© 2013 Nature America, Inc. All rights reserved. contributed equally to this work. Correspondence should be addressed to C.L.-O. ( de Anatomía Patológica, Hospital Clínic, Universitat de Barcelona, Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain. 2 1 POT1 mutations, gene size and codon composition were taken into account, and represent a new tumor-driving factor. In fact, when the number of instability genomic of source a be might gene this in mutations that recruitment telomerase and capping telomere in role prominent its given and, CLL, in mutation somatic for target in CLL roles cal MYD88 described algorithm previously the using mutations somatic tumoral identifying CLL, with individuals untreated 127 of blood peripheral the exomes analyzed of matched tumor and samples normal from the disease inability to accurately identify the genetic alterations that underlie this A long-standing barrier to understanding leukemogenesis has been an management gene The favor chromosomal POT1 and two of found complex were reaching of recurrent data data leukemia Chronic López-Otín Carlos Mónica López-Guerra Neus Villamor Andrew J Ramsay lymphocytic leukemia POT1 Nature Ge Nature Received 29 October 2012; accepted 22 February 2013; published online 17 March 2013; Telomeres and Telomerase Group, Molecular Oncology Program, Spanish National Cancer Research Centre (CNIO), Madrid,Departamento Spain. de Bioquímica y Biología Molecular, Instituto Universitario de Oncología del Principado de Asturias (IUOPA) Universidad de Oviedo, Oviedo, Spain.

telomeres POT1

identification affects

oligonucleotide-/oligosaccharide-binding

from from

in was the gene by that was affected most point second frequently considered. -mutated the

to 4

, have previously been assessed for their functional and clini for functional their , assessed have been previously . . To gain insight further into the genetic basis of CLL, we have CLL

lymphocytic

primarily

be

and 5 9%

acquisition in 1 , somatic 2 6 n

. . Several of the driver genes, such as key

1 27

etics mutated adults may 1

4

mutations cause telomere dysfunction in chronic when is of

abnormalities ) 5– additional individuals

CLL residues

the in this 8

3 facilitate

. We also observed that that . We observed also

POT1

, , David Rodríguez

1 3.5% of mutations occurs

ADVANCE ONLINE PUBLICATION ONLINE ADVANCE –

first only

cells 3

disease.

1

POT1

in . of leukemia , 1

4 We

, , Víctor Quesada

human

the

member encodes required

of individuals

have

affected

3

in have with

novel

, , Armando López-Guillermo the

as malignant

gene that in

a

numerous

cases,

cancer. (CLL) analyzed CLL new POT1

approaches

of a suggest

to

regions

individuals, component

this

and without bind frequently

is with

(encoding features

1 Somatic

POT1 the

telomeric , , Agnieszka Kwarciak Sanger

telomeric exome that

telomeric encoding

1 the

most , 9

4

SF3B1 IGHV , is a frequent genetic genetic is a frequent for 1 , , Miguel Foronda

POT1 0

frequency

identifying (OB) , we hypothesized hypothesized we , of

of

mutated

sequencing

mutation

the sequencing protection

frequent

the

CLL , , structure @

NOTCH1

and

DNA. the clinical mutations folds

mutations shelterin

cells.

Sidrón

and 3 , , Xose S Puente

[email protected] -

1 2 , Cecilia Garabaya , Cecilia , 4 5% of CLL cases ( cases CLL of 5% ( mutations ( netically conserved and suggests that they have an essential role in in role essential an have they that suggests and conserved netically phyloge are residues mutated most that showed alterations somatic the ( encoding folds regions OB gene within reside samples CLL in detected 12 the of 9 Notably, complex. shelterin the to POT1 anchors and TPP1 binds that terminus C a to addition in TTAGGG, for sequence (ssDNA) DNA affinity single-stranded protein the this to confer which domains, OB N-terminal telomer by ase extension telomere and replication modulating by capping, telomere integrity telomere of regulators critical are POT1) ( CLL in event driver a constitute tools bioinformatics five and were predominantly predicted to be deleterious by a consensus of nonsynonymous all were mutations somatic remaining The protein. the 12 mutations found in in with CLL along make that of have a wild-type with individuals of 9% that implies also finding fied 12 somatic point mutations in 341 CLL cases (3.5%; alleles in CLL tumor cells (data not shown). Therefore, we have identi of mutant expression the confirmed cases of available analysis (RNA-seq) sequencing RNA mutations. somatic additional 5 of ing ( CLL with individuals from samples normal and tumor matched 214 of consisting set validation of analysis our sequence for the development of this aggressive CLL subtype. We next extended of inactivation exclusively altered in samples with wild-type P , Laura , Conde Laura = 8.6 × 10 × 8.6 = Shelterin proteins (namely TRF1, TRF2, TIN2, TPP1, RAP1 and and RAP1 TPP1, TIN2, TRF2, TRF1, (namely proteins Shelterin 12– POT1 1 d POT1 4 SF3B1 ), E.C. ( o . Structurally, POT1 is the only shelterin that contains two two contains that shelterin only the is POT1 Structurally, . i : 1 0 Fig. P one of so mutated far the most genes reported frequently . mutation, which is a comparable mutational frequency to 1 = 4.2 × 10 1 (11%) in of individuals this CLL subtype −11 [email protected] 0 , , María A Blasco 3

POT1 1 8 ). ). a / n ). Comparative sequence analysis of the OB fold fold OB the of analysis sequence Comparative ). Supplementary Table 1 Table Supplementary POT1 NOTCH1 3 g , Alejandra , Martínez-TrillosAlejandra . 2 could represent a distinct molecular alteration alteration molecular distinct a represent could 5 1 , , Mercedes Gallardo −6 8 4 was found to be mutated in approximately approximately in mutated be to found was 1 POT1 ), ), with only 1 POT1 , supporting the idea that idea the , supporting , , Supplementary Table 2 Supplementary SF3B1 by performing Sanger sequencing in by Sanger a sequencing performing ) or M.A.B. ( are to predicted result in a truncated POT1 Table 2 , Elías , Campo Elías , , SF3B1 TP53 3 Unidad de Hematopatología, Servicio somatic mutations we have have we mutations somatic 1 ). [email protected] and having a higher frequency ) and, conspicuously, was was conspicuously, and, ) IGHV@ ATM 2 ,

s r e t t e l POT1 5– , suggesting , that suggesting ), with the find the with ), 3 7 & 8 . . Our findings 3 . . Notably, 3 of Table ). , 4 These authors

