at low levels from both CHR-X homologues. The initiation of XCI is marked by an upsurge in the expression of a stable X/ST transcript from the X-CHR chosen to be the future Xi [Ogawa and Lee, 2003]. X/ST accumulates in the cell and spreads along the chromosome, eventually forming a thick coat of mRNA. Methylation of the histone H3 lysine 9 (H3K9) occurs rapidly after the onset of XCI [Plath et al., 2003]. The conformation of the Xi begins to change as it becomes enriched for the chromatin associated protein macroH2A 1 [Chadwick and Willard, 2003; Chadwick and Willard, 2001; Lyon, 1999]. Hypoacetylation of histone 4 (H4), methylation of CpG islands, and condensation of the DNA into a heterochromatin-like structure follows [Lyon, 1999; Boumil and Lee, 2001]. These mechanisms collectively ensure the maintenance of XCI.

If a TSG were present on CHR-X, a higher incidence of cancer would be expected in males since they are hemizygous for this chromosome. As this is not observed, it raises the interesting possibility that X-linked TSG are specific to female tissues, such as the ovary. Putative oncogenes subjected to X-inactivation may become over-expressed if the inactive-X becomes reactivated (bi-allelic expression) in somatic tissues.

1.6 Analysis of Chromosome-X gene expression in an in vitro OC model system

Microarray technology (Affymetrix®) was applied as an approach for identifying CHR-X genes that are associated with ovarian tumourgenesis. Gene expression profiles were evaluated in an in vitro OC model system comprised of four spontaneously immortalized epithelial ovarian cancer (EOC) cell lines and twelve primary cultures of normal ovarian surface epithelial (NOSE) cells [Tonin et al., 2001]. The clonai nature of cell lines facilitates the study of X-inactivation because the same CHR-X homolog is inactive in ail cells. Accordingly, X-linked genes subjected to X-inactivation will be expressed exclusively from the same parental allele.

The EOC cell lines were derived from the malignant ovarian tumours (TOV81 D, TOV21G, and TOV112D) or malignant ovarian ascites (OV90) of patients diagnosed with advanced disease (Table 1) [Provencher et al., 2000]. The phenotypes exhibited by EOC ceillines in vitro mimic the clinical aggressiveness of the tumours from which they

6 were derived (Table 2). An earlier study using a prototype Affymetrix® array demonstrated that the biology of EOC cell lines is reflected in their global gene expression profiles [Tonin et al., 2001]. TOV81 0 corresponds to the most indolent form of ovarian cancer, while the most aggressive form of the disease is represented by OV90, TOV21G, and TOV112D. The EOC cell lines were derived from four histopathological subtypes of OC: a c1ear cell carcinoma (TOV21 G), undifferentiated adenocarcinoma (OV90), endometrioid carcinoma (TOV112D), and papillary serous adenocarcinoma (TOV81 0). Stratifying the EOC cell Iines by histopathology will facilitate the identification of CHR-X genes involved in molecular pathways associated with OC histopathological subtypes. Analysis of the EOC cell lines as a group will identify molecular changes associated with ovarian tumourgenesis, or related to the biological characteristics of ovarian carcinomas.

Table 1. ln Vitro Model of ovarian cancer

Name Origin Histology Grade Stage Survival NOVs NOSE Normal

TOV-21G Solid Clear cell 1-2 III tumour carcinoma TOV-81D Solid Papillary serous IIIC >9 years tumour adenocarcinoma 3 OV-90 Ascites Adenocarcinoma 3 IIiC 18 months

TOV-112D Sol id Endometrioid IIIC months tumour carcinoma 3 3

Table 2. Biological characteristics of four EOe ceillines

Doubling Relative . Nude Time of Ceilline time Saturation ~~~~~~~ mouse appearance Passages (days) density assay (4) (wks) TOV-21G 1.5 ++++ +++ 4 3-12 >70

TOV-81D 4-6 + o >50

OV-90 1.5 ++++ ++ 2 3-12 >80

TOV-112D 0.8 +++++++ ++++ 4 2-5 >90

7 MATERIALS AND METHODS

2.1 Description of clinical materials

Ovarian tissues and patient-matched peripheral blood lymphocytes were obtained fram participants, following informed consent, at the time of surgery. Clinical samples were collected from the McGili University Health Centre (Montreal General Hospital, Montreal, Canada) and fram the Centre Hospitalier de L'Université de Montréal, (Hôpital Notre Dame, Montreal, Canada). Histopathology was determined in accordance to criteria established by the International Federation of Gynecologists and Oncologists (FIGO). Tissues were snap-frazen and stored in liquid nitrogen. The cellular fraction of ascites fluid was collected by centrifugation following removal by paracentesis and stored at - 80°C in 90% fetal bovine serum (FBS), 10% buffered DMSO solution (50 ml DMSO,

3.03g Tris-base, 1.25g dextrose, 1.68g sodium citrate, H20 to 100 ml, pH 6.7).

2.2 Establishment of primary cultures and ceU lines

Primary cultures were established fram the NOSE cells of 12 independently ascertained ovaries (NOV31, NOV61 , NOV116D, NOV220D, NOV319, NOV436G, NOV504D, NOV653G, NOV821, NOV848D, NOV900, AND NOV910G) as described [Lounis et al., 1994]. The NOSE samples were derived from the ovaries of women with no prior history of ovarian cancer following praphylactic oophorectomy at the Centre Hospitalier de l'Université de Montréal (CHUM). Primary cultures were also established from borderline and malignant ovarian tumours (TOV samples), and the cellular fraction of ascites fluid (OV samples). The EOC cell lines were established from ovarian malignant tumors (TOV81 D, TOV21 Gand TOV112D) and fram ovarian malignant ascites (OV-90) of chemotherapy naïve patients as described [Provencher et al., 2000]. They were derived from a grade 1-2 and stage IIlc papillary serous adenocarcinoma (TOV81 D), a grade 3 and stage III clear cell carcinoma (TOV21G), a grade 3 and stage IIlc endometrioid carcinoma (TOV112D), and from the ascites fluid of a grade 3 and stage IIlc adenocarcinoma (OV90). Cells were cultured in OSE medium consisting of 50:50 medium 199: 105 containing 2.51-1 g/ml fungizone and 50ug/ml gentamicin. Culture media

8 was supplemented with 15% FBS (NOSE cultures) or 10% FBS (EOC cell lines). Cell cultures were passaged with a 1 :2-3 split ratio and frozen in buffered DMSO solution.

2.3 Extraction of nucleic acids

DNA was extracted from cell cultures and solid tumors (snap frozen at the time of resection) according to described methods [Maniatis T et al., 1982]. Total RNA was extracted with TRlzol™ reagent (Gibco/BRL, Life Technologies Inc., Grand Island, NY) from cultured cells grown to 80% confluence in 100mm petri dishes and from snap frozen tumors. DNA and RNA samples used in experiments are described in Tables 3 and 4.

Table 3. Description of DNA samples used in the study

DNA sample Description Histopathology Source Passage1 Experiment F111 N3266 lymphocytes - blood - Allelotyping studies F612 N2170 lymphocytes - blood - Allelotyping studies F767 N2788 lymphocytes - blood - Allelotyping studies F904 N3106 lymphocytes - blood - Allelotyping studies rn Q) F1038 N3374 lymphocytes - blood - Allelotyping studies "i5.. F1040 N3408 lymphocytes - blood - Allelotyping studies E (Il F1045 N3846 lymphocytes - blood - Allelotyping studies Cf) c F1064 N4131 lymphocytes - blood - Allelotyping studies (Il .~ F1134 N4154 lymphocytes - blood - Allelotyping studies > F1144 N4199 - Allelotyping studies 0 lymphocytes - blood C F1235 C3408 lymphocytes - blood - Allelotyping studies 0 Z F2195 N3718 lymphocytes - blood - Allelotyping studies F3311 C3525 lymphocytes - blood - Allelotyping studies F3497 N3392 lymphocytes - blood - Allelotyping studies F3564 C3704 lymphocytes - blood - Allelotyping studies F3594 N3427 lymphocytes - blood - Allelotyping studies TOV81D malignant tumour serous ceilline 17,26,61 Allelotyping studies rn ma lignant tumour serous ceilline 26 Allele-specific detection Q) TOV81D c TOV21G malignant tumour clearcell ceilline 8,59,68 Allelotyping studies :.J TOV21G malignant tumour clearcell ceilline 8 Allele-specific detection Qi 0 TOV112D malignant tumour endometrioid ceilline 69,70 Allelotyping sludies 0 endometrioid 69 AIIele-specific detection 0 TOV112D malignant tumour ceilline w OV90 ma lignant ascites adenocarcinoma ceilline 55,61 Allelotyping sludies OV90 malignant ascites adenocarcinoma ceilline 55,61 Allele-specific detection

1Cell culture passage at which nucleic acids were harvested

9 Table 4. Description of RNA samples used in the study

Sam pie Description Histopathology source1 Passage2 Experiment NOV116D NOSE eells normal PC 13 Hu6800 array studies NOV220D NOSE eells normal PC 6 Hu6800 array studies NOV220D NOSE eells normal PC 6,8 RT-PCR analysis CIl NOV31 NOSE eells normal PC 11 Hu6800 array studies Q) Ci NOV31 NOSE eells normal PC 14 HG-U133A array studies E (Il NOV31 NOSE eells normal PC 11,14,17 RT-PCR analysis CI) NOV319 NOSE eells normal PC 9 Hu6800 array studies E .:::! NOV319 NOSE eells normal PC 9 RT-PCR analysis Qi .s NOV436G NOSE cells normal PC 12 Hu6800 array studies '0. NOV436G NOSE cells normal PC 12 RT-PCR analysis uu NOV504D NOSE cells normal PC 8 Hu6800 array studies Q) u NOV61 NOSE cells normal PC 10 Hu6800 array studies (Il 't: NOV61 NOSE cells normal PC 7 HG-U133A array studies ::::l CI) NOV61 NOSE cells normal PC 7,10,14 RT-PCR analysis c (Il NOV653G NOSE cells normal PC 8 Hu6800 array studies .~ NOV653G NOSE eells normal PC 8 HG-U133A array studies > 0 NOV653G NOSE eells normal PC 8 RT-PCR analysis ro NOV821 NOSE eells normal PC 6 Hu6800 array studies E (; NOV821 NOSE eells normal PC 6,8 RT-PCR analysis z NOV848D NOSE eells normal PC 4 Hu6800 array studies NOV848D NOSE cells normal PC 4 RT-PCR analysis NOV900 NOSE cells normal PC 8 Hu6800 array studies NOV910G NOSE cells normal PC 5 Hu6800 array studies TOV81D malignant tumour serous CL 37 Hu6800 array studies

CIl TOV81D malignant tumour serous CL 14 HG-U133A array studies Q) c TOV81D malignant tumour serous CL 20 RT-PCR analysis ::i TOV81D malignant tumour serous CL 14 Allele-specifie deteetion Qi Ü TOV21G malignant tumour clear cell CL 49 Hu6800 array studies TOV21G malignant tumour clear cell CL 56 HG-U133A array studies c~ TOV21G malignant tumour clear cell CL 116,56 RT-PCR analysis (Il Ü TOV21G malignant tumour clear cell CL 56 AIIele-specifie deteetion c (Il TOV112D malignant tumour endometrioid CL 74 Hu6800 array studies .~ TOV112D malignant tumour endometrioid CL 87 HG-U 133A array studies > 0 TOV112D malignant tumour endometrioid CL 63,87,140 RT-PCR analysis T!1 TOV112D malignant tumour endometrioid CL 87 AIIele-specifie detection Qi .r. OV90 malignant tumour adenocareinoma CL 78 Hu6800 array studies ~ OV90 malignant tumour adenocareinoma CL 80 HG-U133A array studies uu OV90 malignant tumour adenocareinoma CL 68,98 RT-PCR analysis OV90 malignant tumour adenoeareinoma CL 70 AIIele-specifie deteetion TOV1010D borderline tumour serous PC 4 Hu6800 array studies CIl Q) TOV720G borderline tumour serous PC 14 Hu6800 array studies Ci E TOV916 borderline tumour serous PC 3 Hu6800 array studies (Il CI) TOV920D borderline tumour serous PC 6 Hu6800 array studies c (Il TOV984 borderline tumour serous PC 5 Hu6800 array studies .~ TOV991G borderline tumour serous PC 5 Hu6800 array studies > 0 OV1005 malignant ascites serous PC 2 Hu6800 array studies C OV552 malignant ascites serous PC 6 Hu6800 array studies tU c OV648 malignant ascites serous PC 6 Hu6800 array studies .Ql ro OV665 malignant ascites serous PC 6 Hu6800 array studies ~ OV1127 malignant tumour serous PC 4 Hu6800 array studies -0 c TOV513 malignant tumour serous PC 8 Hu6800 array studies tU ID TOV540 malignant tumour serous PC 8 Hu6800 array studies .S TOV892 malignant tumour serous PC 5 Hu6800 array studies ~ -0 TOV908D malignant tumour serous PC 5 Hu6800 array studies (; TOV959D malignant tumour serous PC 6 Hu6800 array studies ID TOV986 malignant tumour serous PC 5 Hu6800 array studies

1 PC=Primary Culture; CL=Celi Lin 2Cell culture passage at which nucleic acids were harvested

10 2.4 Affymetrix® oligonucleotide microarray experiments

2.4.1 Description of Affymetrix® GeneChips

Analysis of chromosome-X gene expression was performed with two generations of Affymetrix GeneChips® (Santa Clara, CA) as they became commercially available: the Hu6800 microarray (also known as HuGeneFI) and the HG-U133A micraarray. Expression analysis of the 12 NOSE samples (NOV31, NOV61, NOV116D, NOV220D, NOV319, NOV436G, NOV504D, NOV653G, NOV821, NOV848D, NOV900, and NOV910G) and four EOC cell lines (TOV81D, OV90, TOV21G and TOV112D) was performed with the Hu6800 GeneChip®. Micraarray analysis of six borderline ovarian tumours (TOV1 01 00, TOV991 G TOV920D, TOV916, TOV720G, TOV984) and 11 malignant ovarian tumours (TOV540, TOV908D, TOV959G, TOV892, TOV513, TOV986, OV1005 OV1127, OV552 OV648, and OV665) was also performed with the Hu6800 GeneChip®. Expression analysis of the NOSE samples NOV31, NOV61, and NOV653G, and each of the EOC cell lines was performed with the HG-U133A array. Microarray experiments were performed once per sam pie per GeneChip®.

2.4.2 Microarray hybridization and scanning

Hybridization targets were prepared fram total RNA as described [Tamayo et al., 1999]. The complete protocol is available at http://www.genome.wi.mit.edu/MPR. In brief, 20l-lg total RNA was reverse transcribed to double-stranded (ds) cDNA using oligo-dT primer containing a T7 RNA polymerase binding site. The cDNA was transcribed in vitro to cRNA using biotinylated dUTP and dCTP. The resulting cRNA target represents a labeled 50- to 100-fold linear amplification of the cDNA sample. Hybridizations were performed with 151-1g cRNA that was first fragmented in 40mM Tris acetate, 100mM potassium acetate, and 30mM MgCI (pH 8) at 95°C, to reduce secondary structure. The micraarrays were scanned with the Hewlett Packard GeneArray scanner (Palo Alto, CA), following washing and staining.

11 2.4.3 Microarray data set normalization

Gene expression levels were calculated from the scanned images using Mas4 and Mas5 software (Affymetrix® Microarray Suite) for the Hu6800 and HG-U133A GeneChips®, respectively. The software generates an average difference ratio (raw expression value) across the 13-20 probe pairs that correspond to one probe set, as weil as a reliability score indicating the variability of hybridization signal within each probe set: Present (P cali), Marginal (M-call), or Ambiguous (A-cali). Probe pairs are 25mers designed from an mRNA sequence or Expressed Sequence Tag (EST) deposited in GenBank (http://www.ncbi.nlm.nih.gov/GenBank). In order to eliminate systematic biases when comparing the expression values from independently generated data sets, the raw data was re-scaled (normalized) by multiplying the value for individual probe sets by 100 and dividing by the mean of the raw expression values for the given data set, as described [Presneau et al., 2003; Tonin et al., 2001].

2.4.4 Chromosome-X data subset generation

Extractor©vA (Lypny and Tonin 2002), a data filtering software application written using an xTalk scripting language (MetaCard Corporation) was used to retrieve probe sets representing known or hypothetical genes that map to CHR-X according to the UniGene database builds dated November 2002 or October 2003 (http://www.ncbi.nlm.nih.gov). Probe sets were aligned to the X-CHR according to the base pair position of their representative gene, using the UCSC Genome Browser (May 2004 Assembly; http://genome.ucsc.edu). Additional information for genes represented by the probe sets was gathered from the literature and extracted from NetaffixTM Analysis Center (www.Affymetrix.com) or other web-based resources (see online resources). A more in depth literature review was performed for genes represented on the Hu6800 GeneChip®, as the HG-U133A GeneChip® did not become available until the end of this study.

2.4.5 Microarray data analysis

Comparative analyses of the EOC cell lines versus the NOSE samples were performed with probe sets that generated high reliability scores (P-call), for at least one sample in the data set. Probe set expression values falling in the lower range of expression for the

12 Hu6800 and HG-133A data sets were reassigned threshold values of 20 or 15, respectively. The threshold values used for re-scaling are based on the mean of expression values, for the given GeneChip®, of probe sets with low reliability scores (A calls). Scaling the data to a threshold value prevents the overestimation of gene expression differences resulting from the higher experimental variability of probe sets with low values of expression [Novak et aL, 2002].

The range of expression of CHR-X genes in normal ovary was determined from the maximum and minimum values of expression observed in 12 NOSE samples (Hu6800 array) or three NOSE samples (HG-U 133A array). The expression values for each of the EOC cell lines were analyzed relative to the range of expression values observed in the NOSE samples. Fold differences were calculated using re-scaled expression values in two-way comparisons between the individual EOC cell lines and the maximum or minimum value of expression of the NOSE samples.

Correlation analysis and hierarchical clustering (Pearson's correlation) of normalized expression values was carried out using Microsoft Excel and GeneSpring™ software (Silicon Genetics), respectively, for the Hu6800 and the HG-U133A data sets. Correlation analyses were also carried out for the autosomes (CHR 1 to 22) based on the probe set representation of genes mapping to these chromosomes on the Hu6800 GeneChip®.

Differentially expressed chromosome-X genes represented on the Hu6800 and HG U133A arrays were identified in the EOC cell lines based on the following selection criteria: (1) Gene expression values that were greater than the maximum or less than the minimum values of expression of the NOSE samples in ail four EOC ceillines; (2) Gene expression values that were greater than the maximum or less than the minimum values of expression of the NOSE samples in ail three tumourgenic EOC cell lines; (3) Gene expression values that varied at least a three-fold relative to the maximum or the minimum values of expression of the NOSE samples in any one of the EOC cell lines.

Differentially expressed genes with known XCI status were selected according to a different criterion for the study of allele-specific expression from the active and inactive CHR-X homologs in the absence of X/ST expression. Genes represented on the Hu6800

13 array were selected if they displayed a distinctive pattern of expression ("outlier" with a standard residual >2) when the CHR-X gene expression profiles of the cell lines TOV112D or TOV21G were compared to that of the other EOC cell lines by weighted regression analysis. Genes represented on the HG-U133A array were selected if they exhibited expression values for the EOC cell lines TOV112D or TOV21 G that had P-calls were at least two-fold higher th an the mean of expression values of the NOSE samples.

Ali probe sets identified as differentially expressed in the EOC cell lines relative to the NOSE samples were investigated further based on their probe designs. The target sequence provided by Affymetrix® (NetAffyx®) for each probe set was queried using the UCSC BLAT search engine (July 2003 Assembly; http://genome.ucsc.edu) to determine the fidelity of alignment to the intended target transcript. Probe sets that did not align to Chromosome-X were excluded from further analyses. Differentially expressed probe sets representing their target gene accurately were investigated further in two other Hu6800 GeneChip®-derived data sets: A panel of borderline and malignant EOC tumours and an independently derived published data set of EOC-derived cancer cell lines [Ross et al., 2000].

2.5 PCR-Based studies

2.5.1 RT -PCR analysis

Total RNA was treated with DNAsel according to the manufacturer's instructions (Invitrogen Life technologies, Carlsbad, CA). DNasel treated RNA (1 I-Ig) from the EOC cell lines, NOSE primary cultures, EOC tumour samples, and commercially prepared RNA from placenta and testes (BD Biosciences) were reverse-transcribed using the Superscript III first strand synthesis kit (lnvitrogen Life technologies, Carlsbad, CA), according to the manufacturer's instructions. cDNA was diluted 1:5 in water prior to PCR reactions and stored at -20°C. Gene transcripts were detected by PCR amplification in a total volume of 12.5 1-11 containing: 2 1-11 of cDNA, 1X PCR buffer, 100nm each of dNTPs, 50 pmol of each primer, and 0.25 unit of Taq polymerase. Ali reagents were from Invitrogen Life technologies (Carlsbad, CA). PCR reactions were performed in parallel with a gene-specifie primer and an internai reference primer designed to amplify the gene GAPOH or 18S RNA. Gene-specifie primers were designed with the Primer3 software

14 (www.broad.mit.edu/cgi-bin/primer/primer3.cgilprimer3 www.cgi) to amplify the 3'-UTR of test genes. Gene transcript sequences were obtained from the UCSC Genome Browser (November 2002, and October 2003 assemblies). Primer sequences and PCR conditions are described in Table SA. PCR products were electrophoresed on 1.2% agarose gels and visualized by ethidium bromide staining. PCR amplimers were scored for intensity relative to the co-amplified 18S RNA.

Table SA. Primers used for RT-PCR studies

Size PCR PCR Gene Forward Primer Reverse Primer Reference (bp) Temp Cycles

18S TGAGGCCATGATTAAGAGGG CGCTGAGCCAGTCAGTGTAG 643 55°C 23 E/F2S3 AGAATGAAGTGCTCATGGTG CTCCTACCTCTGTGCACACT 119 55°C 35 Carrel et al., 1999 MSN CGACAGTCCTAGCTAAACT ACGGAACTTAAAGAGCAGG 290 56°C 30 Carrel et al., 1999 PGRMC1 AAACAGAGCTCAGCTGCAAA CCCTCCCTCATTTCAAATGAG 294 55°C 30 Carrel et al., 1999 P/M2 CCAATGGTCAGAAGAGCCA GCTCCTTTGTAGGATTGGGA 183 55°C 30 Carrel et al., 1999 RBBP7 CAGCGAATTTATTCTAGCCACC TTGTCCCTCCAGTTCGGATGT 421 55°C 30 Carrel et al., 1999 RSK2 GTGGATGAATCTGGTAATCCG GCAGCATCATAGCCTTGTCT 152 55°C 30 Carrel et al., 1999 SLC25A5 GGGTTGACTTCCTATCCATT GCTTCCCATTTTCAACCAGT 353 57"C 23 Carrel et al., 1999 SMC1L1 AGGCATAGTGATGCTCCTGT CGATGTTTTTGAGATCTGTGC 179 55°C 30 Carrel et al., 1999 SRPX ATAGTGACATGCACACGGGA CAACCAGCCATGATGGAGTA 175 56°C 30 TMSB4X GCCCCTTTCACATCAAAGAA TACAGCCTGCAGGACACTTG 200 55°C 25 Anderson et al., 1999 X/ST CTTGAAGACCTGGGGAAATCCC TGTCAATCTAAAGGTAACCGGC 162 59°C 30 Ganesan et al., 2002 GAPDH AGGGGTCTACATGGCAACTG CGACCACTTTGTCAAGCTCA 328 55°C 25

2.5.2 Allele-specific transcript detection assay

An ailele-specific transcript detection as say was used to investigate the reactivation of CHR-X genes normaily subjected to X-chromosome-inactivation (XCI). Gene-specific primers were used to PCR-amplify target regions in gene transcripts (cDNA) and genomic DNA (gDNA) that harbored coding single nucleotide polymorphisms (cSNP). Mono-ailelic or bi-ailelic expression of candidate genes was determined by comparing the ailelotypes of gene transcripts (cDNA) with that of matched genomic DNA (gDNA). Single nucleotide polymorphisms mapping within the transcribed gene sequence were identified from the NCBI dbSNP data base (http://www.ncbi.nlm.nih.gov). Coding SNPs (cSNP) were aligned to the X-chromosome according to their base pair position in the gene transcript using the UCSC Genome Browser (July 2003 Assembly). Primer sets were designed with Primer3 software to amplify 0.3-1.8 Kb regions overlapping the identified

15 cSNPs (Table 58). Genomic DNA and cDNA were PCR amplified, as described in table 58, prior to sequencing at the Laboratoire d'Analyse et de Synthèse d'Acides Nucléiques (Université Laval, Cité Universitaire, Québec, Canada). Larger volumes of undiluted cDNA (up to 4 1-11) were required for certain PCR reactions depending on the transcript copy number. Chromatographs were analyzed with Chromas© software (Technelysium; http://www.technelysium.com.au/chromas.html) for the presence of informative cSNPs.

