Methamphetamine Induces Trace Amine‐Associated Receptor 1 (TAAR1) Expression in Human T Lymphocytes: Role in Immunomodulation

Article

Methamphetamine induces trace amine- associated receptor 1 (TAAR1) expression in human T lymphocytes: role in immunomodulation Uma Sriram, Jonathan M. Cenna, Bijayesh Haldar, Nicole C. Fernandes, Roshanak Razmpour, Shongshan Fan, Servio H. Ramirez, and Raghava Potula1 Department of Pathology and Laboratory Medicine, Temple University School of Medicine, Philadelphia, Pennsylvania, USA RECEIVED AUGUST 13, 2014; REVISED JULY 27, 2015; ACCEPTED AUGUST 5, 2015. DOI: 10.1189/jlb.4A0814-395RR

ABSTRACT Introduction The novel transmembrane G protein-coupled receptor, Among the various substances of abuse, METH is gaining trace amine-associated receptor 1 (TAAR1), represents increasing popularity among drug-abusing populations world- a potential, direct target for drugs of abuse and mono- wide for its addictive psychostimulant effects [1, 2]. Recreational aminergic compounds, including amphetamines. For the METH use is one of the fastest growing substance-abuse first time, our studies have illustrated that there is an problems in the United States [3, 4]. METH use is associated with induction of TAAR1 mRNA expression in resting high-risk sexual behavior and high rates of HIV acquisition [5]. T lymphocytes in response to methamphetamine. Meth- amphetamine treatment for 6 h significantly increased Animal and human studies have demonstrated that METH – TAAR1 mRNA expression (P , 0.001) and protein ex- suppresses innate and adaptive immunity [6 8]. More insights pression (P , 0.01) at 24 h. With the use of TAAR1 gene into the mechanism of action of METH have been revealed in silencing, we demonstrate that methamphetamine- the last decade with the discovery of the receptor(s) for METH induced cAMP, a classic response to methamphetamine that belong to speciﬁc families of GPCRs [9, 10]. Members of this stimulation, is regulated via TAAR1. We also show by large family of GPCRs are now referred to as TAARs, and TAAR1 TAAR1 knockdown that the down-regulation of IL-2 is the prototypical member [11, 12], which is activated by in T cells by methamphetamine, which we reported a broad range of monoamines and amphetamine-related earlier, is indeed regulated by TAAR1. Our results also psychostimulants, including METH [13, 14]. show the presence of TAAR1 in human lymph nodes from There is substantial evidence for TAAR1 mRNA expression in the HIV-1-infected patients, with or without a history of meth- rodent and primate brain [15–17]. TAAR1 mRNA and protein amphetamine abuse. TAAR1 expression on lymphocytes was largely in the paracortical lymphoid area of the lymph expression have also been shown in other peripheral tissues, such as nodes with enhanced expression in lymph nodes of HIV-1- liver, kidney, spleen, pancreas, heart, and gastrointestinal tract, in infected methamphetamine abusers rather than infected- rodent and primate models [9], as well as in leukocyte subpopu- only subjects. In vitro analysis of HIV-1 infection of human lations of mice and humans [18]. TAAR1 mRNA has been shown to PBMCs revealed increased TAAR1 expression in the be up-regulated in human PBMCs following in vitro stimulation presence of methamphetamine. In summary, the ability of with PHA [18]. Miller et al. [15] have pharmacologically methamphetamine to activate trace TAAR1 in vitro and to characterized rhesus monkey TAAR1 in HEK293 cells by use of regulate important T cell functions, such as cAMP activa- a highly sensitive CRE-Luc (cAMP response element - luciferase) tion and IL-2 production; the expression of TAAR1 in assay. Activation of TAAR1 has been shown to induce cAMP, which T lymphocytes in peripheral lymphoid organs, such as involves phosphorylation-dependent, downstream effects of PKA lymph nodes; and our in vitro HIV-1 infection model in PBMCs suggests that TAAR1 may play an important role in and PKC pathways [9, 16]. methamphetamine -mediated immune-modulatory re- METH abuse has seriously impacted management of HIV-1 – sponses. J. Leukoc. Biol. 99: 213–223; 2016. infection globally [8, 19 21], as evidenced by studies of various cohorts in the United States [4, 22, 23] and around the world [24, 25]. METH abuse has been shown to be associated with high b b Abbreviations: -PEA = -phenylethylamine, ADA = adenosine deaminase, viral loads, especially in the CNS [26, 27], development of GPCR = G protein-coupled receptor, HEK = human embryonic kidney, METH = – methamphetamine, MFI = median fluorescence intensity, PKA/C = protein kinase antiretroviral resistance, and rapid progression to AIDS [28 31]. A/C, pPKA RIIa = phospho-PKA regulatory subunit IIa, qRT-PCR = quantitative RT- PCR, siRNA = small interfering RNA, TAAR1 = trace amine-associated receptor 1 1. Correspondence: Dept. of Pathology and Laboratory Medicine, Temple The online version of this paper, found at www.jleukbio.org, includes University School of Medicine, 3500 N. Broad St., MERB 845A, supplemental information. Philadelphia, PA 19140, USA. E-mail: [email protected]