mutations mutations IGHV@ 1 ). ). This POT1  - - - -

© 2013 Nature America, Inc. All rights reserved. in dark and light purple, respectively. ( in purple, and dark light are highlighted residues conserved and partially Completely are shown. species diverse in evolutionarily (arrows) residues mutated the non-truncating ( in are shown black. and CLL studies in tumors other alterations Below,somatic boxes). (green additional of indicated the OB domains the with positions of the protein, on a are representation depicted (red) in study this 1 Figure 25 total mutations), confirming that this region is the main target of the tions that are annotated in databases affect the OB fold of POT1 (19 of genome study on leukemia this independent an from CLL with individual an in as well as cinomas car hepatocellular,ovarian and lungcell, squamous stomach, breast, tional ( chance by occurred have to likely not is interface interaction DNA that the clustering of point substitutions in residues close to the POT1- ing of POT1 to DNA.telomeric A Monte Carlo simulation confirmed that the somatic mutations in reported this work the destabilize bind ( sequence ent of telomeric regions the with Gln94 and differ interactions His266 likely disrupt electrostatic Lys90, Tyr36, affecting mutations whereas DNA, telomeric guanine of base terminal the with residue aromatic this of interaction the telomeric ssDNA( bind to POT1 of ability the diminishing and interaction POT1 the in residues affect or protein resulting the terminate prematurely observed The tions. interrogate implications the of structural potential the OB fold altera (ref. POT1 human of portion N-terminal the protein s r e t t e l  to CLL with are shown the right. in individuals identified acids amino mutated of views several Detailed 099 157 013 184 044 Case T 284 085 072 647 006 195 742 P Conservation b a able able 1 POT1 < 1 × 10 Opossum Chicken Human Mouse - K18 POT1 Splicing telomere interaction interface, thereby likely destabilizing this thereby likely destabilizing interface, telomere interaction Frog

function ( function Rat Structural impact of impact Structural Fig. 1 Fig. S N omatic omatic mutations affecting −7 g.124493080C>A g.124493098T>A g.124493146G>T g.124499045T>C g.124503669T>C g.124503669T>C g.124503682T>C g.124511022A>C g.124532338A>T g.124537227T>A g.124537268A>T g.124465325A>C G76V mutations in individuals with multiple myeloma and and myeloma multiple with individuals in mutations ). ). Further genomic database analysis has addi identified c N24S M1 Mutation ). Thus, the mutation affecting Tyr223 would abolish abolish Tyr223 would affecting mutation the Thus, ). G95C 36 L Fig. Y36N K39E F101I POT1

1 Y66 OB1 b R137L I78T ). The availability of a crystal structure for structure crystal a of availability The ). mutations in individuals with CLL either either CLL with individuals in mutations * POT1 K90E P146Q Exon 4–5 8 R137C 18 10 10 10 90 9 8 8 8 7 6 5 , 1 somatic mutations. ( mutations. somatic 6 Q94R Q94R ( W148L c Fig. 1 ) Ribbon representation of the POT1 OB domains (green) bound to a telomere-like oligonucleotide (orange). (orange). oligonucleotide to bound a telomere-like (green) of the OB POT1 domains ) representation Ribbon 94 Amino-acid change Y223C Fig. 1 Fig. POT1 G205D V183L p.His266Leu p.Cys591Trp p.Tyr223Cys p.Gly272Val a OB2 p.Gln94Arg p.Gln94Arg p.Lys90Glu p.Tyr36Asn p.Met1Leu p.Ser250* ). ). Most of the p.Tyr66* S250 c in individuals with C Q214 ). This finding suggests suggests finding ). This – 1 G274E 5 * ) allowed us to next next to us allowed ) * 223 H266L D224H a ) Impact of mutations on the primary structure of the POT1 protein. The alterations identified identified The alterations of the protein. POT1 structure on the primary ) of mutations Impact T246 G272V L343F POT1 b G S Mutation type ) Phylogenetic features of the mutated residues. Protein sequence alignments around around alignments sequence Protein residues. of the mutated features ) Phylogenetic 272 Nonsense Nonsense Missense Missense Missense Missense Missense Missense Missense Missense Missense muta Splicing 266 V R276S LL ------

272 P446 orsodn H18 cls ( cells HT1080 corresponding the in Myc to antibody with immunoprecipitations in DNA meric telo detected that assays (ChIP) immunoprecipitation by chromatin tion of the mutant Myc-tagged POT1 proteins confirmed was further the OB fold do not interrupt telomeric localization. Telomeric associa protein binding ( TRF1 a had proteins telomere- the with POT1 colocalized and pattern staining nuclear punctate Myc-tagged mutant and wild-type the that Consistent with ( this finding, sequence a similar abolishmenttelomeric of the telomere bind binding to unable were substitution p.Tyr223Cys or p.Tyr36Asn the containing proteins POT1 contrast, POT1 wild-type bound efficiently telomeric ssDNA, whereas, in stark com plexes by that mobility shift assay electrophoretic confirmed (EMSA) protein-DNA the of Visualization ssDNA. telomeric labeled ( proteins POT1 translated were POT1 mutant and wild-type for cDNA containing Constructs hang. the of ability POT1 to bind to the 3 affected domains OB the of p.Tyr36Asnp.Tyr223Cys and alterations the whether to determine sought we next mutantproteins, the POT1 ( proteins mutant POT1 the of presence the in telomeres to localized remained that the also confirmed shelterin components RAP1, TRF1 and TRF2 P475L Q K46 5 Deleterious Deleterious Deleterious Deleterious Deleterious Deleterious Deleterious Deleterious Prediction * Neutral R477T Fig. 591 – – – C591W

2b I535F a Supplementary Fig. 1a Fig. Supplementary in vitro in , DVANCE ONLINE PUBLICATION ONLINE DVANCE c ). Having established the telomeric localization of localization telomeric the established Having ). Fig. Fig. 2 microscopy analysis of HT1080 cells showed showed cells of HT1080 analysis microscopy Immunofluorescence POT1. endogenous of and Tyr223Cys) POT1 proteins exogenous in the presence express Myc-tagged to wild-type and mutant (Tyr36Asn transfer gene viral created we heter possibility, this assess further the for reported dominant- a in negative manner, analogous to function that previously proteins POT1 mutated thathypothesizedwethe allele, type wild- one retaining cells tumor with zygous, oftypes human cancer. different in protein this in events mutational , and equivalent quantities of the resulting resulting the of quantities equivalent and , c As the identified a o ), showing that the mutations affecting ), showing that the mutations affecting logous HT1080 cell lines using retro using lines cell HT1080 logous i. 2b Fig. ′ end over of telomeric the G-rich , c ) were incubated with radio with incubated were ) ). In addition, ChIP assays assays ChIP addition, In ). ∆ POT1 OB POT1 mutant POT1 OB K90 Q94