Table 58. Primers used for the Chromosome-X allelotyping studies

Size PCR Target §Primer Name Forward Primer Reverse Primer (bps) Annealing DNA

MID1_SNP TGCCATTGGTCTTGCTTACA AACTTTTGAGGCATGAATCTAGC 1500 60.4°C gDNNcDNA POLA_SNP CAATTCTTGTCCCGAAGTGG CTGCCAAAGACGGTCCTATT 929 58.8°C gDNNcDNA (C)CSTF2 GTTCTGTGTTCGTGGGGAAC GATGGGAGTCCTCCACCTG 1814 57.6°C cDNA (G1)CSTF2 TCTTACAGCAGCCCTGAAAAG TGAAAACCTGATGTGATTTGCT 276 57.6°C gDNA (G2)CSTF2 TTTGGACAGAAGCTGGTGGT GAGTCTAGCTGAGTGGATTGAGG 341 57. 6°C gDNA (C1)DKC1_mRNA CAAACCTGAATCCAAAGTTGC CATAATCTTGGCCCCATAGC 835 56SC gDNNcDNA (C2)DKC1_ UTR TCATCTCTACCTGCGACCAT AAACAGGACAAGATGGGATGA 669 56SC cDNA (G1)DKC1_ Ex2 CATGTGCTCACGACATGGTA GCCACTGCCTTCCTGAATAG 224 56.5°C gDNA (G2)DKC1_ Ex6 TGGTGGCTCAGATGAAGGAT CTCATGACTCCAGAACGAACC 236 56.5°C gDNA (G3)DKC1_ UTR TGGATGGTATCTGTGAGCTTTC AAACAGGACAAGATGGGATGA 835 56SC gDNA NONO_SNP GCTGGAGTGTAGTGGCATGA TGCTGCATTACTGCTCCATT 677 57"C gDNNcDNA PLP2_SNP CGGTGTAGGCGAACTTCC CAATGTTTATTATTCATTTATCCCTCT 393 55°C gDNNcDNA (G1 )SLC25A5 GCTTCCGGATCCCAAGAAC ACCAGTTTGTGGCAGCAGAT 201 61.8°C gDNA (C1 )SLC25A5 GGGTTGACTTCCTATCCATT GCTTCCCATTTTCAACCAGT 354 58°C cDNA USP11_SNP CAAGGCAGCCTATGTCCTCT GGGGCACCTAACACGAATAA 235 61.8°C gDNNcDNA PGK1_SNP TTCAACTCTTGAGTTTTTCAGGT ACATAAGTAAATTTAATCATAGCATAC 247 55°C gDNNcDNA MSN_SNP TAAAATTTGCCCTCCCATCC GGTCACCTGAGAGGGTTGAG 684 55°C gDNNcDNA UBE1_UTR GCTGTGCTGTAACGACGAGA GGTAGAAGGCAGTGGCAAGA 224 57"C gDNNcDNA (C)UBE1_SNP GCACACCCAGTACTCGAACA ATGGATCTTGACGCCAGACT 283 57"C cDNA (G)UBE1_SNP GAGAGGCCTTCACTCTCAGG ATGGATCTTGACGCCAGACT 395 57"C gDNA KIF4A_UTR1 AAAGAGATGTGCGATGTGGA TGACTTAGCACCCTTCTGGAG 415 57.4°C gDNNcDNA KIF4A_UTR2 TTGTTGGATGTGGGCCTTA GACGGGCTAAGGTTTATTTACTTAC 412 57.4°C gDNNcDNA FHL 1_UTR1 GGGGCTCCTGTCCTGTAAA TGCAAGTTTCCAAACCCATAA 837 57.4°C gDNNcDNA FHL 1_UTR2 CGTCACAACGAATACTTCTGGA GCTGCTTTATTTCTGTAAGGATACACT 595 57.4°C gDNNcDNA SUV39H1_UTR1 ACCCCGTGGACATGGAGA ACTGTGAAGGCAGAGCTTGG 874 61.8°C gDNNcDNA SUV39H1_UTR2 CCAAGCTCTGCCTTCACAGT CCCACTCCAGGCTGCATAG 692 61.8°C gDNNcDNA (G)RBM10_UTR GCCGACTCCCTTCTCGTC TCGCGCCTCCTCTACGTC 310 57.4°C gDNA (C)RBM10_UTR GCCGACTCCCTTCTCGTC CCCGATAGTCGCCGTCTC 677 57.4°C cDNA PHKA1_UTR AAAACCCTTGGCGCAGAT TGCTCCCCAAACAGGAGTTA 522 58-59°C gDNNcDNA (C)TMSNB_UTR CGGGAACGCTAACCTGGTC CTGCAAAAGCATGCAACTTC 639 58°C cDNA (G)TMSNB_UTR GGCATGTATGCAGACTTCGAT CTGCAAAAGCATGCAACTTC 584 58°C gDNA ZNF261_UTR1 CCTGAAAGCCTCCGGACT AGAAGGCAGCTGGGTTTTTC 607 58-59°C gDNNcDNA ZNF261_UTR2 ATTGGTTGTTGGCACCATCT TTTGAAACAAACAATTTCAGAGAC 712 58-59°C gDNNcDNA HADH2_UTR AAAAAGAGACTTTA TT AGGCACAGAGG GTTTGGCACCCCACTGCT 324 58-59°C gDNNcDNA

16 2.5.3 Chromosome-X allelotyping studies

The allelic content of CHR-X in the four EOC cell lines was investigated with 18 polymorphie mierosatellite repeat markers. Primer sets and PCR assays were described previously for four of 18 markers (OXS1068 and OXS991, AR, and HPRT) [Sleddens et al.,1992; Weissenbaeh et al., 1992; Perinchery et al.,2000]. Fourteen additional markers (Xp22.22, Xp22.11, Xp11.3, Xp11.23, PLP2, Xp11.22, MSN, Xq13.1, Xq13.2, PGK1, Xq22.1, SLC25A5, Xq26.3, and Xq28) were generated from simple repeat tracks identified with the Genome Browser (July 2003 Assembly). Primer sets were designed with the Primer3 software to amplify CHR-X regions having a minimum of 10 perfect DNA repeats (dinucleotide, trinueleotide, or tetranucleotide) as deseribed in Table 5C. The number of eontinuous perfeet repeats predicts the likelihood of a polymorphism at the given locus [Benson, 1999]. The mierosatellite repeat markers were PCR-amplified from genomic DNA extracted from the EOC cell lines. PCR reactions were performed in a total volume of 12.51J1 containing: 100ng genomic DNA, 50 pmol each of forward and reverse primers, 200nm each of dCTP, dGTP and dTTP, 1.251JCi Redivue a-35S[dATP],

1X PCR buffer with 1.5mM MgCI 2 (Qiagen), and 0.625 units of HotStart taq polymerase (Qiagen). The PCR reagents were heat-activated at 95°C for 15 minutes prior to amplification for 30-35 cycles as follows: 94°C for 30s, 55-62°C for 30s, and 72°C for 30s. Stop buffer (90% formamide, 10mM EDTA, 10% bromophenol blue, 10% xylene cyanol) was added to dilute PCR products 2:3. PCR products were denatured at 95°C for 10 min and 41J1 was loaded onto a 5% polyacrylamide denaturing gel (BioRad Laboratories reagents). PCR products were electrophoresed in 1X TBE buffer for 2.5- 3.5 hours at 70W, using the Life Technologies Gibco BRL sequencing system. The gels were transferred to paper and dried for 0.5-1 hour at 80°C (Bio-Rad Model 583 gel dryer) before being exposed to Kodak Biomax film for 2-7 days. Autoradiograms were scored visually for the absence or presence of at least two alleles. The presence of both parent-of-origin CHR-X homologues (maternally and paternally derived) was determined from the number of alleles amplified from genomic DNA extracted from the cell lines. The presence of an inactive copy of CHR-X was inferred from the expression of the X inactivation-specific-transcript (X/ST) and the presence of heterozygous CHR-X loci in the EOC cell lines. Matched DNA samples from the original tumours and peripheral blood lymphocytes were not available for this analysis.

17 Table 5C. Primers used for Allele-Specific Transcript Detection

Marker Size Temp 1 f 30NA 3Copy 4 Forward Primer Reverse Primer HTZ Name (bp) (OC) oca Ion Repeat No.

2Xp22.22 ACTCACCCAAGGAACCAAG TGAGTTCAAGACCAGCCTG 142 57.5 Xp22.22 TTCC 10.3 2Xp22.11 CTTCTCTCTGTTCTAGGCCTC CACTTCACTCCAGCTTGG 184 57.5 Xp22.11 TATT 10.3 'OXS1068 CCTCTAAAGCATAGGGTCCA CCCATCTGAGAACACGCTG 245 59 Xp11.4 CA 19 0.82 2Xp11.3 GCCCAGACACACATATCCAAT GGGAACAAGACAGGCAAAG 128 57.5 Xp11.3 GATA 14 2Xp11.23 TGCGAGATGAAAGGGGAA TGGGATTACAGGCGTGAG 175 57.5 Xp11.23 CATA 12 2PLP2 CAGCAGAAGTGGAGACATGC CTCGCAGCCATGATACTTCC 125 55 Xp11.23 CATA 12 2Xp11.22 GGCTGGCTTTCTTTCTTTCTTT AGATCGTGTCACTGCACA 283 59.2 Xp11.22 TCTT 15.8 , OXS991 ACTTCAACCACAGAAGCCTC ATCATTTGAGCCAATTCTCC 256 59 Xp11.21 AC 23 0.82 'AR TCCGCGAAGTGATCCAGAAC CTTGGGGAGAACCATCCTCA 195 60 Xq12 GGC 17.3 0.9 2MSN TGACGGAGCGAGACCTT AGTGGTAGCCCATCTTGGTG 256 57 Xq12 GT 19 2Xq13.1 CCAAAGGCAAAGCACTAACC CAGAGATCATGCCAATGCA 149 59.2 Xq13.1 TTTC 16.3 2Xq13.2 GGCTTCAATGTCTGGCTTC AGGAGAATGGTGTGAACCC 120 57.5 Xq13.2 TTTA 10.8 2PGK1 CCACAATTAGCAATCGTGCTT AGCAGGGCTCAGAAGACCTA 166 57 Xq21.1 TG 21.5 2Xq22.1 TCTTTCCTTCCTTCCTTCCTTC CGAGACTGTGTGACTGCA 191 59.2 Xq22.1 CTTT 15.5 2SLC25A5 TGTCTCAATGGAGGAATTAGTTTT CCCACCTTAGCCTTCCAAAT 154 57 Xq24 CAT 10 1 HPRT ATGCCACAGATAATACACATCCCC CTCTCCAGAATAGTTAGATGTAGG 263 56 Xq26.2 TCTA 18 0.78 2Xq26.3 GGTTTGGGATTCTGTGCTC GCTCCCTCAAATATTGCCC 158 59.2 Xq26.3 TTTC 22.8 2Xq28 TCTTCTTCTTCTTCTTCCTCCC GTTGCAGTGACCAAGATTCC 219 57.2 Xq28 CTT 25

1 Marker reported in the GOB data base (hltp://www.gdb.org/gdb/) 2 Marker designed from simple repeat tracks identified with the UCSC Genome Browser (July 2003 Assemby; hltp://genome.ucs

3 Information reported for simple repeat tracks by the UCSC Genome Bowser (July 2003 Assemby; hltp://genome.ucsc.edu).

4 Maximum Heterozygosity (HTZ) reported for marker by the GOB data base (hltp://www.gdb.org/gdb/)

18 RESULTS

3.1 Representation of Chromosome-X genes on the Affymetrix GeneChips®

Two hundred and five probe sets corresponding to 186 known genes or expressed sequence tags (EST) mapping to CHR-X were identified from 7,070 probe sets represented on the Hu6800 array (Table 6). An additional 612 probe sets corresponding to 428 X-linked genes or ESTs were retrieved from the 22,000 probe sets contained on the HG-U 133A array. Ali cytobands, with the exception of Xq 11.1, were represented on one or both of the arrays (Figure 1). Greater coverage of CHR-X was achieved with the HG-U133A array, having an average density of 15.3 probe sets per cytoband, as compared to 5.1 probe sets per cytoband with the Hu6800 array.

Table 6. Chromosome-X Representation of Affymetrix® GeneChips

Affymetrix Oligonucleotide Arrays Hu6800 GeneChip® U133A GeneChip®

Total No. Probe sets: 7,070 22,000

Total No. Genes represented: -8,000 -14,500

CHR-X mapped probe sets:

UniGene Build

Genome Browser 205C 612 C

CHR-X genes represeneted: 186C 428C

a Based on the November 2002 UniGene build (NCSI; hUp://www.ncbi.nlm.nih.gov)

b Sased on the October 2003 UniGene build (NCBI; hUp://www.ncbi.nlm.nih.gov)

C Based on the UCSC Genome Browser (July 2003 Assembly; http://www.genome.ucsc.e

3.2 Chromosome-X gene expression profiles in NOSE primary cultures

The expression signature of CHR-X genes was first evaluated in a panel of 12 primary cultures of NOSE cells derived from women with no personal history of ovarian cancer. NOSE cells were selected as a normal tissue reference since they reflect the cell population from which epithelial ovarian cancer is derived [Auersperg et al., 2001].

19 Figure 1. Distribution of Affymetrix® GeneChip probe sets relative to cytological bands on the X-chromosome. Schematic diagram illustrating the net distribution of probe sets from two Affymetrix® arrays relative to each of the cytobands on chromosome-X. Probe sets representing X-linked genes on the Hu6800 GeneChip® are indicated by white bars; probe sets representing X-linked genes on the U 133A GeneChip® are indicated by black bars.

20 Figure 1. Distribution of Affymetrix® GeneChip probe sets relative to cytological bands on the X-chromosome.

o 25 75 1(J(J 125 100 No. Probesets Expression values for 205 probe sets were highly correlated across the 12 NOSE samples (p>0.9). Fifty-four of 205 probe sets (26%) generated expression values for ail 12 NOSE samples that were below the detection threshold established for the Hu6800 GeneChip® (value <20 with A-calls). Expression was detectable (value >20 with P-calls) for at least 19 of the se probe sets in other ovary-related data sets (data not shown). Thirty-seven of 205 probe sets produced values of expression that were greater than 20 with a high reliability score (P-call) across ail 12 NOSE samples.

The variability of CHR-X gene expression levels was established by two-way comparisons of the maximum and minimum values of expression observed in the NOSE samples for each of the 205 probe sets. The range of expression of 29 probe sets (14%) varied at least a three-fold in the NOSE samples. Seven of these probe sets generated values of expression with very low reliability scores (A-calls) across the 12 NOSE samples. Eight probe sets had poor designs that were not compatible with the transcribed gene sequence (see Appendix 1). Twenty-one probe sets aligned in proper orientation and uniquely with the target gene transcript. When the probe set design and reliability scores were taken into account, 14 of 186 X-linked genes (15 of 205 probe sets) represented on the Hu6800 GeneChip® exhibited a range of expression values that varied at least three-fold in the NOSE samples (Table 7A).

Similar results were obtained from an experiment performed with the HG-U133A GeneChip® where the expression profiles of 428 CHR-X genes (n=612 probe sets) were evaluated in three NOSE samples. The values of expression across 612 probe sets were highly correlated in ail three NOSE samples (p>0.88). One hundred and fifty nine probe sets (26%) generated values of expression for ail three NOSE samples that were below the detection threshold established for the HG-U 133A GeneChip® (value <15 with A-calls). Two hundred and fifty probe sets (41 %) produced values of expression that were greater than 15 with P-calls across ail the three NOSE samples. The range of expression of 37 probe sets (6%) varied at least three-fold between the maximum and minimum values of expression of the NOSE samples. Seven of these probe sets had probe designs that were incompatible with transcribed gene sequences (see Appendix 1). While the other 30 probe sets had proper designs, 21 of these generated low expression values « 100) in at least two of the three NOSE samples (Table 78). After taking probe set designs and reliability

21 scores into consideration, the expression levels of 28 of 428 CHR-X mapped genes (30 of 612 probe sets) represented on the HG-U133A array varied at least three-fold in the NOSE samples (Tables 7A-B).

Both GeneChip analyses identified four genes (A TRX, BGN, PGRMC1, and SRPX) that varied at least 3-fold in the NOSE samples. The expression levels of an equivalent proportion of CHR-X genes represented on the Hu6800 and HG-U133A arrays were found to vary at least three-fold in the NOSE samples. No discernible patterns of gene expression were observed when these genes were associated with their position on CHR-X.

Table 7A. Variably expressed CHR-X genes represented on the Hu680a GeneChip®

1Variability Gene Expression Values in the NOSE Samples Gene Probe NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 2Probe Set Fold L'.. Symbol Set 1160 2200 31 319 436G 5040 61 653G 821 8480 900 910G Alignment

1 1 APXL X83543 3 43 26P 28;M 491p 20A 63P 26P 33 1P 20!A 53P 3ip 20 A 20!A target gene 1 1 TCTE1L U02556 3 154 173 ,P 97 1p 121:P 154jP 132 p 224 1p 109!P 100,P 70iP 76,P 160P 213 P target gene

SRPX U61374 7 342 173iP 202 p 404iP 246iP 201:P 210lp 342:P 153:P 62!P 214'P 222iP 204,P target gene ' ~ ~ ; l j TM4SF2 L10373 7 113 34ip 20 lA 20lA 20 lA 20;A 74 A SO,P 20iA 20 lA 20'A 121 ip 133,P target gene ' ; SMCX L25270 6 100 69iP 21 P S3P 281p 41 ;P 99 P 91P 69'P 671p 121 P 25'P 31 :p target gene ' ~ l HADH2 U73514 5 86 20'P 20A 20P 20lA 20 A 20'A 20 P 20A 42!A 106'P 41'A 20:P target gene i AR M23263 3 42 211A 38A 23 A 54P 40iA 42P 34 P 62 P 21 A 62 P 35 A 57P target gene , i 1 ZNF261 X95808 3 46 31P 20A 20P 20 M 30iP 45'P 26,P 37 A 48P 31 iP 66 P 31 A target gene ! i i 1 1 ATRX U09820 3 50 56 ,p 70 p 30 P 39'P 57 P 41P 22 P 20A 30 P 31P 47P 52 p target gene TCEAL1 M99701 3 88 77P 68:P 56 P 43,P 60 lp 80P 55;P 43 A 62 P 47;P 131 P 110P target gene , 1 PGRMC1 Y12711 4 70 65P 52,P 34 P 48'P 90iP 54P 33P 31 P 32 P 20,P 20A 23 P target gene 1 1 ZNF183 X98253 3 103 44P 147P 64A 76'A 94P 83P 57 A 82 P 97 P 78P 99 A 92P target gene i i RAB33A 014889 3 46 43P 52A 20 P 20 p 42p sip 29 A 64 P 43P 35 P 66 P 62 P target gene ' i i LOC91966 L43579 3 46 38P 61 P 41 P 50!A 56 p 68'P 58 P 22A 26A 35 P 36 P 44 P target gene 54!A 49iA 94'A BGN J04599 18 331 20A 69P 30 'A 611A 351 P 41:A 96P 64 A 42A target gene

1 Variability of expression in NOSE samples: Fold=maximum/minimum expression value; L'..=maximum-minimum expression value

2 Based on BLAT analysis (http:\\www,genome,ucsc,edu) of the hybridization targets provided by NetAffyx® (http:\\www,affymetrix,cor

22 Table 7B. Variably expressed CHR-X genes represented on the HG-U133A GeneChip®

Gene 1Variability Expression in the NOSE 3Probe Set Probe Set Symbol Fold Il NOV31 NOV61 NOV653G Alignment

38961 212414_5_at 4 104 110P 40:P 145;P gene target ALEX1 218694_at 3 93 131 P 68;P 38iP gene target ATRX 208859_5_at 4 45 37,P 60!P 15!A gene target 8GN 201261_x_at 7 134 28 P 23P 157;P gene target CHST7 206756_at 3 31 46P 15,A 15;A gene target COL4A6 213992_at 19 284 19A 300 P 16;A gene target CUL48 202213_5_at 4 145 56,P 201 P 80P gene target DKFZp5641 209596_at 67 985 15,A 1000,P 338,P gene target ; EIF1A 201018_at 4 107 76:P 143ip 36,P gene target EIF2S3 205321_at 5 72 3LA 19 lA 91P gene target ! FACL4 202422_5_at 3 73 108 P 110'P 37!P gene target FLJ10097 215440_5_at 6 69 15,P 84 i p 19' P gene target HCFC1 202474_5_at 4 90 94P 33P 123P gene target ! HEPH 203903_5_at 3 35 15 iP 29,P 50iP gene target IL 1RAPL 1 220663_at 3 31 15 P 46 P 15 P gene target ITM2A 202747 _5_at 5 55 15'A 70 P 15:A gene target KAL1 205206_at 3 40 31 ip 58'P 18,P gene target LDOC1 204454_at 9 286 35iA 240P 320iP gene target MAOA 212741_at 7 97 15A 112 P 42 1A gene target

MST4 218499_at 15 283 62P 304P 21 ~P gene target ,1 PGRMC1 201120_5_at 6 294 358'P 64,P 135!P gene target RNF128 219263_at 24 339 15M 354 P 161p gene target SAT 203455_5_at 3 447 296P 658:P 211 P gene target SMC1L1 201589_at 3 100 150,P 103 P 50!P gene target 1 SRPUL 205499_at 6 161 191 P 30'P 44 ' P gene target SRPX 204955_at 4 699 949 P 250!P 488\P gene target ' 1 STAG2 209023_5_at 3 61 76P 87P 26 i P gene target l TM4SF6 209109_5_at 3 66 96P 31,P 57 'P gene target CUL48 215997 _5_at 4 82 25P 107 P 53P gene target SAT 213988_5_at 4 198 78 P 276P 214;P gene target

3.3 Patterns of global Chromosome-X gene expression in four EOC ceillines

The expression signature of CHR-X genes was evaluated in four EOC ceillines relative to that of the NOSE samples. Expression values for 58 of 205 probe sets (28%) were below the detection threshold of the Hu6800 array (value <20 with A-calls) across ail four EOC cell lines. In comparison, transcript levels in the four EOC cell lines were below the detection threshold of the HG-U133A array (value <15 with A-calls) for 159 of

23 612 probe sets (18%). The expression values for 54 probe sets (26%) and 232 probe sets (38%) represented on the Hu6800 and HG-U133A GeneChips®, respectively, had P-calls and were above the detection threshold in ail four EOC cell lines.

The values of expression for 205 probe sets (Hu6800 data set) were highly correlated (p>0.89) when comparing the EOC cell lines TOV81 D, TOV21 G, and OV90 to one another, or to the 12 NOSE samples (Table 8A). In contrast, expression values differed markedly for these probe sets when the tumourgenic cell line TOV112D was compared to the NOSE samples (p <0.71) and the other EOC cell lines (p <0.67). Correlation analysis of 612 probe sets represented on the HG-U133A array also demonstrated differences in gene expression profile for TOV112D relative to that of the other EOC cell lines (p<0.69) and the NOSE samples (p>0.72) (Table 8B). Expression values across 612 probe sets were also correlated between the ceillines TOV81D and OV90, and the NOSE samples (p>0.80). Contrary to the unremarkable gene expression profile generated by 205 probe sets (Hu6800) for the EOC cell line TOV21 G, differences in the expression values of 612 probe sets (HG-U 133A) were revealed for this cell line relative to the other EOC ceillines (p<0.73) and the NOSE samples (p>0.77).

Table 8A. Correlation coefficient analysis of global CHR-X gene expression for 205 probe sets represented on the Hu6800 GeneChip®

TOV 1120 1 TOV 810 0.67 TOV21G 0.71 0.95 OV90 0.46 0.89 0.92 NOV 1160 0.54 0.95 0.91 0.94 NOV 2200 0.55 0.95 0.93 0.95 0.99 1 NOV 8480 0.56 0.96 0.93 0.93 0.98 0.98 NOV 436G 0.57 0.95 0.91 0.92 0.99 0.98 0.97 NOV 900 0.59 0.96 0.93 0.92 0.96 0.98 0.98 0.94 1 NOV31 0.62 0.97 0.93 0.89 0.97 0.97 0.96 0.98 0.95 NOV 91 DG 0.62 0.97 0.94 0.92 0.98 0.98 0.99 0.98 0.98 0.98 NOV61 0.63 0.97 0.94 0.90 0.97 0.97 0.98 0.98 0.96 0.99 0.99 1 NOV 821 0.65 0.98 0.95 0.91 0.97 0.98 0.98 0.97 0.98 0.97 0.99 0.98 NOV 5040 0.66 0.99 0.94 0.90 0.97 0.96 0.97 0.97 0.97 0.98 0.99 0.99 0.98 1 NOV 653G 0.66 0.97 0.94 0.89 0.95 0.95 0.97 0.94 0.98 0.97 0.98 0.98 0.98 0.98 NOV 319 0.67 0.98 0.95 0.89 0.95 0.96 0.96 0.96 0.96 0.98 0.99 0.99 0.98 0.99 0.99 TOV TOV TOV av ~V~V~V~V~V~V~V~V~V~V~V~V 1120 810 21G 90 1160 2200 8480 436G 900 31 910G 61 821 5040 653G 319

24 Table 8B. Correlation coefficÎent analysÎs of global CHR-X gene expression for 205 probe sets represented on the HG-133A GeneChip®

TOV112D 1 TOV81D 0.56 TOV21G 0.69 0.65 1 OV90 0.63 0.8 0.73 1 NOV31 0.72 0.91 0.76 0.8 1 NOV61 0.58 0.91 0.77 0.8 0.88 NOV653G 0.55 0.98 0.66 0.8 0.89 0.91 TOV TOV TOV OV NOV NOV NOV 112D 81D 21G 90 31 61 653G

Hierarchical clustering analysis (Pearson's correlation) grouped the NOSE samples and EOC cel! lines into clusters largely consistent with the patterns of gene expression established by correlation analysis. Two samples (TOV810 and NOV1181) misclassified based on the analysis of 205 probe set expression values (Figure 2A). The cel! line TOV81 0 also grouped with the NOSE samples based on the analysis of 612 probe set expression values (Figure 2B).

