DOCSLIB.ORG

Thesis Reference

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thesis Reference Thesis C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization DESMURS-ROUSSEAU, Marjorie Abstract Cette thèse a permis d'identifier C11orf83, désormais appelé UQCC3, comme étant une protéine mitochondriale ancrée dans la membrane interne. Nous avons constaté l'implication de C11orf83 dans l'assemblage du complexe III de la chaîne respiratoire via la stabilisation du complexe intermédiaire MT-CYB/UQCRB/UQCRQ. Nous avons également prouvé que C11orf83 était associée avec le dimère de complexe III et était détectée dans le supercomplexe III2/IV. Son absence induit une baisse significative de ce supercomplexe et du respirasome (I/III2/IV). La capacité de C11orf83 de lier les cardiolipines, connues pour être impliquées dans la formation et la stabilisation de ces supercomplexes, pourrait expliquer ces résultats. Ainsi, ce travail de thèse en lien avec une récente étude clinique mettant en évidence une déficience du complexe III chez un patient atteint d'une mutation du gène C11orf83 (Wanschers et al., 2014) permet d'améliorer les connaissances sur l'assemblage du complexe III et la compréhension d'une maladie mitochondriale. Reference DESMURS-ROUSSEAU, Marjorie. C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. Thèse de doctorat : Univ. Genève, 2015, no. Sc. 4857 DOI : 10.13097/archive-ouverte/unige:108015 URN : urn:nbn:ch:unige-1080158 Available at: http://archive-ouverte.unige.ch/unige:108015 Disclaimer: layout of this document may differ from the published version. 1 / 1 UNIVERSITÉ DE GENÈVE Département de Biologie Cellulaire FACULTÉ DES SCIENCES Professeur Jean-Claude Martinou Département de Science des Protéines Humaines FACULTÉ DE MEDECINE Professeur Amos Bairoch C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. THESE présentée à la Faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologie par Marjorie DESMURS de France Genève 2015 2 Table of contents Remerciements ............................................................................................................................ 7 Résumé ......................................................................................................................................... 9 Abstract ...................................................................................................................................... 11 Abbreviations ............................................................................................................................. 13 Introduction ........................................................................................................ 15 I. Mitochondria ...................................................................................................................... 16 I.1. Mitochondria functions ................................................................................................. 17 I.2. Mitochondrial structure ................................................................................................. 18 I.2.1. Outer membrane .................................................................................................. 18 I.2.2. Inner boundary membrane ................................................................................... 18 I.2.3. Cristae and proteins and lipids involved in their maintenance.............................. 19 II. Electron transport chain (ETC) ......................................................................................... 29 III. Ubiquinol-cytochrome c reductase .................................................................................. 31 III.1. The catalytic mechanism of the bc1 complex: ............................................................. 31 the Q-cycle ............................................................................................................................... 31 III.2. Structure of the bc1 complex ....................................................................................... 33 III.2.1. The bc1 catalytic core subunits ............................................................................ 34 III.2.2. The bc1 complex supernumerary subunits .......................................................... 35 III.3. Assembly of bc1 complex ............................................................................................ 36 III.3.1. Early and late core subcomplexes ....................................................................... 37 III.3.2. Rieske protein (UQCRFS1/Rip1p) insertion into late core subcomplex ............... 37 III.3.3. Dimerization of the bc1 complex .......................................................................... 38 III.4. Nuclear-encoded accessory proteins involved in bc1 assembly .................................. 39 III.4.1. UQCC1 and UQCC2 ............................................................................................ 39 III.4.2. BCS1L ................................................................................................................. 41 III.4.3. LYRM7/MZM1L .................................................................................................... 42 III.4.4. TTC19 .................................................................................................................. 44 III.5. Role of lipids in bc1 complex stability and assembly .................................................... 45 3 III.6. Bc1 complex deficiencies ............................................................................................. 48 IV. Respiratory chain supercomplexes (RCS)....................................................................... 51 IV.1. Are RCS respiratory active entities? ............................................................................ 52 IV.2. Functional roles of RCS ............................................................................................... 53 IV.2.1. Kinetic advantage: channeling ............................................................................. 53 IV.2.2. OXPHOS adaptation to metabolic needs ............................................................. 54 IV.2.3. Reactive oxygen species limitation ...................................................................... 55 IV.2.4. Structural advantage: protein stability and assembly scaffold .............................. 