Sarcoma Fusions 101 Flyer

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Get more from your sarcoma analysis Detect known and novel fusion partners for fast insights with NGS Sarcomas are rare but complex Gene fusion partners matter Sarcomas are cancers found in connective tissues such Some genes, such as EWSR1, are particularly as bone and soft tissues. While rare—with more than associated with sarcomas and have multiple fusion 15,000 new diagnoses each year in the US—27% are partners. These varied fusion partnerships result in found in children and young adults under age 30.1,2 different sarcoma subtypes.5 DDIT3 Myxoid Liposarcoma ERG FLI1 ETV1 Ewing's Sarcoma E1AF Gene FEV fusion EWSR1 ATF1 Clear Cell Sarcoma WT1 Desmoplastic Small Cell Tumor ZSG Askin Like CD99 Negative Sarcoma Translocation TEC Extraskeletal Myxoid Chondrosarcoma NMP4 Acute Lymphatic Leukemia ~1/3 of sarcomas are caused by chromosomal Sarcomas include more than 50 subtypes based on translocations that lead to gene fusions.3,4 the cell of origin.6 Accurate subtype identification is essential for implementing insights Detecting sarcoma subtypes is more complicated than identifying the cell of origin, but conventional molecular analysis methods can have limitations. Fluorescence in situ hybridization (FISH) • Usually interrogates only one pair of genes • Translocations of one gene can occur with multiple fusion partners, resulting in incorrect sarcoma subtype identification Reverse transcription polymerase chain reaction (RT-PCR) • Requires knowledge of both partners and anticipated break points TruSight™ RNA Fusion Panel: Comprehensive coverage in a single assay Next-generation sequencing (NGS) covers hundreds of fusion-associated genes—and can detect novel fusions—so you can identify chromosomal abnormalities in the first try. For Research Use Only. Not for use in diagnostic procedures. The TruSight RNA Fusion Panel Known and novel fusions. Fast and accurate insights. TruSight RNA Fusion Panel covers a broad range of fusion-associated genes Novel without prior knowledge >500 142 Fusions Fusion of specic translocations Fusion-associated genes previously found in sarcomas4 Detection or chromosomal breakpoints Identify fusions associated with common sarcomas Ewing’s Sarcoma Alveolar Rhabdomyosarcoma Synovial Sarcoma Myxoid Liposarcoma Other subtypes PAX7 TAF15 SSX1 WT1 COL1A1 TFG FOX01 SS18 TCF12 SS18L1 NR4A3 ETV4 SSX2 PDGFB PATZ1 ATF1 PAX3 SSX4 CLTC ATIC EWSR1 CREB3L1 SEC31A FLI1 DDIT3 FOX04 CREB3L2 NCOA1 TPM4 ALK CARS ASPSCR1 FEV ERG NTRK3 ETV1 FUS RANBP2 TPM3 TFE3 ETV6 Round cell tumors Spindle cell tumors The TruSight RNA Fusion Panel provides a reproducible and economical solution7 for identifying gene fusions in sarcomas. Learn More For more information about the TruSight RNA Fusion Panel, visit illumina.com/RNAFusion. References 1. Estimated New Cases, 2017. American Cancer Society. https://cancerstatisticscenter.cancer.org/#/data-analysis/module/BmVYeqHT?type=barGraph. Accessed June 23, 2017. 2. SEER Cancer Statistics Review 1975-2004: Table I-10, Age Distribution at Diagnosis and Death. National Cancer Institute Surveillance, Epidemiology, and End Results Program. https://seer.cancer.gov/archive/csr/1975_2004/results_merged/topic_age_dist.pdf. Accessed July 17, 2017. 3. Taylor BS, Barretina J, Maki RG, Antonescu CR, Singer S, Ladanyi M. Advances in sarcoma genomics and new therapeutic targets. Nat Rev Cancer. 2011;11(8):541-557. 4. Mertens F, Antonescu CR, Mitelman F, et al. Gene fusions in soft tissue tumors: Recurrent and overlapping pathogenetic themes. Genes Chromosomes Cancer. 2016;55(4):291-310. 5. Åman P. Fusion Oncogenes in tumor development. Semin Cancer Biol. 2005;15(3):236-243. 6. What is a soft tissue sarcoma? American Cancer Society. https://www.cancer.org/cancer/soft-tissue-sarcoma/about/soft-tissue-sarcoma.html. Accessed June 23, 2017. 7. Data calculations on file. Illumina, Inc. 2017. For Research Use Only. Not for use in diagnostic procedures. © 2017 Illumina, Inc. All rights reserved. Pub. No. 1170-2017-011.
Recommended publications
  • SS18 (SYT) (18Q11) Gene Rearrangement by FISH Indications for Ordering Genetics