Figure 2. Hierarchical clustering of global CHR-X gene expression profiles in the EOC cel! lines and NOSE samples

A. 205 probe sets represented on the Hu6800 GeneChip®

Il ---'1

o 0 0 ~ ~ ~ 0 0 ~ 000 0 000 ~ 0 0 o ~ ~ ~ ~ M ~ MON co ~ ~ 0 'N~ ~ ~ ~ 6 6 ~ ~ g ai ~ ~ 0 ~ ~ > ~ ~ 0 z z ~ ~ 0 ~ ~ 0 0 > > 0 0 0 > o 0 0 zoo z o 0 z z 001- 1- o z z z z z z z Z Z Z 1-

25 8. 612 probe sets represented on the HG-U133A GeneChip®

...- ...- a ...-o o ~ ~ ~ ...-N o o ~ o z z o ;; f- o f-

Patterns of CHR-X gene expression were evaluated further in the EOC cell lines using probe sets that generated at least one p-call with a value of expression above the detection threshold in the in vitro model system (Figure 3 and Table 9). Thirty-two of 130 probe sets (Hu6800 data set), as compared to 30 of 434 probe sets (HG-U133A data set), had expression levels across ail four EOC cell lines that fell within the range of expression observed in the NOSE samples. A much greater proportion of probe sets representing CHR-X genes on the HG-U133A array (93% of n=434) had expression values that fell outside of the range of expression of the NOSE samples in at least one EOC cell line, as compared to the Hu6800 array (75% of n=130). For those CHR-X genes represented in the Hu6800 data set, expression levels fell outside of the range of expression of the NOSE samples most frequently (69 of 130 probe sets) in the tumourgenic ceilline TOV112D, and least frequently (22 of 130 probe sets) in the non tumourgenic cell line TOV81 0 (Table 9A). When the analysis was repeated for CHR-X genes represented in the larger HG-U 133A data set, the number of expression values falling outside of the range of expression of the NOSE samples was highest (n=272 of 434 probe sets) in two tumourgenic cell lines (TOV112D and TOV21G), and lowest in the ceilline TOV81 0 (n=194 of 434 probe sets) (Table 98).

26 Figure 3. Global patterns of Chromosome-X gene expression in four EOC cel! lines

A. Gene expression values in the EOC cel! B. Gene expression values varying at least lines falling outside the limits of the range three-fold in the EOC ceU lines relative to the of expression in the NOSE samples range of expression in the NOSE samples 250 40 U133A GeneChip® U133A GeneChip® 200 30 ..~ 150 " 20 0..~ 100 zci 10 50

0 80 10 ,...... Hu6800 GeneChip® 60 ~ rJl 6 .c"e 40 0.. 4 ci z 20

0 TOV112D TOV21G OV90 TOV81D TOV112D TOV21G OV90 TOV81D

l1li Value above the range of expression in NOSE samples l1li Over-expressed at least 3-fold relative to NOSE samples o '{aiue belowtherange of expressionin NOSE samp~s _ _ D_Under-e)(~ressl3Cl at least 3-fold relative toNOSE samples

Table 9. Global patterns of Chromosome-X gene expression in four EOC cell lines

A. Number of Hu6800 Probe Sets with: TOV112D TOV21G OV90 TOV81 0

Gene expression below the threshold for detection in 75 75 75 75 the in vitro model system (values<20 with A-calls) Gene expression levels in the EOe ceillines falling 61 86 79 108 within the range of expression in the NOSE samples Gene expression levels in the EOC ceillines falling 69 44 51 22 outside the range of expression in the NOSE samples Gene expression varying at least three-fold in the EOe 53 41 34 5 cell lines relative to the NOSE samples Total probe sets representing CHR-X Genes 205 205 205 205

B. Number of HG-U133A Probe Sets with: TOV112D TOV21G OV90 TOV81 0

Gene expression below the threshold for detection in 178 178 178 178 the in vitro model system (values<15 with A-calls) Gene expression levels in the EOe ceillines falling 162 162 186 140 within the range of expression in the NOSE samples Gene expression levels in the EOe ceillines falling 272 272 248 194 outside the range of expression in the NOSE samples Gene expression varying at least three-fold in the EOe 9 9 9 0 cell lines relative to the NOSE samples Total probe sets representing eHR-X Genes 612 612 612 612

27 3.4 Differentially expressed Chromosome-X genes identified in the EOC ceillines

Microarray analysis of 446 CHR-X genes identified 42 genes that were differentially expressed in the three tumourgenic EOC cell lines (32 over-expressed and 10 under expressed), as weil as 26 genes that were differentially expressed in ail four EOC cell lines (21 over-expressed and 5 under-expressed). GeneChip analysis with the Hu6800 array identified 13 of these genes (n=13 probe sets): five over-expressed genes found in ail four EOC cell lines; six over-expressed and 2 under-expressed genes found in the tumourgenic EOC cell lines (Table 10). Fifty-nine additional genes represented by 75 probe sets were identified with the HG-U 133A array: 17 over-expressed and 5 under expressed genes found in ail four EOC cell lines; 27 over-expressed and 10 under expressed genes found in the tumourgenic EOC cell lines (Table 11).

Seventy-three differentially expressed genes displayed expression levels that varied at least three-fold relative to the NOSE samples. Eighteen differentially expressed probe sets representing 18 of these genes (4 under-expressed genes and 14 over-expressed) were identified from the analysis of the Hu6800 data set (Table 10). Analysis of the HG U 133A data set identified 63 differentially expressed probe sets corresponding to the additional48 genes (14 under-expressed and 34 over-expressed genes) (Table 11).

Most of the genes that varied at least three-fold showed over-expression (n=52) rather than under-expression (n=21) relative to NOSE samples. Under-expressed genes were most often identified simultaneously in more than one EOC cell line (7 of 18 genes), whereas over-expressed genes were more frequently found only in one of the cell lines (39 of 48 genes). Two genes were differentially expressed in ail three tumourgenic EOC cell lines: the up-regulated gene EIF2S3 (Hu6800) and down-regulated gene ALEX2 (HG-U133A). No genes had expression levels that varied at least three-fold in ail four EOC cell lines. Differentially expressed genes were more often identified simultaneously in TOV112D and TOV21G (n=7), than in OV90 and TOV112D (n=3), or OV90 and TOV21 G (n=2). Ali differentially expressed genes identified in TOV81 D were unique to this cell line.

When examining the expression profiles of ail 446 CHR-X genes, the greatest number of differentially expressed genes varying at least three-fold relative to the NOSE samples

28 Table 10. Differentially expressed Chromosome-X genes represented on the Hu6800 GeneChip®

Gene Probe Probe Set NOSE Samples TOV81D OV90 TOV112D TOV21G Cytoband Symbol MAX MIN Fold Expression Fold Expression Fold Expression Fold Expression Fold Design M16279_at C099 945 517 2 938 P 621 P 166 p. 356 Xp22.33 TARGET X83572_at ARSO 23 20 1 23 P 20 A 20 A 57 Xp22.33 TARGET M17733_at TMSB4X 5176 2559 2 2816 P 4014 P 20 A 2367 :1 Xp22.2 TARGET Y07867_at PIR 28 20 1 20 P 78 P 38 P 20 P TARGET X72841_at RBBP7 216 133 2 128 250 P 223 P 446 P Xp22.2 TARGET , '%'> $ U08316_at RPS6KA3 26 20 1 60 149 P 34 P 90 P Xp22.12 TARGET PIP . &0 ~ L 19161_at EIF2S3 23 20 1 27 p.: 133 P 79 P 483 P Xp22.11 TARGET U61374_at SRPX 404 62 7 97 P 26 P 57 P 20 P Xp11.4 TARGET U50553_at OOX3X 30 20 1 63 p. 31 P 69 P 87 P Xp11.4 TARGET 086969_at PHF16 20 20 1 20 A 20 A 88 P 32 P Xp11.3 TARGET M25269_at ELK1 22 20 1 27 pB 31 91 P 20 P Xp11.23 TARGET Z37986_at EBP 157 81 2 122 P 433 86 P 219 Xp11.23 TARGET U77735_at PIM2 22 20 1 20 A 66 :1 26 A 52 :1 Xp11.23 TARGET U66359_at T54 20 20 1 20 A 20 A 110 A 20 A Xp11.23 TARGET M69066_at MSN 1059 729 1 1041 P 206 p. 569 P 480 p. Xq12 TARGET 083783_at TNRC11 26 20 1 20 A 20 A 93 P 20 P Xq13.1 TARGET 000860_at PRPS1 76 37 2 100 203 98 P 166 P Xq22.3 TARGET ,w. ~~

pl~ Y12711_at PGRMC1 90 20 4 201 Pi> ; 180 P " . 111 P 185 P Xq24 TARGET J02683_s_at SLC25A5 398 229 2 320 P 1178 PI934 P 1050 P Xq24 TARGET

M31642_at HPRT1 90 48 2 64 P 92 ~.. .,~171 P 163 P Xq26.2 TARGET M67468_s_at FMR1 28 20 1 20 P 20 A 70 P 43 P Xq27.3 TARGET L43579_s_at LOC91966 68 22 3 50 P 76 112 P 73 P Xq28 TARGET U47105_at H105E3 68 32 62 P 72 68 P 96 P Xq28 TARGET 2 ~.~@ ---, Table 11. Differentially expressed Chromosome-X genes represented on the HG-U133A GeneChip®

Gene NOSE Samples TOV81D OV90 TOV21G TOV112D Probe Probe Set Cytoband Symbol MAX MIN Fold Expression Fold Expression Fold Expression Fold Expression Fold Design 201029_s_at CD99 1364 1230 1 1350 P 1278 P 596P III 184 P Xp22.33 Target 209394_at ASMTL 118 79 1 63 A 76 A 113 M 19 A Xp22.33 Target 210963_s_at GYG2 20 15 1 38 P 69 P 23 A 15 A Xp22.33 Target 210964_s_at GYG2 42 15 3 30 A 131 P 15 A 15 A Xp22.33 Target 218951_s_at FLJ11323 69 54 1 39 A 257 P 98 P 29 A Xp22.33 Target 201867 _s_at TBL1X 72 35 2 63 P 77P 238 P 47 P Xp22.31 Target 201868_s_at TBL1X 43 16 3 30 A 34 P 206 P 22 A Xp22.31 Target 204060_s_at PRKX 59 20 3 28 A 76 P 83 P 63 P Xp22.3 Target 203401_at PRPS2 52 18 3 54 P 39 P 159 P 147 P Xp22.22 Target 203637 _s_at MID 1 24 15 2 20 P 31 P 262 P 164 P Xp22.22 Target 205673_s_at ASB9 15 15 1 15 P 20 P 73 P 15 P Xp22.22 Target 206167 _s_at ARHGAP6 15 15 1 15 A 137 P 20 P 15 A Xp22.22 Target 207469_s_at PIR 35 27 1 53 P ..-. 129 P 62 P 99 P Xp22.22 Target 213400_s_at TBL1X 91 61 1 67 P 131 P 307 P 45 A Xp22.22 Target 219962_at ACE2 15 15 1 15 A 661 P 15 A 15 A Xp22.22 Target 222257 _s_at ACE2 15 15 1 15 A 768 P 15 A 15 A Xp22.22 Target 203569_s_at OFD1 90 38 2 46 P 203 P 138 P 117 P Xp22.2 Target 201017_at EIF1A 53 37 1 66 P 80 P 90 P 59 P Xp22.13 Target 206473_at MBTPS2 15 15 1 48 P 15 A 15 A 15 A 2 Target 203455_s_at SAT 658 211 3 231 P 121 P 722P 35 P Xp22.11 Target 210592_s_at SAT 1256 476 3 725P 220 P 1224 P 47 P 1 Target 213988_s_at SAT 276 78 4 233 P 60 P 283 P 15 A Xp22.11 Target 219351_at SEDL 42 34 1 26 A 51 P 86 P 43 P Xp22 Target 206218_at MAGEB2 15 15 22 P 16 P 16 P 21 P Xp21.3 Target 209655_s_at TM4SF10 84 52 2 132 P 15 A 33 P 15 P Xp21.1 Target 209656_s_at TM4SF10 727 346 2 530 P 28 P 351 P 87 P Xp21.1 Target Table 11. Differentially expressed Chromosome-X genes represented on the HG-U133A GeneChip®

Gene Probe Probe Set NOSE Samples TOV81D OV90 TOV21G TOV112D Cytoband Symbol MAX MIN Fold Expression Fold Expression Fold Expression Fold Expression Fold Design 201211_s_at DDX3X 29 15 2 122P. 17 A 19 A 34 A Xp11.4 Target 204955_at SRPX 949 250 4 626 P 75 65 p. 121 P Xp11.4 Target 218251_at STRAIT11499 62 29 2 36 P 515 :1 35 P 69 P ,,', Xp11.4 Target 219433_at BCOR 15 15 1 15 P 15 P 59 P 40 P Xp11.4 Target 201666_at TlMP1 3490 1588 2 3486 P 1763 P 806 P 42 A Xp11.3 Target 204866_at PHF16 27 15 2 30 P 20 P 49 P 82 P XpH.3 Target 207239_s_at PCTK1 62 35 2 73 P 87 P 211 P 156 P Xp11.3 Target 208823_s_at PCTK1 67 40 2 63 A 126 P 129 P 127 P Xp11.3 Target 203342_at TlMM17B 73 66 1 63 P 197 P 153 P 133 P Xp11.23 Target 203456_at JM4 102 64 2 112 P 35 P 126 P 15 A Xp11.23 Target 203776_at T54 57 52 1 67 P 73 P 61 P 196 P Xp11.23 Target 204269_at PIM2 34 23 1 25 A 110 P 38 P 42 P Xp11.23 Target 205324_s_at FTSJ1 186 107 2 141 P 413 P 195 P 264 P Xp11.23 Target 206846_s_at HDAC6 87 45 2 90 105 P 116 P 163 P XpH.23 Target pDI{~" -''\: 207769_s_at PQBP1 37 27 1 29 P 45 P 48 P 189 P Xp11.23 Target Target 210499_s_at PQBP1 15 15 1 27 P y~,:,"~" * 17 P 19 P 16 P Xp11.23 213787_s_at EBP 87 70 1 62 P 1~ • 153 P 147 P 161 P Xp11.23 Target 214527 _s_at PQBP1 68 52 1 58 P 95 P 71 P 346 P Xp11.23 Target 218619_s_at SUV39H1 39 33 1 25 54 P 40 P 125 P Xpi1.23 Target x ,," 218952_at PCSK1N 29 15 2 45 A , ' , 141 P 39 A 104 P Xp11.23 Target f'~ '",,_. AI~'S4; 219483_s_at PPN 37 22 2 39 A 113 P 46 A 45 A Xp11.23 Target ::' .~ 201589_at SMC1L1 150 50 3 139 P 221 P 253 P 435 P Xp11.22 Target 202383_at SMCX 74 51 1 72P 77P 76 P Xp11.22 Target 204408_at APEX2 47 27 2 26 61 P 52 P 57 P Xp11.22 Target

212916_at PHFB 16 15 1 22 MIP ~,ilill* 20 P 38 P 46 P Xp11.22 Target 219855_at NUDT11 71 48 1 32 A ' , 15 A 15 A 138 P Xp11.22 Target Table 11. Differentially expressed Chromosome-X genes represented on the HG-U133A GeneChip®

Gene NOSE Samples TOV81D OV90 TOV21G TOV112D Probe Probe Set Cytoband Symbol MAX MIN Fold Expression Fold Expression Fold Fold Fold Design

213627 _at MAGED2 199 121 2 145 P 90 P Xp11.21 Target 218573_at MAGEH1 56 50 1 96 P. .., 25 P Xp11.21 Target 200600_at MSN 988 599 2 764 P 260 P Xq12 Target 212341_at MGC21416 90 67 1 106 99 P Xq12 Target 207563_s_at OGT 34 22 2 56 , 56 P Xq13 Target 214224_s_at P/N4 141 66 2 57 :1P w 223 P Xq13 Target 206299_at TED 15 15 1 15 A 19 A Xq13.1 Target 209240_at OGT 126 93 1 170 302 P III Xq13:1 Target ,fi:, ~ 212307_s_at OGT 42 21 2 48 :PI @,*' 55 P Xq13.1 Target 212729_at DLG3 23 21 1 29 25 P Xq13.i Target 218355_at K/F4A 44 22 2 26 P 34 P Xq13.1 Target 219650_at FLJ20105 15 15 1 15 A 15 A Xq13.1 Target 214218_s_at X/ST 92 53 2 57 P 130 P Xq13.2 Target 20 1443_s_at A TP6AP2 655 446 1 569 P 389 P Xq21 Target 201444_s_at A TP6AP2 272 170 2 623 P 157 P Xq21 Target 221606_s_at NSBP1 19 15 1 15 A 15 P Xq21.1 Target 214430_at GLA 148 114 1 119 P 283 P 195 P Xq22 Target 203404_at ALEX2 285 102 3 291 15 A 15 A Xq22.i Target P fil- 'iilMk 205347 _s_at TMSNB 30 17 2 28 P • 17 P 150 P Xq22.1 Target 205499_at SRPUL 191 30 6 108 P 15 A 15 A Xq22.1 Target 218694_at ALEX1 131 38 3 95 P 15 P 15 A Xq22.1 Target 219335_at FLJ12969 28 20 1 26 P 46 P 53 P Xq22.1 Target 217963_s_at NGFRAP1 1681 1450 1 1431 P , 1148 P 1070 P Xq22.2 Target ru 217975_at LOC51186 492 408 1 360 P i\, '. 335 P 227 P Xq22.2 Target " ~ 209440_at PRPS1 150 122 1 167 P ,~1 270 P 258 P il Xq22.3 Target 206172_at /L13RA2 15 15 1 83 P 1 15 A 15 A Xq23 Target Table 11. Differentially expressed Chromosome-X genes represented on the HG-U133A GeneChip®

Probe Set Gene NOSE Samples TOV81D OV90 TOV21G TOV112D Cytoband Pro~e Symbol MAX MIN Fold Expression Fold Expression Fold Expression Fold Expression Fold Design 209628_at NXT2 49 39 1 23 p. 42 P 169 P Xq23 Target 219015_s_at MDS031 51 26 2 46 P 68 P 54 P Xq23 Target 201887_at /L13RA1 171 124 1 150 P 75 P 105 P Target 201888_s_at /L13RA1 31 20 2 40 P 15 P 15 P Xq24 Target 218757_s_at UPF3B 51 28 2 41 P 122 P 141 P Xq24 Target 220009_at RNF127 18 15 19 A III 39 P 55 P Xq24 Target 207983_s_at STAG2 66 54 1 62 P 78 P 163 P Xq25 Target 209022_at STAG2 148 112 1 149 P 253 P 423 P Xq25 Target 203446_s_at OCRL 121 90 1 111 P 88 P Xq25-Xq26 Target 205512_s_at PDCDB 106 79 1 88 P 140 P 171 P Xq26.1 Target 206039_at RAB33A 39 19 2 15 A. 16 A 15 A Xq26.1 Target 204984_at GPC4 15 15 1 15 A 15 A 118 P Xq26.2 Target 203689_,_al FMR1 58 25 2 54 P 71 P 107 P 104 P 1 Xq27.3 r"get 201864_at GD/1 511 417 1 407 P 1 384 P 281 P & 275 P ..ill'., '~.'.Xq28 Target 202275_at G6PD 54 50 1 82 P 472 P 101 P 38 P Mi,1i! Xq28 Target 203274_at FBA 110 66 2 98 P 16 A 218 P 101 P Xq28 Target 203744_at HMGB3 63 50 62 P 70 P 119 P 334 P Xq28 Target 203912_s_at DNASE1L1 88 47 2 108 P 15 A 93 P 20 A Xq28 Target 204425_at ARHGAP4 15 15 15 A 15 A 46 P 23 A Xq28 Target 204584_at L1CAM 25 15 2 15 A 15 A 1016 P 18 A Xq28 Target 204585_s_at L1CAM 15 15 1 15 A 15 A 75 P 15 A Xq28 Target

205777 at DUSP9 15 15 1 15 P 31 P~" 31 P 28 P '" Xq28 Target ' ..- 209279_s_at NSDHL 33 27 1 40 P 37 P ,,' ~ 45 P 46 P ;,~,Xq28 Target 219061_s_at DXS9B79E 102 56 2 87 P 136 P ;:,~~"·1197 P 162 P '>:':.' Xq28 Target 221746_at-. UBL4 71 58 1 60 M 135 P 1", 77 P 100 P '. Xq28 Target were found in the tumourgenic cell line TOV112D (n=30) and the fewest such genes were found in the non-tumourgenic cell line TOV81 D (n=3). Parallel results were obtained when the expression levels of 428 X-linked genes represented in the HG U 133A data set were evaluated independently: differentially expressed genes were most often detected in TOV112D (n=25) and least often detected in TOV81 0 (n=3) (Table 11). Analysis of 186 CHR-X genes represented in the Hu6800 data set did not reveal any differential expression in the ceilline TOV81 0 (Table 10). Of these 186 genes, very few varied at least three-fold relative to the NOSE samples even in the tumourgenic EOe ceillines: OV90 (n=8), TOV21G (n=6), and TOV112D (n=6).

3.5 Investigation of differentially expressed Chromosome-X genes

One hundred genes represented by 206 differentially expressed probe sets identified in the EOe cell lines were evaluated further as putative candidates in OC tumourgenesis.

3.5.1 Investigation of GeneChip® probe set designs

Twenty-three of 36 probe sets (64%) in the Hu6800 data set showed proper alignment with the target gene transcript based on the BLAT analysis, suggesting a reliable design (Table 10). Thirteen probe sets (36%) had a poor design on the account overlapping with non-target transcripts that mapped to other chromosomes (See Appendix 1). Seve nt y five percent of 137 probe sets in the HG-U 133A data set showed a high fidelity in their probe design (Table 11). Nine probe sets (7%) were reported by Affymetrix® to cross-hybridize with other sequences. Twenty-five probe sets (18%) had a poor design owing to sequences that either mapped within the target gene's intron (n=1), did not align with any CHR-X transcript (n=1), overlapped a gene family conserved motif (n=3), or aligned with non-target mRNAs mapping to either CHR-X (n=3) or other chromosomes (n=17) (See Appendix 1). Overall, an equivalent proportion of genes was represented by those differentially expressed probe sets from the Hu6800 data set (23 of 30 genes) and HG-U133A data set (90 of 124 genes) that had designs compatible with transcribed sequences (Tables 10 and 11).

29 3.5.2 Expression profiles of select genes in additional Affymetrix® data sets

Twenty-one of 23 differentially expressed genes represented by properly designed probe sets on the Hu6800 array were expressed (value>20 with P-call) in one or more tumour evaluated in the panel of borderline (n=6) and malignant (n=11) EOC tumours (Figure 4). These 21 genes were also expressed in at least one of six OC cell lines examined in a published Hu6800 data set by Ross et al. (2000) (Figure 5). The expression levels of nine genes were significantly different between the borderline and malignant tumours (p<0.05).

Figure 4. Expression profiles of differentially expressed genes in borderline and malignant EOC tumours ascertained with the Hu6800 GeneChip®

80 RBBP7 p=O.0006 RPS6KA3 p=O.004 60 200

100 20

~ ~ <:> N <:> :;: :; o 0

80 100 DDX3X p=O.009 H105E3 p=O.009 60 75

40 50

20 25

60 80 FMR1 p=O.01 EIF2S3 p=O.018 60 40

o Borderline EOC • Malignant EOC

30 Figure 5. Investigation of differentially expressed genes in a published microarray data set for NCIC60 ovarian cancer-derived cell lines. Probe sets on the Hu6800 GeneChip® representing chromosome-X genes that were differentially expressed relative to the NOSE samples were evaluated in an Affymetrix® Hu6800 data set for OC-derived cancer celllines published in Ross et al. (2000) Nat Genet 24: 227-235. Oashed lines indicate the range of expression values (maximum and minimum) of the 12 NOSE samples in our study. Gene expression was detected (value>20) in at least one of the six OC derived celllines for 21 of the 23 differentially expressed genes examined.

31 Figure 5, Expression candidate genes in a published data set of ovarian cancer-derived cel! lines

CD99 ~. +

TMSB4X,: II1II " ,~-'_~::"-,_'C ',,-, • J.E -, -.' + MSN ,1 II! J.E. - + SRPX ~~" ' .. \ PRPS1 11)>:?" : J TNRC11 .: l' ' PHF16 i!+: "_

SLC25A5 i II1II '" -':"t .e·- i ."'. ,- EIF2S3 .- + LOC91966 __ '

ELK1 ~~ Gene HPRT1 ,1 : f • FMR1 ..

RPS6KA3 i;'i5~ ' !. , 1 H105E3 '~

DDX3X lfi.-!, ' PIM2 ~, , --- RBBP7 ~l.;.'+ , " ARSD .. • IGROV1 O\ICAR-3 OVCAR-4 PIR •• • OVCAR-5 :1., O\ICAR-B SK-OV-3 " " - EOC MAX EOC MIN PGRMC1 ~~ -l' EBP i_ 1

o 500 1000 1500 2000 2500 3000 3500 4000 4500 5000

Expression Units 3.5.3 RT -PCR analysis of selected candidate genes

The expression of select candidate genes (n=11) was validated by RT-PCR analysis (Figures 6 and 7). The profiles generated by RT-PCR for eight genes were largely consistent with microarray studies (bar graphs). Smaller differences in gene expression values detected by microarray analysis across the EOC ceU lines (dark grey bars) and across the NOSE samples (Iight grey bas) were not seen by RT-PCR. No differences in band intensities were observed by hot RT -PCR for the gene PGRMC1.