0741-5400/16/0099-213 © Society for Leukocyte Biology Volume 99, January 2016 Journal of Leukocyte Biology 213 METH-induced responses mediated through TAAR1 signaling 20 medium (Lonza, Walkersville, MD, USA), supplemented with 1% heat- have never been studied in the context of HIV-1 infection in inactivated normal human serum, 20 mg/ml gentamycin, and 2 mM m peripheral immune cells. glutamine. The concentration of METH used (100 M) was based on our previously published dose-response studies that produced a maximum We have shown that METH induces T cell dysfunction via biologic response without causing toxicity [7]. induction of oxidative stress and mitochondrial injury [7]. Mitochondrial dysfunction paralleled reduced IL-2 secretion and qRT-PCR T cell-proliferative responses after TCR-CD28 stimulation, in- 3 6 m m dicating impaired T cell function. In this study, we focused on Pan-isolated T cells (1 10 /ml) were stimulated with 100 M METH or 100 M b-PEA for 4, 6, and 8 h and harvested for RNA extraction by use of an RNA the mechanisms of METH action via TAAR1 in resting (non- Extraction Kit (Qiagen, Germantown, MD, USA). RNA was extracted, per the activated) human T cells from normal donors. Our studies show, manufacturer’s protocol, including DNase treatment. cDNA was made by use of for the first time, a significant induction of TAAR1 mRNA and 1 mg RNA template and proceeded to real-time PCR by use of TaqMan probes protein expression in resting T lymphocytes in response to for TAAR1 (Applied Biosystems, Life Technologies). Real-time PCR was run in METH. Similar to neuronal and non-neuronal cells, resting a StepOnePlus PCR thermocycler (Applied Biosystems, Life Technologies). DD T cells induced cAMP and cAMP-dependent PKA activation GAPDH was used as the housekeeping gene. The comparative threshold method was used to calculate the fold change in TAAR1 expression compared upon METH treatment. With the use of a gene-silencing with untreated control. technique, we confirm that the signaling is mediated via TAAR1. Previously, we have reported [7] that METH decreased IL-2 Confocal imaging production in T cells upon CD3/CD28 stimulation. In the b current study, we show that METH via TAAR1 signaling Total PBMCs were treated with METH, -PEA, or tyramine for 24 h and were harvested and plated on poly-D-lysine-coated coverslips and allowed to adhere modulates IL-2 production. These data suggest that METH has for 1 h at 37°C. Cells on coverslips were fixed with methanol/acetone (1:1) for an important immunomodulatory effect that is likely attributable 20 min at 220°C. Cells were then blocked with 3% BSA + 0.1% Triton X-100 to the activity of the receptor. Furthermore, increased TAAR1 in PBS for 15 min at room temperature. After blocking, cells were incubated expression was seen in T cells from PBMC upon METH with mouse anti-human CD3 (1:100; BioLegend) and rabbit anti-human treatment, followed by HIV-1 infection in an in vitro infection TAAR1 (10 mg/ml; MBL International; LS-A2041) primary antibodies for 1 h model. We also show increased TAAR1 expression in human at room temperature. Cells were then incubated with donkey anti-mouse Alexa Fluor 594 (1:400; Invitrogen, Life Technologies) and donkey anti-rabbit lymph nodes from HIV-1-infected patients with a history of Alexa Fluor 488 (1:400; Invitrogen, Life Technologies) secondary antibodies METH abuse compared with non-METH abusers. for 1 h at room temperature. Samples were washed and mounted on glass In summary, the current study clearly demonstrates the slides by use of ProLong Gold + DAPI reagent. Immunofluorescently labeled following: that 1) METH activates TAAR1 in vitro, 2) METH T lymphocytes were imaged at the Temple University Confocal Imaging regulates cAMP and IL-2 production in T cells, 3) HIV-infected Facility by use of a Leica SP5 confocal microscope. METH abusers express TAAR1 in T lymphocytes in peripheral lymphoid organs, such as lymph nodes, and 4) HIV-infected, Flow cytometry METH-exposed T cells in vitro express increased TAAR1. Taken Total PBMCs (1 3 106 /ml) were cultured in complete RPMI-1640 medium, together, the study suggests that TAAR1 may play an important supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/ml m role in METH-mediated, immune-modulatory responses. penicillin, 100 g/ml streptomycin, and 20 mM HEPES (Life Technologies, Carlsbad, CA, USA) for 24 h, with or without 100 mM METH, tyramine, or b-PEA. Cells were harvested and stained with purified rabbit anti-human TAAR1 (1:100 dilution; MBL International), followed by allophycocyanin- MATERIALS AND METHODS tagged anti-rabbit secondary, along with FITC-tagged anti-human CD3, PE- tagged anti-human CD4, and eFlour 450-tagged anti-human CD8. Cells were Sample collection washed in FACS buffer, fixed in 1% paraformaldehyde/PBS, and read in a BD fl PBMCs were isolated from leukopheresis packs (Pall, Port Washington, NY, FACSCanto II ow cytometer (BD Biosciences, San Jose, CA, USA). Data were USA) from normal donors obtained from the American Red Cross analyzed by use of FlowJo software (TreeStar, Ashland, OR, USA). (Philadelphia, PA, USA) within 2–6 h after blood collection. cAMP analysis and Phosflow detection of Reagents and antibodies phosphorylated PKA METH-induced cAMP on T cells was detected by use of an antibody to cAMP METH, b-PEA, and tyramine are from Sigma-Aldrich (St. Louis, MO, USA). after stimulation of Pan-isolated T cells with METH or forskolin for 30 min–1h. Antibodies to human TAAR1 were obtained from MBL International Cells were permeabilized, per the manufacturer’s protocol, and stained with (Woburn, MA, USA; LS-A2041 and LS-A2042). Fluorochrome-tagged anti- mouse monoclonal cAMP (SPM486; Abcam, Cambridge, MA, USA) at room bodies were procured from eBioscience (San Diego, CA, USA) and temperature for 1 h, followed by anti-mouse secondary PE antibody for a further BioLegend (San Diego, CA, USA; anti-human CD3, CD4, and CD8) and 15 min. Dead cells were analyzed by Fixable Viability Dye 780 dye (eBioscience). secondary antibodies from Invitrogen, Life Technologies (Carlsbad, CA, Intracellular Phosflow assay was used to analyze PKA phosphorylation on T cells USA). Reagents for PCR were from Applied Biosystems (Life Technologies, by use of anti-PKA RIIa (pS99) antibody (a regulatory subunit; BD Biosciences) Carlsbad, CA, USA). [32] by flow cytometry. Total PBMCs were treated with 100 mMMETHor forskolin (positive control), harvested after 15 min treatment, and processed for T cell isolation and culture flow cytometric analysis by use of the BD Biosciences Phosflow-staining protocol. PBMCs were obtained by Ficoll-gradient centrifugation of blood eluted Cells were counterstained with FITC-conjugated anti-human CD3 antibody to from leukophoresis packs. T cells were isolated by use of a Pan T Cell analyze phophorylated PKA. Cells were analyzed in a BD FACSCanto II Isolation Kit (Miltenyi Biotec, San Diego, CA, USA; purity was .98% by this cytometer. Approximately 10,000 events were acquired for each sample. Data method; data not shown). T cells (1 3 106/ml) were cultured in X-Vivo were analyzed by use of FlowJo software.

214 Journal of Leukocyte Biology Volume 99, January 2016 www.jleukbio.org Sriram et al. METH induces TAAR1 in human T cells