    SS18 (SYT) (18Q11) Gene Rearrangement by FISH Indications for Ordering Genetics

    SS18 (SYT) (18q11) Gene Rearrangement by FISH Indications for Ordering Genetics Diagnosis of synovial sarcoma in conjunction with histologic Translocations – SS18-SSX1, SS18-SSX2 and clinical information Structure/function Test Description • SS18 is located on chromosome 18 • SSX1 and SSX2 are located on the X-chromosome Fluorescence in situ hybridization • Each gene in the translocation codes for proteins that have opposite transcriptional functions Tests to Consider o SS18 – activator of oncogenes Primary test o SSX1, SSX2 – tumor suppression SS18 (SYT) (18q11) Gene Rearrangement by FISH 3001303 Test Interpretation • Molecular diagnosis of synovial sarcoma Results Related test • Positive – SS18 rearrangement is detected Chromosome FISH, Interphase 2002298 o SSX translocation partner is not identified with this • Specific probe for SS18 (SYT) rearrangement must be testing methodology requested o Synovial sarcoma likely • Fresh tissue specimens only • Negative – no SS18 rearrangement detected Disease Overview o Does not entirely exclude the presence of an SS18 rearrangement as some translocations are cryptic and Incidence – rare not evaluable by this testing methodology • Synovial sarcomas account for 8-10% of all soft tissue o Does not entirely exclude diagnosis of synovial sarcoma sarcomas Limitations Diagnostic/prognostic issues • Testing using tissue fixed in alcohol-based or non-formalin • Synovial sarcomas may resemble other neoplasms, fixatives has not been validated using this method particularly those displaying an epithelioid, spindle cell, or • SS18 fusion partners are not detected with this test combined morphology • t(X;18)(p11.2;q11.2) translocation serves as a specific marker for synovial sarcoma o SS18 (SYT) gene fuses with SSX gene . Fusion with SSX1 in ~65% of synovial sarcomas .
  • CREST Monoclonal ANTIBODY Catalog Number:60314-1-Ig

    CREST Monoclonal ANTIBODY Catalog Number:60314-1-Ig

    For Research Use Only CREST Monoclonal ANTIBODY www.ptglab.com Catalog Number:60314-1-Ig Catalog Number: GenBank Accession Number: Purification Method: Basic Information 60314-1-Ig BC034494 Protein G purification Size: GeneID (NCBI): CloneNo.: 150UL , Concentration: 1000 μg/ml by 26039 3D5D10 Bradford method using BSA as the Full Name: standard; synovial sarcoma translocation gene Source: on chromosome 18-like 1 Mouse Calculated MW: Isotype: 396 aa, 43 kDa IgG1 Observed MW: Immunogen Catalog Number: 50 kDa AG3119 Tested Applications: Applications WB, ELISA Species Specificity: human, rat, mouse SS18-like 1(SS18L1) is a transcriptional activator that is required for calcium-dependent dendritic growth and Background Information branching in cortical neurons. It's also a nuclear protein interacts with CREB-binding protein and expressed in the developing brain. It helps regulate neuronal morphogenesis in calcuim-dependent manner. The N-terminal domain of SS18L1 is required for suppressing transactivation in the basal state, while the C-terminal domain is required for calcium-induced transactivation. It's part of the CREST-BRG1 complex, a multiprotein complex that regulates promoter activation by orchestrating a calcium-dependent release of a repressor complex and a recruitment of an activator complex. This complex also binds to the NR2B promoter, and activity-dependent induction of NR2B expression involves a release of HDAC1 and recruitment of CREBBP. The calculated molecular weight of CREST is about 43 kDa, but the modified of CREST protein is 55 kDa (PMID: 25888396). Storage: Storage Store at -20°C. Stable for one year after shipment. Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3.
  • SYT-SSX1 and SYT-SSX2 Interfere with Repression of E-Cadherin by Snail and Slug