55 IV.3. Assembly of RSC ......................................................................................................... 56 IV.4. Assembly factors and stabilizing factor ........................................................................ 58 IV.4.1. Cardiolipin ............................................................................................................ 58 IV.4.2. Rcf1p/Rcf2p (HIGD1A, HIGD2A) ......................................................................... 59 IV.4.3. COX7A2L/SCAF1 ................................................................................................ 60 Aim of Thesis ...................................................................................................... 63 Results ............................................................................................................... 67 I. C11orf83 is an integral mitochondrial IM protein facing the IMS ................................... 68 II. C11orf83 downregulation impairs mitochondrial functions ........................................... 73 III. C11orf83 depletion induces defects in RSC .................................................................... 75 IV. C11orf83 interacts with the bc1 complex and is involved in the early stages of bc1 assembly .................................................................................................................................... 78 V. C11orf83 is a CL-binding protein involved in cristae maintenance ............................... 82 Discussion and Perspectives ........................................................................................... 93 I. C11orf83 is a mitochondrial protein ................................................................................. 94 II. C11orf83 is a new human bc1 complex assembly factor ............................................... 95 III. C11orf83/UQCC3 could be the human functional analogue of Cbp4p .......................... 96 IV. How could C11orf83/UQCC3 assist the bc1 assembly? ............................................... 101 IV.1. CL-binding property of C11orf83/UQCC3 .................................................................. 101 IV.2. GXXXG motif ............................................................................................................. 102 4 V. C11orf83/UQCC3 and RCS stabilization......................................................................... 104 VI. C11orf83/UQCC3 is involved in cristae maintenance ................................................... 106 VII. C11orf83/UQCC3 is a target of OMA1 ............................................................................ 107 VIII. Mutation in C11orf83/UQCC3 causes a mitochondrial complex III deficiency ........... 111 Material and Methods ....................................................................................... 113 Appendix .................................................................................................................................
Load more

Recommended publications
  • Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach
    Mafalda Rita Avó Bacalhau Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach Tese de doutoramento do Programa de Doutoramento em Ciências da Saúde, ramo de Ciências Biomédicas, orientada pela Professora Doutora Maria Manuela Monteiro Grazina e co-orientada pelo Professor Doutor Henrique Manuel Paixão dos Santos Girão e pela Professora Doutora Lee-Jun C. Wong e apresentada à Faculdade de Medicina da Universidade de Coimbra Julho 2017 Faculty of Medicine Establishing the pathogenicity of novel mitochondrial DNA sequence variations: a cell and molecular biology approach Mafalda Rita Avó Bacalhau Tese de doutoramento do programa em Ciências da Saúde, ramo de Ciências Biomédicas, realizada sob a orientação científica da Professora Doutora Maria Manuela Monteiro Grazina; e co-orientação do Professor Doutor Henrique Manuel Paixão dos Santos Girão e da Professora Doutora Lee-Jun C. Wong, apresentada à Faculdade de Medicina da Universidade de Coimbra. Julho, 2017 Copyright© Mafalda Bacalhau e Manuela Grazina, 2017 Esta cópia da tese é fornecida na condição de que quem a consulta reconhece que os direitos de autor são pertença do autor da tese e do orientador científico e que nenhuma citação ou informação obtida a partir dela pode ser publicada sem a referência apropriada e autorização. This copy of the thesis has been supplied on the condition that anyone who consults it recognizes that its copyright belongs to its author and scientific supervisor and that no quotation from the
    [Show full text]
  • Light-Induced Psba Translation in Plants Is Triggered by Photosystem II Damage Via an Assembly-Linked Autoregulatory Circuit
    Light-induced psbA translation in plants is triggered by photosystem II damage via an assembly-linked autoregulatory circuit Prakitchai Chotewutmontria and Alice Barkana,1 aInstitute of Molecular Biology, University of Oregon, Eugene, OR 97403 Edited by Krishna K. Niyogi, University of California, Berkeley, CA, and approved July 22, 2020 (received for review April 26, 2020) The D1 reaction center protein of photosystem II (PSII) is subject to mRNA to provide D1 for PSII repair remain obscure (13, 14). light-induced damage. Degradation of damaged D1 and its re- The consensus view in recent years has been that psbA transla- placement by nascent D1 are at the heart of a PSII repair cycle, tion for PSII repair is regulated at the elongation step (7, 15–17), without which photosynthesis is inhibited. In mature plant chloro- a view that arises primarily from experiments with the green alga plasts, light stimulates the recruitment of ribosomes specifically to Chlamydomonas reinhardtii (Chlamydomonas) (18). However, we psbA mRNA to provide nascent D1 for PSII repair and also triggers showed recently that regulated translation initiation makes a a global increase in translation elongation rate. The light-induced large contribution in plants (19). These experiments used ribo- signals that initiate these responses are unclear. We present action some profiling (ribo-seq) to monitor ribosome occupancy on spectrum and genetic data indicating that the light-induced re- cruitment of ribosomes to psbA mRNA is triggered by D1 photo- chloroplast open reading frames (ORFs) in maize and Arabi- damage, whereas the global stimulation of translation elongation dopsis upon shifting seedlings harboring mature chloroplasts is triggered by photosynthetic electron transport.