TAAR1 siRNA knockdown ImmPRESS-AP and visualization with Vector Blue (Vector Laboratories). Sections were then reblocked and incubated overnight at 4°C in mouse TAAR1 expression in total PBMCs was silenced by siRNA transfection for ;44 h. anti-human CD3 (Ready-to-Use, Clone PS1; Novocastra, Buffalo Grove, IL, We chose the TAAR1 siRNA (CAGAATATATCTTATCGCTAA) that has been USA), followed by detection with anti-mouse ImmPRESS-AP and visuali- used by Babusyte et al. [33]. INTERFERin transfection reagent (Polyplus- zation with Vector Red. Sections were rinsed, dehydrated, cleared, and Transfection; Bioparc, Illkirch, Cedex, France) was used to transfect directly the permanently mounted (VectaMount; Vector Laboratories) for bright-field siRNA in RPMI medium. In brief, fresh PBMCs, isolated by the Ficoll-Hypaque microscopy. Slides were reviewed by use of a Nikon 80i upright microscope method, were seeded between 3 and 5 3 105 in a 12-well tissue-culture plate in configured to a DS-Fi2 color camera (Nikon Instruments, Melville, NY, complete RPMI with 10% FBS. TAAR1 siRNA was obtained from Qiagen USA).ImageswereacquiredbyuseoftheNISElementsimaging (FlexiTube gene solution) or scrambled siRNA (ON-TARGETplus nontargeting software (Nikon). siRNA (Fisher Scientific, Pittsburg, PA, USA); 20 nM in buffer was allowed to Image analysis was performed with an automated cell-counting macro by form siRNA duplexes with the INTERFERin transfection reagent in nonserum use of ImageJ 1.48v image processing and analysis software (U.S. National medium. TAAR1 or scrambled duplex solution, 200 ml each, was added in the Institutes of Health, Bethesda, MD, USA; http://rsb.info.nih.gov/ij/). Particle respective wells and mixed well by swirling the plate. Cells were incubated at counting was performed on high-resolution images (3/case, taken at 103 37°C, 5% CO , for 4 h, and 1 ml complete RPMI was added to each well. Cells 2 objective magnification) on double (CD3 and TAAR1)- and triple (CD3, were incubated for up to 44 h and then tested for other functional readouts. TAAR1, and p24)- immunolabeled cells. In ImageJ, the images were calibrated Cells in medium alone served as controls. TAAR1-specific siRNA selectively and then sequentially processed for background subtraction, color threshold knocked down the target, as assessed by qPCR, by use of GAPDH control. The segmentation, and binary conversion (with application of the watershed knockdown was up to 90%. function). Cells identified from the above parameters in an area of 5.61 3 105 mm2 were counted by use of the analysis particles function cAMP analysis of siRNA-treated cells (selected on the basis of particle area and circularity). METH-induced cAMP was measured to test whether cAMP was regulated by TAAR1. Scrambled and TAAR1 siRNA conditioned cells were treated with HIV-1 infection of PBMC METH (100 mM) or forskolin (100 mM) for 30 min–1 h. Cells were harvested Ficoll-separated total PBMCs (1 3 106/ml) from normal donors were first and stained for CD3 surface marker (CD3-FITC; eBioscience). Cells were m permeabilized by use of the manufacturer’s protocol and stained with mouse activated for 72 h with PHA (2.5 g/ml) and then infected with HIV-1-1ADA – monoclonal cAMP (SPM486; Abcam), followed by anti-mouse secondary PE at a multiplicity of infection of 0.01 0.1 virus particles/target cell for 4 h [34] with polybrene (10 mg/ml) [35]. Following incubation, cells were antibody, as described earlier. Dead cells were analyzed by Fixable Viability washed and cultured in fresh RPMI-1640 medium, supplemented with 10% Dye 780 dye from eBioscience. Cells were analyzed in a BD FACSCanto II cytometer. Approximately 10,000 events were acquired for each sample. Data FBS, antibiotics, and 20 U/ml IL-2 (Advanced Biotech, Totowa, NJ, USA) m were analyzed by use of FlowJo software. inthepresenceorabsenceof100 M METH for 6 days. In some experiments, PBMCs were also treated with METH, 24 h before HIV-1 infection. Treatments were maintained for 6 d, with half-medium re- IL-2 measurement placement on d 3 after HIV-1 was added to the cells. siRNA-treated cells were treated further after ;44 h, with or without METH, for 30 min and then cross-linked with soluble CD3 (LEAF Purified anti-human Analysis of HIV-1 infection CD3, clone HIT3a; BioLegend) and CD28 (LEAF Purified anti-human CD28, Culture supernatant was collected on d 6 and stored at 280°C until it was clone CD28.2; BioLegend). After 24 h of CD3/CD28 stimulation, super- assayed for HIV-1 RT activity. The HIV-1 RT assay is a radiometric assay natants were collected. As the volume of the medium for the number of cells designed for the quantitative measurement of RT activity in cell culture and was high, we concentrated the supernatants by use of Amicon Ultra was performed as described previously [35]. HIV-1 p24 expression was centrifugal filters (EMD Millipore, Billerica, MA, USA) by use of 3 kDa cutoff. analyzed by flow cytometry. Total PBMCs were stained for HIV-1 p24 antigen The samples were then tested by use of an MSD human IL-2 detection kit by use of BD Coulter KC57-FITC antibody (Beckman Coulter, Indianapolis, (Meso Scale Diagnostics, Rockville, MD, USA). Fold change in the IL-2 levels IN, USA) and for CD3 by use of mouse anti-human CD3-PE/Cyanine7 between the scrambled and TAAR1 siRNA-treated cells, stimulated with (eBioscience). Cell death staining was performed by use of Fixable Viability METH and CD3/CD28, was analyzed. Dye eFluor 780 from eBioscience. Twenty-thousand events were collected for each sample and analyzed by FlowJo software. Immunohistochemistry and image analysis ELISA for p24 detection was also performed on the HIV-infected culture fi Immunohistochemistry analysis was performed to determine the expression supernatants to con rm infection and how METH modulated the p24 levels. of TAAR1 receptors in lymph nodes from HIV-1-infected patients, with or The HIV p24 antigen capture assay kit was purchased from ABL (Rockville, ’ without a history of METH abuse. Paraffin-embedded samples were MD), and assay was performed per the manufacturer s instructions. procured from the core facility at the Medical Center at the University of California, San Diego (San Diego, CA, USA), from which 5 mm serial sections Western blotting were obtained and glass-slide mounted. Sections were heat-induced epitope PBMCs were harvested on d 6 post-HIV-1 infection and analyzed for TAAR1 by retrieval antigen retrieved by use of pH 6.0 citrate buffer (Cat. #S1700; Dako, Western blotting. In brief, whole-cell lysate of total PBMC was made with Carpenteria, CA, USA) and subsequently probed for p24, TAAR1, and CD3 CelLytic M (Sigma-Aldrich) buffer. Protein concentration was measured by expression in a sequential manner by use of Vector Laboratories-labeled bicinchoninic acid assay (Pierce, Rockford, IL, USA). SDS-PAGE and Western polymer ImmPRESS HRP and ImmPRESS-AP detection systems (Vector blot analysis were performed as described previously [7, 36]. TAAR1 was Laboratories, Burlingame, CA, USA). As a result of the use of multiple detected by use of anti-human rabbit polyclonal TAAR1 antibody. systems, both endogenous peroxidase and alkaline phosphatase activity were quenched (Bloxall; Vector Laboratories) before normal serum blocking. Sections were then incubated overnight at 4°C in mouse anti-human p24 Statistical analysis (1:8dilution,Cat.#M0857,CloneKal-1;Dako),followedbydetectionwith Data were analyzed by use of Prism software (GraphPad Software, San anti-mouse ImmPRESS HRP and visualization with ImmPACT DAB Diego, CA, USA). One sample t test, two-tailed Student’s t test, or one-way (Vector Laboratories). Sections were reblocked and incubated in rabbit ANOVA, as appropriate, was used as statistical test for different sets of anti-human TAAR1 (1:1200 dilution, Cat. #MC-2041; MBL International) experiments and considered significant values at P , 0.05 (see figures for for 45 min at room temperature, followed by detection with anti-rabbit other significance values).

