NCS-1 Protein Upregulation Facilitates Chronic Hypoxia- Induced Respiratory Adaptation in Lymnaea Stagnalis

NCS-1 protein upregulation facilitates chronic hypoxia- induced respiratory adaptation in Lymnaea stagnalis

Yi Quan

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Physiology University of Toronto

NCS-1 protein upregulation facilitates chronic hypoxia-induced respiratory adaptation in Lymnaea stagnalis

Yi Quan

Master of Science

Graduate Department of Physiology University of Toronto

2012 Abstract

Chronic hypoxia is a consequence of many common diseases, including sleep apnea and chronic lung disease. As there is no cure for many of these diseases, managing the symptoms of these diseases, including hypoxia is of great clinical importance. Preliminary data from the Feng lab show that the calcium binding protein neuronal calcium sensor-1 (NCS-1) is upregulated in the central nervous system of the freshwater pond snail Lymnaea stagnalis following chronic hypoxia treatment. This upregulation coincides with increased aerial respiratory activity.

Furthermore, knockdown of NCS-1 attenuates hypoxia-induced facilitation of aerial respiration.

Since this aerial respiratory activity is controlled by a respiratory central pattern generator

(rCPG), it is hypothesized that hypoxia-induced upregulation of NCS-1 may regulate rCPG activity. Using intercellular sharp electrode recording, I show that in response to chronic hypoxia treatment, there is increased bursting activity and altered action potential profile in the pacemaker neuron of the rCPG, RPeD1. Knockdown of NCS-1 partially prevents these hypoxia- induced changes. Our findings suggest that NCS-1 upregulation is necessary for chronic hypoxia-induced respiratory adaptation.

Acknowledgments

I would like to thank my supervisor – Dr. Feng – for giving me this opportunity to work in this exciting field, and for all her help, guidance and support during this journey. I would also like to thank my committee members – Dr. Charlton and Dr. Jankov – for all their time, suggestions and attention to my work.

It was a pleasure working alongside other scientists-in-training in Dr. Feng’s lab: Nasrin Nejatbakhsh, Andrew Barszczyk, and Marielle Deurloo. I am grateful to Qing Li for teaching me Western blots. I would also like to thank Tom Lu and Kathy Li for teaching me intracellular recordings, Mila Aleksic for teaching me qPCR, Mike Qiu and Ryan Instrum for their technical assistance. I would especially like to thank Dr. Jeffrey Dason for his generosity, expertise and for giving me the opportunity to work with him. Thanks to Dr. Rene Prashad, for his advice and assistance and Dr. Alex Smith, for his constructive criticisms. I would also like to thank Dr. Sun, for giving me the opportunity to collaborate with him, and his lab members – Dr. Pei Lin and Dr. Ammar Alibrahim, Christine Bae – it was a pleasure working with you. Thank you.

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Tables ...... vii

List of Figures ...... viii

List of Appendices ...... ix

1 Introduction...... 1

1.1 General Overview ...... 1

1.2 Introduction to chronic hypoxia ...... 1

1.2.1 Definition of chronic hypoxia ...... 1

1.2.2 Classification of chronic hypoxia ...... 1

1.2.3 Physiological classification of hypoxia ...... 2

1.2.4 Causes of chronic hypoxia ...... 2

1.3 Effects of Hypoxia in Mammalian Systems ...... 2

1.3.1 Evolutionarily conserved response to hypoxia ...... 2

1.3.2 Changes to ion currents in neurons ...... 6

1.3.2.1 Changes in potassium channels in response to chronic hypoxia ...... 6

1.3.2.2 Chronic hypoxia-induced changes in Ca2+ currents and channels ...... 7

1.3.3 Hypoxia and calcium regulation ...... 7

1.3.4 Calcium binding proteins ...... 8

1.4 Introduction to the Neuronal Calcium Sensor (NCS) Family ...... 9

1.4.1 Discovery of NCS-1 ...... 11

1.4.2 Structure ...... 14

1.4.3 Expression of NCS-1 ...... 17

1.4.4 Function: Regulation of basal synaptic transmission and short-term plasticity by NCS-1 ...... 17

1.4.4.1 NCS-1 and Ca2+ channels ...... 18

1.4.4.2 NCS-1 and PI4Kβ ...... 19

1.4.5 Function: Regulation of K+ channels ...... 21

1.4.6 Function: Neuroprotection ...... 21

1.4.7 Function: Hypoxia tolerance ...... 22

1.5 Lymnaea stagnalis as an experimental model ...... 22

1.5.1 Lymnaea stagnalis ...... 23

1.5.2 Aerial respiratory behavior and respiratory central pattern generator ...... 23

1.5.3 Hypoxic modulation of rCPG ...... 30

1.5.4 Hypoxia-induced molecular changes...... 30

1.6 Hypotheses ...... 31

1.6.1 Rationale ...... 31

1.6.2 Objectives and Hypotheses ...... 31

1.6.3 Experimental Approach ...... 32

2 Materials and Methods ...... 33

2.1 Animals ...... 33

2.2 Hypoxia treatment ...... 33

2.3 Intracellular recordings of RPeD1 ...... 33

2.3.1 Samples ...... 33

2.3.2 Semi-intact preparations ...... 34

2.3.3 Electrophysiological recording ...... 34

2.3.4 Parameters assessed ...... 35

2.4 In vivo RNAi gene silencing ...... 40

2.4.1 siRNA Synthesis ...... 40

2.4.2 Delivery of siRNA ...... 42

2.5 Real-time quantitative polymerase chain reaction (qPCR) ...... 42

2.5.1 Sample Preparation ...... 42

2.5.2 RNA Extraction and cDNA synthesis ...... 42

2.5.3 Real-time quantitative polymerase chain reaction (qPCR)...... 42

2.6 Statistical Analysis ...... 45

3 Results ...... 46 v

3.1 Hypoxia-induced changes in RPeD1 activity ...... 46

3.1.1 Basal Membrane Properties are not altered by chronic hypoxia ...... 47

3.1.2 Increased firing frequency and bursting activity of RPeD1 following chronic hypoxia ...... 50

3.1.3 Altered action potential profile following chronic hypoxia...... 53

3.2 Contribution of NCS-1 to hypoxia-induced changes ...... 56

3.2.1 NCS-1 knockdown does not affect basal membrane properties ...... 57

3.2.2 NCS-1 knockdown affects RPeD1 bursting activity...... 60

3.2.3 NCS-1 knockdown affects action potential profile ...... 63

3.3 Hypoxia-induced upregulation of NCS-1 is dependent on post-translational modifications ...... 67

4 Discussion ...... 70

4.1 Summary of Data ...... 70

4.2 Hypoxia-induced changes in neuronal networks ...... 70

4.3 NCS-1 regulation of RPeD1 under normoxic conditions ...... 71

4.4 Hypoxia-induced changes in RPeD1 neuron...... 72

4.4.1 No changes in basal membrane properties ...... 72

4.4.2 Increased bursting activity ...... 72

4.4.3 Changes in action potential profile ...... 73

4.5 NCS-1 regulation of RPeD1 under hypoxic conditions ...... 74

4.6 RNAi ...... 75

4.7 Mechanism of NCS-1 upregulation ...... 76

4.8 Future Directions ...... 78

4.9 Importance of Study ...... 78

4.10 Conclusion ...... 78

References ...... 79

List of Tables

Table 1: Proposed functions of NCS proteins ...... 10

Table 2: Primer sequences used for qPCR ...... 41

Table 3: Sequences used for RNAi silencing of NCS-1 ...... 44

Table 4: RPeD1 action potential profile parameters ...... 66

vii

List of Figures

Figure 1: HIF signaling pathway ...... 4

Figure 2: Sequence comparison of the NCS-1/frequenin proteins from yeast to humans ...... 12

Figure 3: The structure and Ca2+ binding properties of NCS-1 ...... 15

Figure 4: The respiratory central pattern generator of Lymnaea stagnalis ...... 25

Figure 5: Ion currents responsible for RPeD1 bursting activity ...... 28

Figure 6: Protocol for intracellular recordings ...... 36

Figure 7: Semi-intact preparations...... 38

Figure 8: Chronic hypoxia treatment does not alter the resting membrane potential or input ...... 48

Figure 9: Chronic hypoxia increases bursting activity in RPeD1 ...... 51

Figure 10: Chronic hypoxia alters the profile of RPeD1 action potentials: ...... 54

Figure 11: NCS-1 siRNA does not alter resting membrane potential or input resistance of ...... 58

Figure 12: NCS-1 knockdown prevents hypoxia-induced increase in RPeD1 bursting activity ...... 61

Figure 13: NCS-1 siRNA attenuates hypoxia-induced changes in half-width duration and decay time of RPeD1 action potentials ...... 64

Figure 14: NCS-1 mRNA levels are not changed after four days of hypoxia treatment ...... 68

Figure 15: Effect of NCS-1 siRNA on NCS-1 protein expression ...... 93

Figure 16: Survival rate of flies are indifferent under normal physiological conditions ...... 102

Figure 17: frq nulls show impaired tolerance to hypoxia ...... 105

Figure 18: Overexpression of frq or Hsp70 does not alter hypoxia tolerance ...... 107