    [Show full text]
  • Dual Mutations Reveal Interactions Between Components of Oxidative Phosphorylation in Kluyveromyces Lactis
    Copyright 2001 by the Genetics Society of America Dual Mutations Reveal Interactions Between Components of Oxidative Phosphorylation in Kluyveromyces lactis G. D. Clark-Walker and X. J. Chen Molecular Genetics and Evolution Group, Research School of Biological Sciences, The Australian National University, Canberra, ACT, 2601, Australia Manuscript received April 10, 2001 Accepted for publication August 3, 2001 ABSTRACT Loss of mtDNA or mitochondrial protein synthesis cannot be tolerated by wild-type Kluyveromyces lactis. The mitochondrial function responsible for ␳0-lethality has been identified by disruption of nuclear genes encoding electron transport and F0-ATP synthase components of oxidative phosphorylation. Sporulation of diploid strains heterozygous for disruptions in genes for the two components of oxidative phosphoryla- tion results in the formation of nonviable spores inferred to contain both disruptions. Lethality of spores is thought to result from absence of a transmembrane potential, ⌬⌿, across the mitochondrial inner membrane due to lack of proton pumping by the electron transport chain or reversal of F1F0-ATP synthase. Synergistic lethality, caused by disruption of nuclear genes, or ␳0-lethality can be suppressed by the atp2.1 ␤ mutation in the -subunit of F1-ATPase. Suppression is viewed as occurring by an increased hydrolysis of ATP by mutant F1, allowing sufficient electrogenic exchange by the translocase of ADP in the matrix for ATP in the cytosol to maintain ⌬⌿. In addition, lethality of haploid strains with a disruption of AAC encoding the ADP/ATP translocase can be suppressed by atp2.1. In this case suppression is considered to occur by mutant F1 acting in the forward direction to partially uncouple ATP production, thereby stimulating respiration and relieving detrimental hyperpolarization of the inner membrane.
    [Show full text]
  • Mitochondrial Complex III Deficiency Associated with a Homozygous Mutation in UQCRQ
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REPORT Mitochondrial Complex III Deficiency Associated with a Homozygous Mutation in UQCRQ Ortal Barel,1 Zamir Shorer,2 Hagit Flusser,2 Rivka Ofir,1 Ginat Narkis,1 Gal Finer,1 Hanah Shalev,2 Ahmad Nasasra,2 Ann Saada,3 and Ohad S. Birk1,4,* A consanguineous Israeli Bedouin kindred presented with an autosomal-recessive nonlethal phenotype of severe psychomotor retarda- tion and extrapyramidal signs, dystonia, athetosis and ataxia, mild axial hypotonia, and marked global dementia with defects in verbal and expressive communication skills. Metabolic workup was normal except for mildly elevated blood lactate levels. Brain magnetic resonance imaging (MRI) showed increased density in the putamen, with decreased density and size of the caudate and lentiform nuclei. Reduced activity specifically of mitochondrial complex III and variable decrease in complex I activity were evident in muscle biopsies. Homozygosity of affected individuals to UQCRB and to BCSIL, previously associated with isolated complex III deficiency, was ruled out. Genome-wide linkage analysis identified a homozygosity locus of approximately 9 cM on chromosome 5q31 that was further narrowed down to 2.14 cM, harboring 30 genes (logarithm of the odds [LOD] score 8.82 at q ¼ 0). All 30 genes were sequenced, revealing a single missense (p.Ser45Phe) mutation in UQCRQ (encoding ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5 kDa), one of the ten nuclear