    SYT-SSX1 and SYT-SSX2 Interfere with Repression of E-Cadherin by Snail and Slug

    Research Article SYT-SSX1 and SYT-SSX2 Interfere with Repression of E-Cadherin by Snail and Slug: A Potential Mechanism for Aberrant Mesenchymal to Epithelial Transition in Human Synovial Sarcoma Tsuyoshi Saito, Makoto Nagai, and Marc Ladanyi Department of Pathology, Memorial Sloan-Kettering Cancer Center, New York, New York Abstract open spaces [i.e., glandular epithelial differentiation (GED)] in a Synovial sarcoma is a primitive mesenchymal neoplasm background of spindle cells (Supplementary Fig. S1). Both the characterized in almost all cases by a t(X;18) fusing the SYT spindle and epithelial elements of synovial sarcoma contain transcriptional coactivator gene with either SSX1 or SSX2, the t(X;18) and are thus clonally related (2, 3). The GED in synovial with the resulting fusion gene encoding an aberrant tran- sarcoma has the hallmarks of a genuine mesenchymal to epithelial scriptional regulator.A subset of synovial sarcoma, predom- transition (MET) akin to those seen in embryonic development inantly cases with the SYT-SSX1 fusion, shows foci of (e.g., in developing kidney). Thus, the epithelial cells in synovial h morphologic epithelial differentiation in the form of nests of sarcoma express E-cadherin, keratins, a-catenin, -catenin, and glandular epithelium.The striking spontaneous mesenchymal g-catenin, whereas the spindle cells express vimentin and, focally, to epithelial differentiation in this cancer is reminiscent of a N-cadherin (4, 5). Epithelial differentiation in synovial sarcoma is developmental switch, but the only
  • A Novel Type of SYT/SSX Fusion

    A Novel Type of SYT/SSX Fusion

    A Novel Type of SYT/SSX Fusion: Methodological and Biological Implications Maria Törnkvist, M.Sc., Bertha Brodin, Ph.D., Armando Bartolazzi, M.D., Ph.D., Olle Larsson, M.D., Ph.D. Department of Cellular and Molecular Tumor Pathology, Cancer Centrum Karolinska, Karolinska Hospital (MT, BB, AB, OL), Stockholm, Sweden; and Department of Pathology, Regina Elena Cancer Institute (AB), Rome, Italy the presence of SYT/SSX transcripts in two cases Synovial sarcoma (SS) is a rare soft-tissue tumor using the proposed RT-PCR approach. Applications that affects children and young adults. It is charac- of optimized RT-PCR can contribute to reduce false- terized by the chromosomal translocation t(X; negative SYT/SSX SS cases reported in literature. 18)(p11.2;q11.2), which results in the fusion of the SYT gene on chromosome 18 with a SSX gene on KEY WORDS: RT-PCR, Synovial sarcoma, SYT/SSX chromosome X. In the majority of cases, SYT is fusion gene, SYT/SSX variants. fused to exon 5 of SSX1 (64%), SSX2 (36%), or, Mod Pathol 2002;15(6):679–685 rarely, SSX4. A novel fusion transcript variant deriv- ing from the fusion of SYT to exon 6 of SSX4 gene Synovial sarcomas (SS) account for 7 to 10% of all (SYT/SSX4v) was found coexpressed in one of the human soft-tissue sarcomas and are mainly located previously reported SYT/SSX4 cases. In the present in the extremities in the vicinity of large joints (1). investigation, we describe a new SS case that was Depending on histomorphological appearance, SSs previously shown to be negative for SYT/SSX1 and are usually subdivided into two major forms, bipha- SYT/SSX2 expression by conventional reverse tran- sic and monophasic.
  • HSF1 Polyclonal Antibody Catalog # AP70419