Figure 19: Frq nulls, Hsp70 nulls and Frq/Hsp70 double nulls show impaired tolerance to heat stress ...... 110

Figure 20: fwd null (PI4KIIIβ) mutants have reduced survival and tolerance to heat shock ...... 113

viii

List of Appendices

Appendices ...... 93

5 Drosophila melanogaster as an experimental model ...... 95

5.1 Genetic Model ...... 95

5.1.1 GAL4/UAS system ...... 95

5.1.2 FLP/FRT recombination...... 95

5.2 Molecular Model ...... 96

5.3 Model of Hypoxia-Tolerance ...... 96

5.4 Hypothesis/Rationale ...... 97

5.4.1 Rationale ...... 97

5.4.2 Objectives and Hypotheses ...... 97

6 Materials and Methods ...... 98

6.1 Fly stocks ...... 98

6.2 Hypoxia Assay ...... 98

6.2.1 Flies ...... 98

6.2.2 Hypoxia Assay ...... 98

6.2.3 Paralysis ...... 99

6.2.4 Survival ...... 99

6.3 Heat Assay ...... 99

6.3.1 Flies ...... 99

6.3.2 Heat Assay ...... 99

6.3.3 Survival ...... 99

6.3.4 Paralysis ...... 99

6.4 Statistical Analysis ...... 100

7 Results ...... 100

7.1 Developing Hypoxia Assay...... 100

7.2 Developing Heat Assay ...... 100

7.3 Frequenin knockout flies do not show reduced survival under normal conditions ...... 101

7.4 Frequenin knockout flies show reduced survival and faster paralysis after hypoxia ...... 104

7.5 Frequenin knockout flies show reduced survival and faster paralysis after heat shock...... 109

7.6 fwd null mutants have reduced survival and tolerance to heat shock ...... 112

8 Discussion ...... 115

8.1 Summary of Data ...... 115

8.2 Frequenin and stress tolerance ...... 115

8.3 Hsp70 and stress tolerance ...... 115

8.4 PI4K and heat tolerance ...... 116

References ...... 117

x 1

1 Introduction 1.1 General Overview

Chronic hypoxia is a consequence of many clinical diseases that impair respiration or blood flow, such as asthma, chronic obstructive pulmonary disease (COPD), obstructive sleep disorder, cardiac arrest, brain tumor, vascular occlusion and stroke (Pena and Ramirez, 2005). The adult mammalian central nervous system is not well equipped to survive under chronic oxygen deprivation. In contrast, many lower vertebrates, such as fish, amphibians and reptiles, as well as invertebrates, such as snails, have evolved mechanisms for tolerating long periods of oxygen deprivation (Bickler and Buck, 2007; Wijsman et al., 1985). Understanding such mechanisms would greatly enhance our knowledge of ways to manage hypoxia-induced cellular changes. In this study, using the hypoxia-tolerant freshwater pond snail Lymnaea stagnalis as a model, I explore how an evolutionarily conserved calcium binding protein, named neuronal-calcium sensor-1 (NCS-1) may play a role in regulating pacemaker neurons in response to chronic hypoxia condition, and thus facilitate the adaptation of snails to chronic hypoxia.

1.2 Introduction to chronic hypoxia

1.2.1 Definition of chronic hypoxia

Hypoxia is defined as a decrease in tissue oxygen supply below normal levels (Pierson, 2000). In contrast to acute hypoxia, which lasts from minutes to hours (Azad and Haddad, 2009), chronic hypoxia lasts from hours to months. Hypoxia is closely related to anoxia, which is a complete lack of oxygen in the tissues (Sharp and Bernaudin, 2004).

1.2.2 Classification of chronic hypoxia

Chronic hypoxia can be classified as constant or intermittent. In intermittent hypoxia, periods of hypoxia are interspersed among periods of normoxia. Chronic constant hypoxia (CCH) and chronic intermittent hypoxia (CIH) arise from different physiological stimuli and evoke different genomic and physiological responses. This thesis focuses on the effects of CCH. CCH affects all body regions. In particular, when there is a reduced oxygen supply to the brain, there is cerebral hypoxia (Azad and Haddad, 2009). Prolonged oxygen deprivation to neurons result in cell death and irreversible brain injury.

1.2.3 Physiological classification of hypoxia

Four types of hypoxia are recognized. Hypoxic hypoxia is characterized by a decrease in the amount of inspired oxygen. This usually occurs with hypoventilation or when the ambient oxygen tension is low (e.g., high altitude). Anemic hypoxia occurs when there is a decrease in the amount of hemoglobin available for oxygen binding; this could occur as a result of blood loss, reduced red cell production, genetic defects of carbon monoxide poisoning. Stagnant hypoxia refers to low blood flow to due vasoconstriction of blood vessels or reduced cardiac output. Histotoxic hypoxia occurs as a result of poisoning of oxidative enzymes, for example with cyanide (Sharp and Bernaudin, 2004).

1.2.4 Causes of chronic hypoxia

Hypoxia can occur under normal physiological conditions, such as ascent to high altitude, or during pathophysiological conditions. Most commonly, chronic hypoxia is the result of respiratory dysfunction or insufficient blood flow. Respiratory diseases that lead to chronic hypoxia include chronic obstructive pulmonary diseases (COPD), asthma and obstructive sleep apnea. Diseases such as cerebrovascular hemorrhage, brain tumor, vascular occlusion and cardiac arrest which impair blood circulation, also lead to chronic tissue hypoxia (Pena and Ramirez, 2005). To date, there are no defined curative strategies for many of these diseases. As such, managing the symptoms of such diseases, such as tissue hypoxia is of great clinical significance. Although much is known about the effects of hypoxia, there are limited therapeutic approaches that are effective against its deleterious effects. Thus further research is warranted to better understand the effects of hypoxia in order to develop clinically relevant treatment protocols.

1.3 Effects of Hypoxia in Mammalian Systems

1.3.1 Evolutionarily conserved response to hypoxia

Much of the molecular changes observed in chronic hypoxia results from activation of the transcription factor hypoxia-inducible factor-1 (HIF-1), a protein that is evolutionarily conserved from yeast to mammals (Semenza, 2001). HIF-1 is a dimer comprised of HIF-1α and HIF-1β, both of which contain basic helix-loop-helix PAS domains that mediate DNA binding (Jiang et al., 1996). HIF-1β is constitutively expressed and its expression level is not regulated by oxygen

concentration (Wang et al., 1995, Wood et al., 1996). HIF-1α is also constitutively expressed, but is constantly degraded under normoxic conditions (Metzen, 2003). It contains an oxygen- dependent degradation domain (ODD), which when hydroxylated by prolyl-4-hydroxylases in the presence of oxygen, targets the protein for degradation (Huang et al., 1998). Hydroxylation of proline residues 402 and 564 in the ODD changes the conformation of HIF-1α, allowing it to bind to von Hippel Lindau (VHL) protein, which together with other cofactors, acts as an E2 ubiquitin ligase, and targets HIF-1α for proteasomal degradation (Hon et al., 2002; Jaakkola et al., 2001; Masson et al., 2001; Min et al., 2002; Mole et al., 2001; Sharp and Bernaudin 2004). Under hypoxic conditions, prolyl-hydroxylation is prohibited, decreasing the degradation of HIF- 1α by the ubiquitin-proteasome system, thus leading to accumulation of HIF-1α (Jaakkola et al., 2001, Maxwell et al., 1999). HIF-1α dimerizes with HIF-1β, forming the HIF-1 dimer, which can then bind to hypoxia-response elements (HREs) in HIF target genes, stimulating their transcription (Ratcliffe et al., 1998; Semenza, 2001). HIF-1 targets many genes involved in vasomotor control (Cormier-Regard et al., 1998; Eckhart et al.; 1997; Hu et al., 1998; Palmer et al., 1998;), angiogenesis (Forsythe et al., 1996; Gerber et al., 1997), erythropoiesis (Wang and Semenza, 1993) and energy metabolism (Ebert et al., 1995; Iyer et al., 1998; Semenza et al., 1994; Takahashi et al., 2000) which promote survival under hypoxic conditions. Furthermore, recent studies have shown that the HIF-1 transcription factor is also necessary for the induction of heat shock proteins, such as heat shock protein 70 (Hsp70) under hypoxic conditions (Baird et al., 2006; Chang et al., 2009; Huang et al., 2009; Xia et al., 2009; Yeh et al., 2010). Upregulation of these chaperones prevent protein misfolding and aggregation, which are potent triggers of cell death. However, HIF-1 activity also promotes the transcription of proapoptotic proteins, such as NIP3 (nineteen kD interacting protein-3), a member of the Bcl2 (B-cell lymphoma 2) proapoptotic family (Bruick, 2000; Sowter et al., 2001; Figure 1).

Figure 1

Figure 1. HIF-1 signaling pathway

In the presence of oxygen (O2), prolyl hydroxylase post-translationally modifies HIF-1α, allowing it to interact with the von Hippel-Lindau (VHL) complex. VHL is part of a larger complex that includes elongin-B, elongin-C, CUL2, RBX1 and an ubiquitin-conjugating enzyme (E2). This complex, together with an ubiquitin-activating enzyme (E1), mediates the ubiquitylation (Ub) of HIF-1α. Ubiquitylated HIF-1α is targeted for degradation by the 26s proteasome. Under hypoxic conditions, HIF-1α cannot be hydroxylated, and thus is translocated to the nucleus, where it dimerizes with HIF-1β, and together with the coactivator P300/CBP, leads to the transcription of genes containing the hypoxia-response element (Baird et al., 2006; Bruick, 2000; Carroll and Ashcroft, 2005; Harris, 2002; Sowter et al., 2001).