    [Show full text]
  • Airway Inflammation Mitochondrial Dysfunction Increases Allergic
    Mitochondrial Dysfunction Increases Allergic Airway Inflammation Leopoldo Aguilera-Aguirre, Attila Bacsi, Alfredo Saavedra-Molina, Alexander Kurosky, Sanjiv Sur and Istvan This information is current as Boldogh of October 1, 2021. J Immunol 2009; 183:5379-5387; Prepublished online 28 September 2009; doi: 10.4049/jimmunol.0900228 http://www.jimmunol.org/content/183/8/5379 Downloaded from References This article cites 61 articles, 11 of which you can access for free at: http://www.jimmunol.org/content/183/8/5379.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 1, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Mitochondrial Dysfunction Increases Allergic Airway Inflammation1 Leopoldo Aguilera-Aguirre,*§ Attila Bacsi,*¶ Alfredo Saavedra-Molina,§ Alexander Kurosky,† Sanjiv Sur,‡ and Istvan Boldogh*2 The prevalence of allergies and asthma among the world’s population has been steadily increasing due to environmental factors.
    [Show full text]
  • M-AAA and I-AAA Complexes Coordinate to Regulate OMA1, The
    © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs213546. doi:10.1242/jcs.213546 SHORT REPORT m-AAA and i-AAA complexes coordinate to regulate OMA1, the stress-activated supervisor of mitochondrial dynamics Francesco Consolato1,*, Francesca Maltecca1,*, Susanna Tulli1, Irene Sambri2 and Giorgio Casari1,2,‡ ABSTRACT and fission (L and S forms, respectively) (Anand et al., 2014). The The proteolytic processing of dynamin-like GTPase OPA1, mediated balance between long and short OPA1 forms is finely regulated by two by the activity of both YME1L1 [intermembrane (i)-AAA protease mitochondrial inner membrane proteases, OMA1 (Ehses et al., 2009) complex] and OMA1, is a crucial step in the regulation of mitochondrial and YME1L1, which cleave OPA1 at different sites (Song et al., 2007). dynamics. OMA1 is a zinc metallopeptidase of the inner mitochondrial The intermembrane (i)-AAA protease YME1L1 exposes its membrane that undergoes pre-activating proteolytic and auto- catalytic domain to the intermembrane space (Leonhard et al., 1996) proteolytic cleavage after mitochondrial import. Here, we identify and is responsible for generation of the S2-OPA1 form by proteolytic AFG3L2 [matrix (m)-AAA complex] as the major protease mediating cleavage, whereas OMA1 gives rise to the S1 and S3 forms (Anand this event, which acts by maturing the 60 kDa pre-pro-OMA1 to the et al., 2014; MacVicar and Langer, 2016; Quirós et al., 2012). 40 kDa pro-OMA1 form by severing the N-terminal portion without OMA1 harbours an M48 metallopeptidase domain and is the major recognizing a specific consensus sequence. Therefore, m-AAA and player in OPA1 processing under conditions of stress (Quirós et al., Δϕ i-AAA complexes coordinately regulate OMA1 processing and 2012).
