DOCSLIB.ORG

Early Inhibition of Fatty Acid Synthesis Reduces Generation of Memory Precursor Effector T Cells in Chronic Infection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Early Inhibition of Fatty Acid Synthesis Reduces Generation of Memory Precursor Effector T Cells in Chronic Infection Early Inhibition of Fatty Acid Synthesis Reduces Generation of Memory Precursor Effector T Cells in Chronic Infection This information is current as Samad A. Ibitokou, Brian E. Dillon, Mala Sinha, Bartosz of October 1, 2021. Szczesny, Añahi Delgadillo, Doaa Reda Abdelrahman, Csaba Szabo, Lutfi Abu-Elheiga, Craig Porter, Demidmaa Tuvdendorj and Robin Stephens J Immunol 2018; 200:643-656; Prepublished online 13 December 2017; doi: 10.4049/jimmunol.1602110 Downloaded from http://www.jimmunol.org/content/200/2/643 Supplementary http://www.jimmunol.org/content/suppl/2017/12/13/jimmunol.160211 http://www.jimmunol.org/ Material 0.DCSupplemental References This article cites 69 articles, 21 of which you can access for free at: http://www.jimmunol.org/content/200/2/643.full#ref-list-1 Why The JI? Submit online. by guest on October 1, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Early Inhibition of Fatty Acid Synthesis Reduces Generation of Memory Precursor Effector T Cells in Chronic Infection Samad A. Ibitokou,* Brian E. Dillon,* Mala Sinha,† Bartosz Szczesny,‡ An˜ahi Delgadillo,x Doaa Reda Abdelrahman,x Csaba Szabo,‡ Lutfi Abu-Elheiga,{ Craig Porter,x Demidmaa Tuvdendorj,‖ and Robin Stephens*,# Understanding the mechanisms of CD4 memory T cell (Tmem) differentiation in malaria is critical for vaccine development. However, the metabolic regulation of CD4 Tmem differentiation is not clear, particularly in persistent infections. In this study, we investigated the role of fatty acid synthesis (FAS) in Tmem development in Plasmodium chabaudi chronic mouse malaria infection. We show that T cell–specific deletion and early pharmaceutical inhibition of acetyl CoA carboxylase 1, the rate limiting step of FAS, inhibit generation of early memory precursor effector T cells (MPEC). To compare the role of FAS during early differen- tiation or survival of Tmem in chronic infection, a specific inhibitor of acetyl CoA carboxylase 1, 5-(tetradecyloxy)-2-furoic acid, Downloaded from was administered at different times postinfection. Strikingly, the number of Tmem was only reduced when FAS was inhibited during T cell priming and not during the Tmem survival phase. FAS inhibition during priming increased effector T cell (Teff) proliferation and strongly decreased peak parasitemia, which is consistent with improved Teff function. Conversely, MPEC were decreased, in a T cell–intrinsic manner, upon early FAS inhibition in chronic, but not acute, infection. Early cure of infection also increased mitochondrial volume in Tmem compared with Teff, supporting previous reports in acute infection. We demonstrate that the MPEC-specific effect was due to the higher fatty acid content and synthesis in MPEC compared with terminally http://www.jimmunol.org/ differentiated Teff. In conclusion, FAS in CD4 T cells regulates the early divergence of Tmem from Teff in chronic infection. The Journal of Immunology, 2018, 200: 643–656. espite some progress in the control of malaria, the World chronic parasites (6). We have shown that CD4 T cells in the memory Health Organization estimates that 3.2 billion people are still phase of P. chabaudi infection primarily have an effector memory at high risk worldwide (1). The