1.3.2 Changes to ion currents in neurons

At the onset of hypoxia, there is initial transient hyperpolarization due to opening of adenosine + triphosphate (ATP) -sensitive potassium channels (KATP) and calcium-activated potassium (K ) channels (Erdemli et al., 1998; Silver and Erecinska, 1990) in hippocampal and dorsal vagal neurons (Trapp and Ballanyi, 1995). Sustained hypoxia (<1 hr) or anoxia however leads to depolarization in hippocampal and hypoglossal neurons, (Haddad and Donnelly, 1990; Raley- Susman et al., 2001), which is the result of changes in potassium (K+), sodium (Na+) and calcium (Ca2+) fluxes (Shimoda and Polak, 2011). The voltage-gated potassium channel 2.1

(KV2.1), important for regulating action potential frequency and general cell excitability in neurons (Ikematsu et al., 2011; Trimmer, 1991), shows increased activity following ischemic or metabolic stress, leading to cell hyperpolarization (Ikematsu et al., 2011; Misonou et al., 2005). There is increased Na+ influx, which contributes to hypoxia-induced depolarization in rat hippocampal slices (Muller and Somjen, 2000; Raley-Susman et al., 2001). This increase is in part due to reduced activity of Na+/K+ ATPase as a result of lowered ATP levels (Raley-Susman et al., 2001) and through voltage-gated Na+ channels (Raley-Susman et al., 2001). Na+ influx may also occur through nonselective cation channels (NSCCs) (Sheldon et al., 2004).

The effect of chronic hypoxia (hours to days) on ion currents in neurons is less well known (Pena and Ramirez, 2005). Currently, the only studies on the effect of chronic hypoxia on ion currents are in PC12 cells. Two channels, a Ca2+-dependent K+ channel and the L-type voltage gated Ca2+ channel have been shown to be involved in chronic hypoxia.

1.3.2.1 Changes in potassium channels in response to chronic hypoxia

Ca2+-dependent K+ channels (BK) are found in the carotid bodies (Peers, 1990; Riesco-Fagundo et al., 2001) and neurons (Jiang and Haddad, 1994). They are activated by changes in membrane potential and increases in intracellular Ca2+ ions. Opening of BK channels allow large efflux of K+ through the channel, resulting in cell membrane hyperpolarization and a decrease in cell excitability. This channel contains a pore-forming α-subunit which is stably expressed together with the auxiliary β-subunit. Acute hypoxia inhibited the activity of these channels, partially via a shift in Ca2+ sensitivity, with no changes in voltage sensing properties (Lewis et al., 2002). In response to chronic hypoxia, current densities were increased over a wide range of intracellular Ca2+ levels. The altered activity is mediated through β-subunits (Hartness et al., 2003). Western

blotting showed a significant increase in protein level of β-subunit following chronic hypoxia (Hartness et al., 2003). Immunocytochemical studies suggest an increased association of β- subunit with the α-subunit in the plasma membrane (Hartness et al., 2003); in cells that express solely the α-subunit, chronic hypoxia had no effects on the current densities of the BK channel. Furthermore, chronic hypoxia does not change the α- or β-subunit mRNA expression of BK channels (Peers and Kemp, 2004).

1.3.2.2 Chronic hypoxia-induced changes in Ca2+ currents and channels

2+ L-type Ca channels (CaV1.1-1.4) are the most widely distributed sub-family of voltage-gated Ca2+ channels, and play key roles in gene expression, contractility and exocytosis (Dolphin, 1999). They are present in the carotid bodies (Buckler and Vaughan-Jones, 1994), and throughout the nervous system (Hell et al., 1993; Lipscombe et al., 2004). In PC12 cells, reducing O2 concentration to between 2.5 and 10% for 12-48 hours caused dramatic enhancement of secretory response that was fully dependent on Ca2+ influx. Upregulation of L- type Ca2+ channels is the major cause of increased Ca2+ currents. There is also formation of Ca2+ permeable channels formed from amyloid β-peptides (AβPs) which are the primary components responsible for the pathogenesis of Alzheimer’s disease (Taylor et al., 1999). Chronic hypoxia has also been shown to induce the upregulation of T-type voltage gated Ca2+ channels in rat PC12 cells (del Toro et al., 2003).

1.3.3 Hypoxia and calcium regulation

Ca2+ is a ubiquitous signaling molecule and plays an essential part in many cellular processes, including metabolism, growth, differentiation, hormonal secretion, gene expression, protein synthesis, neurite outgrowth and retraction, intracellular signaling and apoptosis. As such, Ca2+ concentration is tightly regulated. At rest, cells have about 10-100 nM of free Ca2+, whereas in the extracellular space, the Ca2+ concentration can be 10 000 times higher (about 10-3 M). During hypoxia, there is elevated intracellular Ca2+ level in hippocampal neurons (Diarra et al., 1999; Tjong et al., 2007). This is mainly through high-voltage (L- or N-type) voltage-gated Ca2+ channels (Lukyanetz et al., 2003; Tjong et al., 2007; Yao and Haddad, 2004) and Ca2+ permeable nonselective cation channels (Chao and Xia, 2010). In response to chronic hypoxia treatment, there is increased current density through L-type Ca2+ channels (Peers and Kemp, 2004), and upregulation of T-type voltage gated Ca2+ channels (Del Toro et al., 2003). During the post-

ischemic reoxygenation period, Ca2+ overload in the cytosol is one of the main reasons responsible for ischemic reperfusion injury (Kutala et al., 2007). The elevated free Ca2+ level in the cytosol initiates cell death signaling pathways and reactive oxygen species generation that lead to neuronal apoptosis (Broughton et al., 2009).

Three mechanisms exist to maintain low intracellular Ca2+ levels. Ca2+-ATPase pumps at the cell membrane continually pump Ca2+ out of the cytosol against its concentration gradient. In the cytosol, the endoplasmic reticulum (ER) and mitochondria sequester Ca2+ in order to decrease the free Ca2+ concentration in the cytosol. Lastly, calcium binding proteins are able to rapidly bind to excess free Ca2+ in the cytosol, and thus play an important role in regulating Ca2+ ion dynamics (Berridge et al., 2003).

1.3.4 Calcium binding proteins

Calcium binding proteins can be categorized into two groups based on their Ca2+ binding motif. About 250 calcium binding proteins contain EF-hand domains - a conserved Ca2+ binding structure composed of 30-35 amino acids. Each EF-hand domain contains a 12 residue Ca2+ binding loop that is flanked by N and C terminal α-helices which are differentially exposed in the presence of Ca2+ (Gariepy and Hodges, 1983; Kretsinger and Nockolds, 1973; Yap et al., 1999). The other calcium binding proteins, such as synaptotagmin and members of the protein kinase C (PKC) family, contain C2-domains (Nalefski and Falke, 1996; Rizo and Sudhof, 1998). C2-domain containing proteins will not be discussed further as they are not the focus of this thesis.

Functionally, calcium binding proteins can be categorized as buffers or sensors (Ikura, 1996). Ca2+ buffers do not undergo Ca2+-dependent conformational changes have slow kinetics and bind Ca2+ with high affinity and capacity (Ikura, 1996; Skelton et al., 1994). As such, they function to buffer or modulate intracellular Ca2+ levels. Calcium sensors, on the other hand, bind Ca2+ at relatively lower affinities and undergo significant conformational changes after Ca2+ binding that render them capable of interacting with downstream target proteins (Chin and Means, 2000; Ikura, 1996; Skelton et al., 1994). Based on their calcium binding affinity, their Ca2+ dependent conformational shift and ability to interact with target proteins, members of the neuronal calcium

sensor (NCS) family of EF-hand calcium binding proteins have been categorized as Ca2+-sensing proteins (Burgoyne and Weiss 2001, Bajec 2002).

1.4 Introduction to the Neuronal Calcium Sensor (NCS) Family

The NCS family of Ca2+ sensors contain over 40 proteins, and have been implicated in a number of Ca2+ dependent pathways, including synaptic transmission, regulation of ion channels and receptors, learning and memory and synapse formation (Burgoyne and Weiss, 2001; Dason et al., 2012; Table 1). They are grouped into five classes based on phylogenetic relationships and the degree of homology between the proteins (Burgoyne and Weiss, 2001). In mammals, there are 14 NCS genes that encode a single class A protein (neuronal calcium sensor-1), five class B proteins (hippocalcin, neurocalcin, visinin-like protein 1, 2, 3), a single class C protein (recoverin), three class D proteins (guanylate cyclase-activating protein 1, 2, 3) and four class E proteins (potassium channel interacting protein 1, 2, 3, 4) (Burgoyne, 2007; Table 1). The primordial member of the NCS family is frequenin (Burgoyne and Weiss, 2001). The mammalian homologue is known as neuronal calcium sensor-1 (NCS-1).