mutations are hetero Nature Ge Nature H266 Y223 Fig. 2 Fig. 10 n , etics 1 7

. To . Y36 d ). ). ­ - - - - ­ ­

© 2013 Nature America, Inc. All rights reserved. telomeric FISH analysis of metaphase spreads. At population doubling and mutant wild-type POT1 proteins after 5, 15 and expressing 45 population doublings by cells HT1080 in aberrations chromosomal of to chromosomal alterations. Accordingly, we examined the frequency terized by elongated telomeres and unprotected telomere ends that lead orthologs POT1 function, ablation of human loss of and/or full partial to manner facilitate in a dominant-negative ( and ( examined points doubling population the of each in length telomere increased significantly proteins POT1 mutant the whereas cells, in HT1080 length telomere increase POT1 did not significantly of wild-type expression exogenous reports, previous with agreement the over maintained ( 45 examined doublings population was proteins POT1 mutant and wild-type of the for described previously as telomeres causes telomere elongation in a dominant-negative fashion, bind overhangs. G-strand telomeric to unable are but components shelterin other with telomeres to localize to able are proteins POT1 mutant that show Pot1a experiments homolog, mouse POT1 the of domain OB the into introduced was substitution p.Phe62Ala the when seen was capacity cell derived lines independently two from calculated metaphase per events of means depict Bars staining. FISH telomeric by determined as 45 doubling population at constructs retroviral indicated the with infected cells HT1080 in metaphase ( fusions and breaks chromosomal and ( 5 bars, Scale MTSs. blue, light fusions; end-to-end chromosome-type yellow, SCFs; orange, Arrowheads: DAPI). blue, TTAGGG-Cy3; (red, 45 doubling population at constructs retroviral indicated the with infected cells HT1080 of spreads metaphase the on FISH and performed, Student’s Two-tailed s.e.m. lengths telomere mean show Bars 45. and 5 doublings population at constructs retroviral indicated the with infected cells HT1080 in spreads metaphase on HTQFISH by calculated were lengths telomere Mean homeostasis. length telomere aberrant in result POT1 in ( proteins. POT1 indicated the of presence (TTAGGG) oligonucleotides labeled overhang G-strand the bind to unable are mutants POT1 Tyr223Cys values mean depict Bars antibody. each with isolated DNA in ( control. G immunoglobulin IgG, probe. repeat TTAGGG a with hybridized were controls Input proteins. indicated the to antibodies the using constructs retroviral indicated the with infected transiently cells HT1080 in assays 5 bars, Scale cells. HT1080 transfected transiently in telomeres to proteins POT1 mutant and (WT) wild-type ( mutants. POT1 Tyr223Cys and Tyr36Asn the and POT1 2 Figure Nature Ge Nature mutant45, expressing cells HT1080 POT1 proteins showed a marked g e c Supplementary Fig. 1e Fig. Supplementary , alterations p.Tyr223Cys and p.Tyr36Asn The ) experiments ChIP four of Quantification ) b h We then sought to determine whether mutant POT1 localized at localized POT1 mutant whether determine to sought Wethen representing the percentage of telomeric telomeric of percentage the representing ) Quantification of the numbers of SCFs ( SCFs of numbers the of Quantification ) Supplementary Fig. 1c Fig. Supplementary ± s.e.m. Two-tailed Student’s Student’s Two-tailed s.e.m.

Biological properties of wild-type wild-type of properties Biological 18 a ) Localization of Myc-tagged Myc-tagged of Localization ) n , 2 ± 0 etics s.e.m. ( s.e.m. resulted in a dysfunctional telomeric phenotype charac P values are given. ( given. are values µ

m. ( m. ADVANCE ONLINE PUBLICATION ONLINE ADVANCE d in vitro in ) Tyr36Asn and and Tyr36Asn ) b ) Telomeric ChIP ChIP Telomeric ) , f t ). Consistent with the mutations behaving behaving mutations the with Consistent ). tests were were tests . EMSA of [ of EMSA . , d ) without altering telomerase activity activity telomerase altering without ) ∆ 3 t in the the in tests were performed for comparisons, and and comparisons, for performed were tests f OB POT1 mutant POT1 OB ) Telomeric Telomeric ) POT1 h Supplementary Fig. 1b Supplementary

) per per ) µ 32 m. m.

P]- (ref.

±

g

)

1 9 ) ) and of mouse a f

Tyr36Asn Vector Tyr223Cys Tyr36Asn WT Vector 10 TRF1

, 1 7 . Expression Expression . My 1 ), ), and, in c 8 . These These . Fig. 2 Fig. POT1 DAPI WT Tyr223Cys e -

In individuals with CLL, increased genomic complexity has has POT1 harboring cases CLL complexity from cells tumor survival purified in genomic lengths telomere decreased increased with correlated CLL, been with individuals In tumorigenesis in event key a aberrations, genomic of acquisition amounts. protein POT1 in increase ized general a to than rather lines cell heterologous the in POT1 mutant that the alterations chromosomal were ofdue to activities the specific ( examined events chromosomal of the of each frequency the in change no to led POT1 2c Fig. Supplementary to cells expressing wild-type POT1 or an empty vector ( vector empty an or POT1 and wild-type expressing cells to breaks chromosomal more comparison in proteins POT1 mutant the expressing cells in fusions significantly observed also We ( proteins POT1 mutant the of actions the to due fragility telomere elevated was there that suggesting MTSs, of numbers higher have to tendency a had proteins POT1 mutant ing express cells Notably, HT1080 at telomeres. stalling fork replication (MTSs), a telomere aberration that has been associated with increased fragility telomere against guarding gatekeepers are components shelterin As cantly with progressive population doublings ( phase; meta per fusions (>5 chromatids sister of fusion the for propensity P d b Unprotected telomeres can lead to chromosomal instability and the values are given. given. are values Input 1/320 1/160 1/80 IgG Myc TRF1 TRF2 RAP1 POT1 mutations control to in in CLL age-matched comparison those Fig. 2f Fig. * 12

, No lysate 1 3

, , we the also measured presence of signals multitelomeric Vector Vector ,

g WT ), with the frequency of incidence increasing signifi increasing incidence of frequency the with ),

g WT Tyr36Asn

Fig. 2f Fig. Tyr36Asn Tyr223Cys

Events per metaphase 10 0 2 4 6 8 Tyr223Cys TTAGGG Tyr223Cys Tyr36Asn WT Vector P P , =0.75 d c =0.002 , g P SCFs ). In contrast, ove contrast, In ). Protein-DNA (TTAGGG) Telomeric DNA in ChIP (%) =0.002 and and complexes 0 1 2 3 4 5 IgG Supplementary Fig. 2a Fig. Supplementary Tyr223Cys Tyr36Asn WT Vector 3 h Events per metaphase Myc e 0.5 1.0 1.5 2.0

0 Telomere length (kb) 10 15 Chromosomal P TRF1 Supplementary Fig. 2b Fig. Supplementary 0 5 =0.37 22 r P Supplementary Fig. 2a expression of wild-type wild-type of expression breaks =0.032 P , P 2 Tyr223Cys Tyr36Asn WT Vector =0.017 3

P < . We first assessed assessed first We . Population doubling

0.0001 < TRF2 5 0.0001 s r e t t e l P – Chromosome POT1 =0.69 d P Fig. 2 Fig. P fusions =0.005

), showing showing ), P < P

0.0001 =0.04 < 4 0.0001 5 RAP1 h and and 2 1 ). ). ).  - - - ­ .