most recent subunit malaria T cell (Tem) phenotype and that these cells contain an increased D 2 vaccine candidate, RTS,S, has shown poor efficacy and a lack of proportion of IFN-g+TNF+IL-2 Th1 cells during chronic infection long-lived protection (2). Immunity to blood-stage malaria infection, compared with infections cured after 30 d (7). However, the mech- by guest on October 1, 2021 the stage of parasite that causes disease pathology, requires CD4 anisms of Tem differentiation are much less well understood than T cell– and B cell–mediated mechanisms (3). Yet, mechanisms of those of central memory T cells (Tcm) generated in acute stimulation. activation and differentiation for these protective cells are not well Two models have been proposed for the differentiation of understood. Infection of mice with Plasmodium chabaudi is an ac- memory T cells (Tmem). In simplified terms, these models propose curate and well-defined model for the immunity and pathology of a bifurcating model in which all Tmem, including Tem, are gen- mild malaria, and it has a chronic phase lasting up to 3 mo (4). erated early in activation (8) or a linear model in which Tem are Plasmodium falciparum is also documented to become chronic, derived from effector T cells (Teff) and are predicted to have a lasting up to a year, even in the absence of a rainy season and short half-life (9). It should be noted that early differentiation mosquitos (5). Chronic infection and chronically stimulated T cells steps do not exclude the role of later inflammatory effects that protect animals from reinfection against Plasmodium and other promote terminal differentiation in CD8 T cells or the role of *Division of Infectious Diseases, Department of Internal Medicine, University of Address correspondence and reprint requests to Dr. Robin Stephens, Division of Texas Medical Branch, Galveston, TX 77555; †Biomedical Informatics, Institute Infectious Diseases, Department of Internal Medicine and Department of Microbiol- for Translational Science, University of Texas Medical Branch, Galveston, TX ogy and Immunology, University of Texas Medical Branch, 301 University Boule- 77555; ‡Department of Anesthesiology, University of Texas Medical Branch, Gal- vard, Galveston, TX 77555-0435. E-mail address: [email protected] veston, TX 77555; xShriners Hospital for Children, Galveston, TX 77550; {Verna and The online version of this article contains supplemental material. Marrs McLean Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX 77030; ‖Division of Endocrinology, University of Texas Abbreviations used in this article: ACC, actyl CoA carboxylase; Cpt, carnitine pal- Medical Branch, Galveston, TX 77555; and #Department of Microbiology and Im- mitoyl transferase; CT, threshold cycle; CTV, CellTrace Violet; DAG, diacylglycer- munology, University of Texas Medical Branch, Galveston, TX 77555 ide; ECAR, extracellular respiratory capacity; ETC, electron transport chain; FAO, fatty acid oxidation; FAS, fatty acid synthesis; fDNL, fractional de novo lipogenesis; ORCIDs: 0000-0002-7760-7412 (S.A.I.); 0000-0003-3110-4235 (C.S.); 0000-0002- GC-MS, gas chromatograph–mass spectrometer; 2H O, deuterium water; MPEC, 7366-3556 (L.A.-E.); 0000-0002-5913-6194 (A.D.); 0000-0001-9847-5714 (D.R.A.). 