Table 1. Proposed Function of NCS Proteins (Adapted from Burgoyne and Weiss, 2001)

Class Protein Functions Regulation of neurotransmission, exocytosis, learning, short-term neuronal calcium synaptic plasticity, Ca2+ channels, Kv4 channel regulation, A sensor-1 (NCS- phosphoinositide metabolism, dopamine D2 receptor endocytosis, 1)/frequenin GDNF signalling, neuronal growth and survival. Antiapoptotic, AMPA receptor recycling, MAPK signalling, Hippocalcin learning, spatial and associative memory, LTD, and slow afterhyperpolarization currents

Neurocalcin Guanylyl cyclase activation, synaptic plasticity of Purkinje cells

Visinin-like Protein Guanylyl cyclase activation and recycling, traffic of nicotinic B 1 (VILIP1) receptors, increase of cAMP levels and secretion

VILIP2 Regulation of P/Q type Ca2+ channels

VILIP3 unknown

C Recoverin Light adaptation by inhibition of rhodopsin kinase

Guanylyl cyclase- D activating proteins Regulates retinal guanylyl cyclases (GCAP1-3)

Potassium channel- interacting Regulation of Kv4 and Kv1.5 channels, repression of transcription. Proteins (KChIP1)

E Regulation of Kv4 channels, presenilin and amyloid precursor KChIP2 protein processing, repression of transcription, pro-apoptotic, regulation of ER Ca2+ Regulation of Kv4 channels, presenilin-processing, repression of KChIP3 transcription

1.4.1 Discovery of NCS-1

NCS-1 was first discovered in Drosophila melanogaster, in a screen for hyper-excitability mutants (Mallart et al, 1991). The mutants resulted from an X-ray induced T(X;V)V7 rearrangement near the Shaker gene which upregulates the expression of the calcium binding protein, then named frequenin (Pongs et al., 1993). The mutants were so named as they shook their legs vigorously (Tanouye et al., 1980) under the influence of anesthesia. Since then, the frequenin gene has been found in all organisms from yeast to human, and is highly conserved between species (Figure 2). Aside from Drosophila (Romero-Pozuelo et al., 2007) and zebrafish Danio rerio (Blasiole et al., 2005) which contain two copies of the frequenin gene, all other organisms contain only one copy. The two copies of frequenin protein in Drosophila and zebrafish are highly conserved (Blasiole et al., 2005; Romero-Pozuelo et al., 2007). Functionally, the two Drosophila frequenin proteins have similar functions, although their developmental expression profiles differ significantly (Romero-Pozuelo et al., 2007). In zebrafish, NCS-1a is ubiquitously expressed in the nervous system, and is involved in inner ear development; NCS-1b, on the other hand, is only expressed in the olfactory bulb, and its function is currently unknown (Blasiole et al., 2005)

Figure 2

Human MGKSNSKLKP EVVEELTRKT YFTEKEVQQW YKGFIKDCPS GQLDAAGFQK 50 Rat MGKSNSKLKP EVVEELTRKT YFTEKEVQQW YKGFIKDCPS GQLDAAGFQK 50 Mouse MGKSNSKLKP EVVEELTRKT YFTEKEVQQW YKGFIKDCPS GQLDAAGFQK 50 Chicken MGKSNSKLKP EVVEELTRKT YFTEKEVQQW YKGFIKDCPS GQLDAAGFQK 50 Xenopus MGKSNSKLKP EVVEELTRKT YFTEKEVQQW YKGFIKDCPS GQLDATGFQK 50 Drosophila MGKKSSKLKQ DTIDRLTTDT YFTEKEIRQW HKGFLKDCPN GLLTEQGFIK 50 Aplysia MGKRASKLKP EEVEELKQQT YFTEAEIKQW HKGFRKDCPD GKLTLEGFTK 50 L. stagnalis MGKRASKLRP EEVDELKAHT YFTESEIKQW HKGFRKDCPD GKLTLEGFTK 50 C. elegans MGKGNSKLKS SQIRDLAEQT YFTEKEIKQW YKGFVRDCPN GMLTEAGFQK 50 S. cerevisiae MGAKTSKLSK DDLTCLKQST YFDRREIQQW HKGFLRDCPS GQLAREDFVK 50

Human IYKQFFPFGD PTKFATFVFN VFDENKDGRI EFSEFIQALP VTSRGTLDEK 100 Rat IYKQFFPFGD PTKFATFVFN VFDENKDGRI EFSEFIQALS VTSRGTLDEK 100 Mouse IYKQFFPFGD PTKFATFVFN VFDENKDGRI EFSEFIQALS VTSRGTLDEK 100 Chicken IYKQFFPFGD PTKFATFVFN VFDENKDGRI EFSEFIQALS VTSRGTLDEK 100 Xenopus IYKQFFPFGD PTKFATFVFN VFDENKDGRI EFSEFIQALS VTSRGTLDEK 100 Drosophila IYKQFFPQGD PSKFASLVFR VFDENNDGSI EFEEFIRALS VTSKGNLDEK 100 Aplysia IYQQFFPFGD PSKFANFVFN VFDENKDGFI SFGEFLQALS VTSRGTVEEK 100 L. stagnalis IYQQFFPFGD PSKFANFVFN VFDENKDGFI SFSEFLQALS VTSRGTVEEK 100 C. elegans IYKQFFPQGD PSDFASFVFK VFDENKDGAI EFHEFIRALS ITSRGNLDEK 100 S. cerevisiae IYKQFFPFGS PEDFANHLFT VFDKDNNGFI HFEEFITVLS TTSRGTLEEK 100

Human LRWAFKLYDL DNDGYITRNE MLDIVDAIYQ MVGNTVELPE EENTPEKRVD 150 Rat LRWAFKLYDL DNDGYITRNE MLDIVDAIYQ MVGNTVELPE EENTPEKRVD 150 Mouse LRWAFKLYDL DNDGYITRNE MLDIVDAIYQ MVGNTVELPE EENTPEKRVD 150 Chicken LRWAFKLYDL DNDGYITRNE MLDIVDAIYQ MVGNTVELPE EENTPEKRVD 150 Xenopus LRWAFKLYDL DNDGYITRNE MLDIVDAIYQ MVGNTVELPE EENTPEKRVD 150 Drosphila LQWAFRLYDV DNDGYITREE MYNIVDAIYQ MVGQQPQS-E DENTPQKRVD 149 Aplysia LKWAFRLYDL DNDGFITRDE LLDIVDAIYR MVGESVRLPE EENTPEKRVN 150 L. stagnalis LKWAFRLYDL DNDGYITRDE LLDIVDAIYR MVGESVRLPE EENTPEKRVN 150 C elegans LHWAFKLYDL DQDGFITRNE MLSIVDSIYK MVGSSVQLPE EENTPEKRVD 150 S. cerevisiae LSWAFELYDL NHDGYITFDE MLTIVASVYK MMGSMVTLNE DEATPEMRVK 150

Human RIFAMMDKNA DGKLTLQEFQ EGSKADPPIV QALSLYD-GLV- 190 Rat RIFAMMDKNA DGKLTLQEFQ EGSKADPSIV QALSLYD-GLV- 190 Mouse RIFAMMDKNA DGKLTLQEFQ EGSKADPSIV QALSLYD-GLV- 190 Chicken RIFAMMDKNA DGKLTLQEFQ EGSKADPSIV QALSLYD-GLV- 190 Xenopus RIFAMMDKNS DGKLTLQEFQ EGSKADPSIV QALSLYD-GLV- 190 Drosophila KIFDQMDKNH DGKLTLEEFR EGSKADPRIV QALSLGG-G--- 187 Aplysia RIFQVMDKNK DDKLTFDEFL EGSKEDPTII QALTLCDSGQA- 191 L. stagnalis RIFQVMDKNK DDQLTFEEFL EGSKEDPTII QALTLCDSGQA- 191 C. elegans RIFRMMDKNN DAQLTLEEFK EGAKADPSIV HALSLYE-GLSS 191 S. cerevisiae KIFKLMDKNE DGYITLDEFR EGSKVDPSII GALNLYD-GLI- 190

Figure 2. Sequence comparison of NCS-1/frequenin proteins from yeast to humans.

The sequences of NCS-1 from human (AAF01804.1), rat (NP_077342.1), mouse (NP_062655.1), chicken (NP_990708.1), the frog Xenopus (AAC59690.1), the fruit fly Drosophila (AAA28539.1), the marine snail Aplysia (AAB36879.1), L. stagnalis (DQ099793.2) the nematode C. elegans (CCD63971.1) and the yeast S. cerevisiae (EDV07959.1) were aligned. Amino acids underlined are those that differ from the human NCS-1. Amino acids highlighted in red make up the N-terminal myristoylation domain. Amino acids in light blue make up EF-hand domain 1, dark blue EF-hand domain 2, purple EF-hand domain 3 and orange EF-hand domain 4.