www.jleukbio.org Volume 99, January 2016 Journal of Leukocyte Biology 215 RESULTS amines [17]. CD4+ T cells are prime targets for HIV-1 infection [40, 41]. It is now well established that METH abuse increases HIV-1 METH increases TAAR1 gene expression in resting infection [42, 43]. Therefore, we firstsoughttoexploreeffectsof human T cells METH on TAAR1 expression on resting T cells, that is, the primary TAAR1 expression has been classically demonstrated pri- signaling pathway downstream of METH stimulation. We analyzed marily in the brain [12, 16]. Subsequent studies have shown the expression of TAAR1 on primary human PBMCs stimulated with evidence in different cell types in rodent, primate, and METH or known, potent agonists of TAAR1, b-PEA, or tyramine – human models [18, 37 39]. We followed a time course of up [44] by use of confocal microscopy and flow cytometry. PBMCs to 8 h to test induction of TAAR1 mRNA in Pan-isolated treated with tyramine (100 mM), b-PEA (100 mM), and METH T cells from PBMCs from different donors after METH (100 mM) showed significant increases in TAAR1 expression in treatment (Fig. 1). Although there were appreciable differ- T cells compared with untreated control cells (Fig. 2). Flow cytometric ences in the level of TAAR1 mRNA in the different donors analyses (Fig. 3) also showed increases in TAAR1 expression in CD4+ tested (n =5),theincreaseinTAAR1expressionat6hwas and CD8+ T cell subsets after 24 h stimulation. Stimulation with fi , highly signi cant (P 0.001; Fig. 1). Interestingly, in all of METH potently increased TAAR1 expression in T cells, similar to the donors tested, we consistently observed a huge induction b-PEA and tyramine. The strongest induction was with b-PEA ; of TAAR1 mRNA upon METH treatment at 6 h (up to 300-fold (Fig. 3A). In our hands, TAAR1 antibodies LS-A2041 and -A2042 up-regulation over untreated control), which dropped dras- performed optimally for flow with good cell-surface staining, as well as b tically at 8 h (Fig. 1). -PEA, a well-known ligand of TAAR1, good detection by confocal microscopy. Interestingly, a greater consistently induced high TAAR1 expression in T cells at 8 h. percentage of CD8+ T cells constitutively expressed TAAR1 on their The TAAR1 gene was constitutively expressed in 3 out of 5 cell surface rather than CD4+ T cells without any stimulation (Fig. 3B). fi donors tested (data not shown), con rming the observations Together, the data for the protein expression of TAAR1 suggest by Babusyte et al. [33]. The huge variation in TAAR1 gene that TAAR1 plays a role in modulating T cell responses to METH, expression induced by METH was also attributable to the as other biogenic amines, such as tyramine and b-PEA [44]. variation in the baseline-level expression of TAAR1 in the different individuals. METH induced cAMP and cAMP-dependent protein METH increases TAAR1 protein expression in human kinase activity in resting T cells from normal donors T cells from normal donors via TAAR1 Increased expression in TAAR1 has been shown in total lymphocytes An increase in cAMP and cAMP-dependent PKA activation is and in B cell lines [16, 18, 33] upon stimulation with biogenic a classic response to TAAR1 activation and has been demonstrated in HEK293 cell lines, immortalized rhesus monkey B cells, PHA- activated rhesus monkey lymphocytes [38], and neurologic cell types [45]. TAAR1-dependent phosphorylation of PKA and PKC has been shown in these studies. Whereas other groups have shown PKA activation upon METH in PHA-activated total lymphocytes, in this report, we demonstrate that METH, upon TAAR1 signaling, increased cAMP levels in resting human T cells. cAMP levels increased on T cells stimulated with METH for 30 min–1h,as indicated by the increase in the MFI compared with control (Fig. 4A). Forskolin was used as a positive control. Phosflow analysis of METH-induced cAMP increase and subsequent PKA activation on T cells was measured by use of an antibody to pPKA RIIa (pS99), whichisaregulatorysubunitofPKA.AnincreaseincAMPdecreases phosphorylation of PKA RIIa. This is demonstrated by the shift in fluorescence intensity to the left in the histogram, showing decreased MFI (Fig. 4B). Treatments with METH and the positive control forskolin decreased the MFI compared with the control, suggesting that METH induces activation of cAMP on T cells. Figure 1. METH induces TAAR1 mRNA expression in resting human T lymphocytes. Human T cells were treated with b-PEA (100 mM) and METH (100 mM)overatimecourse(4–8 h) to see how these METH-induced cAMP and IL-2 production by T cells is treatments altered TAAR1 gene expression. TAAR1 mRNA was TAAR1 dependent quantified by use of TaqMan probe reagents by real-time PCR. Data To demonstrate that TAAR1 regulated METH-induced responses in represent the mean fold changes 6 SEM of the mRNA from at least 3 T cells, we resorted to a gene-silencing technique and used cAMP different experiments in triplicate compared with untreated control production and IL-2 production, the 2 major classic responses of cells. The horizontal line in the graph represents the baseline of 1 T cells upon METH stimulation, as readouts. We used the TAAR1 for the untreated control, from which the fold change of expression was calculated. There was a significant increase in TAAR1 mRNA after siRNA sequence referenced in Babusyte et al. [33] and used 6 h of METH treatment and 8 h of b-PEA treatment. ***P , 0.001 by INTERFERin transfection reagent and obtained a very good one-way ANOVA. TAAR1 gene knockdown (up to 90%; Fig. 5A). Gene expression

216 Journal of Leukocyte Biology Volume 99, January 2016 www.jleukbio.org Sriram et al. METH induces TAAR1 in human T cells

Figure 2. METH increases TAAR1 protein expression in resting human T cells. (A) Immunofluorescent staining and confocal imaging of human T lymphocytes showing expression of TAAR1. Representative photomicrographs of CD3 (red) and TAAR1 (green). One million T lymphocytes were left untreated or incubated for 24 h at 37°C with 100 mM of the one following treatments: b-PEA (Sigma-Aldrich), tyramine (Sigma-Aldrich), or MET (Sigma- Aldrich). (B) Data represent the fold change of the average of mean gray-pixel values 6 SEM from 5 separate images/treatment were taken at 633. Images were analyzed for mean gray pixels/cells in the field by use of ImageJ software. T cells treated with tyramine (100 mM), b-PEA (100 mM), and METH (100 mM) showed a significant increase in TAAR1 expression compared with untreated control cells. *P , 0.05 for METH and tyramine; **P , 0.01 for b-PEA. was assessed by qPCR by use of the GAPDH housekeeping gene the pathogenesis of HIV-1 infection itself [5, 46]. It is as reference. By the gene-silencing technique, we confirm that important to study the effects of this drug on the immune the induction of cAMP is mediated via TAAR1 (Fig. 5B), as seen by response in the context of understanding the biology, as well a significant decrease in cAMP induction in the absence of TAAR1 as in viral infections, especially HIV-1 infection, along with compared with scrambled control. Forskolin, which increases chronic drug abuse. Paraffin-embedded lymph node tissue was intracellular levels of cAMP by activating enzyme adenylyl cyclase, sectioned at 5 m and immunostained for CD3, TAAR1, and the remained unaltered, further confirming that METH via TAAR1 HIV-1 core protein p24, shown in Fig. 6.Asshowninthe induces cAMP levels in human T cells. multiplexed images (Fig. 6), evaluation of TAAR1 expression As a measure of T cell effector function, we measured IL-2 in (blue) on the CD3 T cells (red) and p24 (golden brown) was the supernatant of siRNA-treated cultures that were stimulated with performed on paraffin-embedded lymph node sections of soluble CD3/CD28 in the presence or absence of 100 mMMETH. HIV-1-infected patients (10 male patients and 1 female patient), Earlier, we have shown that METH decreased IL-2 production by obtained from the California NeuroAIDS Tissue Network, T cells upon CD3/CD28 stimulation [7]. Knockdown of TAAR1 University of California, San Diego. The mean age of patients siRNA reversed the effect of METH on IL-2 as opposed to the with and without a history of METH abuse was the following: scrambled siRNA control (Fig. 5C), suggesting that IL-2 production, METH-negative group, 54 6 10 yr; METH-positive group, a key cytokine produced by T cells, is regulated by TAAR1, implicating 39 6 9 yr, respectively. The mean HIV-1 plasma viral load a very important role of TAAR1 in modulating T cell responses. (Log 10) was the following: METH-negative group, 3.85 6 2.07; METH-positive group, 4.41 6 1.70. Among the METH-positive, METH abusers with HIV-1 infection have increased HIV-infected patients, 3 cases had no alcohol dependence nor TAAR1 expression in their lymph nodes other drug dependence, whereas the other 4 cases had past METH-induced modulation of immune responses in HIV-1 alcohol dependence; 1 of these patients also had other drug infection has a huge impact on treatment interruption and on dependence. One of the 4 HIV patients from the METH-

www.jleukbio.org Volume 99, January 2016 Journal of Leukocyte Biology 217 Figure 3. METH enhances expression of TAAR1 protein in CD4+ and CD8+ T cell subsets. Two million PBMCs were treated with tyramine (100 mM), b-PEA (100 mM), and METH (100 mM) for 24 h and then stained with CD3-, CD4-, CD8-, and TAAR1-specificantibodyandrunonanLSRII (BD Biosciences) flow cytometer. (A) Representative flow cytometric analysis of TAAR1 expression in CD4 and CD8 T cells treated with tyramine (100 mM), b-PEA (100 mM), and METH (100 mM). Plots show percentage of CD3+,CD4+,CD8+ Tcellsubsets positive for TAAR1 staining, respectively. (B, left) Representative of TAAR1 expression on CD3, CD4, and CD8 T cells from a normal donor; (right) bar graph shows percentage of CD3+,CD4+,andCD8+ T cells expressing TAAR1 constitutively. Data are means 6 SEM of 3 independent testings. Significant constitutive increase in CD8 among the other subsets is represented by **P , 0.01, as analyzed by one-way ANOVA.