2 memory precursor effector T cell; MQ, mefloquine hydrochloride; MSP-1, merozoite Received for publication December 15, 2016. Accepted for publication November 9, surface protein-1; MTG, MitoTracker Green; MTR, MitoTracker Red; NRx, no treat- 2017. ment; OCR, oxygen consumption rate; p.i., postinfection; PL, phospholipid; SLEC, short-lived effector T cell; SRC, spare respiratory capacity; Tcm, central memory This work was supported by National Institute of Allergy and Infectious Diseases T cell; Teff, effector T cell; TeffEarly, early Teff; TeffInt, intermediate Teff; TeffLate, Grant R01AI08995304 (to R.S.), the Department of Internal Medicine, University late Teff; Tem, effector memory T cell; TG, triglyceride; Tg, transgenic; Tmem, of Texas Medical Branch Institute for Human Infections and Immunity (to R.S. and memory T cell; TOFA, 5-(tetradecyloxy)-2-furoic acid; Treg, regulatory T cell; S.A.I.), and the American Association of Immunologists (to S.A.I.). WT, wild-type. The microarray data presented in this article have been submitted to the National Center for Biotechnology Information Gene Expression Omnibus (http://www.ncbi. Copyright Ó 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 nlm.nih.gov/geo/query/acc.cgi?acc=GSE89555) under accession number GSE89555. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1602110 644 EARLY CD4 Tmem DIFFERENTIATION DRIVEN BY FAS regulatory T cells (Treg) in controlling the quiescence of Tmem (9). generation of CD4 memory and support an early bifurcation in the Furthermore, there are differences between CD4 and CD8 Teff dif- differentiation of Tmem from Teff. ferentiation. For example, Blimp-1 drives terminal differentiation in CD8 Teff, but not in CD4 Teff (10, 11), which indicates that there are Materials and Methods likely differences in CD8 and CD4 Tmem differentiation as well. Our Mice and parasite work on CD4 T cell differentiation in P. chabaudi infection definitively B5 TCR–transgenic (Tg) mice, a kind gift from Jean Langhorne (The Francis support the early divergence of CD4 Teff and Tem in chronic infection Crick Institute, London, U.K.), were generated as previously described (23) and + 2 hi (12). We have recently identified CD4 IL-7Ra CD62L early Teff backcrossed to BALB/cJ mice (N4-N10; The Jackson Laboratory, Bar Harbor, (TeffEarly), which can be detected as early as day 5 postinfection (p.i.), ME). The B5 TCR recognizes merozoite surface protein-1 (MSP-1; 1157-1171, d as precursors of Tcm and Tem (12). We also showed that the Tem ISVLKSRLLKRKKYI/I-E ); B5 TCR–Tg mice were typed using primers Va2, 9 9 9 phenotype of the CD4+ Tmem developed in P. chabaudi infection is 5 -GAACGTTCCAGATTCCATGG-3 and 5 -ATGGACAAGATCCTGA- CAGCATCG-39 and Vb8.1, 59-CAGAGACCCTCAGGCGGCTGCTCAGG-39 and determined within the first 5 d of infection, because it can be blunted 59-ATGGGCTCCAGGCTGTTCTTTGTGGTTTTGATTC-39. Thy1.1 BALB/ by treatment of infection on day 3 p.i.
Load more

Recommended publications
  • Increased COUP-TFII Expression in Adult Hearts Induces Mitochondrial Dysfunction Resulting in Heart Failure
    ARTICLE Received 9 Mar 2015 | Accepted 30 Jul 2015 | Published 10 Sep 2015 DOI: 10.1038/ncomms9245 OPEN Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure San-Pin Wu1,2, Chung-Yang Kao1, Leiming Wang1, Chad J. Creighton3,4, Jin Yang5, Taraka R. Donti6, Romain Harmancey7, Hernan G. Vasquez7, Brett H. Graham6,8, Hugo J. Bellen6,8, Heinrich Taegtmeyer7, Ching-Pin Chang5, Ming-Jer Tsai1,8 & Sophia Y. Tsai1,8 Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP- TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy. 1 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA. 2 Adrienne Helis Malvin Medical Research Foundation, New Orleans, Louisiana 70130, USA.