1.4.2 Structure

NCS-1/frequenin proteins contain four EF hand motifs, three of which are able to bind to Ca2+ with high affinity (Bourne et al., 2001; Figure 3). Furthermore, NCS-1 has an N-terminal myristoylation domain, which anchors it to the membrane independently of Ca2+ binding (Jeromin et al., 2007; Figure 3). This is in contrast to other NCS proteins, where Ca2+ binding is required for the extrusion of the myristoylation motif, which allows anchoring and localization of NCS-1 proteins to the membrane (O’Callaghan and Burgoyne, 2003). The myristoylation motif in NCS-1 modulates its function by affecting its Ca2+ affinity and its ability to interact with target proteins. Specifically, myristoylation induces a conformational change in NCS-1 structure, allowing it to bind to Ca2+ more strongly than the non-myristoylated NCS-1 (Dason et al., 2012; Jeromin et al., 2004). Myristoylation is also required for the interaction of NCS-1 with its target proteins, such as phosphatidylinositol-4-OH Kinase (PI4K) (de Barry et al., 2006; Sippy et al., 2003). In addition to myristoylation, the N-terminus of NCS-1 is also important for protein- protein interactions (Dason et al., 2012), such as PI4Kβ (Zheng et al., 2005) and dopamine D2 receptors (Kabbani et al., 2002; Lian et al., 2011).

The C-terminal region creates a wide hydrophobic crevice at the surface of frequenin. This crevice is unique to frequenin and has been proposed to accommodate an unidentified protein (Bourne et al., 2001). It is unknown or how many proteins bind to this region, but its functional importance has been delineated with an interfering C-terminal peptide which consists of the last 33 amino acids of NCS-1 (Dason et al., 2009; Hui et al., 2007; Hui and Feng, 2008; Romero- Pozuelo et al., 2007; Tsujimoto et al., 2002). This peptide affects Ca2+ currents signals, suggesting that it may play a role in functionally modulating the activity of Ca2+ channels (Hui et al., 2007).

Figure 3.

N EF1 EF2 EF3 EF4 C

Ca2+ Ca2+ Ca2+

Figure 3. The structure and Ca2+ binding properties of NCS-1.

NCS-1 has an N-terminal myristoylation domain (pink) and four EF hands (EF1-4), the first of which cannot bind Ca2+. An interfering N-terminal peptide (yellow, 27 amino acids) inhibits PIP synthesis. The interfering C-terminal peptide (blue, 33 amino acids) impairs Ca2+ channel function (Modified from Burgoyne and Weiss, 2001; Dason et al., 2012).

1.4.3 Expression of NCS-1

NCS-1 proteins are primarily found in the central nervous system (Chen et al., 2002; Martone et al., 1999; Pongs et al., 1993). In humans, NCS-1 is strongly expressed in the temporal lobe, occipital pole, frontal lobe, thalamus, amygdala and hippocampus (Chen et al., 2002); moderately in the cerebellum, putamen, caudate nucleus and low levels in the medulla, substantia nigra and corpus callosum (Chen et al., 2002). It is also found in the peripheral nervous system at the presynaptic terminals in the neuromuscular junctions of Drosophila (Pongs et al., 1993), crayfish (Jeromin et al., 1999), frogs (Werle et al., 2000) and adult and developing rats (Garcia et al., 2005). Despite its name, NCS-1 expression has also been detected in non-neuronal tissues, including the heart (Guo et al., 2002; Nakamura et al., 2003; Nakamura et al., 2011).

1.4.4 Function: Regulation of basal synaptic transmission and short-term plasticity by NCS-1

Short-term synaptic plasticity is a dynamic change in synaptic strength in response to input patterns on the timescale of milliseconds to minutes. The direction of short-term plasticity (depression or facilitation) correlates with basal synaptic release probability. Synapses with high initial release probability are more likely to show depression, due to depletion of readily available vesicles, and conversely, synapses with an initially low release probability show facilitation (Zucker and Regehr, 2002). Majority of reports suggest that NCS-1 facilitates basal synaptic transmission and results in short-term depression.

In the Drosophila neuromuscular junction, overexpression of either frequenin genes results in enhanced basal levels of neurotransmitter release, and a reduction in paired-pulse ratio (Dason et al., 2009; Romero-Pozuelo et al., 2007). Conversely, frequenin null mutants show decreased neurotransmitter release and increased paired-pulse ratio (Dason et al., 2009). These findings are consistent with those in Xenopus, which show that injection of frequenin into Xenopus embryonic spinal neurons lead to an increase in both spontaneous and evoked neurotransmitter release (Olafsson et al., 1995; Wang et al., 2001). Upregulation of NCS/frequenin by glial cell- line derived neurotrophic factor (GDNF) reduces paired-pulse facilitation in Xenopus nerve- muscle co-cultures by enhancing the amplitude of the first evoked synaptic response (Wang et al., 2001). Furthermore, in the mammalian system, injection of NCS-1 C-terminal peptide into

18 mouse hippocampal slices impairs basal synaptic transmission and enhanced paired-pulse facilitation (Saab, 2010). On the contrary, Sippy et al. (2003) showed that in rat hippocampal cell cultures, increases in NCS-1 protein level switches paired-pulse depression into facilitation without altering basal synaptic transmission or initial neurotransmitter release probability.

In PC12 cells, overexpression of NCS-1 enhances hormone release, suggesting that NCS-1 is a positive regulator of evoked dense-core granule exocytosis (de Barry et al., 2006; Haynes et al., 2005; Haynes et al., 2007; Koizumi et al., 2002; McFerran et al, 1998; McFerran et al., 1999; Rajebhosale et al., 2003; Scalettar et al., 2002; Taverna et al., 2002).

The effect of NCS-1 on synaptic transmission may be mediated through regulation of Ca2+ channels or PI4K.

1.4.4.1 NCS-1 and Ca2+ channels

Although a physical interaction between NCS-1 and Ca2+ channels has yet been found, however, there is evidence suggesting a functional effect of NCS-1 on Ca2+ channels. Several reports show that NCS-1 may facilitate Ca2+ currents. For example, in Xenopus nerve-muscle cultures, GDNF-dependent upregulation of NCS-1 has been shown to enhance synaptic transmission by enhancing N-type Ca2+ channel activation (Wang et al., 2001). Injection of frequenin antibody prevents GDNF’s effects. Similarly, in Drosophila frequenin null mutants, there is impaired Ca2+ influx in response to single action potentials (Dason et al., 2007), suggesting that frequenin enhances Ca2+ channel activity. In Lymnaea stagnalis, reducing NCS-1 levels with siRNA or injection of an interfering NCS-1 C-terminal peptide led to reduced Ca2+ signals in response to single action potential in growth cones of cultured primary neurons (Hui et al., 2007), suggesting that NCS-1 enhances neurotransmitter release by increasing Ca2+ entry through Ca2+ channels. In the Calyx of Held synapse, injecting NCS-1 into nerve terminals caused activity dependent facilitation of P/Q calcium currents, and loading of an interfering C-terminal peptide abolished this facilitation (Tsujimoto et al., 2002).

Studies from neuroendocrine cells suggest that NCS-1 may negatively regulate Ca2+ channels. For example, in bovine adrenal chromaffin cells, injection of a dominant negative form of NCS- 1, where the third EF-hand has been inactivated, increased non-L-type Ca2+ channel currents (Weiss et al., 2000). In PC12 cells, expression of IL1-receptor accessory protein-like 1 gene

(IL1RAPL1) leads to silencing of N-type Ca2+ channels, in a manner dependent on NCS-1 (Gambino et al., 2007). Lastly, in Xenopus oocytes, NCS-1 reduced L, N and P/Q type Ca2+ currents, in a manner dependent on the β-subunit expressed, suggesting that NCS-1 may affect the α-/β-subunit interaction and thus regulate the trafficking of Ca2+ channels (Rousset et al., 2003). The opposing effects of NCS-1 on Ca2+ channels suggest that NCS-1 may have cell specific functions.

1.4.4.2 NCS-1 and PI4Kβ

Phosphatidylinositol 4-kinase β (PI4Kβ) is responsible for the synthesis of phosphatidylinositol 4,5-bisphosphate (PIP2), which is involved in neurosecretory vesicle targeting, exocytosis, endocytosis and ion channel modulation (Osborne et al., 2001). PIP2 also forms an intermediate in the IP3/DAG signaling pathway. When hydrolyzed by phospholipase C (PLC), PIP2 is split into two second messengers, inositol 1, 4, 5-triphosphate (IP3) and diacylglycerol (DAG). DAG remains membrane-bound and activates downstream signaling pathways by activating protein kinase C (PKC). IP3 enters the cytoplasm and activates IP3 receptors on the smooth endoplasmic reticulum (ER), which opens calcium channels, allowing mobilization of Ca2+ into the cytosol (Berridge, 2002).

NCS-1 has been shown to directly interact with the yeast orthologue of PI4K, Pik1, and this is essential for survival in yeast (Hendricks et al., 1999). NCS-1 has also been shown to coimmunoprecipitate with mammalian PI4K from COS-7 cells (Zhao et al., 2001), bovine chromaffin cells (Pan et al., 2002) and rat neuro-secretory cells (Taverna et al., 2002).