negative group was alcohol dependent at the time the samples METHabuseshowedagreaternumberofdouble-andtriple- were collected but had no history of other drugs of abuse. positive cells (indicated by arrows under “Triple” positive) Numerous T lymphocytes in the paracorticular area had compared with HIV-1-only cases (Fig. 6H). These ﬁndings of detectable TAAR1 expression in the cytosolic, membranous, increased expression of TAAR1 in T lymphocytes in the peripheral or both cellular compartments (examples are denoted as lymphoid organs, such as lymph nodes, suggest that TAAR1 may “Double” positive by the arrows). Individual T cells, stained play a role in METH-mediated, immune-modulatory responses. double positive for CD3 and TAAR1 in the seronegative HIV-1 control, did not show any p24 immunostaining (Fig. 6A). In METH increases TAAR1 expression in the presence of HIV-1 (Figures 6B–D) and HIV-1 with METH abuse cases (Fig. HIV-1 infection 6E–G), there was an appreciable increase in TAAR1 detection Several studies have examined the effects of METH during HIV-1 (number of cells) and in expression (strength of staining). infection in different models [27, 40, 47]. We report, for the Cases from HIV-1-positive individuals with a known history of ﬁrst time, an increase in TAAR1 expression in total PBMCs that

218 Journal of Leukocyte Biology Volume 99, January 2016 www.jleukbio.org Sriram et al. METH induces TAAR1 in human T cells

(Supplemental Fig. 1B). METH increased HIV-1 p24 expression in CD3+ T cells, as seen by the increase in the percentage of p24- positive T cells, as assessed by ﬂow cytometry (2.9% in HIV-1 alone vs. 4.5% in METH + HIV-1; Supplemental Fig. 1C). Overall, these data highlight a plausible association among TAAR1 expression, METH, and HIV-1 infection. Whereas these observations are noteworthy, further investigation is warranted to deﬁne the role of TAAR1 in HIV-1 infection, if any.

DISCUSSION

Since its discovery in 2001, TAAR1, a GPCR that is potently activated by trace amines, has gained a lot of attention, especially as a potential Figure 4. METH-induced TAAR1 activates cAMP and cAMP-dependent PKA phosphorylation. (A) Induction of cAMP was detected by flow therapeutic target for psychiatric disorders [14, 48]. Among the cytometry in MACS-isolated T cells after METH stimulation for 30 min–1 various TAARs, TAAR1 is the most extensively studied molecule; its h by use of a purified mouse mAb, followed by an anti-mouse secondary, potential agonists, cellular expression, signaling cascades, brain as described in MATERIALS AND METHODS. Results are average MFI of cAMP regional distribution, and modulatory function in monoaminergic from 3 different normal donors, each condition performed in duplicate. systems are very well established [9, 10, 15, 49]. Whereas a lot of , fl a ***P 0.001. (B) Phos ow analysis for pPKA RII (pS99) was done on studies in the last decade have focused on analyzing TAAR1 total PBMC. Cells were counterstained for CD3 and analyzed. Histograms show fluorescence intensities of pPKA RIIa on CD3+ T cells at 15 min expression in cells of the CNS [12, 16, 17], it is only recently that the after stimulation. Decrease in pPKA RIIa is indicated by a shift of the importance of TAAR1 in non-neuronal cells and immune cells in curve to the left, indicating increased cAMP-dependent protein kinase the periphery has been addressed [33, 38]. However, so far, no study activity. One representative of 2 independent testings done in duplicate. has investigated the role of TAAR1 in resting/nonactivated primary ISO, isotype; FORSK, forskolin; UNTR, untreated. human T cells exposed to METH and in the context of HIV-1 infection. Our findings are novel in this regard. were exposed to METH before infection with HIV-1 (Fig. 7). The TAAR family is comprised of 9 mammalian TAAR Western blot analysis of TAAR1 in total PBMC infected with subtypes, with intact genes and pseudogenes differing consid- HIV-1 in the presence or absence of METH for 24 h revealed an erably, even between closely related species [50]. Mouse and increase in TAAR1 expression (Fig. 7A and B). With the use of human TAAR1 is expressed in many tissues except olfactory p24 analysis by ELISA from supernatants of HIV-infected PBMC epithelium, where other TAARs may play a role [44]. TAAR1 in the presence or absence of METH, we confirm that p24 levels and TAAR2 are expressed in human lymphocytes from were increased in the HIV-infected cells exposed to METH peripheral blood [33]. Miller and colleagues [51] have studied (Supplemental Fig. 1A). HIV-RT analysis also showed an the functional evolution of TAAR1 and report expansion (in increase in HIV-1 RT activity in METH-treated and HIV-1- rodents) or reduction (in primates) of members of the gene infected cells compared with HIV-1-infected cells alone family. In this study, we report, for the first time, TAAR1

Figure 5. The silencing of TAAR1 decreases METH-induced cAMP and increases IL-2 production in T cells. Total PBMCs were treated with scrambled or TAAR1 siRNAs and cultured for ;44 h in complete RPMI medium. (A) Cells were harvested at 44 h, and RNA was isolated for qPCR check for TAAR1 silencing. TAAR1 siRNA significantly knocked down the expression in PBMC. TAAR1 expression in scrambled siRNA versus TAAR1 siRNA; ***P , 0.001. (B) PBMC treated with siRNA was stimulated with METH (100 mM) or forskolin (100 mM) for 30 min–1 h, harvested and stained for CD3 and cAMP, and analyzed by flow cytometry. Results are expressed as fold change in cAMP MFI on CD3+ TcellsinTAAR1 siRNA-treated PBMC versus scrambled siRNA- treated PBMC for each treatment. TAAR1 knocked down PBMCs showed significantly less cAMP expression compared with scrambled control siRNA (*P , 0.05), whereas forskolin-treated cells responded the same to both scrambled and TAAR1 siRNA. (C) Cells that were treated with siRNA were further treated with METH (100 mM) for 30 min and then stimulated with soluble CD3/CD28 antibodies and cultured for another 24 h. Supernatants were concentrated and analyzed for IL-2 by use of the MSD human IL-2 ELISA kit. The bar graph represents fold change from scrambled control. A significant increase (**P , 0.01) in the IL-2 levels was observed in the absence of TAAR1.

www.jleukbio.org Volume 99, January 2016 Journal of Leukocyte Biology 219 Figure 6. TAAR1 expression in lymph nodes of HIV-1-infected patients, with or without a history of METH abuse. Paraffin-embedded lymph node tissue was sectioned at 5 mm and immunostained for CD3, TAAR1, and the HIV-1 core protein p24. As shown in the multiplexed images, the T lymphocyte marker CD3 appears in red (Vector Red), TAAR1 expression is observed in blue (Vector Blue), and p24 appears as golden brown (ImmPACT DAB). Representative images of (A) HIV-1 seronegative control, (B–D) HIV-1-positive cases (n = 3) with no history of METH abuse, and (E–G) HIV-1-positive individuals with a known history of METH abuse. Small insert images were taken under 203 objective magnification (original scale bars, 50 mm); the larger images were taken under 603 objective magnification (original scale bars, 25 mm). (H) Graph showing image analysis (with the use of segmentation, color threshold, and particle counting) results of the number of cells showing double (plotted on the left y-axis) and triple (plotted on the right y-axis) labeling. Results are shown as the averages 6 SEM. Statistical analyses were performed by use of one-way ANOVA with Dunnett’s multiple comparisons. Statistical significance differences, *P , 0.05, comparisons with the control (seronegative for HIV-1); #P , 0.05, analysis of those particular group comparisons. expression and kinetics in resting human T cells upon METH METH-induced alterations in immune cell subsets in humans or in stimulation. We observe that METH potentially increases animal models. Our study, for the first time, reveals that TAAR1 TAAR1 gene and protein expression, as do other amines, such protein is increased in CD4+ and CD8+ T cells upon METH as b-PEA or tyramine, whereas the kinetics of induction may be stimulation, as well as with other classic biogenic amines that signal different. A recent study shows constitutive expression of through TAAR1. Interestingly, there is an increased constitutive TAAR1 and TAAR2 in peripheral mononuclear cells and T and expression of TAAR1 in CD8+ T cells compared with CD4+ or B cells [33]. Some functions, such as chemotaxis, have been CD3+ subsets. The biologic significance and functional conse- tested by use of an siRNA knockdown system [33]. It will be quence of this increased expression of TAAR1 in CD8+ T cells are interesting to study the expression of TAAR2 upon METH unknown and need further investigation. As this constitutively treatment and if it coexpresses with TAAR1 to bring about increased TAAR1 expression on CD8 T cells may have important immune responses in T cells. relevance on the ability of CD8 to fight viral infections, the Several studies reveal that METH profoundly interferes with observation warrants further investigation. How TAAR1 regulates immunologic networks and affects diverse leukocyte subsets, CD8 T cell function in a viral infection may be important to thereby increasing susceptibility to infection [6, 7, 52, 53]. understand, as our study shows that METH increases TAAR1 in However, there has been no systematic approach to dissect out CD4 and CD8 subsets, but we speculate that they may be further the role of the primary receptor TAAR1 in differentially regulating the T cell functions in both subsets.