Figure 6. RT -PCR analysis of differentially expressed genes identified in the EOC ceillines

A. RT-PCR studies B. Microarray analysis

--1 Z Z Z --1 0 Z Z 0 0 0 0 0 0 < < < 0 ~ N i 00 00 < < N (!)< ~ ~ ~ 0 '"(J) ~ 0 0 0 SRPX 18S

6000 TMSB4X TMSB4X , ~ 14000 18S Ulli~l, ~Illl :'00

--1 Z Z Z --1 0 0 0 0 0 < 0 ~ N< <(J) 00< N U1 ..,. ~ <(!) ~ 0 '" 00 0 0 0 SLC25A5 18S

--1 Z Z Z --1 0 Z 0 0 0 0 0 < 0 ~ ..,.< <(XJ <00 00 < ..,. <(!) ~ ~ '"(J) ~ 00 0 0 0 RBBP7 18S

lB NOSE Samples liliiii EOC Cell Lines

32 A. RT -PCR studies B. Microarray analysis

--1 --1 --1 Z Z 0 0 0 0 0 < < 0 00 5: < < ~ <(!) ~ ~ a N Gl a EIF2S3 ", ;0-", ::: EIF2S3 1 GAPDH 150 1 QccaocacDcccol •

--1 --1 --1 Z Z 0 0 0 0 0 < < 0 00 5: < < ~ <(!) 225 ~ ~ a N Gl a .. ·················································RPS6KAJ RPS6KA3 150 GAPDH ': l' DJlunOUO,OD0111dl --1 "1l --1 --1 0 ru z 0 0 Cl 5: ru 0 < < 0 ::0 < ~ ~ <(!) N ru- ~ a Gl a a 1 150 i PGRMC1 PGRMC1 111 GAPDH n. ~nnn IlnDJl~J ' :

PIM2 GAPDH

--1 "1l --1 --1 0 ru z 0 0 Cl 0 0 5: ru <00 < ::0 < ~ <(!) N ru- ~ a Gl a a D50 MSN GAPDH --~Il.111 ••-

225 ...... ~ ~ ...... ~ ..

150 SMC1L1 SMC1L 1 1 GAPDH 7: kLn oOOnULlLD 0 DJl 1111.

EJ NOSE Samples III!III EOC Cel! Lines

33 Figure 7. RT-PCR analysis of X/ST expression in four EOC ceillines. Heteroduplex RT-PCR was performed with a female control samples (placental RNA in lane 1) and a male control samples (testes RNA in lane 2), a reference NOSE sample (NOV31 in lane 4), and the four EOC cell lines (TOV21 G in lane 3; TOV81 0 in lane 5; OV90 in lanes 6- 7; and TOV112D in lanes 8-9. GAPDH was used as an internai control [Top bands]. XIST RNA was not detected in the EOC ceillines TOV112D and TOV21G [arrows].

34 Figure 7, RT -PCR analysis of X/ST expression in the EOC ceillines

l'II c c C) c N N s::: 1/) ...... -Q) Q) N M co 0 0 ...... (,) 0') 0') l'II 1/) > > > > > -Q) 0 0 0 > > 0 0 0:: ...... z .... 0 0 ......

Jilut.1i r!:;Uii ,5

X/ST \ \\ ~._~,t" 3.5.4. Localization of candidate genes on CHR-X relative to regions of interest in OC

The position of differentially expressed genes (n=100) along CHR-X was evaluated relative to regions of interest identified by others in OC (Figure 8). A high frequency of loss-of-heterozygosity (LOH) was reported for five regions of CHR-X [Yang-Feng et al.,1992; Choi et al.,1997; Buekers et al.,2000; Edelson et al.,1998]. The locus of 40 genes (10 over-expressed and 30 under-expressed) mapped within one of these minimal region of deletion (MRD). Seven additional genes that flanked a MRD mapped within 1 Mb of CHR-X markers with very high LOH frequencies (up to 100%).

Figure 8. Schematic diagram depicting the positions of differentially expressed CHR-X genes

x Candidate Gene ...... Buekers et al. (2000)

Yang-Feng et al. (1992) -À Edelson et al. (1998) ...... Choi et al. (1997) ...... Choi et al. (1997)

~-['- --1 ~ 0000000

20000000

x 30000000 x • 40000000 ; 50000000 60000000 CHR-X x Locus 1 70000000 (bps) x 80000000

90000000

100000000

110000000

120000000 ! 130000000 140000000 ..... 1 150000000

35 3.6 Molecular signature of Chromosome-X in highly tumourgenic EOC cel! lines

Loss-of-expression of the X-inactive-specific-transcript (X/ST) was investigated in the EOC cel! lines in relation to the pattern of differential CHR-X gene expression and the integrity of XCI mechanisms. X/ST expression was not detected for the cel! lines TOV112D and TOV21G by microarray analysis and RT-PCR (Table 11 and Figure 7). The global expression profile of CHR-X genes distinguished the cel! line TOV112D from the NOSE samples and the EOC cel! lines based on hierarchical clustering and correlation analysis of miroarray data (Figure 2 and Table 8). The cel!line TOV21G also exhibited a distinct expression profile for 449 probe sets that differed both from that of the EOC cel! lines and the NOSE samples. Correlation analyses were repeated for each of the autosomes (CHR 1 to 22) based on the probe set representation of these chromosomes on the Hu6800 GeneChip® (see Appendix Il). Low correlation coefficients were detected with certain autosomes. The expression profiles of these chromosomes were not comparable to that observed for CHR-X in the EOC cel! lines and NOSE samples.

Eighteen polymorphie markers were genotyped to verify the heterozygosity of the CHR X homologues in each of the EOC cel! line (Table 12). Both parent-of-origin chromosomes appeared to be present in the cel! lines OV90, TOV21 G, and TOV81 0 as suggested by heterozygosity at 9/17, 15/17, and 3/7 loci tested, respectively. In contrast, 16 of 17 loci tested were homozygous in the cel! line TOV112D. Heterozygosity was observed for one marker (AR) mapping to Xq, suggesting the possibility that both Xq homologues could be present in TOV112D. Numerical or cytogenetic abnormalities of the X-CHR were not observed for any of the four EOC cel! lines based on SKY karyotype analysis (data not shown).

36 Table 12. Allelotype analysis of the CHR-X content in the EOC ce!! lines

EOC CeU Unes Marker Cytoband TOV112D OV90 TOV21G TOV81D

Xp22.22 Xp22.22 Xp22.11 Xp22.11 DXS1068 Xp11,4 Xp11.3 Xp11.3 Xp11.23 Xp11.23 PLP2 Xp11.23 Xp11.22 Xp11.22 DXS991 Xp11.21 MSN Xq12 AR Xq12 Xq13.1 Xq13.1 Xq13.2 Xq13.2 PGK1 Xq21.1 Xq22.1 Xq22.1 SLC25A5 Xq24 HPRT Xq26.2 Xq26.3 Xq26.3 Xq28 Xq28

D No data • Homozygous Heterozygous

An allele-specific transcript detection assay was used to investigate whether the IOS5 of X/ST expression in the EOC cell lines TOV11 D and TOV21 G was associated with reactivation and over-expression of genes that are normally subjected to X-inactivation (Figure 9). Nineteen over-expressed genes were identified by microarray analysis and selected for further study. Seven genes (NONO, PLP2, MSN, PGK1, SLC25A5, UBE1, and USP11) represented on the Hu6800 array were selected based on having a distinctive pattern of expression ("outliar" with standard residual >2) when the CHR-X gene expression profiles of the cell lines TOV112D or TOV21 G were compared to that of the other EOC ceillines by weighted regression (see Appendix "1). Twelve other genes (CSTF2, DKC1, FHL1, HADH2A. K/F4A, MID1, PHKA1, POLA, RBM10, SUV39H1, TMSNB, ZNF261) , in addition to the genes NONO and PLP2, were selected from the

37 HG-U133A data set based on having values of expression in the cell lines TOV112D and/or TOV21 G that were at least two-fold higher than the mean of expression of the NOSE samples (see Appendix III). Seventeen of 19 genes are subjected to XCI (mono allelic expression), while two genes escape XCI (bi-allelic expression). An average of four single nucleotide polymorphisms (SNPs) mapping within the gene transcript were identified for 17 test genes (range=1 t013 SNP/gene) (Table 13). No coding SNPs (cSNP) were reported for two of 19 genes (HAOH2A and PHKA1).

Figure 9. Schematic representation of the allele-specific detection assay

Bi-Allelic Expression Mono-Allelic Expression

Xi 1* ----Xa 1* Xa PCR

cDNA cD NA cSNP tfV0fyfv]~ detection by

i, (' ... T C '.J 0 sequencing ;, ,\ G Gee .~ Genomic 1fwMJ\ NWW&f DNA

3752356; 3752356;

2 2

11795799 11795799

1803001 1803001

No.) No.)

1059295 1059295

(rs (rs

2728534; 2728534;

1803004; 1803004;

1802968 1802968

3208714; 3208714;

lines lines

11573533;6629934 11573533;6629934

11795799; 11795799;

2728533;2853350;2853355; 2728533;2853350;2853355;

transcript transcript

3183972; 3183972;

14952;2228658 14952;2228658

cell cell

9018 9018

3199958; 3199958;

gene gene

11573532; 11573532;

in in

EOC EOC

7878787; 7878787; 5945234; 5945234;

13731 13731

2746; 2746;

1803002; 1803002;

1802970; 1802970; 1802971;

1802191 1802191

SNP SNP

four four

3146 3146

in in

5952419 5952419 11573531; 11573531;

1800533; 1800533;

2728532; 2728532;

11557378 11557378

16657 16657

1803003; 1803003;

1802558;2794; 1802558;2794;

1046487;1046488;1046489;1046490;3186470;3186472; 1046487;1046488;1046489;1046490;3186470;3186472;

reported reported

1804872;2230147; 1804872;2230147;

cSNP cSNP

3752357; 3752357;

2853347; 2853347;

1802950; 1802950; 1802951;

12390;3147; 12390;3147;

6525006;6525007; 6525006;6525007;

1802647; 1802647;

11553614;7062004 11553614;7062004

1136457; 1136457;

No No 2272778; 2272778;

1136472; 1136472;

1046485; 1046485; 3752322 3752322

No No

3373 3373

1063508; 1063508; 1063509;

1319 1319

1127319; 1127319;

12008422; 12008422;

11573534; 11573534;

1802190;741500; 1802190;741500;

Heterogeneous. Heterogeneous.

transcripts transcripts

+ +

OV90 OV90

(HTG) (HTG)

gene gene

+ + +

in in

TOV81D TOV81D

Escapes, Escapes,

CHR-X CHR-X

cSNP cSNP

+ +

(E) (E)

of of

TOV21G TOV21G

Subject, Subject,

Informative Informative

(5) (5)

http://www.ncbLnlm.nih.gov/entrez/query.fcgi?db=Snp) http://www.ncbLnlm.nih.gov/entrez/query.fcgi?db=Snp)

detection detection

TOV112D TOV112D

1 1

S S

S S S S

S S

E E

S S

status: status:

HTG HTG

XCI

(dbSNP; (dbSNP;

(XCI) (XCI)

base base

Xq26.3 Xq26.3

Xq28 Xq28

Xq24 Xq24

Xq22.1 Xq22.1

Xq21.1 Xq21.1

Xq13.1 Xq13.1

Xq12 Xq12

Xp11.22 Xp11.22

Xp11.23 Xp11.23

Xp11.3 Xp11.3

Xp22.11 Xp22.11

Xp22.22 Xp22.22

data data

Allele-specific Allele-specific

Location Location

Inactivation Inactivation

SNP SNP

13. 13.

1 1

NCSI NCSI

CHR-X CHR-X

2 2

DKC1 DKC1

FHL1 FHL1

1 1

TMSNB TMSNB

SLC25A5 SLC25A5

CSTF2 CSTF2

PGK1 PGK1

ZNF261 ZNF261

PHKA1 PHKA1

NONO NONO

KIF4A KIF4A

MSNMSN MSNMSN

HADH2A HADH2A

SUV39H1 SUV39H1

USP11 USP11 PLP2 PLP2

UBE1 UBE1

RBM10 RBM10

POLA POLA

MID MID

Symbol Symbol

Gene Gene Table Table Informative cSNPs were detected in four of 19 genes (NONO, SLC25A5, and OKC1, and FHL 1) tested. Mono-allelic expression was observed for three genes subject to XCI: NONO was mono-allelically expressed in the cell line TOV21 G (Figure 1DA); SLC25A5 was mono-allelically expressed in the ceillines TOV81 0 (Figure 10B) and OV90 (Figure 10C); and OKC1 was mono-allelically expressed in the cell line OV90 (Figure 100). Bi allelic expression of the gene FHL 1, which is normally X-inactivated and expressed mono-allelically, was detected in the ceilline TOV21G (Figure 10E).

Figure 10. Allele-specific expression of Chromosome-X genes in the EOe ceillines

A. N li C T G fi

" gDNA

cDNA

B. C.

CACNG TTC CACNG TiC

~;V\/\ gDNA 1\z:tJ:l\Af\/\ gDNA

ih~ cDNA Jh;;;NA~ cD NA

D. ~ ______~ E. .-______~

b 1\ G li C C l:, C .w G A G T

gDNA " gDNA 1:. CNG"" GT l\àGGCCà cDNA ~ cDNA

39 DISCUSSION

4.1 Chromosome-X transcriptome of the in vitro OC model system

Normal tissues used in microarray studies as a reference for comparisons with tumour samples must be selected very carefully. The choice of normal tissue strongly influences which genes will be identified as differentially expressed. Exposure to cell culture conditions is known to influence the expression profiles of NOSE cells [Zorn et al., 2003]. Studying gene expression in an in vitro OC model system minimizes such artefacts, as NOSE primary cultures (reference normal) and long-term passages of tumour-derived cells (test samples) are both exposed to the tissue culture conditions. The expression profile established in cultured NOSE cells represents the expression of X-linked genes in dividing normal surface epithelial cells of the ovary. Epithelial ovarian cancer is thought to originate from NOSE cell lining the inclusion cysts of the ovary. Hierarchical clustering and correlation analyses showed that the 12 NOSE samples used for comparative analyses are very similar to one another based on the expression of CHR-X genes (Table 8 and Figure 2). The majority of X-linked genes appear to be under tight transcriptional regulation in NOSE cells. Fewer than eight percent of the ascertained genes varied at least a three-fold when comparing the maximum and minimum expression values in the NOSE samples (Table 7). Most variable genes were expressed at low levels «100). The CHR-X expression profile of NOSE cells was reproducible, independent of the number of NOSE samples assayed or the representation of CHR-X transcripts on the GeneChip® used for the analysis. The global patterns of gene expression observed for CHR-X are similar the expression profiles reported for previously studied chromosomes (CHR 3 and 17) [Manderson et al., 2002; Presneau et al., 2003; Tonin et al., 2001]. On the basis of their homogeneity in CHR-X gene expression, the NOSE samples appear to be a suitable comparison group for evaluating differential expression of X-linked genes in the EOC cell lines.

Nearly one third of ail CHR-X mapped probe sets represented on the Hu6800 and HG U 133A arrays gave values of expression that were below the detection threshold in the in vitro model, suggesting that many CHR-X genes are not expressed in ovarian tissues. Similar results were reported by a microarray study of CHR-17 gene expression [Presneau et al., 2003]. Seve nt y five percent of probe sets (n=130) in the Hu6800 data

40 set with reliable expression values, as compared to 93% of probe sets from the HG U133A data set (n=403), gave expression values that fell outside of the range of expression values of the NOSE samples in at least one of four EOC cell lines. This contrasts to the findings reported for CHR-17 where a smaller proportion of probe set expression values that were above the threshold level for detection (62% of n=252 probe sets) fell outside of the range of expression observed in the NOSE samples in at least one EOC ceilline [Presneau et aL, 2003]. Although differences between the expression profiles for CHR-17 and CHR-X may be attributable to the sizes of data sets, they more likely reflect biological differences in the genes expressed from each of these chromosomes in ovarian cancer. Differences observed between the Hu6800 and HG U 133A data sets probably result from the algorithms (Mas4 and Mas5) used to calculate average difference ratios from scanned images. Data sets derived with Mas 5 are less compressed than those generated with Mas4, accounting for the broader range of gene expression values observed with the HG-U133A GeneChip®. It is likely that the number of probe sets exhibiting expression values outside of the range of expression in NOSE samples was overestimated for those CHR-X genes represented in the HG-U133A data set.

Previous studies have reported that the patterns of altered gene expression in ovarian cancer reflect the morphological features and biological behaviour of tumours in vivo, or the phenotypes exhibited by EOC cell lines in vitro [Schwartz et al., 2002; Manderson et aL, 2002; Presneau et aL, 2003; Tonin et aL, 2001]. Consistent with findings from these studies, global patterns of CHR-X gene expression determined by hierarchical clustering and correlation analysis appeared to be related with the biological characteristics exhibited by the EOC cell lines and NOSE samples, including that of two seemingly misclassified samples (TOV81 D and NOV1181).

The misclassified sample NOV1181 was harvested from the ovaries of a patient with a germline BRCA2 mutation, in the context of a prophylactic oophorectomy. NOV1181 is also unusual in that expression of the X/ST transcript was not detected by microarray analysis in this sam pie (PN Tonin, unpublished data). Interestingly, NOV1181 clustered with one of two tumourgenic EOC cell lines that did not express the X/ST transcript either. The grouping observed for the EOC cell line TOV81 D matches the findings of other studies, which reported that this cell line displays a gene expression profile

41 comparable to that of NOSE cells [Manderson et aL, 2002; Presneau et aL, 2003; Tonin et aL, 2001]. The phenotype exhibited by the EOC cell line TOV81D - epithelial morphology, anchorage-dependent growth, and inability to form tumours in nude mouse xenografts - approaches that of NOSE primary cultures (Table 2). TOV81 0 represents the least aggressive form of EOC as suggested by the indolent clinical presentation of the disease (>5 yrs disease-free and >7 yrs survival) in the patient from whom TOV81 0 was derived [Provencher et aL, 2000].

Hierarchical clustering analysis established that three tumourigenic EOe cell lines (TOV112D, TOV21 G, and OV90) differed the most from the cell line TOV81 0 and the NOSE samples, based on the expression of CHR-X genes (Figure 2 and Table 8). The cel! lines TOV112D, TOV21 G, and OV90 formed separate clusters, indicating some divergence (albeit to a lesser degree) in their CHR-X expression profiles. The highly tumourgenic EOC cel! line TOV112D consistently branched the furthest from the NOSE samples and the EOC cel! lines. The cel! lines TOV21 Gand OV90 branched in different orders depending on the data set analyzed (Hu6800 or HG-U133A). Branching patterns for the cel! lines OV90 and TOV81D and the NOSE samples did not reveal the same high degree of similarity between CHR-X expression profiles that was demonstrated from the correlation analysis of the Hu6800 and HG-U133A data sets. Branching patterns for the cel! lines TOV112D and OV90 also did not reflect the large deviation observed between the expression profiles of these cel! lines based on correlation analysis of the Hu6800 data set. Clustering pattern of TOV112D was consistent with the distinctive CHR-X expression profile identified by correlation analysis for this the cel! line.

A similar pattern of expression to that of CHR-X has not been observed in the EOC cel! lines for any chromosome studied previously [Manderson et al., 2002; Presneau et al., 2003; Tonin et aL, 2001]. Typical findings from previous studies are as described in Presneau et al. (2003) for the expression of CHR-17 genes in the in vitro mode!. The study reported CHR-17 expression profiles that were very highly correlated (p>0.94) across 12 NOSE samples and between al! three tumourgenic EOC cell lines, as weil as highly correlated (p >0.81) between ail four EOC cell lines. A global pattern of expression similar to that of CHR-X was not detected for correlation analyses of chromosomes 1 to 22 (see Appendix Il). Although low correlation coefficients were

42 detected with certain autosomes, a pattern of gene expression comparable to that of CHR-X was not observed.

4.2 Differentiai expressed chromosome-X genes associated with OC or the tumourgenic potential of OC

The expression profiles of 446 CHR-X genes were evaluated in four EOC cell lines, three tumourgenic EOC cell lines, or in individual EOC cell lines to identify X-linked genes whose expression is associated with ovarian cancer or the tumourgenic potential of the disease. Twenty-six genes were differentially expressed in the four EOC cell lines while almost twice as many genes (n=42) were differentially expressed in the tumourgenic EOC cell lines. Three genes that were differentially expressed in ail of the tumourgenic cell lines (SRPX, MSN, and HPRT1) were identified in both GeneChip® analyses, which serves as independent confirmation that these genes are indeed differentiallyexpressed. Very few CHR-X genes (73 of 446) had expression levels that varied at least three-fold in one or more EOC cell line, when compared to the NOSE samples. Both GeneChip® analyses identified seven differentally expressed genes (CD99, DDX3X, PHF16, PIM2, PIR, SRPX, and T54) that varied at least 3-fold relative to the NOSE samples. The expression profiles of these genes were concordant in the two data sets, also confirming that these genes are differentially expressed. The sm ail number of CHR-X genes differentially expressed in the EOC cell lines suggests that such changes may be relevant in ovarian cancer.

Of the 73 differentially expressed genes identified, not one varied at least three-fold relative to the NOSE samples in ail four EOC cell lines. This is not surprising since the three genes that varied at least three-fold in the cell line TOV81D (MBTPS2, DDX3X, and IL 13RA2) were not differentially expressed in any other EOC cell line. Only two differentially expressed genes (EIF2S3 and ALEX2) had expression levels that varied at least 3-fold in ail the tumourgenic ceillines (Tables 10 and 11). The gene EIF2S3, which was over-expressed relative to the NOSE samples, has not been described in the context of cancer. This gene encodes the gamma subunit of the eukaryotic translation initiation factor 2 complex. It is a GTP-binding protein involved in the recruitment of met tRNA to the 40 S ribosomal subunit [Gaspar et al., 1994]. The gene ALEX2 (arm protein lost in epithelial cancers, X chromosome, 2) was under-expressed relative to the

43 NOSE samples. The expression of this putative TSG is lost or significantly down regulated in ovarian carcinomas and other tumours of epithelial origin. Since the expression of ALEX2 is readily detectable in tumours of non-epithelial origin (i.e. sarcomas and gliomas), the tumour suppressor function of this gene is thought to be epithelial-specifie [Kurochkin et al., 2001].

Although the tumourgenic EOe cell line TOV112D displayed the greatest number of differentially expressed genes that varied at least three-fold relative to the NOSE samples, only two of these 30 genes (TNRC11 and T54) were differentially expressed only in TOV112D. At least half of ail genes found to be differentially expressed in TOV112D gave expression levels in the four EOC cell lines, or in ail three tumourgenic cell lines, that were outside of the range of expression of the NOSE samples. This was unexpected as TOV112D presented a very distinguishing profile of global CHR-X expression that differed from the other ceillines.

Most differentially expressed genes showed increased, rather than decreased, levels of expression relative to the NOSE samples. These results are consistent with previous findings for studies of chromosomes 17 and 3 [Manderson et al., 2002; Presneau et al., 2003; Tonin et al., 2001]. Increased CHR-X gene expression levels may result from the hypomethylation of genomic DNA, which is common in cancer [Hanahan and Weinberg, 2000]. The majority of CpG islands are methylated on the inactive X-CHR (Xi). Therefore, genes subjected to XCI may be particularly susceptible to aberrant methylation [Shapiro and Mohandas, 1983]. Anderson and Brown (2002) found that in normal cells, hypomethylation of the T1MP1 promoter on the Xi resulted in stable expression of the gene at levels equivalent to the Xa [Anderson and Brown, 2002]. The tumour-specific MAGE antigens on CHR-X are over-expressed in cancer cells due to the demethylation of their promoter [De Smet et al., 1999]. Silenced or decreased CHR-X gene expression levels could also result from regional hypermethylation of CpG islands by de nova methyltransferases such as DNMT1. CHR-X genes subjected to XCI are functionally hemizygous and could therefore be silenced by the methylation of a single allele. Increased DNMT1 expression correlates with the progression of carcinomas, and may explain why under-expressed genes are detected more frequently in tumourgenic EOC cell lines [Belinsky et al., 1996; Issa et al., 1993].

44 4.3 Investigation of candidate Chromosome-X genes

The study of CHR-X gene expression with the Hu6800 and HG-U133A GeneChips® established that at least 24 percent of differentially expressed probe sets identified in the in vitro OC model system have designs that are incompatible with transcribed sequences (see Appendix 1). This translates into a false positive rate of 27 percent when selecting candidate genes or 41 of 154 genes, which owing to poor probe designs, may not actually be differentially expressed (Tables 10 and 11). Arcand et al. reported comparable results when the designs of Hu6800 GeneChip® probe sets mapping to chromosome 22 were investigated [Arcand et al., 2004]. Collectively, these findings emphasize the importance of investigating probe set designs (albeit a tedious endeavour) when using a microarray-based approach for identifying differentially expressed genes.

