Proteomic and Transcriptomic Analysis of Heart Failure
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. - 
												
												New York Chapter American College of Physicians Annual
New York Chapter American College of Physicians Annual Scientific Meeting Poster Presentations Saturday, October 12, 2019 Westchester Hilton Hotel 699 Westchester Avenue Rye Brook, NY New York Chapter American College of Physicians Annual Scientific Meeting Medical Student Clinical Vignette 1 Medical Student Clinical Vignette Adina Amin Medical Student Jessy Epstein, Miguel Lacayo, Emmanuel Morakinyo Touro College of Osteopathic Medicine A Series of Unfortunate Events - A Rare Presentation of Thoracic Outlet Syndrome Venous thoracic outlet syndrome, formerly known as Paget-Schroetter Syndrome, is a condition characterized by spontaneous deep vein thrombosis of the upper extremity. It is a very rare syndrome resulting from anatomical abnormalities of the thoracic outlet, causing thrombosis of the deep veins draining the upper extremity. This disease is also called “effort thrombosis― because of increased association with vigorous and repetitive upper extremity activities. Symptoms include severe upper extremity pain and swelling after strenuous activity. A 31-year-old female with a history of vascular thoracic outlet syndrome, two prior thrombectomies, and right first rib resection presented with symptoms of loss of blood sensation, dull pain in the area, and sharp pain when coughing/sneezing. When the patient had her first blood clot, physical exam was notable for swelling, venous distension, and skin discoloration. The patient had her first thrombectomy in her right upper extremity a couple weeks after the first clot was discovered. Thrombolysis with TPA was initiated, and percutaneous mechanical thrombectomy with angioplasty of the axillary and subclavian veins was performed. Almost immediately after the thrombectomy, the patient had a rethrombosis which was confirmed by ultrasound. - 
												
												Role of Cornification and Triglyceride Synthesis Genes
Gillespie et al. BMC Genomics 2013, 14:169 http://www.biomedcentral.com/1471-2164/14/169 RESEARCH ARTICLE Open Access Transcriptome analysis of pigeon milk production – role of cornification and triglyceride synthesis genes Meagan J Gillespie1,2*, Tamsyn M Crowley1,3, Volker R Haring1, Susanne L Wilson1, Jennifer A Harper1, Jean S Payne1, Diane Green1, Paul Monaghan1, John A Donald2, Kevin R Nicholas3 and Robert J Moore1 Abstract Background: The pigeon crop is specially adapted to produce milk that is fed to newly hatched young. The process of pigeon milk production begins when the germinal cell layer of the crop rapidly proliferates in response to prolactin, which results in a mass of epithelial cells that are sloughed from the crop and regurgitated to the young. We proposed that the evolution of pigeon milk built upon the ability of avian keratinocytes to accumulate intracellular neutral lipids during the cornification of the epidermis. However, this cornification process in the pigeon crop has not been characterised. Results: We identified the epidermal differentiation complex in the draft pigeon genome scaffold and found that, like the chicken, it contained beta-keratin genes. These beta-keratin genes can be classified, based on sequence similarity, into several clusters including feather, scale and claw keratins. The cornified cells of the pigeon crop express several cornification-associated genes including cornulin, S100-A9 and A16-like, transglutaminase 6-like and the pigeon ‘lactating’ crop-specific annexin cp35. Beta-keratins play an important role in ‘lactating’ crop, with several claw and scale keratins up-regulated. Additionally, transglutaminase 5 and differential splice variants of transglutaminase 4 are up-regulated along with S100-A10. - 
												
												FAM210A Is a Novel Determinant of Bone and Muscle Structure And
FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone. - 
												