© 2013 Nature America, Inc. All rights reserved. eety dniid hnmnn f chromothripsis of phenomenon identified recently the and function POT1 in between link potential micronuclei a suggests cells of CLL incidence higher ( the samples Notably, control to relative samples in structures mitotic unresolved of presence the and in increases significant the of frequency observed nuclear aberrations POT1 proteins ( in metaphase per ends signal-free of numbers greater significantly find ity of somal phenotype mouse cells with complete ablation of chromo Pot1 activ the resembling shortening, telomere overt by than rather by produced being frequency of telomere-deficient the fusions in is consistentchange no with these with fusions coincident fusions chromosomal containing individuals. these in fragility telomere greater of presence the ing compared to the controls (2.2-fold increase, in increase the of nificant presence in MTSs sig but modest a detected we cells, HT1080 in As samples. mutated in agreement with the normal telomere lengths observed in in observed lengths telomere normal the with agreement in ( populations two the different between significantly not was signal TTAGGG detectable no with ( in TTAGGG signals also detected significantly more chromosome-type fusions containing ( metaphase per occurring fusions five to in (SCFs) fusions end-to-end chromatid–type sister more significantly found ( spreads metaphase of analysis FISH telomeric through samples CLL the in telomeres of integrity the examined we Next, those from distinct present in of the cell analysis lines and is isogenic inbred mouse strains. that situation a populations, human within lengths telomere in variance the from derives potentially mutations Fig. ences in ( telomere or lengths activities in telomerase or wild-type with cases lines from Bars cases. and four per-individual depict means controls six calculated TTAGGG with fusions detectable type end-to-end FISH from signal ( telomeric are shown for aberrations of SCFs (bottom) ( per-individual chromosomal quantitation bars, 5 POT1 ( 3 Figure s r e t t e l  a Fig. 3 Fig. P a ) Representative fluorescence microscopy images of images FISH from on spreads telomeric microscopy metaphase fluorescence ) Representative = 0.042) ( 0.042) = olciey te bevto o a ih niec o telomere- of incidence high a of observation the Collectively, 18 POT1 ATM

, 3a 2 ± -mutated and control (wild-type and (wild-type -mutated control 0 s.e.m. Two-taileds.e.m. Student’s Chromosome fusions Breaks andfragments SCFs . This notion is further supported by the fact that we did not not did we that fact the by supported further is notion This . a µ ,

b ). Notably, similar to observations made in HT1080 cells, we cells, HT1080 in made observations to Notably,). similar ( m. m. ( Chromosomal aberrations in with mutated CLL cells from aberrations expressing individuals Chromosomal -mutated CLL cells or in HT1080 cells expressing mutant mutant expressing cells HT1080 in or cells CLL -mutated ). The absence of changes in telomere length due to POT1 POT1 to due length telomere in changes of absence The ). Supplementary Table 3 Table Supplementary POT1 b – Fig. 3 Fig. d ) Representative images (red, images TTAGGG-Cy3; ) Representative blue, DAPI; scale bars, 2 Supplementary Figs. 3d -mutated samples than in control samples, with up up with samples, control in than samples -mutated c ), but the number of chromosome-type fusions fusions chromosome-type of number the but ), POT1 POT1 IGHV@ mutation–mediated telomere uncapping uncapping telomere mutation–mediated -mutated samples than in control samples samples control in than samples -mutated MTSs Signal-free ends containing no in mutation containing P t tests were performed for comparisons, and for tests were comparisons, performed = 0.072) ( 0.072) = POT1 ), observing no significant differ significant no observing ), ) ) CLL (red, TTAGGG-Cy3;samples blue, Scale DAPI). upeetr Fig. Supplementary and P Supplementary Fig. 3c Fig. Supplementary P POT1 2e = 0.01) ( 0.01) = = 0.03; b

, respectively). We also Mean frequency per subject 10 -mutated -mutated CLL cells Control 0 2 4 6 8 SCFs Fig. Fig. 3 Supplementary Supplementary P POT1 POT1 POT1 =0.01 Fig. 3a Fig. 24 POT1 , POT1 2 5 d . Further, Further, . -mutated -mutated -mutated -mutated -mutated -mutated ), ), reflect ,

b POT1 3e , , Chromosome fusions c ). We ). TP53 0.5 1.0 1.5 2.0 – 0 (+TTAGGG) g Control ). ). ), ), ------P

=0.042 c POT1 ) ) and MTSs ( versus 46%; STEM CELL), the Körber European AwardScience from the Körber Foundation, (EuroBATS), The European Research Council (ERC) Project GA 232854 (TEL European Union Seventh Framework Programme Project FHEALTH-2010-259749 00017, the Madrid Regional Government the Project (ReCaRe), S2010/BMD-2303 of Ministry Economy and Competitiveness Projects andSAF2008-05384 CSD2007- Foundation.Botín Research in the laboratory of M.A.B. is funded by the Spanish Investigación del Cáncer (RTICC) del ISCIII. C.L.-O. is an Investigator of the through the Instituto de Salud Carlos III (ISCIII) and the Red Temática de This work was funded by the Spanish of Ministry Economy and Competitiveness grateful also very to all individuals with CLL who have participated in this study. T. de Lange (The Rockefeller University) for providing the POT1 plasmid. We are excellent work in the coordination of the CLL Spanish Consortium. We thank and L. Plá for excellent technical assistance and to N. Villahoz and C. Muro for We are grateful to D.A. Puente, S. Guijarro, S. Martín, M. C. SánchezCapdevila, Note: Supplementary information is available in the Institute Bioinformatics accession under European (EBI), the at hosted is Archive which Genome-phenome (EGA), European the at deposited been have code. Accession the in v available are references associated any and Methods Me (PDB), Bank Data ac.uk/ega URLs. disease. this treat to approaches therapeutic novel of prognosis and will provide additional knowledge for the develo mutated be to in humanfound cancer will shelterin hopefully be first useful for the improved and patientCLL in gene mutated frequently clinical novel approaches, including for CLL generate to biology cancer of understanding extend and reshape would techniques sequencing next-generation that idea ( P A POT1 P Supplementary Supplementary Table 4 e = 0.001), than individuals without without individuals than 0.001), = ckno values are values given. r The International Cancer Genome Consortium was formed on The Genome Consortium Cancer International the s t -mutated CLL -mutated cell i o h b n European Genome-phenome Archive (EGA), ), ), chromosome- µ ods w