Evaluation of gene expression profiles in primary cultures of EOC tumours (borderline and malignant) and in published data from OC-derived cancer cell lines established that 21 of 23 candidates identified with the Hu6800 GeneChip® were expressed at detectable levels (Figures 4 and 5). Nine of 23 genes showed statistically significant differences when comparing their expression levels in borderline and malignant tumours (Figure 4). These findings corroborated the suitability of the in vitro model for studying gene expression in ovarian cancer. Furthermore, these results suggest that differentially expressed CHR-X genes are important in the development or progression of ovarian cancer. Due to the unavailability of other data sets for comparison, the profiles of candidate genes identified with the HG-U 133A array were not evaluated further. RT PCR analysis of 11 candidate genes gave an overall pattern of expression for eight genes that was compatible with the GeneChip® analysis (Figures 6 and 7). Many other studies have reported a discrepancy between the gene expression profiles generated by these two methods [Russo et al., 2003]

Microarray analysis identified genes reported by others in the context of ovarian cancer (n=8) and/or other cancers (n=49), in addition to 51 new candidate CHR-X genes (Table 14). Five candidates are transcriptionally regulated by BRCA1 [Welcsh et al., 2002] while others, which interact with BRCA 1 (n=10) or BRCA2 (n=2), are implicated in DNA repair, cell cycle regulation, or apoptosis. The novel candidates presented here (41 up

45 Table 14A. Description of over-expressed Chromosome-X genes identified in the EOC ceillines

CC> IJJ .., Il) CC> ~ Q, CC> ...... ,..... '"CC> Q .., ...... '" .., .... CC> ...... (1) .., Gene Symbol ~ Q;: >< .., Q, CC> (1) ...... Q ...... al 0:( :: ffi Q ..... ~ ~ Cl 0:( ...... '" .... g: ..... l! U 1- ~ '" IJJ :x: :x:(1) 0 (!) '" Q, .... a: ~ Cl (!) .., (!) e: II) '"al ~ '" ~ ...... ~ ~ g: .... ~ L! l3 u'" u ~ Q;: Q;: Q;: (1) u Cl -J ~ ~ al ~ -J ~ CC> :5 Q, Q;: ~ II) ~ .... 0 al Cl 0:( 0:( 0:( 0:( 0:( 0:( al Cl Cl Cl Cl IJJ ~ Üj IJJ Le Le ~ LeU. (!) (!) (!) (!) (!) ë!: :x: ~ :x: ::! ~ s:: .,J .,J ~ :: :: XCI t E E E 5 E E 5 5 5 5 HTG E 5 5 5 5 5 Near Region of X X X X X X X X X X X X X X X X X X X LOH in OC «1Mb) Implicated in cancer X X X X X X X X X X X X X X X X X X X X X X Implicated in OC X X X Interacts with known X1 X X1 X3 X3 X1 TSG or Oncogene X CeU cycle X X X X X X X X Developmentl X X X X X X X Differentiation Growth X X X X X Metabolisml X X X X X X X X X X Catabolism Apoptosis X DNA Repair X Immunity Transport X X X CeU morphology, X X X X X X motility, adhesion Signal transduction X X X X X X X X Hormonal regulation X X X X Chromatin X X remodeling T ranscription/ X X X X X X X X X Translation Protein degradation X X or modification Otherl Unknown X X X X X X X X

1 Interacts with BRCA 1 21nteracts with BRCA2 31nteracts with other T5G or Oncogene implicated in OC (Src, Wnt, RB1 , A TM) t X-Chromosome Inactivation (XCI) status: 5ubjected (5), Escapes (E), Heterogenous (HTG) Table 14A. Description of over-expressed Chromosome-X genes identified in the EOC ceillines (Continued) ...... Il) .... ~ :c: .... ::t: ~ ...... CIO u ...... J "1 ...... "1 ... "1 ""1 ~ ~ "1 >< CIl Gene Symbol .... 0...... ~ Cl ~ .... 0.. "0...... J "1 .... (!) ...... ~ U ~ u CIl ~ CI) ~ U CIl CIl LI.. U ~ ~'" ~ CI) -J 12 (,!) Il: :c: ~ ~ ~ Cl U ...J Cl Il: 9 CI) E I! (,!) u u (,!) ~ 0 g: g: CIl g: ~ LU ...J ~ ~ ~ :::, ~ ~ ~ :c: :c: 0 0 0.. 0.. ~ 0.. ~ ~il: ~ lt 0.. 0: ~ 0: CI) CI) CI) CI) CI) ~ CI) ~ ~ ~ ~ ~ ~ ~ ~ XCl t 5 E 5 E S S 5 E S E S E S E E S S S S S Near Region of X X X X X X X X X X X X X X X X X X LOH in OC «1Mb) Implicated in cancer X X X X X X X X X X X X Implicated in OC Interacts with known X1 X X3 X1 X1.2 X X1-3 X1 X3 X1 TSG or Oncogene Cell cycle X X X X X X X DevelopmenU X X X X X X X X X X Differentiation Growth X X X X Metabolism/ X X X X X X Catabolism Apoptosis X X X X X X DNA Repair X X Immunity X X Transport X X X X X X X Cell morphology, X X motility, adhesion Signal transduction X X X X X X X X Hormonal regulation X X X X Chromatin X X X X remodeling Transcription/ X X X X X X X X X X X Translation Protein degradation X X or modification Other/ Unknown X X X X X X X X X X -- "----- 11nteracts with BRCA1 21nteracts with BRCA2 31nteracts with other T5G or Oncogene implicated in OC (Src, Wnt, RB1 , ATM) t X-Chromosome Inactivation (XCI) status: 5ubjected (5), Escapes (E), Heterogenous (HTG) Table 148. Description of under-expressed Chromosome-X genes identified in the EOC ceillines

cc -1 Q 00 ..... Q.. ~ - >< 1 UJ - "1' ::'i LI. GeneSymbol ~ CI) [il -aï .... -1 .., ~ - -~ Il> CI) co ~ - S - 1 .., (!I (!I 0.. - CI) .... UJ "1' U :z: ~ - ct: ta .... 0.. "1' ~ li '" - ~ CI) § (!I -::e 1 -1 -1 ct: ~ ~ Cl ~ CS u !!.! '" - ::e 0 ct: ct: j:: OC( OC( OC( OC( OC(u Cl ~ (!I -::! .... -1 ~ ~ ::e :z: :z:0 ~ ~ CI) CI) ~ ~ )(. XCl t E 5 S 5 5 5 5 5 5 HTG E 5 Near Region of X X X X X X X X X X LOH in OC «1Mb) Implicated in cancer X X X X X X X X X X X X X X X X X Implicated in OC X X X X X 'L'" a"L" YV'LII known X3 X3 X3 X X3 IT"'''' /'"\, Cell cycle X X Developmentl X X X X X Differentiation Growth X X X Metabolism! X X X Catabolism Apoptosis X X X DNA Repair Immunity Transport X X X X X Cell morphology, X X X X X X X X motility, adhesion Signal transduction X X X X X X X X X X IIVIIIIVnal 1."""I,,Hnn X X Chromatin remodeling Transcription! X Translation 1 Protein degradation X or modification Other! Unknown X X X X X X X X X X X X X 11nteracts with BRCA1 21nteracts with BRCA2 tlnteracts with another TSG or Oncogene implicated in OC (Src, Wnt, RB1, ATM, ) t X.Chromosome Inactivation (XCI) status: 5ubjected (5), Escapes (E), Heterogenous (HTG) regulated, 11 down regulated) act in various cellular processes from metabolism (n=12) to cell cycle regulation (n=3). Five novel candidates interact with known oncogenes/TSG implicated in ovarian carcinomas (n=5). The physical locations of 30 over-expressed genes and 10 under-expressed genes overlapped minimal regions of deletion (MRD) of the X-chromosome that were identified by other studies in OC tumours (Figure 8). Seven under-expressed genes mapping within a MRD were previously investigated in the context of cancer (Table 14). Three of these genes (SRPX, MSN, and C099), which were studied specifically in OC, encode membrane proteins involved in cell adhesion, signaling, and cytoskeleton dynamics. The gene MSN, which is a putative marker for distinguishing ovarian tumours from colon tumours in the abdomen, is closely related to the tumour suppressors NF1/2 [Nishizuka et aL, 2003]. Loss-of-expression of the putative TSG SRPX is associated with the progression towards more malignant phenotypes in various cancers [Kim et al., 2003; Mukaisho et al., 2002; Shimakage et aL, 2002; Shimakage et aL, 2000;Yamashita et aL, 1999]. The C099 gene induces motility in breast cancer cells and is regulated by androgens [Lee et aL, 2002; Shen et aL, 1998]. Microarray analysis of CHR-X gene expression in the OC model system identified differentially expressed genes that are strong candidates for ovarian tumourgenesis based on the following characteristics: [1] having interesting expression profiles in EOC tumours (Figure 2); [2] being implicated in OC and/or other cancers (Table 14); [3] interacting with a known TSG involved in OC (Table 14); [4] mapping to regions with high frequencies of genetic aberrations in OC tumours (Figure 8); and/or [5] regulating processes that underlie tumourgenesis (Table 14).

4.4 Molecular signature of Chromosome-X gene expression in highly tumourgenic EOC cell lines

The molecular signatures of CHR-X expression obtained when analyzing of the Hu6800 and HG-U133A data sets distinguished TOV112D and TOV21G from the NOSE samples and the other EOC cell lines (Table 8 and Figure 2). These cell lines also differed from other EOC cell lines in that expression of X/ST mRNA was not detectable (Figure 7). Previous studies demonstrated that, at the chromosomal level, X/ST transcript was not required for the maintenance of X-inactivation in somatic cells [Csankovszki et al., 1999]. At the gene level however, loss of X/ST expression destabilized X-inactivation and increased the reactivation frequency of individual genes [Csankovszki et aL, 2001]. In

46 the absence of X/ST transcript, demethylation and histone hypoacetylation increased reactivation of X-linked genes even further. The lack of X/ST transcript in TOV112D and TOV21 G could indicate that XCI was compromised in these cell lines owing to the loss of-expression of X/STfrom the Xi. Alternatively, it could indicate that the Xi was lost.

Karyotype analysis performed for the EOC cell lines verified that OV90, TOV81 D, TOV112D, and TOV21G each harbour two copies of the X-chromosome. Polymorphie microsatellite markers were tested to determine the parental origin of the CHR-X homologues in the EOC cell lines. Consistent with the presence of both the maternai and paternal CHR-X homologues, most loci tested were heterozygous when the cell lines TOV21G, OV90, and TOV81D were allelotyped (Table 12). Of sixteen microsatellite markers tested for the cell line TOV112D only fourteen were informative. TOV112D was heterozygous for two polymorphie markers that mapped to the large arm of CHR-X suggesting that, at least for Xq, both parent-of-origin CHR-X homologues are present. The presence of maternai and paternal homologues in TOV112D could not be determined for the sm ail arm of CHR-X, as too few markers were tested relative to the size of this chromosome. The allele-specific expression of 19 genes (17 undergo XCI, 2 escape XCI) was examined in the EOC cell lines to determine if loss of the X/ST transcript was associated with the reactivation genes normally subject to XCI in TOV112D and TOV21 G (Figure 9). The majority of cSNPs were uninformative for the genes that were tested (Table 13). Mono-allelic expression was observed for the genes NONO, SLC25A5, and DKC1 in at least one EOC cell line (Figure 10A-D). These genes are subjected to XCI and are normally expressed only from the Xi. Bi-allelic expression was detected in the cell line TOV21G for FHL1, a gene that is a priori expressed exclusively from the Xa as it undergoes XCI (Figure 1OE).

These findings suggest that different mechanisms are involved in the loss of X/ST expression in the cell lines TOV112D and TOV21 G. The combined results of karyotype analysis, allelotyping studies, and allele-specific transcript detection support that the absence of X/ST mRNA in TOV21 G is attributable to the loss-of-expression of this gene from the inactive-X. In this ceilline, loss-of-X/ST is also associated with destabilized XCI and the reactivation of at least one gene normally subjected to XCI. Based on microarray expression data, the lack of X/ST expression does not result from the increased expression of its anti-sense transcript TS/X (data not shown). For TOV112D,

47 the findings are most consistent with this cell line having lost the inactive-X and duplicated the active-X. However, the results are not incompatible with the loss-of expression of X/STfrom the inactive-X. In order to determine the mechanism behind the absence of X/ST transcript in TOV112D, the presence of both a maternal-derived and paternal-derived copy of CHR-X will have to be verified. The microsatellite markers for which TOV112D was heterozygous mapped near the centromere in close proximity to one another. This small centromeric interval could have been translocated onto another chromosome prior to losing the inactive-X, accounting for the presence of two alleles in this cell line. More extensive allelotyping is needed to determine with certainty the parental origin of both CHR-X homologues in TOV112D. A more extensive study of allele-specific expression could identify putative reactivated genes in the cell line TOV112D, as weil as any additional genes reactivated in the ceilline TOV21G.

Although the significance of X/ST loss in ovarian cancer remains to be determined, one study found that X/ST expression levels predicted a poor prognosis and non-response to chemotherapy in ovarian cancer [Huang et al., 2002]. The high frequency (60%) of Xi loss detected in a series of 22 female tumour-derived cell lines suggests that X/ST loss may even be a common occurrence in female cancers [Kawakami et al., 2004]. Further evidence is provided in the extensive body of literature dating back as far as the 1950's describing the loss of Barr Bodies in various cancers types [Barr and Moore, 1957; Borah et al., 1980; Coutts et al., 1956; Ghosh et al., 1983; Ghosh et al., 1979]. Many of these studies found associations between Barr body loss, a poor prognosis, angiogenesis, and decreased survival [Coutts et al., 1956; Ghosh and Shah, 1981; Rajeswari et al., 1977]. A comparative genomic hybridization (CGH) study of 141 EOC tumours recently determined that the loss of Xq 13 in ovarian carcinomas is significantly associated with higher nuclear grades and advanced disease [Ramus et al., 2003]. Intriguingly, the X/ST locus maps within this interval.

Current studies have focused on resolving the mechanisms of Xi loss in cancer. One probable mechanism involving loss of the Xi followed by duplication of the Xa has been described in the context of many cancers including: cervical cancer [Atkin et al., 1989], female colorectal neoplasms [Muleris et al., 1990; Sakurazawa et al., 2000], the breast cancer cell lines Elco and MCF7 [Wang et al., 1990], intracranial germ-cell tumours [Okada et al., 2002], esophageal tumours [Ghosh et al., 1983], as weil as other cancer

48 types [Liao et al., 2003]. Although less evidence exists for reactivation of the inactive-X as the second mechanism of Xi loss, aberrant reactivation of the gene SSA T was described previously in the context of cancer. SSA T, which undergoes XCI in normal cells, is over-expressed in the lung cancers of female patients, as a result of the somatic reactivation of this gene [Mank-Seymour et al., 1998]. Bi-allelic expression of three other genes normally subjected to XCI (PGK1, OTC, and G6PO) has also been observed in murine tumour-derived cell lines [Beggs et al., 1986; Yoshida, 2002; Goss, 1984; Endo et al., 1998]. A potential hormonal basis for Xi reactivation is supported by the finding that 1713 estradiol treatment of Hela cells leads to reactivation of a previously inactive CHR-X [Ghosh et al., 1979]. Characterization of a series of female tumour derived cell lines suggested that the main mechanism underlying X/ST loss-of expression in cancer is the loss of Xi followed by duplication of the Xa. Interestingly, the only incidences of X/ST loss-of-expression aUributable to Xi reactivation were observed in ovarian cancer-derived ceillines [Kawakami et al., 2004].

4.5 Unique mechanism affecting chromosome-X genes in tumourgenesis

ln the context of cancer, autosomal and X-linked genes acquire aberrant functions through one of the five following mechanisms: (1) gene mutations, (2) deletions, (3) rearrangements/translocations, (4) chromosomal gains/losses, and (5) various epigenetic aberrations. Genes subject to XCI are the targets of additional mechanisms that do not affect autosomes (Figure 11). X-inactivated genes are functionally hemizygous in normal female cells as they are expressed exclusively from the Xa. Eradication of the active allele could be sufficient for the complete loss-of-function of a putative TSG on CHR-X (Top). The gain-of-function of putative CHR-X oncogenes is a consequence that could result from Xi reactivation in somatic cells. Aberrant bi-allelic expression would be functionally equivalent to gene duplication, or perhaps even gene amplification. Given that that the X-CHR is inherently responsive to methylation changes, X-linked genes may be more susceptible to epigenetic mechanisms like aberrant demethylase and methyltransferase activity even though the autosomes and sex chromosomes are equal targets at the molecular level [Mohandas et al., 1981].

49 Figure 11. Mechanisms altering the dosages of cancer-related genes subjected to X chromosome inactivation (XCI).

A. Putative X-linked TSG Gene XaXi Silencing Xa Xi ..... Loss of . . • Expression • Delction )(r • Mutation 1V • fu • Hypcrmcthylation Il< iiIl ... ~ ..... ua ....NA

B. Putative X-linked oncogene

Xa Xi Xa Xi Gene 1[" Reactivation i ' 1 Bi-Allelic • .. Expression . ~ 1 • Mislocalization or i i 1 Loss of the coat 01 l XISTmRNA .... ~ "~_RN&

4.6 Strengths and limitations of this study

This study characterized the expression of CHR-X genes in an in vitro model of ovarian cancer using two generations of Affymetrix® GeneChips. The in vitro model proved useful in the identification of differentially expressed X-linked genes associated with ovarian cancer. Microarray studies are often limited by the quality and quantity of available mRNA. Cultured cells provide a continuai source of abundant mRNA that is readily available. Varying degrees of contaminating tissues, such as stromal cells or infiltrating lymphocytes, can confound expression data if the arrayed tumours are not microdissected. The culture of tumour cells also provides an alternative means of eliminating such heterogeneity when technologies such as laser capture microdissection are not accessible. The use of an in vitro model also enables the study of differential expression in the context of X-inactivation. Genes transcribed from the active-X to be distinguished from those transcribed from the inactive-X due to the clonality of the EOC cell lines. Each EOC cell lines has a priori retained the same inactivate CHR-X

50 homologue. For that reason, allele-specific transcripts with expressed polymorphisms can be used to discriminate whether differentially expressed genes that are normally subjected to XCI are expressed mono-allelically, or have become reactivated (expressed bi-allelically) in ovarian cancer. Most cancer-derived cell lines that are currently under study have been immortalized by chemical or viral transformation. Confounding genetic events that are unrelated to the original tumour can be introduced when cell lines are established using these methods. The EOC ce Il lines used in this study were spontaneously immortalized, and as such, reflect more accurately the molecular phenotypes of the tumours from which they were derived. The disadvantage of using the model system to study CHR-X gene expression is that tumour-derived cell in vitro may not always mirror the tumour cells in vivo. Clonai selection of tumour cells in vitro throughout successive passages may skew the initial cell population by favouring the expansion of certain genetic variants and the elimination of others. The small number of EOC cell lines comprising the model also precludes a comprehensive study of cancer related CHR-X genes. The model was weil suited for the identification of differentially expressed CHR-X genes as each of the EOC cell line display different molecular and biological phenotypes. It became difficult however, to evaluate the significance of these genes in ovarian tumourgenesis without a larger repertoire of EOC cell lines since the frequency of altered expression cannot be established. ln normal cells, an estimated five percent of genes are active at any given time [Russo et al., 2003]. The levels of mRNA in a cell determine protein levels for most genes, as transcriptional regulation is more efficient than regulation at the level of translation [Russo et al., 2003]. Deregulated expression of a subset of genes, resulting from acquired genetic and epigenetic aberrations, determines a cell's capacity for unlimited growth and for malignancy. Microarray analysis allows the expression of thousands of genes to be studied simultaneously in one single experiment. This technology is weil suited for studying epigenetic changes in gene expression levels that arise in cancer from the aberrant functioning of TSG and oncogenes. This approach has also proved useful in identifying differentially expressed genes associated karyotypic anomalies [Arcand et al., 2004; Manderson et al., 2002]. The main limitation of this microarray study is that information can only be obtained for those CHR-X genes that were represented on the Hu6800 and HG-U133A GeneChips®. Potentially important genes in ovarian cancer, such as the recently characterized FANGB gene located at Xp22.3, were

51 not represented on the Hu6800 or HG-U 133A arrays. Computational methods used to calculate the average intensity ratios from scanned images influenced the nature of the data sets. As such, differences in gene expression values may not always reflect biological differences in transcript copy numbers. The inconsistency between gene expression profiles generated quantitative RT-PCR and those generated by microarray analysis represents a complicating factor in validating target genes. The co st associated with microarray technology may also be prohibitive for carrying out experiments in replicate sets. A limitation of microarray analysis particular to this study of CHR-X is that this technology could not discriminate gene expression patterns related to X-inactivation, such as chromosome-specifie gene expression.

4.7 Future directions and further studies

Differentially expressed CHR-X genes described in this study may provide new differentiation markers that reflect histopathological subtypes as weil as potential markers that predict the tumourgenic potential of cells. Expression profiling of candidates in a large panel of ovarian tumours is required to determine their importance in ovarian cancer. X-linked genes that prove to be differentially expressed at high frequencies in OC tumours are strong candidates and should be investigated further by a quantitative RT -PCR analysis. The expression levels of such candidate genes in tumour could then be related to clinical parameters such as prognosis, response to treatment, or disease-free survival, in order to determine clinically relevant associations. /n vivo studies of gene function would ultimately verify the role of candidate genes in ovarian cancer. Transgenic animal models with a candidate gene under the regulation of an inducible ovary-specific promoter could elucidate the function of putative oncogenes that were identified as over-expressed in ovarian tumours. Creating a knock out animal model or alternatively using siRNA to inhibit gene function would clarify the cellular function of putative tumour suppressor genes identified as under-expressed in the EOC cell lines.

The implications and significance of the loss of X/ST expression in ovarian tumours is not known at present. The frequency of X/ST loss-of-expression, as weil as whether or not this loss corresponds with changes in XCI, has yet to be established. A study of 22 cell lines derived from carcinomas of the ovary, breast, and cervix provided preliminary

52 evidence that this could be a common occurrence in female cancers [Kawakami et aL, 2004]. To verify this finding X/ST transcript levels could be investigated by quantitative RT-PCR in a comprehensive panel of ovarian tumours representative of ail the histopathological subtypes. Fluorescent immunohistochemistry could then be used to detect the presence or absence of CHR-X inactivation markers such as Barr Bodies, Histone-3-methyl-lysine-9 (H3K9), or macroH2A 1, in those tumours that do not express X/ST. It will be interesting to determine if this phenotype is clinically relevant in ovarian cancer. If proven relevant, it may provide a novel prognostic indicator, or a new marker for predicting response to treatment. One study has already reported an association between the expression of X/ST and resistance to the chemotherapeutic agent Taxol [Huang et aL, 2002].

There is accumulating evidence from expression profiling and genetic studies that genes involved in sporadic and hereditary ovarian cancers converge into the same molecular pathways that underlie cancer susceptibility [Jazaeri et aL, 2002]. Turner, Tutt, and Asworth recently proposed that certain sporadic cancers share the characteristics of hereditary cancers linked to the BRCAlFanconi Anemia genes due to a common underlying defect in homologous recombination DNA repair. They termed these shared characteristics a "BRCAness" phenotype [Turner et aL, 2004]. The newly discovered association between the TSG BRCA 1 and XCI raises the possibility that X/ST dysfunction, including mislocalization or loss-of-expression, could play a role in the tumourgenesis of both sporadic and hereditary cancers [Ganesan et al., 2002; Ganesan et aL, 2004]. One of the 11 Fanconi Anemia associated genes (FANCB) was very recently localized to Xp22.31 on the X-chromosome and is subjected to X-inactivation [Meetei et aL, 2004]. Intriguingly, LOH of the Xp22.3 interval occurs at high frequencies in ovarian cancers, and at an even higher frequency in BRCA 1-linked ovarian tumours [Buekers et aL, 2000]. This raises the possibility that the X/ST (-) phenotype of sporadic tumours may have functional equivalency to the phenotype of hereditary tumours with underlying defect in BRCA-Fanconi Anemia associated genes. Expression profiling of sporadic and hereditary ovarian tumours with and without X/ST loss-of-expression would be useful in identifying the molecular signature of associated with the X/ST (-) phenotype and elucidating any functional redundancy with the proposed "BRCAness" phenotype. A preliminary analysis of ovarian tumours investigated with the HG-U133A GeneChip® showed X/ST loss-of-expression in a subset of these tumours [Tonin et aL, 2004, unpublished data]. Intriguingly, correlation analysis based on the expression values of probe set that map to CHR-X did suggest a distinctive molecular signature of CHR-X gene expression in these tumours (data not shown).

SUMMARY AND CONCLUSION

The high frequencies of loss-of-heterozygosity (LOH) and anomalies of chromosome X (CHR-X) in ovarian cancers (OC) support a role for genes on this CHR in ovarian tumourgenesis [Yang-Feng et aL, 1992; Yang-Feng et aL, 1993; Pieretti et aL, 2002; Osborne and Leech, 1994; Iwabuchi et aL, 1995; Edelson et aL, 1998; Choi et aL, 1997; Cheng et aL, 1996; Buekers et aL, 2000]. Conventional molecular genetic mapping techniques have limited use in identifying genes associated with recurrent CHR-X anomalies in ovarian tumours as this chromosome is subject to inactivation. In this study, large-scale oligonucleotide microarray expression analysis (Affymetrix®) was applied as an alternative approach for the identification of putative X-linked genes implicated in ovarian tumourgenesis.