												Anti-Inflammatory Role of Curcumin in LPS Treated A549 Cells at Global Proteome Level and on Mycobacterial Infection
Anti-inflammatory Role of Curcumin in LPS Treated A549 cells at Global Proteome level and on Mycobacterial infection. Suchita Singh1,+, Rakesh Arya2,3,+, Rhishikesh R Bargaje1, Mrinal Kumar Das2,4, Subia Akram2, Hossain Md. Faruquee2,5, Rajendra Kumar Behera3, Ranjan Kumar Nanda2,*, Anurag Agrawal1 1Center of Excellence for Translational Research in Asthma and Lung Disease, CSIR- Institute of Genomics and Integrative Biology, New Delhi, 110025, India. 2Translational Health Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, 110067, India. 3School of Life Sciences, Sambalpur University, Jyoti Vihar, Sambalpur, Orissa, 768019, India. 4Department of Respiratory Sciences, #211, Maurice Shock Building, University of Leicester, LE1 9HN 5Department of Biotechnology and Genetic Engineering, Islamic University, Kushtia- 7003, Bangladesh. +Contributed equally for this work. S-1 70 G1 S 60 G2/M 50 40 30 % of cells 20 10 0 CURI LPSI LPSCUR Figure S1: Effect of curcumin and/or LPS treatment on A549 cell viability A549 cells were treated with curcumin (10 µM) and/or LPS or 1 µg/ml for the indicated times and after fixation were stained with propidium iodide and Annexin V-FITC. The DNA contents were determined by flow cytometry to calculate percentage of cells present in each phase of the cell cycle (G1, S and G2/M) using Flowing analysis software. S-2 Figure S2: Total proteins identified in all the three experiments and their distribution betwee curcumin and/or LPS treated conditions. The proteins showing differential expressions (log2 fold change≥2) in these experiments were presented in the venn diagram and certain number of proteins are common in all three experiments. - 
												
												Getic Pathways Critical Issues in Contractile fibres [132]
Journal of Neuromuscular Diseases 1 (2014) 15–40 15 DOI 10.3233/JND-140011 IOS Press Review Mass Spectrometry-Based Identification of Muscle-Associated and Muscle-Derived Proteomic Biomarkers of Dystrophinopathies Paul Dowling, Ashling Holland and Kay Ohlendieck∗ Department of Biology, National University of Ireland, Maynooth, Ireland Abstract. The optimization of large-scale screening procedures of pathological specimens by genomic, proteomic and metabolic methods has drastically increased the bioanalytical capability for swiftly identifying novel biomarkers of inherited disorders, such as neuromuscular diseases. X-linked muscular dystrophy represents the most frequently inherited muscle disease and is characterized by primary abnormalities in the membrane cytoskeletal protein dystrophin. Mass spectrometry-based proteomics has been widely employed for the systematic analysis of dystrophin-deficient muscle tissues, using patient samples and animal models of dystrophinopathy. Both, gel-based methods and label-free mass spectrometric techniques have been applied in compar- ative analyses and established a large number of altered proteins that are associated with muscle contraction, energy metabolism, ion homeostasis, cellular signaling, the cytoskeleton, the extracellular matrix and the cellular stress response. Although these new indicators of muscular dystrophy have increased our general understanding of the molecular pathogenesis of dystrophinopathy, their application as new diagnostic or prognostic biomarkers would require the undesirable usage of invasive methodology. Hence, to reduce the need for diagnostic muscle biopsy procedures, more recent efforts have focused on the proteomic screening of suitable body fluids, such as plasma, serum or urine, for the identification of changed concentration levels of muscle-derived peptides, protein fragments or intact proteins. The occurrence of muscular dystrophy-related protein species in biofluids will be extremely helpful for the future development of cost-effective and non-invasive diagnostic procedures. - 
												
												Computational and Experimental Approaches for Evaluating the Genetic Basis of Mitochondrial Disorders
Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Lieber, Daniel Solomon. 2013. Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11158264 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders A dissertation presented by Daniel Solomon Lieber to The Committee on Higher Degrees in Systems Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Systems Biology Harvard University Cambridge, Massachusetts April 2013 © 2013 - Daniel Solomon Lieber All rights reserved. Dissertation Adviser: Professor Vamsi K. Mootha Daniel Solomon Lieber Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders Abstract Mitochondria are responsible for some of the cell’s most fundamental biological pathways and metabolic processes, including aerobic ATP production by the mitochondrial respiratory chain. In humans, mitochondrial dysfunction can lead to severe disorders of energy metabolism, which are collectively referred to as mitochondrial disorders and affect approximately 1:5,000 individuals. These disorders are clinically heterogeneous and can affect multiple organ systems, often within a single individual. Symptoms can include myopathy, exercise intolerance, hearing loss, blindness, stroke, seizures, diabetes, and GI dysmotility. - 
												