    HSF1 Polyclonal Antibody Catalog # AP70419

    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 HSF1 Polyclonal Antibody Catalog # AP70419 Specification HSF1 Polyclonal Antibody - Product Information Application WB Primary Accession Q00613 Reactivity Human, Mouse Host Rabbit Clonality Polyclonal HSF1 Polyclonal Antibody - Additional Information Gene ID 3297 Other Names HSF1; HSTF1; Heat shock factor protein 1; HSF 1; Heat shock transcription factor 1; HSTF 1 Dilution WB~~Western Blot: 1/500 - 1/2000. Immunohistochemistry: 1/100 - 1/300. HSF1 Polyclonal Antibody - Background Immunofluorescence: 1/200 - 1/1000. ELISA: 1/10000. Not yet tested in other Function as a stress-inducible and applications. DNA-binding transcription factor that plays a central role in the transcriptional activation of Format the heat shock response (HSR), leading to the Liquid in PBS containing 50% glycerol, 0.5% expression of a large class of molecular BSA and 0.02% sodium azide. chaperones heat shock proteins (HSPs) that protect cells from cellular insults' damage Storage Conditions -20℃ (PubMed:1871105, PubMed:11447121, PubMed:1986252, PubMed:7760831, PubMed:7623826, PubMed:8946918, PubMed:8940068, PubMed:9341107, HSF1 Polyclonal Antibody - Protein Information PubMed:9121459, PubMed:9727490, PubMed:9499401, PubMed:9535852, Name HSF1 (HGNC:5224) PubMed:12659875, PubMed:12917326, PubMed:15016915, PubMed:25963659, Synonyms HSTF1 PubMed:26754925). In unstressed cells, is present in a HSP90-containing multichaperone Function complex that maintains it in a non-DNA-binding Functions
  • A Novel FISH Assay for SS18–SSX Fusion Type in Synovial Sarcoma

    A Novel FISH Assay for SS18–SSX Fusion Type in Synovial Sarcoma

    Laboratory Investigation (2004) 84, 1185–1192 & 2004 USCAP, Inc All rights reserved 0023-6837/04 $30.00 www.laboratoryinvestigation.org A novel FISH assay for SS18–SSX fusion type in synovial sarcoma Cecilia Surace1,2, Ioannis Panagopoulos1, Eva Pa˚lsson1, Mariano Rocchi2, Nils Mandahl1 and Fredrik Mertens1 1Department of Clinical Genetics, Lund University Hospital, Lund, Sweden and 2DAPEG, Section of Genetics, University of Bari, Bari, Italy Synovial sarcoma is a morphologically, clinically and genetically distinct entity that accounts for 5–10% of all soft tissue sarcomas. The t(X;18)(p11.2;q11.2) is the cytogenetic hallmark of synovial sarcoma and is present in more than 90% of the cases. It produces three types of fusion gene formed in part by SS18 from chromosome 18 and by SSX1, SSX2 or, rarely, SSX4 from the X chromosome. The SS18–SSX fusions do not seem to occur in other tumor types, and it has been shown that in synovial sarcoma a clear correlation exists between the type of fusion gene and histologic subtype and, more importantly, clinical outcome. Previous analyses regarding the type of fusion genes have been based on PCR amplification of the fusion transcript, requiring access to good- quality RNA. In order to obtain an alternative tool to diagnose and follow this malignancy, we developed a fluorescence in situ hybridization (FISH) assay that could distinguish between the two most common fusion genes, that is, SS18–SSX1 and SS18–SSX2. The specificity of the selected bacterial artificial chromosome clones used in the detection of these fusion genes, as well as the sensitivity of the analysis in metaphase and interphase cells, was examined in a series of 28 synovial sarcoma samples with known fusion gene status.
  • Gene Section Review