The expression of CHR-X genes was evaluated in an in vitro OC model system comprised of 4 weil characterized spontaneously immortalized epithelial OC (EOC) cell lines and 12 primary cultures of normal ovarian surface epithelial (NOSE) cells [Tonin et aL, 2001; Provencher et aL, 2000]. Analyses were performed with two generations of Affymetrix® GeneChips containing 205 probe sets (Hu6800 array) or 612 probe sets (HG-U133A array) corresponding to known CHR-X genes or ESTs. The global expression profile of CHR-X genes was established in EOC cell lines by hierarchical clustering (GeneSpring©) and correlation analysis (Excel). Candidate genes were determined by two-way comparisons of gene expression in the EOC cell lines and NOSE samples. Fold-differences in expression were calculated relative to range of expression observed in the NOSE samples. This study identified 51 new candidate CHR-X genes in addition to identifying genes reported by others in the context of OC (n=8) and/or other cancers (n=49). Many X-linked genes are strong candidates for ovarian tumourgenesis based on mapping to regions showing high frequencies of genetic aberrations in OC and/or their interaction with other known TSG involved in OC. Genes described in this study may provide new markers of differentiation that reflect

54 histopathological subtypes of OC, or novel markers associated with the tumourgenic potential of OC tumours.

The loss of X/ST expression is associated with a poor prognosis and resistance to the chemotherapeutic drug Taxol in ovarian cancer [Huang et aL, 2002]. Two highly tumourgenic EOC cell lines (TOV112D and TOV21 G) with distinctive CHR-X expression profiles did not express X/ST. Allelotyping studies verified the presence of both parent of-origin X-chromosomes in the cell line TOV21 Gand failed to confirm the origin of X homologues in TOV112D. Aberrant bi-allelic expression of an X-inactivated gene (FHL1) was detected in TOV21 Gand not in TOV112D. In the absence of X/ST mRNA to coat the inactive CHR-X in somatic cells, the repressed state of inactivated CHR-X genes becomes destabilized. Taken together these results imply two different mechanisms underlying the loss of X/ST transcript in EOC cell lines: (1) Duplication of the active-X followed by loss of the inactive-X (i.e. TOV112D); or (2) Reactivation of the inactive-X (i.e. TOV21G).

55 ONLINE RESOURCES

SNP Oatabases

GeneSNP, The Environmental Genome Project, University of Utah http://www.genome.utah.edu/genesnps/ Human Browser, UCSC Genome Bioinformatic, UCSC Human Genome Project http://www .genome. ucsc. edu/cgi-bin/hgGateway Human SNP Database, Whitehead Institute, MIT Centre for Genome Research http://www. broad. mit. edu/snp/human/ HGVbase, The Human Genic Bi-Allelic Sequences Oatabase http://hgvbase.cgb.ki.se/ JSNP, The Oatabase of Japanese SNP http://snp.ims.u-tokyo.ac.jp/ dbSNP, National Centre for Biotechnology Information http://www.ncbi.nlm.nih.gov/SNP/ SNP500Cancer, Cancer Genome Anatomy Project, National Cancer Institute http://snp500cancer. nci. nih. gov TSC, The SNP Consortium Ltd http://snp.cshl.org/

Gene Information

Atlas of Genetics and Cytogenetics in Oncology and Haematology Oessen P, Huret JL. Chromosome X Atlas Genet. Cytogene. t Oncol. Haematol. 2002. http://www.infobiogen.fr/services/chromcancer/index.html

Cancer Genetics Web www.cancer-genetics.org

Gene Cards, Weizmann Institute of Science http://bioinfo.weizmann.ac.il/cards/index.html

Cancer Gene, Centre national de resources informatiques appliqués à la génomique http://caroll.vjf.cnrs.fr/cancergene/HOME.html

LocusLink, National Centre for Biotechnology Information http://www. ncbi. nlm. nih.gov/LocusLink/

Cancer Gene, Waldman Gene List, UCSC Cancer Centre http://cc.ucsf.edu/people/waldman/GENES/agenes.html

56 LlTERATURE CITED

Ahluwalia A, Yan P, Hurteau JA, Bigsby RM, Jung SH, Huang TH, Nephew KP (2001) DNA methylation and ovarian cancer. 1. Analysis of CpG island hypermethylation in human ovarian cancer using differential methylation hybridization. GynecolOnco/82: 261-268

Anderson CL, Brown CJ (2002) Variability of X chromosome inactivation: effect on levels of TIMP1 RNA and role of DNA methylation. Hum Genet 110: 271-278

Arcand SL, Mes-Masson AM, Provencher D, Hudson T J, Tonin PN (2004) Gene expression microarray analysis and genome databases facilitate the characterization of a chromosome 22 derived homogeneously staining region. Mol Carcinog 41: 17-38

Atkin NB, Fox MF, Baker MC (1989) A comparison of the number of X-chromatin bodies and of X chromosomes in carcinomas of the cervix uteri. Cytobios 60: 111-114

Auersperg N, Wong AS, Choi KC, Kang SK, Leung PC (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22: 255-288

Barr ML, Moore KL (1957) Chromosomes, sex chromatin, and cancer. Proc Can Cancer Conf2: 3-16

Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP (1998) Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res 72: 141-196

Beggs AH, Axelman J, Migeon BR (1986) Reactivation of X-linked genes in human fibroblasts transformed by origin-defective SV40. Somat Cel! Mol Genet 12: 585-594

Belinsky SA, Nikula KJ, Baylin SB, Issa JP (1996) Increased cytosine DNA methyltransferase activity is target-cell-specific and an early event in lung cancer. Proe Nat! Acad Sei USA 93: 4045-4050

Benson,G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nueleie Aeids Researeh 27(2): 573-580

Borah V, Shah PN, Ghosh SN, Sampat MB, Jussawalla DJ (1980) Further studies on the prognostic importance of Barr body frequency in human breast cancer: with discussion on its probable mechanism. J Surg Oneo/13: 1-7

Boumil RM, Lee JT (2001) Fort Y years of decoding the silence in X-chromosome inactivation. Hum Mol Genet 10: 2225-2232

57 Buekers TE, Lallas TA, Buller RE (2000) Xp22.2-3 loss of heterozygosity is associated with germline BRCA 1 mutation in ovarian cancer. Gynecol Onco/76: 418-422

Carrel L, Cottle AA, Goglin KC, Willard HF (1999) A first-generation X-inactivation profile of the human X chromosome. Proc Nat! Acad Sci USA 96: 14440-14444

Carrel L, Willard HF (1999) Heterogeneous gene expression from the inactive X chromosome: an X-linked gene that escapes X inactivation in some human cell lines but is inactivated in others. Proc Nat! Acad Sci USA 96: 7364-7369

Chadwick BP, Willard HF (2001) Histone H2A variants and the inactive X chromosome: identification of a second macroH2A variant. Hum Mol Genet 10: 1101-1113

Chadwick BP, Willard HF (2003) Chromatin of the Barr body: histone and non-histone proteins associated with or exciuded from the inactive X chromosome. Hum Mol Genet 12: 2167-2178

Chen Y J, Vortmeyer A, lhuang l, Gibril F, Jensen RT (2004) X-chromosome loss of heterozygosity frequently occurs in gastrinomas and is correlated with aggressive tumor growth. Cancer 100: 1379-1387

Cheng PC, Gosewehr JA, Kim TM, Velicescu M, Wan M, lheng J, Felix JC, Cofer KF, Luo P, Biela BH, Godorov G, Dubeau L (1996) Potential role of the inactivated X chromosome in ovarian epithelial tumor development. J Nat! Cancer Inst 88: 510-518

Choi C, Cho S, Horikawa l, Berchuck A, Wang N, Cedrone E, Jhung SW, Lee JB, Kerr J, Chenevix-Trench G, Kim S, Barrett JC, Koi M (1997) Loss of heterozygosity at chromosome segment Xq25-26.1 in advanced human ovarian carcinomas. Genes Chromosomes Cancer 20: 234-242

Choi C, Kim MH, Juhng SW (1998) Loss of heterozygosity on chromosome XP22.2- p22.13 and Xq26.1-q27.1 in human breast carcinomas. J Korean Med Sci 13: 311-316

Coutts WE, Coutts WR, Silva-Inzunza E (1956) Sex chromatin in cells of prostatic hypertrophy and prostatic cancer. Br J Uro128: 268-270

Csankovszki G, Nagy A, Jaenisch R (2001) Synergism of Xist RNA, DNA methylation, and histone hypoacetylation in maintaining X chromosome inactivation. J Cel! Biol 153: 773-784

Csankovszki G, Panning B, Bates B, Pehrson JR, Jaenisch R (1999) Conditional deletion of Xist disrupts histone macroH2A localization but not maintenance of X inactivation. Nat Genet 22: 323-324

58 D'Adda T, Candidus S, Denk H, Bordi C, Hofler H (1999) Gastric neuroendocrine neoplasms: tumour clonality and malignancy-associated large X-chromosomal deletions. J Patho/189: 394-401

De Smet C, Lurquin C, Lethe B, Martelange V, Boon T (1999) DNA methylation is the primary silencing mechanism for a set of germ line- and tumor-specific genes with a CpG-rich promoter. Mol Ce" Biol 19: 7327-7335

Edelson MI, Lau CC, Colitti CV, Welch WR, Bell DA, Berkowitz RS, Mok SC (1998) A one centimorgan deletion unit on chromosome Xq12 is commonly lost in borderline and invasive epithelial ovarian tumors. Oncogene 16: 197-202

Endo Y, Watanabe T, Kuwabara K, Tsunashima K, Mishima Y, Arakawa M, Takagi N, Kominami R (1998) Difference in chromatin packaging between active and inactive X chromosomes by fractionation and allele-specific detection. Biochem Biophys Res Commun 244: 220-225

Evtimova V, Zeillinger R, Kaul S, Weidle UH (2004) Identification of CRASH, a gene deregulated in gynecological tumors. Int J Onco/24: 33-41

Fukushima Y, Kuroki Y, Ito T, Kondo 1, Nishigaki 1 (1987) Familial retinoblastoma (mother and son) with 13q14 deletion. Hum Genet 77: 104-107

Furuya T, Ochi H, Watanabe S (1989) Common fragile sites in chromosomes of bone marrow cells and peripheral blood lymphocytes from healthy persons and leukemia patients. Cancer Genet Cytogenet 43: 131-138

Ganesan S, Silver OP, Drapkin R, Greenberg R, Feunteun J, Livingston DM (2004) Association of BRCA 1 with the inactive X chromosome and XIST RNA. Philos Trans R Soc Land B Biol Sci 359: 123-128

Ganesan S, Silver OP, Greenberg RA, Avni D, Drapkin R, Miron A, Mok SC, Randrianarison V, Brodie S, Salstrom J, Rasmussen TP, Klimke A, Marrese C, Marahrens Y, Deng CX, Feunteun J, Livingston DM (2002) BRCA1 supports XIST RNA concentration on the inactive X chromosome. Ce" 111: 393-405

Gaspar NJ, Kinzy TG, Scherer BJ, Humbelin M, Hershey JW, Merrick WC (1994) Translation initiation factor eIF-2. Cloning and expression of the human cDNA encoding the gamma-subunit. J Biol Chem 269: 3415-3422

Geisler JP, Hatterman-Zogg MA, Rathe JA, Buller RE (2002) Frequency of BRCA 1 dysfunction in ovarian cancer. J Nat! Cancer Inst 94: 61-67

Ghosh SN, Shah PN (1981) Probable mechanism for the loss of Barr body in human female tumor with special reference to breast cancer. Med Hypotheses 7: 1099-1104

59 Ghosh SN, Shah PN, Banerji AP (1979) loss of X-chromatin and X-chromosome activation in Hela cells. Acta Cyto/23: 169-172

Ghosh SN, Shah PN, Desai PB (1983) Barr body frequency in esophageal cancer in Indian women. Acta Cyto/27: 202-203

Goss SJ (1984) The associated reactivation of two X-linked genes. The spontaneous and azacytidine-induced reexpression of ornithine transcarbamoylase and glucose-6- phosphate dehydrogenase in a rat hepatoma. J Cel! Sci 72: 241-257

Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cel! 100: 57-70

Hattori M, Sakamoto H, Satoh K, Yamamoto T (2001) DNA demethylase is expressed in ovarian cancers and the expression correlates with demethylation of CpG sites in the promoter region of c-erbB-2 and survivin genes. Cancer Lett 169: 155-164

Heinzelmann-Schwarz VA, Gardiner-Garden M, Henshall SM, Scurry J, Scolyer RA, Davies MJ, Heinzelmann M, Kalish lH, Bali A, Kench JG, Edwards lS, Vanden Bergh PM, Hacker NF, Sutherland Rl, O'Brien PM (2004) Overexpression of the cell adhesion molecules DDR1, Claudin 3, and Ep-CAM in metaplastic ovarian epithelium and ovarian cancer. Clin Cancer Res 10: 4427-4436

Huang KC, Rao PH, Lau CC, Heard E, Ng SK, Brown C, Mok SC, Berkowitz RS, Ng SW (2002) Relationship of XIST expression and responses of ovarian cancer to chemotherapy. Mol Cancer Ther 1: 769-776

Hultborn R, Hanson C, Kopf l, Verbiene l, Warnhammar E, Weimarck A (1997) Prevalence of Klinefelter's syndrome in male breast cancer patients. Anticancer Res 17: 4293-4297

Issa JP, Vertino PM, Wu J, Sazawal S, Celano P, Nelkin BD, Hamilton SR, Baylin SB (1993) Increased cytosine DNA-methyltransferase activity during colon cancer progression. J Nat! Cancer Inst 85: 1235-1240

Iwabuchi H, Sakamoto M, Sakunaga H, Ma YY, Carcangiu Ml, Pinkel D, Yang-Feng Tl, Gray JW (1995) Genetic analysis of benign, low-grade, and high-grade ovarian tumors. Cancer Res 55: 6172-6180

Jacobs P, Saxe N, Gordon W, Nelson M (1984) Dyskeratosis congenita. Haematologic, cytogenetic, and dermatologie studies. Scand J Haemato/32: 461-468

Jazaeri AA, Yee CJ, Sotiriou C, Brantley KR, Boyd J, Liu ET (2002) Gene expression profiles of BRCA 1-linked, BRCA2-linked, and sporadic ovarian cancers. J Natl Cancer Inst 94: 990-1000

60 Jiang F, Richter J, Schraml P, Bubendorf L, Gasser T, Sauter G, Mihatsch MJ, Moch H (1998) Chromosomal imbalances in papillary renal cell carcinoma: genetic differences between histological subtypes. Am J Patho/153: 1467-1473

Jones HW, TURNER HH, Ferguson-Smith MA (1966) Turner's Syndrome and pheno~pe. Lancet1: 1155

Kaku T, Ogawa S, Kawano Y, Ohishi Y, Kobayashi H, Hirakawa T, Nakano H (2003) Histological classification of ovarian cancer. Med Electron Microsc 36: 9-17

Kawakami T, Zhang C, Taniguchi T, Kim CJ, Okada Y, Sugihara H, Hattori T, Reeve AE, Ogawa 0, Okamoto K (2004) Characterization of loss-of-inactive X in Klinefelter syndrome and female-derived cancer cells. Oncogene 23: 6163-6169

Kim CJ, Shimakage M, Kushima R, Mukaisho K, Shinka T, Okada Y, Inoue H (2003) Oown-regulation of drs mRNA in human prostate carcinomas. Hum Pathol 34: 654-657

Klein CB, Conway K, Wang XW, Bhamra RK, Lin XH, Cohen MD, Annab L, Barrett JC, Costa M (1991) Senescence of nickel-transformed cells by an X chromosome: possible epigenetic control. Science 251: 796-799

Klein G (1981) The role of gene dosage and genetic transpositions in carcinogenesis. Nature 294: 313-318

Knuutila S, Aalto Y, Autio K, Bjorkqvist AM, El Rifai W, Hemmer S, Huhta T, Kettunen E, Kiuru-Kuhlefelt S, Larramendy ML, Lushnikova T, Monni 0, Pere H, Tapper J, Tarkkanen M, Varis A, Wasenius VM, Wolf M, Zhu Y (1999) ONA copy number losses in human neoplasms. Am J Patho/155: 683-694

Kratzert-Adams K, Adelson MD, Badawy SZ, Stein CK, Gordon L (1992) Endometrial adenocarcinoma without prior hormone replacement in a diabetic patient with gonadal dysgenesis. Obstet Gyneco/79: 849-853

Kurochkin IV, Yonemitsu N, Funahashi SI, Nomura H (2001) ALEX1, a novel human armadillo repeat protein that is expressed differentially in normal tissues and carcinomas. Biochem Biophys Res Commun 280: 340-347

Lee HJ, Kim E, Jee B, Hahn JH, Han K, Jung KC, Park SH, Lee H (2002) Functional involvement of src and focal adhesion kinase in a C099 splice variant-induced motility of human breast cancer cells. Exp Mol Med 34: 177-183

Lee JT, Oavidow LS, Warshawsky 0 (1999) Tsix, a gene antisense to Xist at the X inactivation centre. Nat Genet 21: 400-404

Liao OJ, Du QQ, Yu BW, Grignon D, Sarkar FH (2003) Novel perspective: focusing on the X chromosome in reproductive cancers. Cancer Invest 21: 641-658

61 Lin H, Huber R, Schlessinger D, Morin PJ (1999) Frequent silencing of the GPC3 gene in ovarian cancer ceillines. Cancer Res 59: 807-810

Lyon MF (1986) X chromosomes and dosage compensation. Nature 320: 313

Lyon MF (1999) X-chromosome inactivation. Curr 8io/9: R235-R237

Manderson EN, Mes-Masson AM, Novak J, Lee PD, Provencher D, Hudson T J, Tonin PN (2002) Expression profiles of 290 ESTs mapped to chromosome 3 in human epithelial ovarian cancer cell lines using DNA expression oligonucleotide microarrays. Genome Res 12: 112-121

Maniatis T, Fritsch EF, and Sam brook J (1982) Co Id Spring Harbor Laboratory Press: Cold Spring Harbor, NY

Mank-Seymour AR, Murray TR, Berkey KA, Xiao L, Kern S, Casero RA, Jr. (1998) Two active copies of the X-linked gene spermidine/spermine N1-acetyltransferase (SSAT) in a female lung cancer cell line are associated with an increase in sensitivity to an antitumor polyamine analogue. Clin Cancer Res 4: 2003-2008

Martinez-Zaguilan R, Lynch RM, Martinez GM, Gillies RJ (1993) Vacuolar-type H(+) ATPases are functionally expressed in plasma membranes of human tumor cells. Am J Physio/265: C1 015-C1 029

Matsui H, Ishii J, Onodera T, Takano H, Seki K, Sekiya S (1997) Endometrial carcinoma in 45,X Turner's syndrome without hormone replacement therapy. Gyneco/ Onco/65: 548-552

McDonald HL, Gascoyne RD, Horsman D, Brown CJ (2000) Involvement of the X chromosome in non-Hodgkin Iymphoma. Genes Chromosomes Cancer 28: 246-257

Meetei AR, Levitus M, Xue Y, Medhurst AL, Zwaan M, Ling C, Rooimans MA, Bier P, Hoatlin M, Pals G, de Winter JP, Wang W, Joenje H (2004) X-linked inheritance of Fanconi anemia complementation group B. Nat Genet 36: 1219-1224

Mohandas T, Sparkes RS, Shapiro LJ (1981) Reactivation of an inactive human X chromosome: evidence for X inactivation by DNA methylation. Science 211: 393-396

Motegi T, Kaga M, Yanagawa Y, Kadowaki H, Watanabe K, Inoue A, Komatsu M, Minoda K (1983) A recognizable pattern of the midface of retinoblastoma patients with interstitial deletion of 13q. Hum Genet 64: 160-162

Mukaisho K, Suo M, Shimakage M, Kushima R, Inoue H, Hattori T (2002) Down regulation of drs mRNA in colorectal neoplasms. Jpn J Cancer Res 93: 888-893

62 Muleris M, Dutrillaux AM, Salmon RJ, Dutrillaux B (1990) Sex chromosomes in a series of 79 colorectal cancers: replication pattern, numerical, and structural changes. Genes Chromosomes Cancer 1: 221-227

Nishizuka S, Chen ST, Gwadry FG, Alexander J, Major SM, Scherf U, Reinhold WC, Waltham M, Charboneau L, Young L, Bussey KJ, Kim S, Lababidi S, Lee JK, Pittaluga S, Scudiero DA, Sausville EA, Munson PJ, Petricoin EF, III, Liotta LA, Hewitt SM, Raffeld M, Weinstein JN (2003) Diagnostic markers that distinguish colon and ovarian adenocarcinomas: identification by genomic, proteomic, and tissue array profiling. Cancer Res 63: 5243-5250

Novak JP, Siadek R, Hudson T J (2002) Characterization of variability in large-scale gene expression data: implications for study design. Genomics 79: 104-113

O'Doherty AM, Church SW, Russell SE, Nelson J, Hickey 1 (2002) Methylation status of oestrogen receptor-alpha gene promoter sequences in human ovarian epithelial cell lines. Br J Cancer 86: 282-284

Ogawa Y, Lee JT (2003) Xite, X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Ce" 11: 731-743

Okada Y, Nishikawa R, Matsutani M, Louis ON (2002) Hypomethylated X chromosome gain and rare isochromosome 12p in diverse intracranial germ cell tumors. J Neuropathol Exp Neurol 61: 531-538

Osborne RJ, Leech V (1994) Polymerase chain reaction allelotyping of human ovarian cancer. Br J Cancer 69: 429-438

Perinchery G, Nojima D, Goharderakhshan R, Tanaka Y, Alonzo J, Dahiya R (2000) Microsatellite instability of dinucleotide tandem repeat sequences is higher than trinucleotide, tetranucleotide and pentanucleotide repeat sequences in prostate cancer. Int J Onco/16: 1203-1209

Piao Z, Malkhosyan SR (2002) Frequent loss Xq25 on the inactive X chromosome in primary breast carcinomas is associated with tumor grade and axillary Iymph node metastasis. Genes Chromosomes Cancer 33: 262-269

Pieretti M, Hopenhayn-Rich C, Khattar NH, Cao Y, Huang B, Tucker TC (2002) Heterogeneity of ovarian cancer: relationships among histological group, stage of disease, tumor markers, patient characteristics, and survival. Cancer Invest 20: 11-23

Pizzi S, D'Adda T, Azzoni C, Rindi G, Grigolato P, Pasquali C, Corleto VD, Delle FG, Bordi C (2002) Malignancy-associated allelic losses on the X-chromosome in foregut but not in midgut endocrine tumours. J Patho/196: 401-407

Plath K, Fang J, Mlynarczyk-Evans SK, Cao R, Worringer KA, Wang H, de la Cruz CC, Otte AP, Panning B, Zhang Y (2003) Role of histone H3 lysine 27 methylation in X inactivation. Science 300: 131-135 Presneau N, Mes-Masson AM, Ge B, Provencher D, Hudson T J, Tonin PN (2003) Patterns of expression of chromosome 17 genes in primary cultures of normal ovarian surface epithelia and epithelial ovarian cancer ceillines. Oncogene 22: 1568-1579

Provencher DM, Lounis H, Champoux L, Tetrault M, Manderson EN, Wang JC, Eydoux P, Savoie R, Tonin PN, Mes-Masson AM (2000) Characterization of four novel epithelial ovarian cancer ceillines. In Vitro Cell Oev Biol Anim 36: 357-361

Rajeswari S, Ghosh SN, Shah PN, Borah VJ (1977) Barr body frequency in the human breast cancer tissue. A prospective study on its prognostic value and its correlation with specifie oestradiol receptors. Eur J Cancer 13: 99-102

Ramus SJ, Pharoah PD, Harrington P, Pye C, Werness B, Bobrow L, Ayhan A, Wells D, Fishman A, Gore M, DiCioccio RA, Piver MS, Whittemore AS, Ponder BA, Gayther SA (2003) BRCA 1/2 mutation status influences somatic genetic progression in inherited and sporadic epithelial ovarian cancer cases. Cancer Res 63: 417-423

Rangel LB, Agarwal R, D'Souza T, Pizer ES, Alo PL, Lancaster WD, Gregoire L, Schwartz DR, Cho KR, Morin PJ (2003) Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomas. Clin Cancer Res 9: 2567-2575

Ross DT, Scherf U, Eisen MB, Perou CM, Rees C, Spellman P, Iyer V, Jeffrey SS, van de RM, Waltham M, Pergamenschikov A, Lee JC, Lashkari D, Shalon D, Myers TG, Weinstein JN, Botstein D, Brown PO (2000) Systematic variation in gene expression patterns in human cancer ceillines. Nat Genet 24: 227-235

Russo G, Zegar C, Giordano A (2003) Advantages and limitations of microarray technology in human cancer. Oncogene 22: 6497-6507

Sakurazawa N, Tanaka N, Onda M, Esumi H (2000) Instability of X chromosome methylation in aberrant crypt foci of the human colon. Cancer Res 60: 3165-3169

Santin AD, Zhan F, Bellone S, Palmieri M, Cane S, Bignotti E, Anfossi S, Gokden M, Dunn D, Roman JJ, O'Brien T J, Tian E, Cannon MJ, Shaughnessy J, Jr., Pecorelli S (2004) Gene expression profiles in primary ovarian serous papillary tumors and normal ovarian epithelium: identification of candidate molecular markers for ovarian cancer diagnosis and therapy. Int J Cancer 112: 14-25