m) m) (top) and o d f 0 2 4 6 ledgments POT1 /

; ; Picard,

t Control d h MTSs P ) ) in CLL P e = 0.001) and the expression of ZAP-70 (75% versus 31%; =0.03

p . POT1 a a Sequencing, expression and genotyping array data data array genotyping and expression Sequencing, p DVANCE ONLINE PUBLICATION ONLINE DVANCE e http://picard.source http://www.rcsb.or r . E frequent presence of wild-type more the as such features, biological adverse with mutated cases with wild-type advanced disease at diagnosis (Binet B: 13% in in mutations with us to assess the clinical features of individuals for observed individuals with CLL, prompted previously outcomes, clinical poor and bility Finally, the correlation between genomic insta the expressing cells in pressing the tel sup in implicated been has which systems, cell both in POT1 wild-type of from presence the derives potentially discrepancy This to control cells ( DNA in telomeric relative damage difference expressing mutant POT1 proteins showed no POT1 POT1 proteins from mammalian cells proteins mammalian from POT1 of ablation complete with observed been has ). G A S POT1 0 -mutated CLL cells and HT1080 cells cells HT1080 and cells CLL -mutated 2 0 7 . The identification . of The identification 0 0 mutations. Individuals with somatic 0 0 0 POT1 g/pdb 0 o forge.net/index.shtm POT1 Supplementary Fig. 0 meric meric DNA damage response 9 POT1 2 o n . ; ; POT1 / l i P . presented with more more with presented n = and 0.02) with more e ∆

v somatic mutations mutations somatic

OB POT1 isoform POT1 OB e r versus 42% in cases s Nature Ge Nature i o n https:/

o IGHV@ POT1 f

t h e

p /www.ebi. a

l as a new 4a ; ; Protein p n e 18 (100% o p r – etics . n ment , e 19

), as l i , n 2 2 6 1 e - - . .

© 2013 Nature America, Inc. All rights reserved. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. r at online available is information permissions and Reprints The authors declare no competing interests.financial research and wrote the manuscript, which all authors have approved. clinical analysis. A.J.R., V.Q., M.A.B., E.C. and C.L.-O. conceived and directed the studies. performed functional L.C., A.M.-T., N.V., M.L.-G. and A.L.-G. performed performed the analysis of sequence data. A.J.R., M.F., D.R., C.G. and M.G. V.Q., A.J.R., A.K. and X.S.P. developed the bioinformatics algorithms and (Spain) and Research the AXA Fund. the Preclinical Research Award from Fundación Lilly (Spain), Fundación Botín Nature Ge Nature COMPETING FINANCIAL INTERESTS FINANCIAL COMPETING AUTHOR CONTRIBUTIONS e

p

r

Baumann, P. & Cech, T.R. Pot1, the putative telomere end–binding protein in fission L. Wang, G. Fabbri, Quesada, V. X.S. Puente, targets therapeutic new 2011: in cancer Hematological M. Hallek, & P.Cramer, CLL. of basis Pekarsky,Molecular C.M. Y.,Croce, & N. Zanesi, Zenz,T.,Mertens, Kuppers,D., Dohner,Stilgenbauer,R., & H. pathogenesisFrom S. leukemia. lymphocytic Chronic E. Montserrat, & C. Rozman, yeast and humans. and yeast leukemia. of SF3B1 leukaemia. lymphocytic chronic strategies. treatment and 20 treatmentto chronicof lymphocytic leukaemia. (1995). 1052–1057 González-Pérez, A. & Lopez-Bigas, N. Improving the assessment of the outcome of outcome the of assessment the Improving N. Lopez-Bigas, & A. González-Pérez, length telomere TRF1 of transducer terminal a T.as Lange, POT1 De & D. Loayza, Genet. nonsynonymous SNVs with a consensus deleteriousness score, Condel. control. i n t , 370–376 (2010). 370–376 , NOTCH1 s / i n d gene in chronicgenein lymphocytic leukemia.

88 e Nature x . n , 440–449 (2011). 440–449 , N. Engl. J. Med. J. Engl. N. t al. et et al. et h et al. mutational activation. mutational t etics m t al. et l

. Analysis of the chronic lymphocytic leukemia coding genome: role genome: coding leukemia lymphocytic chronic the of Analysis 423 Exome sequencing identifies recurrent mutations of the splicing factor

SF3B1

Whole-genome sequencing identifies recurrent mutations in mutations recurrent identifies sequencing Whole-genome Science , 1013–1018 (2003). 1013–1018 , ADVANCE ONLINE PUBLICATION ONLINE ADVANCE n ohr oe cne gns n hoi lymphocytic chronic in genes cancer novel other and Nat. Rev. Clin. Oncol. Clin. Rev. Nat.

365 292 , 2497–2506 (2011). 2497–2506 , Nature , 1171–1175 (2001). 1171–1175 , J. Exp. Med. Exp. J.

475 , 101–105 (2011). 101–105 , Nat.Genet. Nat.Rev. Cancer

208 9 , 72–74 (2012). 72–74 , , 1389–1401 (2011). 1389–1401 ,

44 h t , 47–52(2012)., t N. Engl. J. Med. J. Engl. N. p

: Semin. Cancer Biol. Cancer Semin. / 10 / w , 37–50(2010)., w w . n Am. J. Hum. a t u r e .

c 333 o m , /

23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 27. 26. 25. 24.

Lin, T.T.Lin, G. Roos, and telomerase for roles Telomericextra-telomeric P.M.A. and Martínez, Blasco, & the of expansion Recent T. Lange, de & H. J.P.,Takai, Daniels, D., Hockemeyer, Shay,Sfeir,Hockemeyer,T.A.J., J.W.,D., protects Lange, W.E. POT1 Wright,de & L. Wu, TRF2 with association POT1 C.M. Counter, & K.S. Barrientos, M.F., Kendellen, S.A. Forbes, telomeric to bound POT1 human of Structure T.R. Cech, & E.R. Podell, M., Lei, Rap1 of Loss T. Lange, de & G.B. Celli, M., Overbeek, van S., Kabir, A., Sfeir, P. Martínez, A.M. Tejera, Hudson, T.J. Hudson, K.S. Barrientos, K. Crasta, P.J. Stephens, Dev. eoi aertos ad hr sria i crnc ypoyi leukemia. lymphocytic 111 chronic in survival short and aberrations, genomic proteins. telomere-binding the Cell telomeres. mouse protect proteins POT1 distinct two rodents: in complex telomeric human how determines and response end. chromosomes damage DNA transient a from telomeres telomeres. at recombination homologous (2006). aberrant and length. telomere regulates (2011). Cancer. in Mutations Somatic of Catalogue Biol. Mol. end-protection. chromosome for model a provides DNA single-stranded Science signal. damage DNA a or NHEJ of absence the in recombination telomere induces inmice. cancer increased and pathologies degenerative to lead deficiency mice. in 18 development skin normal and reprogramming, nuclear during 5251–5264 (2008). 5251–5264 Nature development. cancer during event catastrophic crisis. telomere (2010). a for evidence leukemia: lymphocytic 993–998 (2010). 993–998 , 775–789 (2010). 775–789 ,