    Gene Section Review

    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review SSX2 (Synovial Sarcoma, X breakpoint 2) Josiane Eid, Christina Garcia, Andrea Frump Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232, USA (JE, CG, AF) Published in Atlas Database: April 2008 Online updated version: http://AtlasGeneticsOncology.org/Genes/SSX2ID42406chXp11.html DOI: 10.4267/2042/44431 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology detected in liver, testis, skin melanoma, endometrium, Identity choriocarcinoma, placenta, spleen of Hodgkins Other names: CT5.2; HD21; HOM-MEL-40; lymphoma. MGC119055; MGC15364; MGC3884; RP11-552J9.2; SSX; SSX2A; SSX2B Protein HGNC (Hugo): SSX2 Location: Xp11.22 Description So far, two SSX2 protein isoforms (a and b) are known DNA/RNA to exist. Their mRNAs correspond to SV1 (1466 bases) and SV3 (1322 bases) splice variants, respectively. The Description start codon for both isoforms is located in Exon 2. The SSX2 gene locus encompasses 9 exons and 10,304 SSX2 isoform a is 233 amino acids (26.5 kD) and bp (Xp11; 52,752,974-52,742,671). SSX2 isoform b 188 amino acids (21.6 kD). Of both isoforms, SSX2 isoform b is the most commonly seen Transcription and so far the best studied. The SSX2 gene is transcribed on the minus strand. 7 SSX2 mRNA splice variants (SV1-SV7) have been SSX2 Locus and mRNA Splice Variants. Note: Exons are drawn to scale. Atlas Genet Cytogenet Oncol Haematol.
  • HSF1 Antibody (N-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap14189a

    HSF1 Antibody (N-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap14189a

    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 HSF1 Antibody (N-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP14189a Specification HSF1 Antibody (N-term) - Product Information Application WB, IHC-P,E Primary Accession Q00613 Other Accession P41154, P38532, Q08DJ8, NP_005517.1 Reactivity Human Predicted Bovine, Mouse, Xenopus Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 57260 Antigen Region 72-100 Western blot analysis of HSF1 (arrow) using HSF1 Antibody (N-term) - Additional Information rabbit polyclonal HSF1 Antibody (N-term) (Cat. #AP14189a). 293 cell lysates (2 ug/lane) either nontransfected (Lane 1) or Gene ID 3297 transiently transfected (Lane 2) with the HSF1 gene. Other Names Heat shock factor protein 1, HSF 1, Heat shock transcription factor 1, HSTF 1, HSF1, HSTF1 Target/Specificity This HSF1 antibody is generated from rabbits immunized with a KLH conjugated synthetic peptide between 72-100 amino acids from the N-terminal region of human HSF1. Dilution WB~~1:1000 IHC-P~~1:10~50 Format Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A HSF1 Antibody (N-term) column, followed by peptide affinity (AP14189a)immunohistochemistry analysis in purification. formalin fixed and paraffin embedded human kidney carcinoma followed by peroxidase Storage conjugation of the secondary antibody and Maintain refrigerated at 2-8°C for up to 2 DAB staining.This data demonstrates the use weeks. For long term storage store at -20°C of HSF1 Antibody (N-term) for in small aliquots to prevent freeze-thaw immunohistochemistry.
  • (SS18L1) (NM 198935) Human Tagged ORF Clone Product Data