Schwartz DR, Kardia SL, Shedden KA, Kuick R, Michailidis G, Taylor JM, Misek DE, Wu R, Zhai Y, Darrah DM, Reed H, Ellenson LH, Giordano T J, Fearon ER, Hanash SM, Cho KR (2002) Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas. Cancer Res 62: 4722-4729

64 Sennoune SR, Bakunts K, Martinez GM, Chua-Tuan JL, Kebir Y, Attaya MN, Martinez Zaguilan R (2004) Vacuolar H+-ATPase in human breast cancer cells with distinct metastatic potential: distribution and functional activity. Am J Physiol Cell Physio/286: C 1443-C 1452

Shapiro LJ, Mohandas T (1983) DNA methylation and the control of gene expression on the human X chromosome. Cold Spring Harb Symp Quant Biol 47 Pt 2: 631-637

Shen J, Zhau HE, Hursting SD, Chung LW (1998) Androgen regulation of the human pseudoautosomal gene MIC2, a potential marker for prostate cancer. Mol Carcinog 23: 13-19

Shibata S, Lee JT (2003) Characterization and quantitation of differential Tsix transcripts: implications for Tsix function. Hum Mol Genet 12: 125-136

Shibata S, Lee JT (2004) Tsix Transcription- versus RNA-Based Mechanisms in Xist Repression and Epigenetic Choice. Curr Biol 14: 1747-1754

Shimakage M, Kawahara K, Kikkawa N, Sasagawa T, Yutsudo M, Inoue H (2000) Down regulation of drs mRNA in human colon adenocarcinomas. Int J Cancer 87: 5-11

Shimakage M, Takami K, Kodama K, Mano M, Yutsudo M, Inoue H (2002) Expression of drs mRNA in human lung adenocarcinomas. Hum Patho/33: 615-619

Simpson JL, Rajkovic A (1999) Ovarian differentiation and gonadal failure. Am J Med Genet 89: 186-200

Sieddens HF, Oostra BA, Brinkmann AO, Trapman J (1992) Trinucleotide repeat polymorphism in the androgen receptor gene (AR). Nuc/eic Acids Res 20: 1427

Tamayo P, Sionim D, Mesirov J, Zhu Q, Kitareewan S, Dmitrovsky E, Lander ES, Golub TR (1999) Interpreting patterns of gene expression with self-organizing maps: methods and application to hematopoietic differentiation. Proc Natl Acad Sci USA 96: 2907-2912

Taniguchi T, Tischkowitz M, Ameziane N, Hodgson SV, Mathew CG, Joenje H, Mok SC, D'Andrea AD (2003) Disruption of the Fanconi anemia-BRCA pathway in cisplatin sensitive ovarian tumors. Nat Med 9: 568-574

Tonin PN, Hudson T J, Rodier F, Bossolasco M, Lee PD, Novak J, Manderson EN, Provencher D, Mes-Masson AM (2001) Microarray analysis of gene expression mirrors the biology of an ovarian cancer mode!. Oncogene 20: 6617-6626

Turner HH, Greenblatt RB, Dominguez H (1963) Syndrome of gonadal dysgenesis and abdominal testis with an XO/XY chromosome mosaicism. J Clin En do crin 01 Metab 23: 709-716

65 Turner N, Tutt A, Ashworth A (2004) Hallmarks of 'BRCAness' in sporadic cancers. Nat Rev Cancer 4: 814-819 van Dartel M, Hulsebos T J (2004) Characterization of PMP22 expression in osteosarcoma. Cancer Genet Cytogenet 152: 113-118

Wang N, Cedrone E, Skuse GR, Insel R, Dry J (1990) Two identical active X chromosomes in human mammary carcinoma cells. Cancer Genet Cytogenet 46: 271- 280

Wang XW, Lin X, Klein CB, Bhamra RK, Lee YW, Costa M (1992) A conserved region in human and Chinese hamster X chromosomes can induce cellular senescence of nickel transformed Chinese hamster ceillines. Carcinogenesis 13: 555-561

Wasenius VM, Jekunen A, Monni 0, Joensuu H, Aebi S, Howell SB, Knuutila S (1997) Comparative genomic hybridization analysis of chromosomal changes occurring during development of acquired resistance to cisplatin in human ovarian carcinoma cells. Genes Chromosomes Cancer 18: 286-291

Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, Lathrop M (1992) A second-generation linkage map of the human genome. Nature 359: 794-801

Welcsh PL, Lee MK, Gonzalez-Hernandez RM, Black DJ, Mahadevappa M, Swisher EM, Warrington JA, King MC (2002) BRCA 1 transcriptionally regulates genes involved in breast tumorigenesis. Proc Natl Acad Sci USA 99: 7560-7565

Xu J, Meyers D, Freije D, Isaacs S, Wiley K, Nusskern D, Ewing C, Wilkens E, Bujnovszky P, Bova GS, Walsh P, Isaacs W, Schleutker J, Matikainen M, Tammela T, Visakorpi T, Kallioniemi OP, Berry R, Schaid D, French A, McDonneli S, Schroeder J, Blute M, Thibodeau S, Trent J (1998) Evidence for a prostate cancer susceptibility locus on the X chromosome. Nat Genet 20: 175-179

Yamashita A, Hakura A, Inoue H (1999) Suppression of anchorage-independent growth of human cancer cell lines by the drs gene. Oncogene 18: 4777-4787

Yang-Feng TL, Han H, Chen KC, Li SB, Claus EB, Carcangiu ML, Chambers SK, Chambers JT, Schwartz PE (1993) Allelic loss in ovarian cancer. Int J Cancer 54: 546- 551

Yang-Feng TL, Li S, Han H, Schwartz PE (1992) Frequent loss of heterozygosity on chromosomes Xp and 13q in human ovarian cancer. Int J Cancer 52: 575-580

Yoshida 1 (2002) Spontaneous reactivation of the inactive X chromosome in mouse embryonal carcinoma cells. Cytogenet Genome Res 99: 44-51

66 Zinn AR (2001) The X chromosome and the ovary. J Soc Gynecollnvestig 8: S34-S36

Zorn KK, Jazaeri M, Awtrey CS, Gardner GJ, Mok SC, Boyd J, Birrer MJ (2003) Choice of normal ovarian control influences determination of differentially expressed genes in ovarian cancer expression profiling studies. Clin Cancer Res 9: 4811-4818

67 Appendix 1. Selected probe sets from Affymetrix GeneChips® with poor designs

(1) Hu6800 GeneChip®: Probe sets with expression values that varied at least three-fold in the NOSE samples and differentially expressed probe sets identified in comparative analyses of the EOe cell lines and NOSE samples

(2) HG-U133A GeneChip®: Probe sets with expression values that varied at least three-fold in the NOSE samples and differentially expressed probe sets identified in comparative analyses of the EOe cell lines and NOSE samples

68 1. Probe sets represented on the Hu6800 array with poor designs

Probe set Target GeneE Probe Set AlignmE Study Selection Criteria

X15331_s_at PRPS1 CHR7 mRNA >3-Fold variability in NOSE samples U60115_at FHL1 CHR7 mRNA >3-Fold variability in NOSE samples X52638_at PFKFB1 CHRX EST >3-Fold variability in NOSE samples U66661_at GABRE CHR1mRNA >3-Fold variability in NOSE samples X53416_at FLNA CHR7 mRNA >3-Fold variability in NOSE samples X92896_at OXS9879E CHR9 mRNA >3-Fold variability in NOSE samples U11090_at ASMT Multiple >3-Fold variability in NOSE samples M13829_s_at ARAF1 CHR7 mRNA >3-Fold variability in NOSE samples D80000_at SMC1L1 CHR6 Differentiai expression in EOC cell lines D82345_at TMSNB CHRX Differentiai expression in EOC cell lines U02493_at NONO CHR2 Differentiai expression in EOC cell lines U44103_at RAB9A CHR5 Differentiai expression in EOC cell lines X15331_s_at PRPS1 CHR7 Differentiai expression in EOC cell lines X77588_s_at AR01 CHR4 Differentiai expression in EOC cell lines Z23064_at RB MX CHR1 Differentiai expression in EOC ceillines Z69915_at RBMX CHR1 Differentiai expression in EOC cell lines 2. Probe sets represented on the HG-U133A array with poor designs

Probe set Target Genee Probe Set Alignment Study Selection Criteria

201540_at FHLt CHR3 >3-Fold variability in NOSE samples 210257_x_at CUL4B CHR13 >3-Fold variability in NOSE samples 213110_s_at COL4A5 CHRX >3-Fold variability in NOSE samples 214505_s_at FHLt CHR3 >3-Fold variability in NOSE samples 217356_s_at PGK1 CHR6 >3-Fold variability in NOSE samples 218332_at BEX1 BEX family >3-Fold variability in NOSE samples 219829_at /TGB1BP2 CHR17 >3-Fold variability in NOSE samples 200737_at PGK1 CHR6 Differentiai expression in EOC cel! lines 200738_s_at PGK1 CHR6 Differentiai expression in EOC cel! lines 200980_s_at PDHA1 CHR4 Differentiai expression in EOC cel! lines 201028_s_at CD99 CHRX Differentiai expression in EOC cel! lines 201136_at PLP2 CHR6 Differentiai expression in EOC cel! lines 201828_x_at CXX1 X-Hybridizes Differentiai expression in EOC cel! lines 202110_at COX7B Multiple Differentiai expression in EOC cel! lines 202219_at SLC6AB CHR16 Differentiai expression in EOC cel! lines 203506_s_at TNRC11 Multiple Differentiai expression in EOC cel! lines 203617 J_at ELK1 X-Hybridizes Differentiai expression in EOC cel! lines 204061_at PRKX CHR15 Differentiai expression in EOC cel! lines 205010_at FLJ10613 CHR5 Differentiai expression in EOC cel!lines 205541_s_at GSPT2 CHR16 Differentiai expression in EOC cel! lines 205894_at ARSE ARSD Differentiai expression in EOC cel! lines 207564_x_at OGT X-Hybridizes Differentiai expression in EOC cel!lines 208117 _s_at FLJ12525 CHR12 Differentiai expression in EOC cel! lines 208984J_at RBM10 X-Hybridizes Differentiai expression in EOC cel! lines 209014_at MAGED1 MAGD Family Differentiai expression in EOC cel! lines 209220_at GPC3 CHR7 Differentiai expression in EOC cel! lines 210257 _x_at CUL4B CHR13 Differentiai expression in EOC cel! lines 210467 _x_at MAGEA12 X-Hybridizes Differentiai expression in EOC cel! lines 212340_at MGC21416 NIA CHRX Differentiai expression in EOC cel! lines 212514J_at DDX3X X-Hybridizes Differentiai expression in EOC cel! lines 213762_x_at RBMX X-Hybridizes Differentiai expression in EOC cel! lines 213843J_at SLC6AB X-Hybridizes Differentiai expression in EOC cel! lines 214749_s_at FLJ20B11 CHRX Differentiai expression in EOC cel! lines 214804_at FSHPRH1 Gene Intron Differentiai expression in EOC cel! lines 218332_at BEX1 BEX family Differentiai expression in EOC cel! lines 219754_at FLJ11016 Multiple Differentiai expression in EOC cel! lines 220445_s_at TRAG3 CHRX Differentiai expression in EOC cel! lines 221513_s_at SDCCAG16 CHR13 Differentiai expression in EOC cel! lines 221728_x_at X/ST X-Hybridizes Differentiai expression in EOC cel! lines 221808_at RAB9A CHR9 Differentiai expression in EOC cel! lines 221989_at RPLtO CHR14 Differentiai expression in EOC cel! lines Appendix II. Correlation coefficient analysis of chromosomes 1 to 22

69 Appendix II. Correlation Coefficient Analysis of Automosome and Sex Chromosome Gene Expression Profiles in the ln Vitro OC Model system (Hu6800 GeneChip®)