NCS-1 is able to increase dense-core vesicle exocytosis through interaction with PI4Kβ (de Barry et al., 2006; Haynes et al., 2005; Haynes et al., 2007; Koizumi et al., 2002; McFerran et al., 1998; McFerran et al., 1999; Rajebhosale et al., 2003; Scalettar et al., 2002; Taverna et al., 2002). The effect of NCS-1 is mediated through PI4Kβ since knockdown of PI4Kβ by RNA interference prevents the stimulatory effect of NCS-1. NCS-1 functions to increase PI4Kβ activity, as evidenced by increased PIP2 levels (Rajebhosale et al., 2003) and may also promote the translocation of PI4Kβ to the membrane (Taverna et al., 2002). The increased PIP2 levels may also function to maintain the activity P/Q and N-type Ca2+ channels, which may also facilitate exocytosis (Wu et al., 2002). Despite the importance of the NCS-1 and PI4Kβ in

20 dense-core vesicle exocytosis, they do not appear to play a role in regulating synaptic vesicle exocytosis. In the Drosophila larval neuromuscular junctions, the effect of NCS-1 on synaptic transmission is not due to modulation of PI4Kβ activity, but through modulation of Ca2+ channel activity (Dason et al., 2009). The putative interaction between frequenin and PI4Kβ was tested directly by measuring quantal release in genotypes that overexpress frequenin 1 in a PI4Kβ-null background. The enhanced quantal release, observed in flies that overexpress the frequenin 1 also occurred when Frq1 was overexpressed in a PI4Kβ-null background, suggesting that Frq- PI4Kβ interaction is not involved in enhancing quantal release at the Drosophila neuromuscular junction (Dason et al., 2009).

1.4.5 Function: Regulation of K+ channels

Studies show that NCS-1 act as a positive regulator of voltage-gated K+ channels. Shal-type + (KV4.x) K channels are mainly expressed in the brain and heart (Birnbaum et al., 2004). They are the primary subunits that contribute to voltage-dependent K+ currents in the nervous system (type A K+ currents) and the heart, and play a role in the repolarization of action potentials

(Poulain et al., 1994). Frequenin has been shown to co-immunoprecipitate with KV4 channel subunits in mouse brain fractions (Nakamura et al., 2001), and in mouse myocardium, NCS-1 co-

immunoprecipitates with KV4.3 (Guo et al., 2002). Overexpression of frequenin in COS cells

results in an increase in KV4 channel surface expression, leading to enhanced current amplitudes. In Xenopus oocytes, frequenin also slows the inactivation time course and accelerates recovery

from inactivation of Kv4 channels (Nakamura et al., 2001).

1.4.6 Function: Neuroprotection

The neuroprotective effects of stress-induced upregulation of NCS-1 have previously been reported. Specifically, after vagal axotomy in adult rats, there is upregulation of NCS-1 protein level in the dorsal motor nucleus of the vagus (DMV) neurons as early as 1 day after axotomy. Other stressors, such as application of colchicines, which disrupt tubulin polymerization and blocks axonal transport, also increased NCS-1 protein levels. Furthermore, overexpression of NCS-1 (via vectors) renders cultured primary cortical neurons more resistant to oxidative stress and withdrawal of B27 trophic factor, whereas injection of dominant negative peptide decreased survival of these neurons (Nakamura et al., 2007). Also, overexpression of NCS-1 induces neurite sprouting in vivo. Overexpression of NCS-1 via injection of NCS-1 lentivector into the sensorimotor cortex of adult rats before unilateral pyramidotomy improved axonal sprouting across the midline into the contralateral side where the corticospinal tract was denervated. This overexpression of NCS-1 also resulted in improved forelimb function. The anti-stress, pro- regenerative effects of NCS-1 upregulation are mediated via activation of the PI3K-Akt antiapoptosis pathway (Yip et al., 2010). In short, the stress-induced upregulation of NCS-1 is neuroprotective against injury.

1.4.7 Function: Hypoxia tolerance

To my knowledge, there are currently no published reports linking calcium sensing proteins to hypoxia. However, preliminary data from the Feng lab show the involvement of NCS-1 in chronic hypoxia. Preliminary studies have found that 4 day chronic hypoxia treatment upregulates the protein expression of a calcium binding protein, neuronal calcium sensor-1 (NCS-1) in the central nervous system of the hypoxia-tolerant freshwater pond snail Lymnaea stagnalis. This upregulation coincides with hypoxia-induced facilitation of aerial respiratory activity. However, snails treated with NCS-1 siRNA prior to hypoxia exposure do not show the hypoxia-induced increase in aerial respiration, suggesting that the upregulation of NCS-1 may modulate the activity of rCPG, which controls aerial respiration. Furthermore, our data show that the chaperone protein Hsp70 is upregulated prior to the upregulation of NCS-1. Coimmunoprecipitation data suggest that Hsp70 interacts with NCS-1. Lastly, preventing hypoxia-induced upregulation of Hsp70 with siRNA also abolishes the hypoxia-induced upregulation of NCS-1. These lines of evidence suggest that the Hsp70/NCS-1 interaction may function to maintain the protein expression of NCS-1 and contribute to respiratory behavior adaptation to chronic hypoxia (Fei and Feng unpublished data).

1.5 Lymnaea stagnalis as an experimental model

In contrast to most birds and mammals, lower vertebrates such as fishes, amphibians and reptiles can survive in conditions of extreme oxygen deprivation. For example, the Western painted turtle can survive up to four months in anoxic conditions during the winter (Bickler and Buck, 2007). Such animals possess hypoxia-tolerant characteristics due to strong evolutionary pressures. During the Permian-Triassic transition, the ambient oxygen concentration dropped from 30% to 10%, forcing the ancestors of fishes, amphibians and reptiles to undergo strong selection for hypoxia-tolerance characteristics (Berner, 1999; Huey and Ward, 2005). Furthermore, the environments currently inhabited by these organisms, including ocean tide pools, the Amazon basin, as well as the coastal and pelagic marine waters all present bouts of prolonged hypoxic conditions (Bickler and Buck, 2007; Nilsson and Ostlund-Nilsson, 2004). In order to be hypoxia tolerant, these organisms must be able to achieve metabolic suppression during chronic hypoxia, be able to tolerate acidic metabolic end products, and possess antioxidant defense mechanisms and cell regenerative capability after re-oxygenation (Bickler

23 and Buck, 2007). Many studies have taken advantage of these model systems to better understand the innate and natural mechanisms to tolerate chronic hypoxia. Such studies facilitate our understanding of the physiological changes to hypoxia, and promote translational research to further explore the possibility of applying these mechanisms in clinical situations.

1.5.1 Lymnaea stagnalis

The freshwater pond snail Lymnaea stagnalis is an ideal model for studying chronic hypoxia. The snails naturally prefer to live in standing bodies of water in which the environment becomes hypoxic. In such conditions, the snails switch from transpiration through the skin to aerial respiration through a pulmonary opening (pneumostome) to meet their oxygen needs. The aerial respiratory behavior of snails is a well-established model for studying hypoxia induced changes. First, this behavior is easily observable and quantifiable, and hypoxia greatly alters the output of this behavior. Furthermore, the neuronal circuit that controls this behavior is simple and well characterized (discussed below). The cells in the circuit are large and identifiable, and protocols for detecting electrophysiological changes in cell properties are well established. Furthermore, the central nervous system of the snail presents as a localized tissue that can be harvested for molecular analysis with Western and PCR. As such, the Lymnaea stagnalis is an ideal model for studying the molecular, electrophysiological and behavioral changes elicited by hypoxia treatment.

1.5.2 Aerial respiratory behavior and respiratory central pattern generator

Aerial respiratory behavior is a periodic, homeostatic behavior used by snails to replenish their air supply under normoxic conditions, but can be enhanced by low PO2 concentrations (hypoxia) (Jones, 1961; Syed et al., 1991). A respiratory central pattern generator (rCPG) consisting of three neurons (RPeD1, VD4, IP3) is necessary and sufficient for aerial respiratory activity (Syed et al., 1990; Figure 4). These three neurons form reciprocal synaptic connections with each other, and their concerted actions open and close the pneumostome. RPeD1 is the pacemaker neuron that initiates respiratory rhythm (Syed et al., 1990). Increased RPeD1 activity is associated with more pneumostome openings (Inoue et al., 2001). IP3 and VD4 mediate pneumostome opening (inspiration) and closing (expiration), respectively (Syed et al., 1990). Peripheral inputs modulate the network of rCPG neurons through direct connections from the

24 pneumostome to the RPeD1 (Bell et al., 2007; Inoue et al., 2001; Moccia et al., 2009). In normoxic conditions where cutaneous respiration predominates, the inputs from the peripheral chemoreceptors inhibit rCPG activity. This is demonstrated by a greater firing frequency of RPeD1 in the isolated preparation (composed of the CPG alone) than in the semi-intact preparation (composed of the CPG and peripheral chemoreceptors) (Inoue et al., 2001).

Figure 4

Figure 4. The respiratory central pattern generator of Lymnaea stagnalis

Aerial respiration is controlled by a central pattern generator composed of three interneurons. Respiratory activity takes place by the opening and closing of the pneumostome. Inhibitory synapses are indicated by solid circle, and excitatory synapses are indicated by a line. RPeD1 is the pacemaker neuron that initiates respiratory activity. IP3 excites the motoneuron I/J which opens the pneumostome, and also inhibits the K motoneuron which closes the pneumostome. VD4 stimulate the motoneuron K, which closes the pneumostome, and inhibits the motoneuron I/J, which opens the pneumostome. The pneumostome also contains peripheral chemoreceptors that are able to detect oxygen tension. Under hypoxic conditions, peripheral receptors excite the RPeD1 via a direct synapse. This leads to increased RPeD1 activity, and increased aerial respiration (Bell et al., 2008; Bell and Syed, 2009; McComb et al., 2003; Syed et al., 1990).