, 2246–2252 (2008). 2246–2252 ,

126 23

482

, 2060–2075 (2009). 2060–2075 , 327 , 63–77 (2006). 63–77 , et al. et t al. et t al. et

et al. et 11 , 53–58 (2012). 53–58 , , 1657–1661 (2010). 1657–1661 , t al. et , 1223–1229 (2004). 1223–1229 , et al. et t al. et Telomere dysfunction and fusion during the progression of chronic of progression the during fusion and dysfunction Telomere hr tlmrs r ascae wt gntc opeiy high-risk complexity, genetic with associated are telomeres Short

t al. et DNA breaks and chromosome pulverization from errors in mitosis. in errors from pulverization chromosome and breaks DNA et al. et t al. et Pot1 nrae tlmr faiiy n fsos eutn from resulting fusions and fragility telomere Increased International network of cancer genome projects. genome cancer of network International P1 s eurd o TR rcutet tlmr elongation telomere recruitment, TERT for required is TPP1 EMBO J. EMBO deficiency initiates DNA damage checkpoint activation checkpoint damage DNA initiates deficiency Distinct functions of POT1 at telomeres. at POT1 of functions Distinct OMC mnn cmlt cne gnms n the in genomes cancer complete mining COSMIC: asv gnmc eragmn aqie i a single a in acquired rearrangement genomic Massive Mol. Cell Biol. Cell Mol.

24 Nat. Rev. Cancer Rev. Nat. , 2667–2678 (2005). 2667–2678 ,

29 uli Ais Res. Acids Nucleic , 5611–5619 (2009). 5611–5619 , Cell

11

, 161–176 (2011). 161–176 , 144 , 27–40 (2011). 27–40 , Blood s r e t t e l Cell

Mol. Cell Biol. Cell Mol. 116

39

D945–D950 , 1899–1907 , 126 Nature Nat. Struct. Nat. 49–62 , e. Cell Dev. Genes

Blood TRF1 464

28  , ,

© 2013 Nature America, Inc. All rights reserved. dom nonsynonymous mutations. All had less than 6 residues in this interface interface in this 6 than residues less had All mutations. dom nonsynonymous ran 8 of sets million 10 with simulation Carlo Monte a performed Wethen 271 and 270, 273). 267, 266, 245, 243, 224, 223, 161, 48, 60, 62, 87, 89, 94, 159, 39–42, 36, 33, 31, (residues residues 24 comprising molecules both between (PDB POT1 of structure crystal DNAthe in telomeric the to Å 3.5 than closer residues all of list a compiled we folds, OB the within cluster that residues of selection mutational assess Tostatistically 3KJ accession the from obtained was POT1 of domains OB the of structure The with aligned and (ref. NCBI CLUSTALX2 from gathered were species diverse evolutionarily mutations. of Characterization examined. manually were sequences All Biosystems). (Applied Table( 5 primer each of pmol 5 with Biosystems) (Applied nology tech Terminator v3.1 BigDye Prism ABI using sequenced and Corporation) sequencing. Sanger (30 for coverage higher than 50 and 50 for coverage higher than 100). from exome enrichment. Thus, we added new cutoff values for the S parameter resulting coverage high very with sites for account to adapted was algorithm the used we model implemented in SAMtools. For the identification of somatic substitutions, tially called using the Mapping and Assembly with Qualities (MAQ) consensus SAMtools. Optical or using PCR generated duplicates was file wereBAM removed a and using option, Picard. sampe the Bases(BWA) with wereAligner ini were mapped to the human reference genome (GRCh37) using Read mappingBurrows-Wheeler and processing. protocol. standard the using sequencer IIx Analyzer Genome Illumina an of lane one in sequenced were libraries Enriched intron. an amplify to primers of pair one and amplify exons to primers of pairs two of set a using Biosystems) (Applied System per were library formed. Exon enrichment was validated captured by RT-PCR the on a of 7300 Real-Time PCR amplification of cycles eluted, and additional 18 washed and (Invitrogen), streptavidin with coated by beads down magnetic pulled was DNA Exon-enriched instructions. manufacturer’s the following Technologies) (Agilent kit using 50Mb Exon All library Human each SureSelect for the performed then was sequences exon of Enrichment the sample sequencing paired-end preparation protocol provided by Illumina. in as described library it used of for sequencing a the paired-end construction enrichment. Exome cells. neoplastic >30% contained cohort validation CLL the for samples The <2%. was DNA normal in cells neoplastic from contamination the and contained sequencing exome for samples tumor The agarose on staining spectrophotometer. and a gels, using DNANanodrop ND-100 Green was quantified SYBR by assessed was DNA purified of The quality (Qiagen). kit DNA FlexiGene a using samples purified from extracted DNA was obtained. was fraction was leukocyte the and dextran, 2% with mented fraction CLL the in cells was sedi Whole blood and cytometry. flow by immunophenotyping assessed non-CLL by contamination of Biotec). degree Miltenyi The (AutoMACS, population contaminating each per of the for centage adjustment with CD15), and CD14 (CD11b, granulocytes and CD3), of and (CD2 CD13) and cocktail (CD11b cells monocytes a T CD56), and (CD11b cells (NK) killer against with natural directed incubated antibodies were labeled samples magnetically fraction, CLL the cells. purify To mononuclear cryopreserved or fresh from obtained were sequencing of samples. preparation and Collection Table 1 Supplementary Genome are in shown of subjects 341 the Cancer characteristics Clinical (ICGC). International Consortium the of guidelines the following study the in Subjects. ONLIN Nature Ge Nature 5). had set 1 (only O in the Protein Data Bank (PDB) and was rendered with PyMol v0.99. v0.99. PyMol with rendered was and (PDB) Bank Data Protein the in ). ). Sequencing reactions were run on an ABI-3730 automated sequencer E E All individuals gave informed consent for their participation participation their for consent informed gave individuals All M n Sidrón E etics T H ODS 2 algorithm, which has previously been described been previously has which algorithm, 8 We 3 sheered PCR products were cleaned using ExoSap IT (USB (USB IT ExoSap using cleaned were products PCR ). Alignment was depicted with Jalview v2.7 (ref. (ref. v2.7 Jalview with depicted was Alignment ). . For exome sequencing, reads from each library The amino-acid sequences of POT1 from from POT1 of sequences amino-acid The µ g g of DNAgenomic from each sample and The tumor samples used for exome used samples tumor The 3KJ P ). This defined an interface interface an defined This ). ≥ 95% neoplastic cells, cells, neoplastic 95% Supplementary Supplementary 5 , 6 . This This . 2 9 ). ). ------