Chromosome 1 TOV112D 1 TOV81D 0.66 1 TOV21G 0.78 0.73 1 OV90 0.71 0.79 0.79 1 NOV31 0.77 0.89 0.79 0.80 1 NOV61 0.77 0.92 0.79 0.82 0.98 1 NOV504D 0.66 0.95 0.71 0.76 0.91 0.94 1 NOV900 0.65 0.89 067 0.69 0.92 0.94 0.93 1 NOV653G 0.75 0.91 0.80 0.79 0.97 0.97 0.94 0.93 NOV319 0.78 0.86 0.81 0.80 0.98 0.96 0.88 0.90 0.98 1 NOV910G 0.67 0.89 0.71 0.74 0.92 0.95 0.93 0.97 0.91 0.90 1 NOV848D 0.76 0.90 0.80 0.83 0.95 0.96 0.92 0.90 0.96 0.95 0.90 1 NOV220D 0.76 0.91 0.80 0.81 0.95 0.97 0.92 0.92 0.96 0.95 0.92 0.95 1 NOV116D 0.76 0.88 077 0.81 0.97 0.98 0.90 0.93 0.94 0.96 0.94 0.94 0.96 1 NOV436G 0.75 0.89 0.78 0.83 0.95 0.96 0.88 0.88 0.94 0.96 0.90 0.94 0.96 0.98 1 NOV821 0.62 0.81 0.70 0.75 0.86 0.89 0.86 0.89 0.86 0.86 0.93 0.86 0.88 0.90 0.88 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 2 TOV112D 1 TOV81D 0.66 1 TOV21G 0.78 0.77 1 OV90 0.76 0.89 0.89 1 NOV31 0.67 0.95 0.79 0.91 1 NOV61 0.74 0.95 0.85 0.94 0.98 1 NOV504D 0.72 0.95 0.83 0.94 0.98 0.99 1 NOV900 0.74 0.94 0.85 0.93 0.95 0.97 0.97 1 NOV653G 0.74 0.94 0.85 0.93 0.97 0.99 0.98 0.98 1 NOV319 0.69 0.96 0.81 0.91 0.98 0.99 0.98 0.96 0.98 1 NOV910G 0.73 0.96 0.85 0.93 0.96 0.97 0.97 0.99 0.97 0.97 1 NOV848D 0.76 0.92 0.86 0.92 0.92 0.97 0.96 0.96 0.98 0.95 0.95 1 NOV220D 0.72 0.95 0.82 0.91 0.97 0.98 0.98 0.97 0.98 0.97 0.96 0.96 1 NOV116D 0.73 0.94 0.84 0.93 0.98 1.00 0.98 0.97 0.98 0.98 0.97 0.96 0.98 1 NOV436G 0.69 0.94 0.79 0.90 0.97 0.98 0.97 0.94 0.97 0.98 0.94 0.94 0.98 0.98 1 NOV821 0.67 0.94 0.80 0.92 0.98 0.96 0.97 0.95 0.95 0.96 0.95 0.92 0.96 0.96 0.94 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 3 TOV112D 1 TOV81D 0.82 1 TOV21G 0.96 0.83 1 OV90 0.93 0.85 0.93 1 NOV31 0.88 0.90 0.87 0.90 1 NOV61 0.91 0.92 0.91 0.93 0.99 1 NOV504D 0.92 0.93 0.92 0.92 0.95 0.98 1 NOV900 0.91 0.91 0.89 0.88 0.93 0.94 0.96 1 NOV653G 0.94 0.90 0.92 0.92 0.96 0.97 0.97 0.95 1 NOV319 0.92 0.91 0.91 0.91 0.97 0.98 0.97 0.96 0.99 1 NOV910G 0.91 0.93 0.91 0.89 0.94 0.96 0.98 0.98 0.96 0.96 1 NOV848D 0.93 0.88 0.93 0.93 0.94 0.96 0.96 0.93 0.97 0.96 0.95 1 NOV220D 0.85 0.91 0.87 0.88 0.93 0.94 0.94 0.94 0.94 0.95 0.95 0.94 1 NOV116D 0.88 0.93 0.89 0.90 0.98 0.99 M-7~~~~~~~.97 0.96 0.95 0.96 1 NOV436G 0.86 0.94 0.88 0.89 0.96 0.96 0.95 0.93 0.94 0.96 0.95 0.94 0.95 0.98 1 NOV821 0.88 0.90 0.89 0.87 0.95 0.96 0.94 0.96 0.95 0.95 0.95 0.94 0.96 0.98 0.95 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 4 TOV112D 1 TOV81D 0.66 1 TOV21G 0.94 0.67 1 OV90 0.77 0.57 0.80 1 NOV31 0.65 0.97 0.66 0.58 1 NOV61 0.75 0.95 0.78 0.68 0.98 1 NOV504D 0.78 0.95 0.80 0.68 0.96 0.97 1 NOV900 0.72 0.97 0.75 0.65 0.98 0.99 0.98 1 NOV653G 0.70 0.94 0.74 0.65 0.97 0.99 0.95 0.98 1 NOV319 0.53 0.92 0.55 0.49 0.97 0.94 0.88 0.93 0.95 1 NOV910G 0.85 0.90 0.88 0.75 0.89 0.94 0.96 0.95 0.91 0.79 1 NOV848D 0.87 0.75 0.91 0.77 0.72 0.82 0.87 0.81 0.79 0.58 0.94 1 NOV220D 0.81 0.88 0.85 0.71 0.84 0.90 0.93 0.91 0.86 0.73 0.97 0.94 1 NOV116D 0.65 0.96 0.66 0.58 0.97 0.97 0.93 0.97 0.95 0.96 0.89 0.71 0.86 1 NOV436G 0.72 0.95 0.75 0.66 0.98 0.99 0.95 0.98 0.98 0.94 0.93 0.79 0.88 0.96 1 NOV821 0.78 0.93 0.81 0.71 0.94 0.97 0.97 0.98 0.96 0.87 0.97 0.88 0.94 0.93 0.98 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 5 TOV112D 1 TOV81D 0.50 1 TOV21G 0.93 0.62 1 OV90 0.90 0.57 0.96 1 NOV31 0.61 0.95 0.74 0.70 1 NOV61 0.73 0.90 0.83 0.79 0.95 1 NOV504D 0.54 0.97 0.67 0.61 0.96 0.93 1 NOV900 0.69 0.89 0.82 0.79 0.95 0.95 0.91 1 NOV653G 0.65 0.96 0.77 0.74 0.98 0.97 0.96 0.95 1 NOV319 0.61 0.96 0.73 0.68 0.98 0.95 0.97 0.92 0.98 1 NOV910G 0.70 0.89 0.81 0.77 0.92 0.95 0.91 0.98 0.94 0.91 1 NOV848D 0.63 0.95 0.72 0.68 0.95 0.94 0.95 0.89 0.97 0.96 0.89 1 NOV220D 0.50 0.97 0.62 0.59 0.96 0.91 0.97 0.88 0.96 0.96 0.87 0.97 1 NOV116D 0.65 0.93 0.77 0.74 0.98 0.97 0.96 0.93 0.98 0.98 0.91 0.96 0.96 1 NOV436G 0.43 0.97 0.56 0.52 0.95 0.87 0.96 0.84 0.94 0.96 0.82 0.94 0.99 0.94 1 NOV821 0.72 0.84 0.83 0.80 0.89 0.96 0.88 0.94 0.92 0.88 0.95 0.89 0.85 0.91 0.79 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 6 TOVii2D 1 TOV81D 0.66 1 TOV2iG 0.86 0.77 1 OV90 0.86 0.70 0.85 1 NOV3i 0.68 0.96 0.81 0.72 1 NOV6i 0.77 0.96 0.85 0.81 0.98 1 NOV504D 0.71 0.97 0.82 0.72 0.98 0.97 1 NOV900 0.65 0.92 0.81 0.67 0.95 0.93 0.96 1 NOV653G 0.79 0.93 0.90 0.79 0.95 0.97 0.96 0.93 1 NOV3i9 0.75 0.95 0.84 0.75 0.95 0.96 0.96 0.92 0.97 1 NOV9i0G 0.73 0.93 0.83 0.77 0.94 0.95 0.96 0.96 0.94 0.93 1 NOV848D 0.86 0.81 0.86 0.81 0.81 0.87 0.85 0.84 0.92 0.89 0.88 1 NOV220D 0.79 0.94 0.85 0.78 0.95 0.97 0.96 0.93 0.97 0.97 0.95 0.93 1 NOVii6D 0.72 0.97 0.83 0.73 0.98 0.98 0.98 0.94 0.96 0.98 0.94 0.85 0.97 1 NOV436G 0.73 0.97 0.83 0.74 0.97 0.98 0.98 0.93 0.97 0.98 0.94 0.87 0.98 0.99 1 NOV82i 0.79 0.84 0.88 0.85 0.87 0.92 0.89 0.88 0.92 0.88 0.94 0.91 0.92 0.87 0.88 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 7 TOVii2D 1 TOV8iD 0.61 1 TOV2iG 0.84 0.74 1 OV90 0.68 0.54 0.70 1 NOV3i 0.76 0.86 0.86 0.64 1 NOV6i 0.77 0.87 0.87 0.63 0.98 1 NOV504D 0.67 0.82 0.74 0.54 0.92 0.92 1 NOV900 0.60 0.74 0.74 0.48 0.80 0.86 0.77 1 NOV653G 0.73 0.91 0.83 0.62 0.98 0.96 0.91 0.78 1 NOV3i9 0.71 0.92 0.80 0.60 0.97 0.95 0.90 0.75 0.99 1 NOV9i0G 0.76 0.84 0.87 0.62 0.95 0.96 0.93 0.87 0.93 0.91 1 NOV848D 0.84 0.82 0.88 0.67 0.96 0.94 0.88 0.73 0.94 0.92 0.92 1 NOV220D 0.72 0.88 0.82 0.60 0.97 0.96 0.93 0.80 0.98 0.96 0.93 0.95 1 NOVii6D 0.74 0.87 0.86 0.64 0.97 0.97 0.90 0.76 0.98 0.96 0.94 0.94 0.96 1 NOV436G 0.73 0.93 0.85 0.63 0.96 0.96 0.87 0.79 0.98 0.97 0.93 0.94 0.96 0.98 1 NOV82i 0.70 0.75 0.83 0.56 0.84 0.89 0.75 0.95 0.81 0.78 0.88 0.82 0.85 0.81 0.83 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 8 TOVii2D 1 TOV8iD 0.87 1 TOV21G 0.88 0.89 1 OV90 0.88 0.88 0.97 1 NOV3i 0.90 0.95 0.93 0.93 1 NOV61 0.90 0.95 0.94 0.93 0.99 1 NOV504D 0.85 0.97 0.87 0.85 0.94 0.96 1 NOV900 0.87 0.95 0.86 0.85 0.96 0.96 0.96 NOV653G 0.90 0.96 0.90 0.90 0.98 0.97 0.96 0.96 1 NOV3i9 0.91 0.96 0.90 0.90 0.98 0.97 0.95 0.96 0.99 1 NOV9i0G 0.85 0.93 0.88 0.86 0.94 0.95 0.94 0.97 0.94 0.93 1 NOV848D 0.87 0.94 0.93 0.91 0.94 0.95 0.92 0.90 0.93 0.94 0.90 1 NOV220D 0.84 0.96 0.88 0.86 0.95 0.96 0.97 0.95 0.95 0.95 0.93 0.96 NOVii6D 0.89 0.95 0.95 0.93 0.99 0.99 0.95 0.96 0.98 0.97 0.95 0.96 0.97 1 NOV436G 0.85 0.97 0.83 0.83 0.94 0.94 0.96 0.94 0.96 0.97 0.92 0.93 0.97 0.94 1 NOV82i 0.85 0.90 0.92 0.90 0.94 0.94 0.89 0.89 0.92 0.92 0.89 0.91 0.90 0.95 0.88 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 9 TOV112D 1 TOV81D 0.71 1 TOV21G 0.90 0.75 1 OV90 0.86 0.71 0.88 1 NOV31 0.71 0.95 0.71 0.70 1 NOV61 0.83 0.93 0.85 0.81 0.96 1 NOV504D 0.82 0.92 0.85 0.81 0.89 0.95 1 NOV900 0.79 0.89 0.83 0.78 0.89 0.94 0.94 1 NOV653G 0.79 0.94 0.80 0.79 0.97 0.98 0.92 0.91 1 NOV319 0.79 0.91 0.77 0.78 0.97 0.97 0.91 0.92 0.97 1 NOV910G 0.67 0.88 0.73 0.66 0.85 0.86 0.91 0.92 0.84 0.84 1 NOV848D 0.84 0.92 0.86 0.82 0.92 0.96 0.94 0.93 0.96 0.95 0.86 1 NOV220D 0.82 0.92 0.84 0.80 0.95 0.98 0.93 0.94 0.97 0.97 0.86 0.97 1 NOV116D 0.82 0.93 0.83 0.81 0.96 0.99 0.93 0.94 0.98 0.97 0.86 0.96 0.99 1 NOV436G 0.74 0.94 0.75 0.74 0.98 0.97 0.91 0.92 0.97 0.98 0.85 0.95 0.97 0.98 1 NOV821 0.83 0.88 0.88 0.82 0.89 0.97 0.93 0.95 0.92 0.91 0.85 0.94 0.96 0.96 0.92 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 10 TOV112D 1 TOV81D 0.91 1 TOV21G 0.82 0.86 1 OV90 0.42 0.46 0.79 1 NOV31 0.81 0.90 0.80 0.48 1 NOV61 0.84 0.92 0.85 0.57 0.97 1 NOV504D 0.82 0.88 0.78 0.48 0.89 0.94 1 NOV900 0.76 0.86 0.82 0.56 0.92 0.94 0.94 1 NOV653G 0.91 0.96 0.81 0.43 0.97 0.97 0.90 0.88 1 NOV319 0.89 0.94 0.79 0.43 0.97 0.97 0.91 0.88 0.99 1 NOV910G 0.80 0.89 0.83 0.56 0.95 0.97 0.95 0.99 0.92 0.93 1 NOV848D 0.90 0.93 0.77 0.39 0.95 0.94 0.87 0.85 0.98 0.98 0.89 1 NOV220D 0.78 0.88 0.77 0.49 0.98 0.97 0.89 0.91 0.95 0.97 0.94 0.94 1 NOV116D 0.81 0.90 0.82 0.52 0.97 0.98 0.96 0.97 0.94 0.95 0.98 0.91 0.97 1 NOV436G 0.81 0.89 0.76 0.45 0.97 0.96 0.85 0.86 0.97 0.98 0.91 0.96 0.99 0.94 1 NOV821 0.83 0.93 0.90 0.63 0.91 0.93 0.86 0.93 0.91 0.90 0.94 0.87 0.90 0.92 0.87 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 11 TOV112D 1 TOV81D 0.58 1 TOV21G 0.77 0.78 1 OV90 0.75 0.72 0.90 1 NOV31 0.59 0.95 0.68 0.65 1 NOV61 0.64 0.96 0.75 0.72 0.99 1 NOV504D 0.62 0.97 0.79 0.75 0.95 0.97 1 NOV900 0.66 0.92 0.86 0.80 0.87 0.91 0.95 1 NOV653G 0.61 0.96 0.76 0.73 0.97 0.98 0.98 0.92 1 NOV319 0.64 0.96 0.78 0.74 0.96 0.97 0.96 0.92 0.98 1 NOV910G 0.58 0.96 0.78 0.74 0.95 0.97 0.98 0.95 0.97 0.94 1 NOV848D 0.60 0.91 0.77 0.76 0.89 0.92 0.95 0.88 0.95 0.92 0.92 1 NOV220D 0.66 0.91 0.82 0.79 0.88 0.92 0.95 0.91 0.94 0.93 0.91 0.97 1 NOV116D 0.62 0.96 0.74 0.70 0.99 0.99 0.96 0.90 0.97 0.97 0.96 0.90 0.90 1 NOV436G 0.58 0.96 0.72 0.69 0.97 0.98 0.97 0.88 0.98 0.97 0.95 0.94 0.94 0.98 1 NOV821 0.77 0.87 0.83 0.79 0.86 0.90 0.90 0.92 0.89 0.90 0.89 0.85 0.91 0.89 0.86 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 12 TOVii2D 1 TOV8i 0 0.89 1 TOV2iG 0.97 0.93 1 OV90 0.89 0.87 0.90 1 NOV3i 0,91 0.98 0.95 0.87 1 NOV6i 0.94 0.97 0.96 0.92 0.98 1 NOV504D 0,89 0.98 0.93 0.90 0.97 0.98 1 NOV900 0.86 0.95 0.91 0.81 0.96 0.94 0.95 1 NOV653G 0.89 0.97 0.93 0.84 0.98 0.96 0.96 0.97 1 NOV3i9 0,88 0.96 0,92 0,82 0,98 0,94 0,94 0,96 0,99 1 NOV9i0G 0,90 0,97 0,94 0,89 0,96 0,97 0,98 0,96 0,95 0,94 1 NOV848D 0,85 0,96 0,87 0,88 0,91 0,94 0,96 0.88 0,92 0,90 0,93 1 NOV220D 0,88 0.98 0,91 0,86 0,97 0,97 0,97 0.94 0,97 0,96 0,96 0,95 1 NOVii6D 0,92 0.97 0,94 0,88 0,98 0,99 0,97 0.96 0,97 0,96 0,97 0,93 0,97 1 NOV436G 0,90 0.97 0,92 0,86 0,98 0,97 0,95 0.91 0,97 0,96 0,94 0,93 0,98 0.97 1 NOV82i 0,88 0,94 0,91 0,90 0.94 0,96 0,95 0.93 0,93 0,92 0,95 0,92 0,95 0.94 0,94 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 13 TOV112D 1 TOV8i D 0.82 1 TOV21G 0.97 0.85 1 OV90 0.98 0.81 0,95 1 NOV3i 0,79 0,95 0,83 0.79 1 NOV6i 0,87 0,96 0,88 0,87 0,98 1 NOV504D 0,91 0,96 0,94 0,91 0,96 0.98 1 NOV900 0,88 0,97 0,90 0,88 0,93 0,97 0,96 NOV653G 0,86 0,99 0,88 0,85 0,97 0.99 0.98 0,98 1 NOV319 0,83 0.96 0,84 0,84 0,96 0,97 0,96 0,94 0,96 1 NOV910G 0,88 0,96 0.91 0,87 0,97 0,98 0.99 0,96 0,97 0,98 1 NOV848D 0,91 0.94 0,90 0,90 0,96 0.99 0,97 0.96 0,98 0,94 0,96 1 NOV220D 0,76 0.95 0,80 0.75 0,98 0,96 0,92 0,95 0,96 0,93 0,95 0.93 1 NOVii6D 0,82 0.90 0,87 0,81 0,98 0,95 0,95 0.89 0,93 0,93 0,97 0.93 0,94 1 NOV436G 0,64 0,88 0,70 0,63 0,95 0.90 0,86 0.81 0,88 0,88 0,89 0,86 0,93 0,94 1 NOV82i 0,83 0,97 0,85 0,84 0.95 0,97 0,95 0,98 0.97 0,96 0.97 0,95 0,96 0,90 0,84 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 14 TOVii2D 1 TOV8iD 0,90 1 TOV21G 0,88 0.90 1 OV90 0.91 0.88 0,85 1 NOV3i 0,90 0,98 0,89 0,89 NOV6i 0,89 0,96 0.88 0,87 0,98 1 NOV504D 0,93 0.97 0,93 0,90 0,97 0,96 1 NOV900 0,89 0.95 0,90 0,88 0,96 0,95 0,97 1 NOV653G 0,89 0,97 0,90 0,87 0,98 0,98 0,97 0,95 NOV3i9 0,83 0,93 0,86 0,83 0,94 0,95 0,92 0,91 0,97 NOV9i0G 0,86 0,94 0,90 0,85 0,94 0,93 0,96 0,98 0,94 0,91 1 NOV848D 0,89 0,95 0,95 0,87 0,95 0,94 0,97 0.95 0,96 0,91 0,96 1 NOV220D 0.90 0,97 0,91 0,89 0,97 0,97 0,98 0,97 0,98 0,95 0,97 0,96 1 NOVii6D 0,89 0,96 0,86 0,88 0,98 0,97 0,95 0,94 0,97 0,92 0.93 0,93 0.96 1 NOV436G 0,80 0,93 0,83 0,79 0,95 0,95 0,91 0,91 0,97 0.96 0,92 0,92 0,95 0,94 1 NOV82i 0,87 0,92 0.89 0,87 0,93 0,95 0,94 0,94 0,94 0,95 0,93 0,93 0,97 0,93 0,93 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 15 TOV112D 1 TOV81 0 0.72 TOV21G 0.95 0.74 1 OV90 0.93 0.86 0.93 1 NOV31 0.78 0.97 0.80 0.88 1 NOV61 0.86 0.94 0.86 0.91 0.98 1 NOV504D 0.84 0.96 0.86 0.92 0.97 0.98 1 NOV900 0.78 0.94 0.81 0.83 0.95 0.96 0.96 1 NOV653G 0.81 0.97 0.81 0.89 0.98 0.98 0.98 0.96 1 NOV319 0.78 0.94 0.81 0.86 0.96 0.96 0.97 0.97 0.97 NOV910G 0.84 0.94 0.86 0.90 0.95 0.97 0.99 0.97 0.97 0.97 1 NOV848D 0.90 0.91 0.88 0.94 0.93 0.95 0.94 0.88 0.95 0.89 0.94 1 NOV220D 0.77 0.97 0.78 0.85 0.96 0.95 0.96 0.96 0.98 0.94 0.95 0.93 1 NOV116D 0.80 0.94 0.84 0.87 0.96 0.97 0.98 0.98 0.96 0.98 0.97 0.89 0.95 1 NOV436G 0.79 0.94 0.82 0.88 0.95 0.95 0.98 0.96 0.96 0.99 0.98 0.90 0.94 0.98 1 NOV821 0.78 0.97 0.79 0.88 0.97 0.96 0.97 0.96 0.97 0.94 0.96 0.91 0.97 0.96 0.95 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 16 TOV112D 1 TOV81 0 0.23 1 TOV21G 0.78 0.69 1 OV90 0.76 0.71 0.97 1 NOV31 0.37 0.98 0.79 0.81 NOV61 0.40 0.97 0.81 0.83 1.00 1 NOV504D 0.28 0.98 0.73 0.77 0.99 0.99 1 NOV900 0.18 0.98 0.67 0.70 0.97 0.97 0.99 1 NOV653G 0.29 0.97 0.74 0.78 0.99 0.98 1.00 0.99 1 NOV319 0.22 0.99 0.69 0.72 0.98 0.98 0.99 0.99 0.99 1 NOV910G 0.28 0.99 0.73 0.75 0.99 0.99 0.99 0.99 0.99 1.00 1 NOV848D 0.55 0.88 0.88 0.91 0.95 0.96 0.93 0.89 0.94 0.90 0.92 1 NOV220D 0.45 0.94 0.84 0.87 0.99 0.99 0.97 0.95 0.98 0.96 0.97 0.98 1 NOV116D 0.41 0.97 0.81 0.82 0.99 0.99 0.98 0.95 0.97 0.97 0.98 0.94 0.98 1 NOV436G 0.41 0.95 0.81 0.84 0.99 0.99 0.98 0.96 0.99 0.97 0.98 0.98 0.99 0.98 1 NOV821 0.38 0.98 0.80 0.82 1.00 1.00 0.99 0.97 0.98 0.98 0.99 0.95 0.99 0.99 0.99 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 17 TOV112D 1 TOV81 0 0.78 1 TOV21G 0.95 0.81 1 OV90 0.95 0.80 0.95 1 NOV31 0.83 0.93 0.85 0.85 1 NOV61 0.86 0.95 0.89 0.89 0.98 NOV504D 0.80 0.94 0.84 0.82 0.97 0.97 NOV900 0.82 0.94 0.86 0.82 0.95 0.95 0.95 1 NOV653G 0.81 0.96 0.82 0.82 0.95 0.96 0.95 0.95 1 NOV319 0.80 0.98 0.83 0.83 0.96 0.96 0.95 0.96 0.98 1 NOV910G 0.85 0.93 0.88 0.85 0.95 0.96 0.95 0.98 0.94 0.95 1 NOV848D 0.83 0.95 0.84 0.84 0.98 0.97 0.96 0.95 0.97 0.97 0.95 1 NOV220D 0.69 0.95 0.73 0.71 0.92 0.92 0.93 0.91 0.95 0.95 0.89 0.95 1 NOV116D 0.86 0.94 0.89 0.89 0.97 0.99 0.95 0.96 0.95 0.96 0.95 0.97 0.93 1 NOV436G 0.70 0.95 0.73 0.74 0.91 0.93 0.93 0.89 0.92 0.93 0.87 0.93 0.98 0.94 NOV821 0.85 0.89 0.89 0.89 0.93 0.94 0.91 0.92 0.89 0.91 0.93 0.91 0.85 0.94 0.84 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 18 TOV112D 1 TOV81 0 0.93 1 TOV21G 0.97 0.92 1 OV90 0.79 0.83 0.86 1 NOV31 0.84 0.95 0.81 0.69 1 NOV61 0.94 0.98 0.91 0.76 0.97 1 NOV504D 0.87 0.95 0.83 0.65 0.97 0.97 1 NOV900 0.92 0.99 0.92 0.81 0.95 0.98 0.96 1 NOV653G 0.87 0.97 0.86 0.71 0.99 0.98 0.98 0.97 NOV319 0.88 0.98 0.86 0.77 0.98 0.98 0.97 0.97 0.99 1 NOV910G 0.91 0.98 0.89 0.77 0.97 0.98 0.97 0.99 0.98 0.98 1 NOV848D 0.86 0.95 0.84 0.73 0.97 0.96 0.95 0.94 0.97 0.97 0.95 1 NOV220D 0.86 0.96 0.83 0.69 0.98 0.97 0.96 0.95 0.98 0.97 0.96 0.97 1 NOV116D 0.89 0.98 0.87 0.75 0.99 0.99 0.97 0.98 0.99 0.99 0.99 0.98 0.99 NOV436G 0.90 0.98 0.89 0.77 0.98 0.99 0.97 0.98 0.99 0.99 0.98 0.97 0.99 1.00 1 NOV821 0.94 0.98 0.93 0.76 0.96 0.99 0.95 0.98 0.97 0.97 0.98 0.95 0.97 0.98 0.98 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 19 TOV112D 1 TOV81D 0.90 TOV21G 0.90 0.88 1 OV90 0.89 0.88 0.92 1 NOV31 0.94 0.94 0.89 0.87 1 NOV61 0.95 0.95 0.91 0.90 0.99 1 NOV504D 0.93 0.98 0.89 0.90 0.97 0.98 1 NOV900 0.85 0.93 0.86 0.87 0.92 0.92 0.95 1 NOV653G 0.95 0.94 0.90 0.88 0.99 0.99 0.97 0.92 1 NOV319 0.94 0.95 0.91 0.90 0.99 0.99 0.98 0.94 0.99 1 NOV910G 0.90 0.97 0.91 0.90 0.94 0.96 0.98 0.97 0.94 0.96 1 NOV848D 0.95 0.94 0.90 0.91 0.97 0.98 0.97 0.92 0.97 0.98 0.95 1 NOV220D 0.91 0.93 0.88 0.88 0.97 0.96 0.96 0.95 0.96 0.97 0.94 0.97 1 NOV116D 0.93 0.95 0.88 0.90 0.98 0.98 0.98 0.95 0.97 0.98 0.96 0.97 0.98 1 NOV436G 0.92 0.96 0.90 0.91 0.97 0.98 0.98 0.95 0.97 0.98 0.96 0.98 0.98 0.99 1 NOV821 0.94 0.94 0.90 0.88 0.97 0.98 0.96 0.90 0.97 0.97 0.93 0.97 0.96 0.97 0.97 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 20 TOV112D 1 TOV81D 0.84 TOV21G 0.72 0.84 1 OV90 0.80 0.95 0.83 1 NOV31 0.77 0.89 0.89 0.86 1 NOV61 0.78 0.89 0.90 0.88 0.97 1 NOV504D 0.83 0.90 0.91 0.86 0.94 0.96 1 NOV900 0.83 0.91 0.89 0.88 0.94 0.96 0.98 1 NOV653G 0.80 0.89 0.88 0.85 0.98 0.97 0.96 0.96 1 NOV319 0.78 0.90 0.90 0.85 0.99 0.97 0.96 0.96 0.99 1 NOV910G 0.79 0.85 0.88 0.83 0.96 0.95 0.94 0.95 0.93 0.93 1 NOV848D 0.81 0.93 0.90 0.87 0.98 0.96 0.96 0.95 0.98 0.99 0.94 1 NOV220D 0.81 0.90 0.90 0.87 0.96 0.96 0.97 0.97 0.99 0.98 0.93 0.97 1 NOV116D 0.76 0.88 0.90 0.87 0.99 0.97 0.94 0.94 0.95 0.96 0.98 0.96 0.95 1 NOV436G 0.71 0.84 0.88 0.84 0.98 0.96 0.92 0.92 0.94 0.95 0.96 0.94 0.94 0.99 1 NOV821 0.71 0.79 0.80 0.78 0.83 0.92 0.87 0.89 0.85 0.84 0.81 0.84 0.87 0.82 0.80 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Chromosome 21 TOV112D 1 TOV81 0 0.74 1 TOV21G 0.87 0.68 1 OV90 0.15 0.11 0.19 1 NOV31 0.63 0.89 0.63 0.12 NOV61 0.74 0.93 0.67 0.12 0.97 1 NOV504D 0.55 0.87 0.53 0.09 0.97 0.94 1 NOV900 0.72 0.86 0.80 0.15 0.91 0.88 0.84 1 NOV653G 0.71 0.95 0.69 0.13 0.97 0.98 0.94 0.90 1 NOV319 0,48 0.84 0.48 0.09 0.97 0.93 0.99 0.82 0.93 1 NOV910G 0.70 0.92 0.69 0.12 0.97 0.97 0.94 0.92 0.96 0.92 NOV848D 0.67 0.90 0.67 0.13 0.98 0.95 0.94 0.92 0.96 0.93 0.95 1 NOV220D 0.64 0.91 0.69 0.13 0.96 0.94 0.96 0.92 0.96 0.94 0.95 0.95 1 NOV116D 0.59 0.86 0.58 0.10 0.97 0.95 0.98 0.85 0.94 0.97 0.95 0.94 0.95 1 NOV436G 0.57 0.88 0.55 0.09 0.96 0.95 0.97 0.85 0.94 0.97 0.94 0.95 0.94 0.99 1 NOV821 0.82 0.91 0.86 0.17 0.92 0.92 0.86 0.95 0.94 0.83 0.93 0.93 0.95 0.87 0.86 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome 22 TOV112D 1 TOV81 0 0.31 1 TOV21G 0.72 0.65 1 OV90 0,43 0.18 0.34 1 NOV31 0.54 0.74 0.87 0.26 1 NOV61 0.54 0.71 0.84 0.28 0.99 1 NOV504D 0.47 0.74 0.86 0.27 0.99 0.98 1 NOV900 0.42 0.69 0.79 0.23 0.98 0.98 0.98 1 NOV653G 0.46 0.92 0.82 0.24 0.92 0.90 0.92 0.88 1 NOV3i9 0.48 0.88 0.85 0.25 0.96 0.95 0.96 0.92 0.99 1 NOV910G 0.43 0.67 0.75 0.24 0.97 0.98 0.97 0.99 0.86 0.91 1 NOV848D 0.46 0.91 0.82 0.24 0.94 0.93 0.94 0.91 0.99 0.99 0.90 1 NOV220D 0.44 0.95 0.75 0.24 0.88 0.86 0.86 0.83 0.98 0.96 0.82 0.97 1 NOV116D 0.47 0.67 0.79 0.24 0.98 0.99 0.97 0.99 0.87 0.91 0.99 0.90 0.83 1 NOV436G 0.44 0.82 0.79 0.24 0.97 0.97 0.97 0.97 0.95 0.97 0.97 0.97 0.93 0.97 1 NOV821 0.55 0.71 0.85 0.27 0.99 0.99 0.98 0.98 0.90 0.94 0.98 0.92 0.85 0.98 0.97 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821

Chromosome-X TOV112D 1 TOV81D 0.67 TOV21G 0.71 0.95 1 OV90 0,46 0.89 0.92 1 NOV31 0.62 0.97 0.93 0.89 1 NOV61 0.63 0.97 0.94 0.90 0.99 1 NOV504D 0.66 0.99 0.94 0.90 0.98 0.99 1 NOV900 0.59 0.96 0.93 0.92 0.95 0.96 0.97 1 NOV653G 0.66 0.97 0.94 0.89 0.97 0.98 0.98 0.98 1 NOV319 0.67 0.98 0.95 0.89 0.98 0.99 0.99 0.96 0.99 1 NOV910G 0.62 0.97 0.94 0.92 0.98 0.99 0.99 0.98 0.98 0.99 1 NOV848D 0.56 0.96 0.93 0.93 0.96 0.98 0.97 0.98 0.97 0.96 0.99 1 NOV220D 0.55 0.95 0.93 0.95 0.97 0.97 0.96 0.98 0.95 0.96 0.98 0.98 1 NOV116D 0.54 0.95 0.91 0.94 0.97 0.97 0.97 0.96 0.95 0.95 0.98 0.98 0.99 1 NOV436G 0.57 0.95 0.91 0.92 0.98 0.98 0.97 0.94 0.94 0.96 0.98 0.97 0.98 0.99 1 NOV821 0.65 0.98 0.95 0.91 0.97 0.98 0.98 0.98 0.98 0.98 0.99 0.98 0.98 0.97 0.97 1 TOV TOV TOV OV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV NOV 1120 810 21G 90 31 61 5040 900 653G 319 910G 8480 2200 1160 436G 821 Appendix III. Selection of Chromosome-X genes for the study of allele-specific gene expression in EOC cell lines that do not express the X/ST transcript.

(1) Hu6800 GeneChip®: Weighted regression analysis of CHR-X genes represented on the Hu6800 GeneChip®. Genes represented on the Hu6800 array were selected for the study of allele-specific expression if they displayed a distinctive pattern of expression ("outlier" with a standard residual >2) when the CHR-X gene expression profiles of the cell lines TOV112D or TOV21G were compared to that of the other EOC cell lines by weighted regression analysis.

(2) HG-U133A GeneChip®: Comparative analysis of CHR-X gene expression in the cell lines TOV112D and TOV21G with the mean of expression values of three NOSE samples Genes represented on the HG-U 133A array were selected for the study of allele-specific expression if they exhibited expression values for the EOC cell lines TOV112D or TOV21G that had P-calls were at least two-fold higher than the mean of expression values of the NOSE samples.

70 1. CHR-X genes represented on the Hu6800 GeneChip® with distinct expression profiles in the cell lines TOV11 TOV21G relative to the EOC ceillines

2TOV112D 3 TOV21G Standard Residuals Standard Residuals Expression Values Probe set Gene Symbc XCI TOV81D OV90 TOV21G TOV81D OV90 TOV112D TOV112D TOV21G TOV81D OV90

M69066_at MSN 8 -OA 1.7 1.0 -4.5 2.6 0.2 569 480 1041 206 U02493 at NONO 8 7.2 5.9 6.6 3.3 1.3 -3.6 1690 552 290 494 V00572 at PGK1 8 -0.1 2.4 0.9 -3.1 3.8 1.9 1002 1126 1682 895 L09604 at PLP2 8 4.0 4.6 4.3 -0.5 3.2 -1.9 1281 584 738 268 J02683_s_at SLC25A5 8 3.4 1.7 0.8 8.6 1.2 1.8 934 1050 330 1178 M58028_at UBE1 E 2.4 3.0 2.3 1.2 2.9 -0.2 951 675 666 423

U44839_at USP11 E 1.0 1.1 0.8 0.9 1.2 0.1 436 363 321 264

1 X-Inactivation (Xi) status inferred from Carrel et al. 2005: (8) subject to Xi, (E) escapes Xi.

2 Regression analysis comparing TOV112D to the other EOC cell lines based on 205 probe set expression values

:3 Regression analysis comparing TOV21 G to the other EOC cell lines based on 205 probe set expression values 2. CHR-X genes represented on the HG-U133A GeneChip® with two-fold over-expression in the cell lines TOV112D and/or TOV21 G relative to the NOSE samples

NOSE Samples TOV112D TOV21G OV90 TOV81D 1 Probe set Gene Xi Cytoband Max Mean Value Fold 8 Xp22.22 24 18 164 P 20 P 1

POLA 8 Xp22.11 29 21 66 P 24 A 1

208984J_at RBM10 8 Xp11.3 75 73 237 P 80 P 1 56 P 1

215089_s_at RBM10 8 Xp11.3 90 87 217 P 73 P 1 98 P 1 44 P 1

217221J_at RBM10 8 Xp11.3 65 51 143 P 47 P 1 68 P 1 35 P 1

200964_at UBE1 E Xp11.3 1000 823 1375 P 642 P 1 745 P 1

208723_at USP11 H Xp11.3 68 58 161 P 139 P 99 P 66 P 1

218619_s_at SUV39H1 8 Xp11.23 39 35 125 P 40 P 1 67 P 25 A 1

201136_at PLP2 8 Xp11.23 301 209 378 P 136 P 1 68 P 0 519 P

202282_at HADH2A 8 Xp11.22 271 230 695 P 235 P 1 277 P 1 179 P 1

218355_at KIF4A 8 Xq13.1 44 32 372 P 56 P 133 P 26 P 1

44 36 100 P 74 P 49 P 1 36 P 1

200057_s_at NONO 8 Xq13.1 726 571 1661 P 648 P 1 880 P 758 P 1

208698_s_at NONO 8 Xq13.1 146 115 394 P 127 P 1 374 P 217 P

210470J_at NONO 8 Xq13.1 186 153 545 P 171 M 1 431 P 402 P

205450_at PHKA1 8 Xq13.1 28 25 73 P 45 P 34 P 1 34 P 1

204459_at CSTF2 8 Xq22.1 56 46 149 P 47 P 1 132 P 51 P 1

205347_s_at TMSNB 8 Xqq22.1 30 25 150 P 73 P 29 P 1 28 P 1

201539_s_at FHL1 8 Xq26.3 29 21 43 P 15 A 1 15 P 1 39 P FHL1 8 Xq26.3 213 120 286 P 16 P 0 21 P 0 92 P 1

210298_x_at FHL1 8 Xq26.3 33 21 43 P 15 A 1 15 A 1 33 A

210299_s_at FHL1 8 Xq26.3 36 22 53 P 15 A 1 15 A 1 17 P 1

214505_s_at FHL1 8 Xq26.3 53 30 54 P 15 A 1 15 A 1 34 P 1

201478_s_at DKC1 8 Xq28 152 105 389 P 154 P 1 271 P 82 P 1 DKC1 8 Xq28 278 223 713 P 279 P 1 391 P 177 P 1

1X-lnactivation (Xi) status inferred fram Carrel et al. 2005: (8) subject to Xi, (E) escapes Xi. Appendix III. Ethics approval certificate

71 Appendix IV. Permit for use of radioisotopes