    [Show full text]
  • Proteomic and Metabolomic Analyses of Mitochondrial Complex I-Deficient
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 24, pp. 20652–20663, June 8, 2012 © 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Proteomic and Metabolomic Analyses of Mitochondrial Complex I-deficient Mouse Model Generated by Spontaneous B2 Short Interspersed Nuclear Element (SINE) Insertion into NADH Dehydrogenase (Ubiquinone) Fe-S Protein 4 (Ndufs4) Gene*□S Received for publication, November 25, 2011, and in revised form, April 5, 2012 Published, JBC Papers in Press, April 25, 2012, DOI 10.1074/jbc.M111.327601 Dillon W. Leong,a1 Jasper C. Komen,b1 Chelsee A. Hewitt,a Estelle Arnaud,c Matthew McKenzie,d Belinda Phipson,e Melanie Bahlo,e,f Adrienne Laskowski,b Sarah A. Kinkel,a,g,h Gayle M. Davey,g William R. Heath,g Anne K. Voss,a,h René P. Zahedi,i James J. Pitt,j Roman Chrast,c Albert Sickmann,i,k Michael T. Ryan,l Gordon K. Smyth,e,f,h b2 a,h,m,n3 David R. Thorburn, and Hamish S. Scott Downloaded from From the aMolecular Medicine Division, gImmunology Division, and eBioinformatics Division, Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia, the bMurdoch Childrens Research Institute, Royal Children’s Hospital and Department of Paediatrics, University of Melbourne, Parkville, Victoria 3052, Australia, the cDépartement de Génétique Médicale, Université de Lausanne, 1005 Lausanne, Switzerland, the dCentre for Reproduction and Development, Monash Institute of Medical Research, Clayton, Victoria 3168, Australia, the hDepartment of Medical Biology
    [Show full text]
  • 551978V2.Full.Pdf
    bioRxiv preprint doi: https://doi.org/10.1101/551978; this version posted February 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 A high-resolution, chromosome-assigned Komodo dragon genome reveals adaptations in the 2 cardiovascular, muscular, and chemosensory systems of monitor lizards 3 4 Abigail L. Lind1, Yvonne Y.Y. Lai2, Yulia Mostovoy2, Alisha K. Holloway1, Alessio Iannucci3, Angel 5 C.Y. Mak2, Marco Fondi3, Valerio Orlandini3, Walter L. Eckalbar4, Massimo Milan5, Michail 6 Rovatsos6,7, , Ilya G. Kichigin8, Alex I. Makunin8, Martina J. Pokorná6, Marie Altmanová6, Vladimir 7 A. Trifonov8, Elio Schijlen9, Lukáš Kratochvíl6, Renato Fani3, Tim S. Jessop10, Tomaso Patarnello5, 8 James W. Hicks11, Oliver A. Ryder12, Joseph R. Mendelson III13,14, Claudio Ciofi3, Pui-Yan 9 Kwok2,4,15, Katherine S. Pollard1,4,16,17,18, & Benoit G. Bruneau1,2,19 10 11 1. Gladstone Institutes, San Francisco, CA 94158, USA. 12 2. Cardiovascular Research Institute, University of California, San Francisco, CA 94143, USA. 13 3. Department of Biology, University of Florence, 50019 Sesto Fiorentino (FI), Italy 14 4. Institute for Human Genetics, University of California, San Francisco, CA 94143, USA. 15 5. Department of Comparative Biomedicine and Food Science, University of Padova, 35020 16 Legnaro (PD), Italy 17 6. Department of Ecology, Charles University, 128 00 Prague, Czech Republic 18 7. Institute of Animal Physiology and Genetics, The Czech Academy of Sciences, 277 21 19 Liběchov, Czech Republic 20 8.
    [Show full text]
  • Low Abundance of the Matrix Arm of Complex I in Mitochondria Predicts Longevity in Mice
    ARTICLE Received 24 Jan 2014 | Accepted 9 Apr 2014 | Published 12 May 2014 DOI: 10.1038/ncomms4837 OPEN Low abundance of the matrix arm of complex I in mitochondria predicts longevity in mice Satomi Miwa1, Howsun Jow2, Karen Baty3, Amy Johnson1, Rafal Czapiewski1, Gabriele Saretzki1, Achim Treumann3 & Thomas von Zglinicki1 Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence approach, we demonstrate that electron transport chain proteins, especially the matrix arm subunits of complex I, are decreased in young long-living mice, which is associated with improved complex I assembly, higher complex I-linked state 3 oxygen consumption rates and decreased superoxide production, whereas the opposite is seen in old mice. Disruption of complex I assembly reduces oxidative metabolism with concomitant increase in mitochondrial superoxide production. This is rescued by knockdown of the mitochondrial chaperone, prohibitin. Disrupted complex I assembly causes premature senescence in primary cells. We propose that lower abundance of free catalytic complex I components supports complex I assembly, efficacy of substrate utilization and minimal ROS production, enabling enhanced longevity. 