incubation with antibodies to 53BP1 (Novus Biologicals, NB100-304; 1:500 1:500 NB100-304; Biologicals, (Novus 53BP1 to antibodies with incubation before permeabilized and fixed similarly were (PBMCs) blood cells mononuclear peripheral and cells HT1080 proteins, TIF of detection fluorescence buffer. For in blocking immuno dilution) 1:1,000 ab10579; to (Abcam, TRF1 antibody an with combination in dilution) 1:1,000 Myc (Abcam; to antibody 9E10 with temperature room at h 4 for incubated and PBS in BSA 0.5% and (Sigma) gelatin cold-water-fish 0.2% with blocked were washed, in Cells PBS. X-100 Triton 1% with incubation by 2% permeabilized with were and fixed formaldehyde were cells h, 24 After overnight. adhere to allowed and slips cover glass sterile on plated were POT1 Tyr223Cys) and (Tyr36Asn mutant microscopy. Confocal points. doubling population indicated at the collected were 3 for puromycin with selection undergoing before medium growth in h 24 for recover to allowed were cells room temperature and incubated for 8 h. This protocol was repeated twice, and 5 in 1 ml of viral supernatant was added to the seeded growth medium supplemented with were day, following The cells infection. before h 24 HT1080 confluency 20–30% at plates 6-well package. (VSVG)-based G virus stomatitis ( Table oligonucleotides corresponding the mutagenesis and site-directed (Stratagene) XL kit QuikChange the of using cDNA mutagenesis wild-type site-directed the by generated were changes p.Tyr223Cys and 12387) plasmid (Addgene Lange Retroviral expression. were washed were with 0.1% SDS, washed 1% Triton 2 pellets X-100, mM EDTA, 20 mM Tris-HCl Immunoprecipitation h. 1 for continued was incubation and added, Laboratories, (Bethyl RAP1 (60 DNA–protein beads A agarose sperm to Salmon A300-306A). antibody antibody and ab21382) 05-521), (Abcam, (Millipore, POT1 TRF2 to to antibody ab1423), (Abcam, TRF1 4 10 with incubated were fragments Chromatin (Upstate). slurry agarose A–50% DNA–Protein sperm salmon a and 20 NaCl mM 150 EDTA, mM 2 X-100, Triton with 1.1% of 1:10 composed diluted buffer a was Chromatin temperature. room at in microcentrifuge min 15 a for centrifuged and size in kb <1 of fragments chromatin obtain 10 and 10 for cells/ml cells 10 × 20 of at density a lysed Cross-linked and collected M. PBS, cold with twice 0.125 washed were of concentration final a to glycine of addition (25 ture tempera final room at a min 15 for to incubated were medium cells and 1%, culture of concentration tissue the to directly added was Formaldehyde assays. ChIP (Fujifilm). system imaging mini an LAS-3000 using for 1 h at antibodies Membranes room were temperature. analyzed secondary incubation with species-appropriate horseradish peroxidase (HRP)-conjugated antibody to or dilution) Technology, 1:1,000 Signaling 2341; (Cell CHK1 phosphorylated to antibody dilution), 1:1,000 ab32; Myc to (Abcam, antibody 9E10 with °C 4 was blocked with 5% nonfat dry milk. Membranes were incubated overnight at were separated by SDS-PAGE and(20 transferredlysates of toamounts a Equal nitrocellulose Pierce). membrane(BCA; assay that acid bicinchoninic by cocktail (Roche Applied Science), and protein concentrations were determined Triton 50 X-100, mM Tris-HCl (pH 7.4), 150 mM NaCl and protease inhibitor Protein blot analysis. CorelDraw. using displayed and ImageJ using processed were Images Microsystems). (Leica microscope focal coverslips were mounted on slides, and which cells were after imaged with (DAPI), a Leica SP2 con 4,6-diamidino-2-phenylindole with cells incubating by to stained were antibodies Nuclei temperature. 1 for h at room dilutions) IgG (1:250 rabbit secondary goat 568–conjugated Fluor Alexa and 488– Fluor Alexa with incubated were cells washes, multiple After TRF1. and dilution)

µ °C overnight on a rotating platform: 9E10 antibody to Myc, antibody to to antibody Myc, to antibody 9E10 platform: rotating a on overnight °C

mM Tris-HCl (pH 8.0) containing protease inhibitors and precleared with with and precleared inhibitors protease mM Tris-HCl containing 8.0) (pH g/ml polybrene (Millipore), and plates were centrifuged at 200 at centrifuged were plates and (Millipore), polybrene g/ml

6

mM EDTA containing protease inhibitors. Lysates were sonicated to to sonicated were Lysates inhibitors. protease containing EDTA mM ). Retroviruses were packaged in HEK 293T cells using a vesicular vesicular a using cells 293T HEK in packaged were Retroviruses ).

°C) on a shaking platform. Cross-linking was then stopped by the the by stopped then was Cross-linking platform. shaking a on °C) β -actin (Sigma, A5441; 1:10,000 dilution) and A5441; 1:10,000 (Sigma, -actin then washed before o CI aayi, × 10 × 3 analysis, ChIP For

min at 4 °C in a buffer of 1% SDS, 50 mM Tris-HCl (pH Tris-HCl mM 50 SDS, 1% of buffer a in °C 4 at min Whole-cell lysates were collected in a buffer containing 1% The pLPC myc human HT1080 cells expressing Myc-tagged wild-type and and wild-type Myc-tagged expressing cells HT1080

d. Cells then underwent serial passaging and and passaging serial underwent then Cells d. 1 0 . The The . µ g of one of the following antibodies at antibodies following the of one of g POT1 6 cells were used per condition. condition. per used were cells POT1 variants encoding p.Tyr36Asn encoding variants plasmid was a gift of T. de doi:10.1038/ng.2584 Supplementary Supplementary µ l) were then l) then were g for 1 h at h 1 for