220 Journal of Leukocyte Biology Volume 99, January 2016 www.jleukbio.org Sriram et al. METH induces TAAR1 in human T cells

altered cell-cycle entry and progression and decreased expression of cell-cycle progression markers (cyclin and cyclin- dependent kinase) of CD4+ and CD8+ T cells. This study underscores the effects of METH on the primary peripheral T cells and the probable role of TAAR1 to alleviate further susceptibility to HIV infection by increasing cAMP. Future TAAR1 molecular studies in primary human T cells could further corroborate the role of TAAR1 receptor-mediated immune regulation in the context of HIV. The association of METH with risky sexual behavior and spread of sexually transmitted diseases, such as HIV-1, is a major public health concern [4, 22]. Considerable evidence exists linking drug abuse to immune dysregulation and enhanced Figure 7. METH increases TAAR1 expression in the presence of HIV-1 infection. PBMCs were treated with or without METH for 24 h and then susceptibility to the progression of chronic infections, such as infected with HIV-1ADA for 4 h, washed. and cultured in complete RPMI HIV-1 [21]. METH has been shown to increase HIV-1 replication medium with IL-2. PBMCs were harvested on d 6 postinfection, and in dendritic cells [43] and monocyte-derived macrophages [47]. TAAR1 expression was analyzed by Western blot. (A) TAAR1 was METH has also been suggested to activate HIV-1 long terminal – detected as a 39 40 kDa protein. Actin was used as a loading control. repeat promoter-mediated transcription [57]. Mantri et al. [40] Bands were analyzed from the same blot with 1 sample lane rearranged fi recently reported that increased doses of METH inhibited HIV-1 for the gure. (B) The bar graph represents fold change in band + intensity from untreated control after normalization with actin. replication in primary CD4 T cells by induction of microRNAs. Unactivated control was without any PHA stimulation and without any The time of METH exposure varied in all of these studies [40, 43, treatment. The rest of the conditions were PHA activated and then 47]. None of these studies addressed the role of TAAR1, and treated with or without METH or HIV-1ADA. The blot is representative of therefore, we studied the expression of METH-induced TAAR1 3 independent testings. in the context of HIV infection in T cells. In our model, we exposed total PBMCs to METH for 24 h and then infected them with HIV-1 and continued to give METH every other day to TAAR1 activation is followed by a very high induction of cAMP, simulate chronic exposure until the cells were harvested at which has been demonstrated by several groups [12, 13, 15]. different time points. We used p24 as a marker of HIV infection. Significant increases in the phosphorylation of PKA and PKC We did see an increase in HIV-1 p24 expression levels in T cells following the METH–TAAR1 interaction have been demon- pretreated with METH, as assessed by ELISA and flow cytometry strated in activated total lymphocytes [38]. (Supplemental Fig. 1). We also report, for the first time in this In our earlier study, we showed that METH increased reactive study, that METH, in the presence of HIV-1 infection, increases oxygen species in T cells that are downstream of the cAMP TAAR1 expression in peripheral blood cells. Our analysis of lymph pathway and inhibited the ability of the T cells to proliferate in node sections clearly shows increased TAAR1 expression in HIV-1 response to stimulation, as assayed by measuring IL-2 secretion patients with a history of METH abuse compared with HIV-1 [7]. In this report, we demonstrate direct activation of cAMP patients with no history of METH abuse. The potential and cAMP-dependent PKA activation in resting T cells upon association between the impact of substance abuse on the host METH stimulation by studying the induction of cAMP and factors that affect immune response and the risk for infection phosphorylation of protein kinase that is immediately down- with HIV and sexually transmitted diseases is dependent on stream in the signaling pathway. With the use of TAAR1 multiple compounding factors, along with potential con- knockdown experiments, we demonstrate further that induc- founders. The immune system of HIV patients with drug-abuse tion of cAMP, the classic downstream event after METH history is notably affected by the various drugs and can greatly stimulation in T cells, is regulated by TAAR1. We also confirm, affect the interpretation of effects of each drug studied with the use of TAAR1 gene silencing, that METH stimulation independently [36]. Nevertheless, the enhanced expression of via TAAR1 regulates the production of IL-2 in T cells. This is TAAR1 in the lymph nodes of METH users compared with averyimportantfinding and points to a pivotal role of TAAR1 those with no METH history underscores the plausible role of in regulating T cell immune responses. TAAR1 in mediating METH-induced immune dysregulation. METH- and HIV-1-regulated TAAR1 expression and increased Taken together, our findings highlight the potential role of cAMP levels have been demonstrated recently in astrocytes [42]. TAAR1 in HIV-1 infection and analyzing its role as an immune Intracellular cAMP is thought to inhibit T cell activation and modulator. proliferation via activation of the cAMP-dependent PKA, and In summary, our data suggest a role for METH-induced among the several immunologic factors that contribute to TAAR1 expression in regulating T cell immune responses. susceptibility to HIV infection, increasing evidence suggests that Further investigation of the role of TAAR1 in regulating HIV-1 cAMP and downstream signaling via PKA play a crucial role [54]. pathogenesis, especially in the periphery, can have a major In addition, PKA regulates cell proliferation via alteration of the impact in therapeutic approaches to control HIV-1 infection, cyclin/cyclin-dependent kinase complex [55, 56]. Interestingly, especially in the context of drug abuse. Studies with humanized our unpublished data from characterization of the METH effects mouse models can be helpful to dissect out further the on T cell cycle entry and progression show that it results in TAAR1-mediated pathways.