1 Institute for Ageing and Health, Newcastle University, Newcastle upon Tyne NE4 5PL, UK. 2 Centre for Integrated Systems Biology of Ageing and Nutrition, Newcastle University, Newcastle upon Tyne NE4 5PL, UK. 3 Newcastle University Protein and Proteome Analysis, Devonshire Building, Devonshire Terrace, Newcastle upon Tyne NE1 7RU, UK. Correspondence and requests for materials should be addressed to T.v.Z.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Oma1 (NM 025909) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR208350 Oma1 (NM_025909) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Oma1 (NM_025909) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Oma1 Synonyms: 2010001O09Rik; MPRP-1; ZMPOMA1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Oma1 (NM_025909) Mouse Tagged ORF Clone – MR208350 ORF Nucleotide >MR208350 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCTCCTTTATGGACTGCAGTCTACCAGGATAAATCGGTTTCTCTCTGGAGTGAATAACCTGGCCA ACAGGAGACAGTGGACCCCCCCAGCAAGCTGTCCACTGGCACCAAAGCTCCGAGCAGTAAATGCATACTG GGGACTGAACACAGTCAGTCATTGTCATTCAGTGACCTTACTGCCTAGAAACTTTCTTTTCTGTAGGACT CTCAATCACAAAAAATCAAGATGCCTCTCAAGTGCCCAAAGCAAGGAATTGGGGGTGCTTACCTACAGAT GTACTGTGCGGGGTGATTCTGTTCTAAGACAAGGAGCAAGGAAAGTGGCTGGCGTTCCTGCTCTCGCGGC CTCCTGTTCTCCAAGCTGTCCTGCCGTAATAGAGGCCCGGAGTTTCCGTACATCTGCAAGGGTTCAGGCT GCCCCAGTCCCTCTCTTGCTGCTCATTCTGAAGCCAGTGCAAAAGCTCCTTGCTATCATCGTGGGCAGGG GCATAAGGAAATGGTGGCAAGCACTTCCCCCTAACAAGAAGGAGCTATTTAAAGACAGCGTGAGGAAGAA CAAGTGGCGGCTGCTTCTTGGTCTGAGTGCATTTGGACTGCTCTTTGTAGTGTTTTATTTCACTCACCTG
    [Show full text]
  • Abstracts from the 51St European Society of Human Genetics Conference: Electronic Posters
    European Journal of Human Genetics (2019) 27:870–1041 https://doi.org/10.1038/s41431-019-0408-3 MEETING ABSTRACTS Abstracts from the 51st European Society of Human Genetics Conference: Electronic Posters © European Society of Human Genetics 2019 June 16–19, 2018, Fiera Milano Congressi, Milan Italy Sponsorship: Publication of this supplement was sponsored by the European Society of Human Genetics. All content was reviewed and approved by the ESHG Scientific Programme Committee, which held full responsibility for the abstract selections. Disclosure Information: In order to help readers form their own judgments of potential bias in published abstracts, authors are asked to declare any competing financial interests. Contributions of up to EUR 10 000.- (Ten thousand Euros, or equivalent value in kind) per year per company are considered "Modest". Contributions above EUR 10 000.- per year are considered "Significant". 1234567890();,: 1234567890();,: E-P01 Reproductive Genetics/Prenatal Genetics then compared this data to de novo cases where research based PO studies were completed (N=57) in NY. E-P01.01 Results: MFSIQ (66.4) for familial deletions was Parent of origin in familial 22q11.2 deletions impacts full statistically lower (p = .01) than for de novo deletions scale intelligence quotient scores (N=399, MFSIQ=76.2). MFSIQ for children with mater- nally inherited deletions (63.7) was statistically lower D. E. McGinn1,2, M. Unolt3,4, T. B. Crowley1, B. S. Emanuel1,5, (p = .03) than for paternally inherited deletions (72.0). As E. H. Zackai1,5, E. Moss1, B. Morrow6, B. Nowakowska7,J. compared with the NY cohort where the MFSIQ for Vermeesch8, A.