8.0) 8.0) µ g) g) 6 ­ ­ - -

© 2013 Nature America, Inc. All rights reserved. Gels were visualized by exposure to a phosphorimager screen. phosphorimager a to by exposure visualized were Gels h. 3 for V 80 at run gel EDTA Tris-borate polyacrylamide 6% a on phoresis by electro analyzed were complexes protein-DNA and temperature, at room min 10 for incubated were Reactions glycerol). 5% and EDTA mM 1 NaCl, DNA poly(dI-dC) in binding buffer (25 mM HEPES-NaOH (pH 7.5), 100 mM 1 and (GGTTAGGGTTAGGGTTAGGG) 10 with nM 5-[ was incubated reaction modifications minor with previously as described performed were assays DNA binding (Fujifilm). system phosphorimager 7000 FLA an using quantified amounts visualized relative and were proteins and SDS-PAGE, by analyzed was reaction each of 5- A min. 90 for °C 30 at incubated was lysate reticulocyte rabbit L-[ EasyTag 50- a Briefly, instructions. manufacturer’s the following (Promega) kit lysate reticulocyte POT1 human mutant and wild-type containing vectors T7 the of Each above. lined out as mutagenesis site-directed by mutants Tyr223Cys and Tyr36Asn the expression vector was (OriGene) used to generate the vitro In repeats. telomere of number the in differences for correcting DNA, thus telomeric input total the of percentage a as values ChIP the represented we nal relative to the corresponding total input telomeric DNA signal. In all cases, telomeric DNA immunoprecipitated in each ChIP assay on the basis of the sig of the samples during the cross-link reversal step. We the calculated amount of of along with the were rest in lysate used the processed immunoprecipitations amount the of dilution 1:80 a to corresponding aliquots DNA samples, input of TTAGGG repeats. We the quantified using signal ImageJ software. For total kb 1.6 containing a from plasmid obtained probe a with telomeric hybridized tion and onto ethanol precipitation, slot-blotted a Hybond N+ membrane and bated for 1 h at 45 °C. DNA extrac by was recovered then phenol-chloroform 10 4 20 adding After 250 with NaHCO M 0.1 incubation and SDS by 1% twice beads the from eluted was Chromatin washes). (two EDTA mM 1 and 8.0) (pH Tris-HCl mM 10 and wash); (one 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA and 10 mM Tris-HClEDTA, 20 mM Tris-HCl and (pH 8.0) 500 M mM 0.25 NaCl LiCl, (one (pHwash); 8.0) mM 2 X-100, Triton 1% SDS, 0.1% wash); (one NaCl mM 150 and 8.0) (pH doi:10.1038/ng.2584

h h at 65 20 with °C. Samples were supplemented

µ l of 0.5 M EDTA, 20 EDTA, 20 M 0.5 of l cDNA was used for for used was cDNA translation and G-strand binding assays. binding G-strand and translation 35 µ S]-methionine (1,000 Ci/mmol; PerkinElmer) and 25 25 and PerkinElmer) Ci/mmol; (1,000 S]-methionine l reaction mixture containing 1 1 containing mixture reaction l µ l of 5 M NaCl, cross-links were reversed by incubation for for incubation by reversed were cross-links NaCl, M 5 of l 3 0 . In 20- In . µ g of RNase A and 40 40 and A RNase of g in vitro in 3 for 15 min at room temperature with rotation. rotation. with temperature room at min 15 for µ l reaction mixtures, 5 5 mixtures, reaction l protein expression with the TNT coupled coupled TNT the with expression protein 32 P]-labeled telomeric oligonucleotide oligonucleotide telomeric P]-labeled µ g of the nonspecific competitor competitor nonspecific the of g µ µ µ g of proteinase K and incu and K proteinase of g g of plasmid DNA, 2 2 DNA, plasmid of g l l of 1 M Tris-HCl (pH 6.5), POT1 Human Human µ l of each translation translation each of l variants encoding POT1 µ l fraction fraction l in a T7 T7 a in µ µ µ l of of l l of of l l of of l - - - - -

>5,000 nuclei per HT1080 cell line or subject sample. subject or line cell HT1080 per as nuclei >5,000 performed was (HTQFISH) FISH described telomeric High- quantitative metaphase. per throughput frequency as represented aberra and chromosomal quantified and were tions analyzed, were line cell HT1080 or described subject per as performed telomeric was and obtained, FISH were spreads metaphase h, 72 After L-glutamine. β penicillin-streptomycin, POT1 FBS, 12-O-tetradecanoylphorbol-13-acetate with supplemented Tyr223Cys) ng/ml medium RPMI in (TPA) 7.5 and with (Tyr36Asn stimulated mutant were and wild-type Myc-tagged 10 × 3 spreads, HTQFISH. and metaphase on FISH spreads metaphase on FISH Telomeric described previously as assay (TRAP) protocol amplification repeat assays. TRAP Σ ( DNA lengths to different corresponding rants ( absorbance subtraction, background the across generated After were (Fujifilm). entire lane for software V3.0 sample Multi-Gauge using each quadrants 30–40 of arrays Densitometry tions. instruc manufacturer’s the to according performed was length (TRF) ment frag restriction terminal mean of determination and analysis, blot Southern 2 (Roche), kit assays. length Telomere 33. 32. 31. 30. 29. 28. -mercaptoethanol, sodium pyruvate, nonessential amino acids and and acids amino nonessential pyruvate, sodium -mercaptoethanol, ( A

aea A, ea E, lt, . Bac, .. ihtruhu tlmr length telomere High-throughput M.A. Blasco, & P. Klatt, E., Vera, A., Canela, E. Samper, Blasco, M.A. Baumann, P., Podell, E. & Cech, T.R. Human Pot1 (protection of telomeres) protein: Jalview G.J. Barton, & M. Clamp, D.M., Martin, J.B., Procter, A.M., Waterhouse, M.A. Larkin, Acad. Sci. USA Sci. Acad. studies. population human to application its and FISH by quantification increased instability. despite chromosomal cells primary and mice polymerase–deficient poly(ADP-ribose) RNA. telomerase splicing. alternative (2002). 8079–8087 and structure, workbench. gene cytolocalization, analysis and editor alignment sequence Bioinformatics multiple 2—a Version (2007). 2947–2948 i )/ Σ ( A 3 i / 3 L , seeding at least 150,000 cells in duplicate wells and analyzing analyzing and wells duplicate in cells 150,000 least at seeding , i ) for each sample. each for ) Telomerase activity was measured with a modified telomeric telomeric modified a with measured was activity Telomerase µ t al. et et al.

t al. et g of DNA for each sample were digested and subjected to to subjected and digested were sample each for DNA of g 25

104 Cell , 1189–1191 (2009). 1189–1191 , Telomere shortening and tumor formation by mouse cells lacking oml eoee egh n crmsml n cpig in capping end chromosomal and length telomere Normal lsa W n Cutl vrin 2.0. version X Clustal and W Clustal , 5300–5305 (2007). 5300–5305 ,

91 Using the TeloTAGGG Telomere Length Assay Assay Length Telomere TeloTAGGG the Using J. Cell Biol. Cell J. , 25–34 (1997). 25–34 ,

154 3 6 A 2 PBMCs or HT1080 cells expressing expressing cells HT1080 or PBMCs . At least 5–10 metaphase spreads spreads metaphase 5–10 least At . i ) was obtained ) in of quad each was obtained these , 49–60 (2001). 49–60 , L i ). Mean TRF was defined as defined was Mean TRF ). Nature Ge Nature o. el Biol. Cell Mol. Bioinformatics For telomeric telomeric For Proc. Natl. Proc. 3 1 n . etics

22 23 - - - - , ,