www.jleukbio.org Volume 99, January 2016 Journal of Leukocyte Biology 221 AUTHORSHIP 15. Miller, G. M., Verrico, C. D., Jassen, A., Konar, M., Yang, H., Panas, H., Bahn, M., Johnson, R., Madras, B. K. (2005) Primate trace amine All authors participated in the design of experiments, interpre- receptor 1 modulation by the dopamine transporter. J. Pharmacol. Exp. Ther. 313, 983–994. tation of data, and writing of the manuscript. U.S., J.M.C., B.H., 16. Miller, G. M. (2011) The emerging role of trace amine-associated N.C.F., R.R., S.F., and S.H.R. performed the experiments and receptor 1 in the functional regulation of monoamine transporters and dopaminergic activity. J. Neurochem. 116, 164–176. analyzed the data. 17. Xie, Z., Westmoreland, S. V., Miller, G. M. (2008) Modulation of monoamine transporters by common biogenic amines via trace amine- associated receptor 1 and monoamine autoreceptors in human embryonic kidney 293 cells and brain synaptosomes. J. Pharmacol. Exp. ACKNOWLEDGMENTS Ther. 325, 629–640. 18. Nelson, D. A., Tolbert, M. D., Singh, S. J., Bost, K. L. (2007) Expression of This work was supported by U.S. National Institutes of Health neuronal trace amine-associated receptor (Taar) mRNAs in leukocytes. – (NIH) Grant R01 DA031064 and Temple Development Grant (to J. Neuroimmunol. 192, 21 30. 19. Qian, H. Z., Stinnette, S. E., Rebeiro, P. F., Kipp, A. M., Shepherd, B. E., R.P.), NIH Grant RO3 AR065157 (to U.S.), NIH/National Institute Samenow, C. P., Jenkins, C. A., No, P., McGowan, C. C., Hulgan, T., of Neurological Disorders and Stroke Grant R01 NS086570-01, Sterling, T. R. (2011) The relationship between injection and noninjection drug use and HIV disease progression. J. Subst. Abuse Treat. and Shriners Hospitals for Children Grant 85110-PHI-14 (to 41, 14–20. S.H.R.). The California NeuroAIDS Tissue Network is acknowl- 20. Kipp, A. M., Desruisseau, A. J., Qian, H. Z. (2011) Non-injection drug use and HIV disease progression in the era of combination antiretroviral edged for lymphoid tissue specimens used in this study. therapy. J. Subst. Abuse Treat. 40, 386–396. 21. Friedman, H., Pross, S., Klein, T. W. (2006) Addictive drugs and their relationship with infectious diseases. FEMS Immunol. Med. Microbiol. 47, 330–342. DISCLOSURES 22. Cofrancesco, Jr., J., Scherzer, R., Tien, P. C., Gibert, C. L., Southwell, H., The authors declare no competing financial interests. Sidney, S., Dobs, A., Grunfeld, C. (2008) Illicit drug use and HIV treatment outcomes in a US cohort. AIDS 22, 357–365. 23. Shoptaw, S., Reback, C. J., Freese, T. E. (2002) Patient characteristics, HIV serostatus, and risk behaviors among gay and bisexual males seeking treatment for methamphetamine abuse and dependence in Los Angeles. REFERENCES J. Addict. Dis. 21, 91–105. 1. Gold, M. S., Kobeissy, F. H., Wang, K. K., Merlo, L. J., Bruijnzeel, A. W., 24. Li, L., Assanangkornchai, S., Duo, L., McNeil, E., Li, J. (2014) Cross- Krasnova, I. N., Cadet, J. L. (2009) Methamphetamine- and trauma- border activities and association with current methamphetamine use induced brain injuries: comparative cellular and molecular among Chinese injection drug users (IDUs) in a China-Myanmar border neurobiological substrates. Biol. Psychiatry 66, 118–127. region. Drug Alcohol Depend. 138, 48–53. 2. Panenka, W. J., Procyshyn, R. M., Lecomte, T., MacEwan, G. W., Flynn, 25. Ghimire, B., Suguimoto, S. P., Zamani, S., Ono-Kihara, M., Kihara, M. S. W., Honer, W. G., Barr, A. M. (2013) Methamphetamine use: (2013) Vulnerability to HIV infection among female drug users in a comprehensive review of molecular, preclinical and clinical findings. Kathmandu Valley, Nepal: a cross-sectional study. BMC Public Health 13, Drug Alcohol Depend. 129, 167–179. 1238. 3. Rawson, R. A., Anglin, M. D., Ling, W. (2002) Will the methamphetamine 26. Cisneros, I. E., Ghorpade, A. (2012) HIV-1, methamphetamine and problem go away? J. Addict. Dis. 21, 5–19. astrocyte glutamate regulation: combined excitotoxic implications for 4. Freese, T. E., Obert, J., Dickow, A., Cohen, J., Lord, R. H. (2000) neuro-AIDS. Curr. HIV Res. 10, 392–406. Methamphetamine abuse: issues for special populations. J. Psychoactive 27. Persidsky, Y., Heilman, D., Haorah, J., Zelivyanskaya, M., Persidsky, R., Drugs 32, 177–182. Weber, G. A., Shimokawa, H., Kaibuchi, K., Ikezu, T. (2006) Rho- 5. Boddiger, D. (2005) Metamphetamine use linked to rising HIV mediated regulation of tight junctions during monocyte migration across transmission. Lancet 365, 1217–1218. the blood-brain barrier in HIV-1 encephalitis (HIVE). Blood 107, 6. Martinez, L. R., Mihu, M. R., Gácser, A., Santambrogio, L., Nosanchuk, 4770–4780. J. D. (2009) Methamphetamine enhances histoplasmosis by 28. Ellis, R. J., Childers, M. E., Cherner, M., Lazzaretto, D., Letendre, S., immunosuppression of the host. J. Infect. Dis. 200, 131–141. Grant, I.; HIV Neurobehavioral Research Center Group. (2003) 7. Potula, R., Hawkins, B. J., Cenna, J. M., Fan, S., Dykstra, H., Ramirez, Increased human immunodeficiency virus loads in active S. H., Morsey, B., Brodie, M. R., Persidsky, Y. (2010) Methamphetamine methamphetamine users are explained by reduced effectiveness of causes mitrochondrial oxidative damage in human T lymphocytes antiretroviral therapy. J. Infect. Dis. 188, 1820–1826. leading to functional impairment. J. Immunol. 185, 2867–2876. 29. Smith, D. M., Wong, J. K., Hightower, G. K., Ignacio, C. C., Koelsch, K. K., 8. Cabral, G. A. (2006) Drugs of abuse, immune modulation, and AIDS. Petropoulos, C. J., Richman, D. D., Little, S. J. (2005) HIV drug resistance J. Neuroimmune Pharmacol. 1, 280–295. acquired through superinfection. AIDS 19, 1251–1256. 9. Borowsky, B., Adham, N., Jones, K. A., Raddatz, R., Artymyshyn, R., 30. Colfax, G. N., Vittinghoff, E., Grant, R., Lum, P., Spotts, G., Hecht, F. M. Ogozalek, K. L., Durkin, M. M., Lakhlani, P. P., Bonini, J. A., Pathirana, S., (2007) Frequent methamphetamine use is associated with primary non- Boyle, N., Pu, X., Kouranova, E., Lichtblau, H., Ochoa, F. Y., Branchek, nucleoside reverse transcriptase inhibitor resistance. AIDS 21, 239–241. T. A., Gerald, C. (2001) Trace amines: identification of a family of 31. Moore, R. D., Keruly, J. C., Chaisson, R. E. (2004) Differences in HIV mammalian G protein-coupled receptors. Proc. Natl. Acad. Sci. USA 98, disease progression by injecting drug use in HIV-infected persons in care. 8966–8971. J. Acquir. Immune Defic. Syndr. 35, 46–51. 10. Bunzow, J. R., Sonders, M. S., Arttamangkul, S., Harrison, L. M., Zhang, 32. Francis, S. H., Corbin, J. D. (1994) Structure and function of cyclic G., Quigley, D. I., Darland, T., Suchland, K. L., Pasumamula, S., nucleotide-dependent protein kinases. Annu. Rev. Physiol. 56, 237–272. Kennedy,J.L.,Olson,S.B.,Magenis,R.E.,Amara,S.G.,Grandy,D.K. 33. Babusyte, A., Kotthoff, M., Fiedler, J., Krautwurst, D. (2013) Biogenic (2001) Amphetamine, 3,4-methylenedioxymethamphetamine, lysergic amines activate blood leukocytes via trace amine-associated receptors acid diethylamide, and metabolites of the catecholamine TAAR1 and TAAR2. J. Leukoc. Biol. 93, 387–394. neurotransmitters are agonists of a rat trace amine receptor. Mol. 34. Gendelman, H. E., Orenstein, J. M., Martin, M. A., Ferrua, C., Mitra, R., Pharmacol. 60, 1181–1188. Phipps, T., Wahl, L. A., Lane, H. C., Fauci, A. S., Burke, D. S. (1988) 11. Lindemann, L., Hoener, M. C. (2005) A renaissance in trace amines Efficient isolation and propagation of human immunodeficiency virus on inspired by a novel GPCR family. Trends Pharmacol. Sci. 26, 274–281. recombinant colony-stimulating factor 1-treated monocytes. J. Exp. Med. 12. Lindemann, L., Ebeling, M., Kratochwil, N. A., Bunzow, J. R., Grandy, 167, 1428–1441. D. K., Hoener, M. C. (2005) Trace amine-associated receptors form 35. Abbas-Terki, T., Blanco-Bose, W., Deglon,´ N., Pralong, W., Aebischer, P. structurally and functionally distinct subfamilies of novel G protein- (2002) Lentiviral-mediated RNA interference. Hum. Gene Ther. 13, coupled receptors. Genomics 85, 372–385. 2197–2201. 13. Berry, M. D. (2004) Mammalian central nervous system trace amines. 36. Potula, R., Persidsky, Y. (2008) Adding fuel to the fire: methamphetamine Pharmacologic amphetamines, physiologic neuromodulators. J. enhances HIV infection. Am. J. Pathol. 172, 1467–1470. Neurochem. 90, 257–271. 37. D’Andrea, G., Terrazzino, S., Fortin, D., Farruggio, A., Rinaldi, L., Leon, 14. Berry, M. D. (2007) The potential of trace amines and their receptors for A. (2003) HPLC electrochemical detection of trace amines in human treating neurological and psychiatric diseases. Rev. Recent Clin. Trials 2, plasma and platelets and expression of mRNA transcripts of trace amine 3–19. receptors in circulating leukocytes. Neurosci. Lett. 346, 89–92.