    [Show full text]
  • Original Article Bioinformatic Analysis of Gene Expression Profile in Prostate Epithelial Cells Exposed to Low-Dose Cadmium
    Int J Clin Exp Med 2018;11(3):1669-1678 www.ijcem.com /ISSN:1940-5901/IJCEM0062792 Original Article Bioinformatic analysis of gene expression profile in prostate epithelial cells exposed to low-dose cadmium Qiling Liu1,2*, Rongqiang Zhang2*, Xiang Wang1, Peili Wang2, Xiaomei Ren2, Na Sun2, Xiangwen Li2, Xinhui Li2, Chunxu Hai1 1Department of Toxicology, The Ministry of Education Key Lab of Hazard Assessment and Control in Special Op- erational Environment, Shaanxi Provincial Key Lab of Free Radical Biology and Medicine, School of Public Health, Medical University of The Air Force, Xi’an, Shaanxi 710032, China; 2Department of Epidemic and Health Statis- tics, The College of Public Health for The Shaanxi University of Chinese Medicine, Shaanxi 712046, China. *Equal contributors. Received July 25, 2017; Accepted February 5, 2018; Epub March 15, 2018; Published March 30, 2018 Abstract: Objective: This study was to identify key genes and biological pathways involved in responses of prostate epithelial cells after low-dose Cd exposure by using bioinformatic analysis. Methods: The gene chip data of prostate epithelial cells after low-dose Cd exposure were collected from public databases Gene Expression Omnibus. After identification of differentially expressed genes (DEGs), data were input into Qlucore Omics Explorer, Network Analyst, String, and Genclip for further analysis of gene expression profiles, protein-protein interactions (PPI) and protein- chemicals interactions, and critical molecular pathways. Results: A total of 384 DEGs were identified in Cd treated group compared with control group. The number of DEGs gradually decreased over time, with the largest number at 0 h. Furthermore, NDUFB5 (A, S), CYC1, UQCRB, ETFA (B), SNRPD2, and LSM3 (5, 6) were the hub proteins in the PPI network.
    [Show full text]
  • The Landscape of Genomic Imprinting Across Diverse Adult Human Tissues
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Research The landscape of genomic imprinting across diverse adult human tissues Yael Baran,1 Meena Subramaniam,2 Anne Biton,2 Taru Tukiainen,3,4 Emily K. Tsang,5,6 Manuel A. Rivas,7 Matti Pirinen,8 Maria Gutierrez-Arcelus,9 Kevin S. Smith,5,10 Kim R. Kukurba,5,10 Rui Zhang,10 Celeste Eng,2 Dara G. Torgerson,2 Cydney Urbanek,11 the GTEx Consortium, Jin Billy Li,10 Jose R. Rodriguez-Santana,12 Esteban G. Burchard,2,13 Max A. Seibold,11,14,15 Daniel G. MacArthur,3,4,16 Stephen B. Montgomery,5,10 Noah A. Zaitlen,2,19 and Tuuli Lappalainen17,18,19 1The Blavatnik School of Computer Science, Tel-Aviv University, Tel Aviv 69978, Israel; 2Department of Medicine, University of California San Francisco, San Francisco, California 94158, USA; 3Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts 02114, USA; 4Program in Medical and Population Genetics, Broad Institute of Harvard and MIT, Cambridge, Massachusetts 02142, USA; 5Department of Pathology, Stanford University, Stanford, California 94305, USA; 6Biomedical Informatics Program, Stanford University, Stanford, California 94305, USA; 7Wellcome Trust Center for Human Genetics, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, OX3 7BN, United Kingdom; 8Institute for Molecular Medicine Finland, University of Helsinki, 00014 Helsinki, Finland; 9Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, Switzerland;
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Oma1 (NM 025909) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR208350 Oma1 (NM_025909) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Oma1 (NM_025909) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Oma1 Synonyms: 2010001O09Rik; MPRP-1; ZMPOMA1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Oma1 (NM_025909) Mouse Tagged ORF Clone – MR208350 ORF Nucleotide >MR208350 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCTCCTTTATGGACTGCAGTCTACCAGGATAAATCGGTTTCTCTCTGGAGTGAATAACCTGGCCA ACAGGAGACAGTGGACCCCCCCAGCAAGCTGTCCACTGGCACCAAAGCTCCGAGCAGTAAATGCATACTG GGGACTGAACACAGTCAGTCATTGTCATTCAGTGACCTTACTGCCTAGAAACTTTCTTTTCTGTAGGACT CTCAATCACAAAAAATCAAGATGCCTCTCAAGTGCCCAAAGCAAGGAATTGGGGGTGCTTACCTACAGAT GTACTGTGCGGGGTGATTCTGTTCTAAGACAAGGAGCAAGGAAAGTGGCTGGCGTTCCTGCTCTCGCGGC CTCCTGTTCTCCAAGCTGTCCTGCCGTAATAGAGGCCCGGAGTTTCCGTACATCTGCAAGGGTTCAGGCT GCCCCAGTCCCTCTCTTGCTGCTCATTCTGAAGCCAGTGCAAAAGCTCCTTGCTATCATCGTGGGCAGGG GCATAAGGAAATGGTGGCAAGCACTTCCCCCTAACAAGAAGGAGCTATTTAAAGACAGCGTGAGGAAGAA CAAGTGGCGGCTGCTTCTTGGTCTGAGTGCATTTGGACTGCTCTTTGTAGTGTTTTATTTCACTCACCTG