												1. Ceramide: the Center of Sphingolipid Biosynthesis
Introduction 1. Ceramide: the center of sphingolipid biosynthesis 1.1. Introducing the sphingolipid family The cell membrane contains three main classes of lipids: glycerolipids, sphingolipids and sterols (Futerman and Hannun 2004; Gulbins and Li 2006; Grassme et al. 2007). First discovered by J.L. W. Thudichum in 1876, sphingolipids were considered to play primarily structural roles in membrane formation (Zheng et al. 2006; Bartke and Hannun 2009). However, by the end of the twentieth century, sphingolipids were described as effector molecules which are involved in the regulation of apoptosis, cell proliferation, cell migration, senescence, and inflammation (Hannun 1996; Perry and Hannun 1998; Hannun and Obeid 2002; Futerman and Hannun 2004; Ogretmen and Hannun 2004; Reynolds et al. 2004; Fox et al. 2006; Modrak et al. 2006; Saddoughi et al. 2008). Sphingolipid metabolism pathways have a unique metabolic entry point, serine palmitoyl transferase (SPT) which forms 3-ketosphinganine, the first sphingolipid in the de novo pathway and a unique exit point, sphingosine-1-phosphate (S1P) lyase, which breaks down S1P into non-sphingolipid molecules. In this network, ceramide can be considered to be a metabolic hub because it occupies a central position in sphingolipid biosynthesis and catabolism (Hannun and Obeid 2008) (Figure 1). 1.2. Ceramide structure and metabolism Ceramide (Cer) from mammalian membranes is composed of sphingosine, which is an amide linked to a fatty acyl chain, varying in length from 14 to 26 carbon atoms (Mimeault 2002; Pettus et al. 2002; Ogretmen and Hannun 2004; Zheng et al. 2006) (Figure 1). Ceramide constitutes the metabolic and structural precursor for complex sphingolipids, which are composed of hydrophilic head groups, such as sphingomyelin, ceramide 1-phosphate, and glucosylceramide (Saddoughi et al. - 
												
												Recombinant Human Tissue Transglutaminase for Diagnosis and Follow-Up of Childhood Coeliac Disease
0031-3998/02/5106-0700 PEDIATRIC RESEARCH Vol. 51, No. 6, 2002 Copyright © 2002 International Pediatric Research Foundation, Inc. Printed in U.S.A. Recombinant Human Tissue Transglutaminase for Diagnosis and Follow-Up of Childhood Coeliac Disease TONY HANSSON, INGRID DAHLBOM, SIV ROGBERG, ANDERS DANNÆUS, PETER HÖPFL, HEIDI GUT, WOLFGANG KRAAZ, AND LARS KLARESKOG Department of Rheumatology, Karolinska Hospital, Stockholm, Sweden [T.H., S.R., L.K.]; Pharmacia Diagnostics, Uppsala, Sweden [I.D.]; Department of Pediatrics [A.D.] and Pathology [W.K.], Uppsala University Hospital, Uppsala, Sweden; and Pharmacia Diagnostics, Freiburg, Germany [P.H., H.G.] ABSTRACT Highly discriminatory markers for celiac disease are needed IgA and IgG anti-tTG. There was already an increase in IgA to identify children with early mucosal lesions and for rapid anti-tTG antibodies after 2 wk of gluten challenge (p Ͻ 0.01). follow-up. The aim of this study was to evaluate the potential of Although the criteria-based diagnosis of childhood celiac disease circulating anti-tissue transglutaminase (tTG) IgA and IgG anti- still depends on histologic evaluation of intestinal biopsies, bodies in the diagnosis and follow-up of childhood celiac dis- detection of anti-tTG antibodies provides useful complementary ease. An ELISA using recombinant human tTG was used to diagnostic information. The human recombinant tTG-based measure the levels of IgA and IgG anti-tTG antibodies in 226 ELISA can be used as a sensitive and specific test to support the serum samples from 57 children with biopsy-verified celiac diagnosis and may also be used in the follow-up of treatment in disease, 29 disease control subjects, and 24 healthy control childhood celiac disease. - 
												