222 Journal of Leukocyte Biology Volume 99, January 2016 www.jleukbio.org Sriram et al. METH induces TAAR1 in human T cells

38. Panas, M. W., Xie, Z., Panas, H. N., Hoener, M. C., Vallender, E. J., Miller, 50. Staubert,¨ C., Boselt,¨ I., Bohnekamp, J., Rompler,¨ H., Enard, W., Schoneberg,¨ G. M. (2012) Trace amine associated receptor 1 signaling in T. (2010) Structural and functional evolution of the trace amine-associated activated lymphocytes. J. Neuroimmune Pharmacol. 7, 866–876. receptors TAAR3, TAAR4 and TAAR5 in primates. PLoS One 5, e11133. 39. Wasik, A. M., Millan, M. J., Scanlan, T., Barnes, N. M., Gordon, J. (2012) 51. Vallender, E. J., Xie, Z., Westmoreland, S. V., Miller, G. M. (2010) Evidence for functional trace amine associated receptor-1 in normal and Functional evolution of the trace amine associated receptors in mammals malignant B cells. Leuk. Res. 36, 245–249. and the loss of TAAR1 in dogs. BMC Evol. Biol. 10, 51. 40. Mantri, C. K., Mantri, J. V., Pandhare, J., Dash, C. (2014) 52. Talloczy,´ Z., Martinez, J., Joset, D., Ray, Y., Gacser,´ A., Toussi, S., Methamphetamine inhibits HIV-1 replication in CD4+ T cells by Mizushima, N., Nosanchuk, J. D., Goldstein, H., Loike, J., Sulzer, D., modulating anti-HIV-1 miRNA expression. Am. J. Pathol. 184, 92–100. Santambrogio, L. (2008) Methamphetamine inhibits antigen processing, 41. Lane, H. C. (2010) Pathogenesis of HIV infection: total CD4+ T-cell pool, presentation, and phagocytosis. PLoS Pathog. 4, e28. immune activation, and inflammation. Top. HIV Med. 18, 2–6. 53. Harms, R., Morsey, B., Boyer, C. W., Fox, H. S., Sarvetnick, N. (2012) 42. Cisneros, I. E., Ghorpade, A. (2014) Methamphetamine and HIV-1- Methamphetamine administration targets multiple immune subsets and induced neurotoxicity: role of trace amine associated receptor 1 cAMP induces phenotypic alterations suggestive of immunosuppression. PLoS signaling in astrocytes. Neuropharmacology 85, 499–507. One 7, e49897. 43. Nair, M. P., Saiyed, Z. M., Nair, N., Gandhi, N. H., Rodriguez, J. W., 54. Rahmouni, S., Aandahl, E. M., Trebak, M., Boniver, J., Tasken, K., Boukli, N., Provencio-Vasquez, E., Malow, R. M., Miguez-Burbano, M. J. Moutschen, M. (2001) Increased cAMP levels and protein kinase (PKA) (2009) Methamphetamine enhances HIV-1 infectivity in monocyte type I activation in CD4+ T cells and B cells contribute to retrovirus- derived dendritic cells. J. Neuroimmune Pharmacol. 4, 129–139. induced immunodeficiency of mice (MAIDS): a useful in vivo model for 44. Zucchi, R., Chiellini, G., Scanlan, T. S., Grandy, D. K. (2006) Trace drug testing. FASEB J. 15, 1466–1468. amine-associated receptors and their ligands. Br. J. Pharmacol. 149, 55. Matsuda, S., Kominato, K., Koide-Yoshida, S., Miyamoto, K., Isshiki, K., 967–978. Tsuji, A., Yuasa, K. (2014) PCTAIRE kinase 3/cyclin-dependent kinase 18 45. Espinoza, S., Salahpour, A., Masri, B., Sotnikova, T. D., Messa, M., Barak, is activated through association with cyclin A and/or phosphorylation by L. S., Caron, M. G., Gainetdinov, R. R. (2011) Functional interaction protein kinase A. J. Biol. Chem. 289, 18387–18400. between trace amine-associated receptor 1 and dopamine D2 receptor. 56. White, P. C., Shore, A. M., Clement, M., McLaren, J., Soeiro, I., Lam, E. W., Mol. Pharmacol. 80, 416–425. Brennan, P. (2006) Regulation of cyclin D2 and the cyclin D2 promoter by 46. [No authors listed] (2005) HIV & drugs. Meth use develops stronger link protein kinase A and CREB in lymphocytes. Oncogene 25, 2170–2180. to HIV risk. AIDS Policy Law 20, 5. 57. Wires, E. S., Alvarez, D., Dobrowolski, C., Wang, Y., Morales, M., Karn, J., 47. Liang, H., Wang, X., Chen, H., Song, L., Ye, L., Wang, S. H., Wang, Y. J., Harvey, B. K. (2012) Methamphetamine activates nuclear factor kappa- Zhou, L., Ho, W. Z. (2008) Methamphetamine enhances HIV infection light-chain-enhancer of activated B cells (NF-kB) and induces human of macrophages. Am. J. Pathol. 172, 1617–1624. immunodeficiency virus (HIV) transcription in human microglial cells. J. 48. Miller, G. M. (2012) Avenues for the development of therapeutics that target Neurovirol. 18, 400–410. trace amine associated receptor 1 (TAAR1). J. Med. Chem. 55, 1809–1814. 49. Lindemann, L., Meyer, C. A., Jeanneau, K., Bradaia, A., Ozmen, L., Bluethmann, H., Bettler, B., Wettstein, J. G., Borroni, E., Moreau, J. L., Hoener, M. C. (2008) Trace amine-associated receptor 1 modulates KEY WORDS: dopaminergic activity. J. Pharmacol. Exp. Ther. 324, 948–956. drug abuse • immune response • T cells • HIV infection

www.jleukbio.org Volume 99, January 2016 Journal of Leukocyte Biology 223