    [Show full text]
  • PARL Deficiency in Mouse Causes Complex III Defects, Coenzyme Q Depletion, and Leigh-Like Syndrome
    PARL deficiency in mouse causes Complex III defects, coenzyme Q depletion, and Leigh-like syndrome Marco Spinazzia,b,1, Enrico Radaellic, Katrien Horréa,b, Amaia M. Arranza,b, Natalia V. Gounkoa,b,d, Patrizia Agostinise, Teresa Mendes Maiaf,g,h, Francis Impensf,g,h, Vanessa Alexandra Moraisi, Guillermo Lopez-Lluchj,k, Lutgarde Serneelsa,b, Placido Navasj,k, and Bart De Stroopera,b,l,1 aVIB Center for Brain and Disease Research, 3000 Leuven, Belgium; bDepartment of Neurosciences, Katholieke Universiteit Leuven, 3000 Leuven, Belgium; cComparative Pathology Core, Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104-6051; dElectron Microscopy Platform, VIB Bio Imaging Core, 3000 Leuven, Belgium; eCell Death Research & Therapy Laboratory, Department for Cellular and Molecular Medicine, Katholieke Universiteit Leuven, 3000 Leuven, Belgium; fVIB Center for Medical Biotechnology, VIB, 9000 Ghent, Belgium; gVIB Proteomics Core, VIB, 9000 Ghent, Belgium; hDepartment for Biomolecular Medicine, Ghent University, 9000 Ghent, Belgium; iInstituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, 1649-028 Lisbon, Portugal; jCentro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide-Consejo Superior de Investigaciones Científicas-Junta de Andalucía, 41013 Seville, Spain; kCentro de Investigaciones Biomédicas en Red de Enfermedades Raras, Instituto de Salud Carlos III, 28029 Madrid, Spain; and lUK Dementia Research Institute, University College London, WC1E 6BT London, United Kingdom Edited by Richard D. Palmiter, University of Washington, Seattle, WA, and approved November 21, 2018 (received for review July 11, 2018) The mitochondrial intramembrane rhomboid protease PARL has been proposed that PARL exerts proapoptotic effects via misprocessing implicated in diverse functions in vitro, but its physiological role in of the mitochondrial Diablo homolog (hereafter DIABLO) (10).
    [Show full text]
  • NDUFAB1 Protects Heart by Coordinating Mitochondrial Respiratory Complex
    bioRxiv preprint doi: https://doi.org/10.1101/302281; this version posted April 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. NDUFAB1 Protects Heart by Coordinating Mitochondrial Respiratory Complex and Supercomplex Assembly Running title: Hou et al. Cardiac Protection by NDUFAB1 Tingting Hou 1; Rufeng Zhang 1; Chongshu Jian 1; Wanqiu Ding 1; Yanru Wang 1; Qi Ma 1; Xinli Hu 1; Heping Cheng 1,†; Xianhua Wang 1,† 1State Key Laboratory of Membrane Biology, Beijing Key Laboratory of Cardiometabolic Molecular Medicine, Peking-Tsinghua Center for Life Sciences, Institute of Molecular Medicine, Peking University, China. † Corresponding author. Xianhua Wang Tel: 86-10-62754605 Email: [email protected] Heping Cheng Tel: 86-10-62765957 Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/302281; this version posted April 16, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The impairment of mitochondrial bioenergetics, often coupled with exaggerated reactive oxygen species (ROS) production, is emerging as a common mechanism in diseases of organs with a high demand for energy, such as the heart. Building a more robust cellular powerhouse holds promise for protecting these organs in stressful conditions. Here, we demonstrate that NDUFAB1 (NADH:ubiquinone oxidoreductase subunit AB1), acts as a powerful cardio-protector by enhancing mitochondrial energy biogenesis. In particular, NDUFAB1 coordinates the assembly of respiratory complexes I, II, and III and supercomplexes, conferring greater capacity and efficiency of mitochondrial energy metabolism.
    [Show full text]