As a pacemaker neuron, RPeD1 activity is regulated by its intrinsic membrane properties (ion channels) and synaptic inputs. The ionic currents that contribute to action potential generation

and maintenance as well as bursting pattern have been identified. In particular, CaV (; Audesirk and Audesirk, 1989; Szucs et al., 1995), KV (Sakakibara et al., 2005), NaV (Nikitin et al., 2008) and Ca-K channels contribute to the action potential profile; the Ih current and T-type calcium channel is responsible for afterhyperpolarization; the persistent Na current is responsible for depolarization (Lu and Feng, 2012; Nikitin et al., 2008).

The neurotransmitters that mediate these excitatory and inhibitory connections have begun to be characterized. Through chromatographic, pharmacological and electrophysiological methods, the RPeD1 neuron has been identified to use dopamine as its neurotransmitter (Magoski et al., 1995). Dopamine both inhibits the VD4 neuron and excites a non-CPG neuron (VD2/3) through a D2-like receptor (Magoski et al., 1995). VD4 is a glutamatergic neuron and excites RPeD1 through a glutamate receptor that shows properties reminiscent of both ionotropic and metabotropic receptors (Nesic et al., 1996). VD4 also uses acetylcholine to inhibit a non-CPG neuron (LPeD1) through a G-protein coupled receptor mechanism (McCamphill et al., 2008). The pneumostome provides inhibitory input to RPeD1 through GABA binding to GABA A receptors, and excitatory input through acetylcholine binding to AMPA sensitive receptors (Inoue et al., 2001; Moccia et al., 2009; Figure 5).

Figure 5

Figure 5. Ion currents responsible for RPeD1 bursting activity

The resting membrane potential of the RPeD1 is regulated by both a potassium leak current (IK-

leak) and a current through the NALCN channel (INALCN). The persistent sodium current (INa-P) depolarizes the membrane potential to threshold, and activates voltage gated transient Na

channels (INa-V), which conducts a large sodium current responsible for the rising phase of each action potential. Rapid depolarization of the membrane activates N-type and L-type voltage- 2+ gated Ca channels (ICa N-type, ICa L-type), and the voltage gated potassium channel (IKv), which conducts an inward K+ current responsible for the repolarizing phase of the action 2+ + potential. Afterhyperpolarization is mediated by the Ca dependent K current (IK-Ca), followed by the Ih current. The bursting activity is also regulated by synaptic currents through GABA-A receptors and AMPA receptors (Audesirk and Audesirk et al., 1989; Lu and Feng, 2012; Moccia et al., 2009; Nesic et al., 1996; Nikitin et al., 2008; Sakakibara et al., 2005; Szucs et al., 1995).

1.5.3 Hypoxic modulation of rCPG

The major synaptic input influencing the activity of RPeD1 arises from the peripheral chemoreceptor cells (PCRCs) located near the pneumostome. Hypoxia stimulates the PCRCs, and activity in PCRCs directly excites the RPeD1 through a direct nicotinic cholinergic synapse. Activity in the RPeD1 is transduced through the rCPG, resulting in increased aerial respiratory activity (Bell et al., 2008; Bell and Syed, 2009). Previous studies have shown that in a semi- intact preparation, where the nerve connecting the peripheral chemoreceptors to the RPeD1 is kept intact to the rCPG, there is increased spontaneous firing frequency in the RPeD1 after the

periphery is perfused with hypoxic saline (90% N2 +10% O2). The superfusion of the central compartment (rCPG) with hypoxic saline while keeping the periphery normoxic did not alter RPeD1 discharge. In an isolated ganglionic preparation, where the connection between the peripheral chemoreceptor to the rCPG is severed, bathing the rCPG in hypoxic saline did not significantly alter the firing frequency of RPeD1, suggesting that the rCPG itself, without the peripheral chemoreceptors, does not respond to hypoxic challenge (Inoue et al., 2001). The synapse between the peripheral chemoreceptor cells and RPeD1 is a direct excitatory nicotinic acetylcholinergic synapse (Bell and Syed 2009), and thus may be one source for the increase in bursting activity in RPed1 neurons after chronic hypoxia treatment. Indeed, experiments show that chronic 6 hour hypoxic exposure of intact animals prior to dissection and intracellular recording, lead to increased firing frequency in the RPeD1 neuron, only if it is in a semi-intact preparation, and not isolated ganglionic preparation (Inoue et al., 2001). Increasing the hypoxia exposure to 12 hour did not elicit further increase in RPeD1 activity.

1.5.4 Hypoxia-induced molecular changes

In response to chronic hypoxia treatment (4 days) in hypoxic conditions (5% O2), snails exhibited slower behavior responses, such as slowed reactions to light stimuli and reduced righting movement. The expression of heat-shock protein 70 (Hsp70) was significantly upregulated in snail ganglionic preparations; the expression of presynaptic proteins syntaxin I, synaptic vesicle protein 2 (SV2) and synaptotagmin were significantly downregulated. Time- course analysis shows that the upregulation of Hsp70 precedes all changes in synaptic protein expression level. Preventing Hsp70 upregulation with siRNA caused further hypoxia-induced downregulation of syntaxin and synaptotagmin after hypoxia. Coimmunoprecipitation studies show an interaction between Hsp70 and syntaxin. These results suggest that hypoxia-induced

upregulation of chaperone protein Hsp70 function to maintain appropriate level of presynaptic proteins (Fei et al., 2007)

1.6 Hypotheses

1.6.1 Rationale

Chronic hypoxia is a consequence of many common diseases, including heart disease, hypoventilation syndrome and stroke. As currently there is no cure for these disease, managing the major consequences, such as hypoxia is of great clinical significance. Studies with mammalian models have elucidated the consequences of hypoxia, and identified several important proteins that are responsible for hypoxia-induced injury in neuronal cells. However, to date, the therapeutic value of these molecules is limited. In contrast to mammalian systems, lower vertebrates and invertebrates have naturally evolved mechanisms to tolerate long periods of oxygen deprivation and the reoxygenation period. Understanding and taking advantage of such hypoxia-tolerance mechanisms would yield new insight into the pathophysiology of hypoxia-induced injury, and offer new potential treatment routes for patients.

The hypoxia-tolerant freshwater pond snail Lymnaea stagnalis is an established model for studying the behavioral, molecular and electrophysiological consequences of chronic hypoxia. Preliminary data (Fei and Feng unpublished) show that chronic hypoxia treatment upregulates the protein expression of neuronal-calcium sensor 1 (NCS-1) in Lymnaea. This protein has previously been implicated in neuroprotection against stress, such as oxidative stress, high Ca2+ conditions and axonal injury (Nakamura et al., 2006; Saitoh et al., 2003). Its functional role in response to chronic hypoxia has never been reported.

The aim of the current study is to determine the functional role of the upregulation of NCS-1 using the Lymnaea respiratory central pattern generator (rCPG) as a model. Specifically, it will determine whether hypoxia-induced upregulation of NCS-1 regulates the pacemaker activity of the RPeD1 neuron, and thereby contribute to hypoxia-induced respiratory plasticity in Lymnaea stagnalis. These findings will provide insight into the effects of chronic hypoxia and advance our knowledge of the molecular players involved in hypoxia-tolerance.

1.6.2 Objectives and Hypotheses

1. Compare the activity of RPeD1 neuron in the rCPG network under normoxia and chronic hypoxia conditions, which has increased neuronal NCS-1 protein levels, with intracellular sharp electrode recordings from a semi-intact ganglion preparation of Lymnaea stagnalis. I hypothesize that RPeD1 neuron will exhibit greater firing frequency under hypoxic condition compared to the normoxic condition. 2. Determine the contribution of NCS-1 to hypoxia-induced changes in RPeD1 pacemaker activity. Targeted RNAi followed by intracellular sharp electrode recordings of the RPeD1 after hypoxia or normoxia treatment will be employed. I hypothesize that NCS-1 knockdown will abolish the hypoxia-induced increase in RPeD1 firing frequency.

1.6.3 Experimental Approach

For all experiments, young adult snails measuring 1.5-2 cm in shell length were used. To determine the effect of chronic hypoxia on RPeD1 behavior, snails were placed in normoxic or

hypoxic (bubbled with 100% N2) water for four days. They were taken out, dissected in a semi- intact preparation and intracellular sharp electrode recordings were carried out in normoxic snail saline (Experiment 1, Figure 6A). To determine the contribution of NCS-1 to hypoxia-induced changes in RPeD1 activity, snails were injected with 4 µL of 20 mM control or NCS-1 siRNA before being placed in normoxic or hypoxic water for four days. They were dissected in a semi- intact preparation and intracellular sharp electrode recordings were carried out in normoxic snail saline (Experiment 2, Figure 6B).