												Guinea Pig Transglutaminase Immunolinked Assay Does Not Predict Coeliac Disease in Patients with Chronic Liver Disease
506 Gut 2001;49:506–511 Guinea pig transglutaminase immunolinked assay does not predict coeliac disease in patients with Gut: first published as 10.1136/gut.49.4.506 on 1 October 2001. Downloaded from chronic liver disease A Carroccio, L Giannitrapani, M Soresi, T Not, G Iacono, C Di Rosa, E Panfili, A Notarbartolo, G Montalto Abstract patients with atrophy of the intestinal Background—It has been suggested that mucosa were positive for anti-tTG while serological screening for coeliac disease all others were negative, including those (CD) should be performed in patients false positive in the ELISA based on with chronic unexplained hypertransami- guinea pig tTG as the antigen. nasaemia. Conclusions—In patients with elevated Aims—To evaluate the specificity for CD transaminases and chronic liver disease diagnosis of serum IgA antitissue trans- there was a high frequency of false glutaminase (tTG) determination in con- positive anti-tTG results using the ELISA secutive patients with chronic based on tTG from guinea pig as the anti- hypertransaminasaemia using the most gen. Indeed, the presence of anti-tTG did widely utilised ELISA based on tTG from not correlate with the presence of EmA or guinea pig as the antigen. CD. These false positives depend on the Patients and methods—We studied 98 presence of hepatic proteins in the com- patients with chronic hypertransamina- mercial tTG obtained from guinea pig saemia, evaluated for the first time in a liver and disappear when human tTG is hepatology clinic. Serum anti-tTG and used as the antigen in the ELISA system. antiendomysial (EmA) assays were per- We suggest that the commonly used tTG formed. - 
												
												This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al. - 
												
												Exome Sequencing in Gastrointestinal Food Allergies Induced by Multiple Food Proteins
Exome Sequencing in Gastrointestinal Food Allergies Induced by Multiple Food Proteins Alba Sanchis Juan Department of Biotechnology Universitat Politècnica de València Supervisors: Dr. Javier Chaves Martínez Dr. Ana Bárbara García García Dr. Pablo Marín García This dissertation is submitted for the degree of Doctor of Philosophy September 2019 If you know you are on the right track, if you have this inner knowledge, then nobody can turn you off... no matter what they say. Barbara McClintock Declaration FELIPE JAVIER CHAVES MARTÍNEZ, PhD in Biological Sciences, ANA BÁRBARA GARCÍA GARCÍA, PhD in Pharmacy, and PABLO MARÍN GARCÍA, PhD in Biological Sciences, CERTIFY: That the work “Exome Sequencing in Gastrointestinal Food Allergies Induced by Multiple Food Proteins” has been developed by Alba Sanchis Juan under their supervision in the INCLIVA Biomedical Research Institute, as a Thesis Project in order to obtain the degree of PhD in Biotechnology at the Universitat Politècnica de València. Dr. F. Javier Chaves Martínez Dr. Ana Bárbara García García Dr. Pablo Marín García Acknowledgements Reaching the end of this journey, after so many ups and downs, I cannot but express my gratitude to all those who supported me and helped me through this challenging but rewarding experience. First and foremost, I would like to thank my supervisors, Dr. Javier Chaves Martinez, Dr. Ana Barbara García García and Dr. Pablo Marín García. They gave me the opportunity to work with them when I was still an undergraduate student, and provided me the opportunity to contribute to several exciting projects since then. They also encouraged me into the clinical genomics field and provided me guidance and advice throughout the last four years.