    [Show full text]
  • Cells Phenotype of Human Tolerogenic Dendritic Glycolytic
    High Mitochondrial Respiration and Glycolytic Capacity Represent a Metabolic Phenotype of Human Tolerogenic Dendritic Cells This information is current as of September 26, 2021. Frano Malinarich, Kaibo Duan, Raudhah Abdull Hamid, Au Bijin, Wu Xue Lin, Michael Poidinger, Anna-Marie Fairhurst and John E. Connolly J Immunol published online 27 April 2015 http://www.jimmunol.org/content/early/2015/04/25/jimmun Downloaded from ol.1303316 Supplementary http://www.jimmunol.org/content/suppl/2015/04/25/jimmunol.130331 http://www.jimmunol.org/ Material 6.DCSupplemental Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published April 27, 2015, doi:10.4049/jimmunol.1303316 The Journal of Immunology High Mitochondrial Respiration and Glycolytic Capacity Represent a Metabolic Phenotype of Human Tolerogenic Dendritic Cells Frano Malinarich,*,† Kaibo Duan,† Raudhah Abdull Hamid,*,† Au Bijin,*,† Wu Xue Lin,*,† Michael Poidinger,† Anna-Marie Fairhurst,† and John E.
    [Show full text]
  • Biogenesis of NDUFS3-Less Complex I Indicates TMEM126A/OPA7 As an Assembly Factor of the ND4-Module
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.22.350587; this version posted October 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Biogenesis of NDUFS3-less complex I indicates TMEM126A/OPA7 as an assembly factor of the ND4-module Running title: NDUFS3-dependent CI disassembly pathway Luigi D’Angelo,1* Elisa Astro,1* Monica De Luise,2 Ivana Kurelac,2 Nikkitha Umesh-Ganesh,2 Shujing Ding,3 Ian M. Fearnley,3 Massimo Zeviani,3,4 Giuseppe Gasparre,2,5 Anna Maria Porcelli,1,6# Erika Fernandez-Vizarra,3,7# and Luisa Iommarini1# 1Department of Pharmacy and Biotechnology (FABIT), University of Bologna, Bologna, Italy 2Department of Medical and Surgical Sciences (DIMEC), University of Bologna, Bologna, Italy 3Medical Research Council-Mitochondrial Biology Unit, University of Cambridge, Cambridge, UK 4Venetian Institute of Molecular Medicine, Via Orus 2, 35128 Padova, Italy; Department of Neurosciences, University of Padova, via Giustiniani 2, 35128 Padova, Italy 5Center for Applied Biomedical Research (CRBA), University of Bologna, Bologna, Italy 6Interdepartmental Center of Industrial Research (CIRI) Life Science and Health Technologies, University of Bologna, Ozzano dell'Emilia, Italy 7Institute of Molecular, Cell and Systems Biology, University of Glasgow, Glasgow, UK. *Co-first authors #Co-last authors To whom correspondence should be addressed: Luisa Iommarini Department of Pharmacy and Biotechnology (FABIT) University of Bologna Via Francesco Selmi 3, 40126 Bologna, Italy Tel. +39 051 2091282 e-mail [email protected] Erika Fernandez-Vizarra Institute of Molecular, Cell and Systems Biology University of Glasgow University Avenue Glasgow G12 8QQ, UK Tel.
    [Show full text]
  • C11orf83 (UQCC3) (NM 001085372) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213079L3V C11orf83 (UQCC3) (NM_001085372) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: C11orf83 (UQCC3) (NM_001085372) Human Tagged ORF Clone Lentiviral Particle Symbol: UQCC3 Synonyms: C11orf83; CCDS41658.1; MC3DN9; UNQ655 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_001085372 ORF Size: 279 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC213079). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_001085372.2 RefSeq Size: 1959 bp RefSeq ORF: 282 bp Locus ID: 790955 UniProt ID: Q6UW78 Protein Families: Transmembrane MW: 10.5 kDa Gene Summary: Complex III is a mitochondrial inner membrane protein complex that transfers electrons from ubiquinol to cytochrome c. This gene encodes a protein that functions in complex III assembly. Mutations in this gene result in Mitochondrial complex III deficiency, nuclear type 9. [provided by RefSeq, Dec 2014] This product is to be used for laboratory only.
    [Show full text]
  • NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
    Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
    [Show full text]