    (SS18L1) (NM 198935) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC212373 SYT homolog 1 (SS18L1) (NM_198935) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SYT homolog 1 (SS18L1) (NM_198935) Human Tagged ORF Clone Tag: Myc-DDK Symbol: SS18L1 Synonyms: CREST; LP2261 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC212373 representing NM_198935 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCGTGGCCTTCGCGTCTGCCCGGCCAAGAGGCAAAGGGGAGGTTACGCAGCAAACCATCCAGAAGA TGCTGGACGAGAACCACCACCTGATCCAGTGCATCCTGGAGTACCAGAGCAAGGGCAAGACGGCCGAGTG CACGCAGTACCAGCAGATCCTGCACCGGAACCTGGTATACCTGGCCACGATCGCAGACTCCAACCAGAAC ATGCAGTCCCTGCTTCCTGCCCCGCCCACGCAGAACATGAACCTGGGCCCTGGAGCCCTGACTCAGAGCG GCTCCAGCCAGGGCCTGCACTCTCAGGGCAGCCTGAGTGACGCCATCAGCACGGGCCTGCCACCCTCCTC CCTCCTGCAGGGCCAGATTGGCAACGGGCCGAGCCACGTGTCCATGCAGCAGACGGCGCCTAACACGCTG CCCACCACCTCCATGAGCATCTCTGGGCCCGGCTACAGCCACGCGGGACCCGCCTCGCAGGGCGTCCCCA TGCAGGGGCAAGGCACCATCGGCAACTACGTGTCTCGGACCAACATCAACATGCAGTCCAACCCAGTCTC CATGATACAGCAGCAGGCGGCCACGTCGCACTACAGCTCGGCGCAGGGCGGCAGCCAGCACTACCAGGGC CAGTCGTCCATCGCCATGATGGGGCAGGGCAGCCAGGGGAGCAGCATGATGGGGCAGCGGCCCATGGCGC CCTACCGGCCCTCCCAGCAAGGCTCTTCCCAGCAGTACCTGGGCCAGGAGGAGTACTATGGCGAGCAGTA CAGCCACAGCCAGGGCGCCGCGGAGCCCATGGGCCAGCAGTACTACCCCGACGGCCATGGCGATTACGCC
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
  • Li Et Al. 1 Genetic Interactions Between Mediator and the Late G1

    Li Et Al. 1 Genetic Interactions Between Mediator and the Late G1

    Genetics: Published Articles Ahead of Print, published on July 5, 2005 as 10.1534/genetics.105.043893 Li et al. Genetic interactions between mediator and the late G1-specific transcription factor Swi6 in Saccharomyces cerevisiae. Lihong Li* Tina Quinton*1 Shawna Miles* Linda L. Breeden*2 *Division of Basic Sciences Fred Hutchinson Cancer Research Center Seattle, WA 98109-1024 1Present address: Christensen, O’Connor, Johnson, KindnessPLLC, Seattle, WA 98101 1 Li et al. Running head: Interactions between Swi6 and mediator Key words: Swi6, mediator, transcription, G1, suppressor 2Corresponding author: Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N. Mail stop A2-168, Seattle, WA 98109-1024 telephone (206) 667 4484, fax (206) 667 6526, Email [email protected] 2 Li et al. ABSTRACT Swi6 associates with Swi4 to activate HO and many other late G1-specific transcripts in budding yeast. Genetic screens for suppressors of SWI6 mutants have been carried out. 112 of these mutants have been identified and most fall into seven complementation groups. Six of these genes have been cloned and identified and they all encode subunits of the mediator complex. These mutants restore transcription to the HO-lacZ reporter in the absence of Swi6 and have variable effects on other Swi6 target genes. Deletions of other non- essential mediator components have been tested directly for suppression of, or genetic interaction with swi6. Mutations in half of the known subunits of mediator show suppression and/or growth defects in combination with swi6. These phenotypes are highly variable and do not identify a specific module of the mediator as critical for repression in the absence of Swi6.
  • SSX4 Antibody Cat

    SSX4 Antibody Cat

    SSX4 Antibody Cat. No.: 56-923 SSX4 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human This SSX4 antibody is generated from rabbits immunized with a KLH conjugated synthetic IMMUNOGEN: peptide between 63-91 amino acids from the Central region of human SSX4. TESTED APPLICATIONS: WB APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 22 kDa WEIGHT: Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 25, 2021 1 https://www.prosci-inc.com/ssx4-antibody-56-923.html BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: SSX4 ALTERNATE NAMES: Protein SSX4, Cancer/testis antigen 54, CT54, SSX4, SSX4A ACCESSION NO.: O60224 GENE ID: 548313, 6759 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) BACKGROUND: translocation characteristically found in all synovial sarcomas.