2 Materials and Methods

2.1 Animals

Fresh water pond snails, L. stagnalis, obtained from an inbred culture at the Free University in Amsterdam, were raised and maintained in aquaria at the University of Toronto, as described previously (Fei et al., 2007). Specifically, all animals used were kept in water at 18°C – 20°C on a 12 hr light / 12 hr dark cycle, and fed lettuce twice a week. Two - months old snails having a shell length of 15 to 20 mm were used in all experiments.

2.2 Hypoxia treatment

Snails were divided into two groups. To induce chronic hypoxia, snails were forced to submerge

in water having an equilibrated O2 level of ~ 5% under a plastic box (20 x 10 x 10 cm) with 10 holes (1 x 1 cm) distributed along all five sides for 8 days. A sham control group was submerged into fully aerated water with air. During this treatment, the animals were prevented from breathing oxygen from the air. The pH value of the water for the hypoxic condition was ~7, which was similar to that for the control.

2.3 Intracellular recordings of RPeD1

2.3.1 Samples

Snails treated for four days in normoxia or hypoxia were anesthetized with 10% Listerine for 7 minutes and de-shelled with curved forceps. Semi-intact preparations were dissected and kept

bathed in snail saline (mM: NaCl 51.3, KCl 1.7, CaCl2 4.1, MgCl2 1.5, HEPES 2, adjusted to pH 7.9 using NaOH). Four days of treatment was selected for three reasons. One, the preliminary molecular and behavioral data (see section 1.4.7) for which this study is based on is collected four days after hypoxia treatment. Furthermore, four day hypoxia treatment is an established chronic hypoxia model for Lymnaea stagnalis (Fei and Feng, 2008; Fei et al., 2008; Fei et al., 2007; Silverman-Gavrila et al., 2009). Lastly, although the preliminary data showed that NCS-1 protein level is significantly upregulated after two days of hypoxia treatment, there was no consistent electrophysiological changes in the RPeD1 (data not shown).

2.3.2 Semi-intact preparations

Three models for electrophysiology in snails are possible. Individual neurons, such as the RPeD1 (Lu and Feng, 2011) can isolated and cultured for electrophysiological studies. Also, the central ganglia (Cheung et al., 2006) can be isolated to study electrophysiological changes in the central nervous system. Semi-intact preprations were chosen for this study as it contains all the elements necessary for the hypoxia-induced respiratory response. It contains the peripheral chemoreceptors, the central neurons responsive to chemoreceptor signals, the neurons responsible for respiration, and the muscles that control the pneumostome. Previous study (Inoue et al., 2001) showed such a preparation, dissected 6 hours after hypoxia treatment, exhibit increased rCPG activity; however, in an isolated ganglionic preparation where the pneumostome and peripheral chemoreceptors are removed, hypoxia treatment did not lead to any changes in rCPG activity. This suggests that the periphery is necessary for hypoxia-induced changes, and thus this study selected the only model – the semi-intact preparation – that leaves the periphery intact.

Semi-intact preparations were dissected as described previously (Li, 2011; Lukowiak et al., 1991; Syed et al., 1991). The snail was first deshelled, and digestive organs were removed to expose the central nervous system. The central ganglia ring, buccal ganglia and the lower body (including the pneumostome) were dissected and pinned dorsal side up. The nerve from the right parietal ganglia to the pneumostome was left intact. The pneumostome is able to open and close after dissection spontaneously. After removal of the outer sheath surrounding the ganglia with fine forceps, the preparation was digested with trypsin for four minutes followed by rinsing 3 times with snail saline (Figure 7).

2.3.3 Electrophysiological recording

Under current-clamp mode, conventional sharp electrode recordings were performed to monitor the spontaneous bursting firing activity of RPeD1 cells. Sharp electrodes were filled with

saturated K2SO4 solution (70–80 MΩ), and bath solution with normoxic snail saline. Before intracellular penetration, a 1.0 nA positive current pulse was generated, and the electrode capacitance was neutralized. After impaling the RPeD1, a small hyperpolarizing current was injected briefly (~30 sec) to stabilize the electrode. The neuron was then allowed 5 minutes to recover before recordings (10 min long) were taken. Resting membrane potential was taken five

35 minutes after RPeD1 impalement. Input resistance was calculated based on the size of injected hyperpolarizing current and the resulting membrane potential (−70 to −120 mV), following Ohm's law. Signals were recorded and amplified with a computer with Clampex 8.2 software (Axon Instruments) and Axoclamp 2A connected to Digidata 1322 digitizer (Axon intrsuments).

2.3.4 Parameters assessed

Resting membrane potential was measured at the beginning of each 10 minute recordings. Electrode resistance was measured at the start and end of each experiment. The spontaneous action potential (AP) frequency and inter-spike intervals, as well as parameters of action potential profile (rise time, decay time, half-width duration, amplitude; Figure 6C) were analyzed with Clampfit 9.2 (Axon Instrument). Logarithmic histograms of the inter-spike intervals at bin size 50 were plotted with Clampfit 9.2 to describe the bursting firing pattern.

Figure 6

[A]

[B]

decay time [C]

Spike height 50% width

rise time mV

ms Vthres

Figure 6. Protocol for Intracellular Recordings

[A] Time course for objective 1. Snails were placed in normoxic or hypoxic water for 4 days. After the snails are taken out of the normoxic or hypoxic treatment, they were allowed 15 min recovery in normoxic water. They were then dissected, and intracellular recording was performed.

[B] Time course for objective 2. Prior to normoxic or hypoxic treatment, snails were injected with either control or NCS-1 specific siRNA. After four days of normoxic or hypoxic treatment, snails were allowed 15 min recovery in normoxic water. They were then dissected, and intracellular recording was performed.

[C] Parameters measured to determine changes in action potential profile of RPeD1. The

amplitude (spike height) is the change in voltage between the threshold potential (Vthres) and the peak of the action potential. Half-width duration was taken where spike height is 50% of its maximal value. The 10% to 90% rise time is the time it takes to go from 10% of maximum amplitude to 90% of maximum amplitude. The 10% to 90% decay time is the time it takes to drop from 90% of maximum amplitude to 10% of maximum amplitude.

Figure 7. Semi-intact preparation

[A] [B]

Figure 7. Semi-intact preprations

[A] Snail is first anesthetized with Listerine and then deshelled, and placed in a plated bathed with snail saline. The digestive organs were removed to reveal the central nervous system. The lower body and the pneumostome are left intact with the central nervous system.

[B] Close-up view detailing the central ganglia, the nerve connecting the RPed1 to the peripheral chemoreceptors, and the pnueostome.

2.4 In vivo RNAi gene silencing

2.4.1 siRNA Synthesis

A short 27-mer siRNA NCS-1 (Hui et al., 2006) was designed using SciTools RNAi Design software (IDT DNA), and purchased from IDT DNA. TriFECTa control siRNA was used as a control (IDT DNA). The sequences for each siRNA are listed in Table 2.

Table 2. Sequences used for RNAi silencing of NCS-1

Name Sequence

NCS-1 5’GUCCUUAUUCUCGUCGAAGACGUUGAA siRNA 5P-CAACGUCUUCGACGAGAAUAAGGdAdC

TriFECTa 5’UCACAAGGGAGAGAAAGAGAGGAAGGA control 5P-CUUCCUCUCUUUCUCUCCCUUGUdGdA

5P represents 5’ phosphate; dN represents deoxynucleotide; all other bases are ribonucleotides

2.4.2 Delivery of siRNA

As previously described (Fei et al., 2007), snails anesthetized with Listerine for 5 min were partially deshelled from the top of the snail head, and pinned down on a dissecting board filled

with the snail saline (mM: 40 NaCl, 1.7 KCl, 10 HEPES-NaOH, 1.5 MgCl2, and 4.1 CaCl2, pH 7.95). Using a microliter syringe (Hamilton Company, Reno, NV, USA), 4 µL of 20 mM NCS-1 siRNA or control siRNA was injected into the snail above the central ring ganglia. The animals were then kept under either the hypoxic or normoxia control condition for 4 days. Electrophysiological studies were carried out after hypoxic or normoxic exposure.

2.5 Real-time quantitative polymerase chain reaction (qPCR)

2.5.1 Sample Preparation

Snails were placed in normoxic (n=6) or hypoxic (n=6) water for four days as described above. They were then anesthetized with 10% Listerine for 7 minutes and de-shelled with curved forceps. The central ganglia from snails were dissected and frozen with dry ice, and stored at - 80°C until time of RNA extraction.

2.5.2 RNA Extraction and cDNA synthesis

Total RNA was extracted with TRIzol (Invitrogen, USA) following manufacturer’s instructions. Specifically, 300 µL of TRIzol was used and the final pellet was resuspended in 10 µL of 0.5% diethyl pyrocarbonate (DEPC) water. RNA concentration was measured using spectrophotometry. First strand synthesis of cDNA was conducted using SuperScript III reverse transcriptase (Invitrogen, USA) with random hexamer primer following manufacturer’s instructions in a reaction volume of 20 µL for 1 µg of total RNA. cDNA quality and concentration were measured using spectrophotometry. Final working concentration of cDNA was diluted to 1 µ g/µL.

2.5.3 Real-time quantitative polymerase chain reaction (qPCR)

qPCR was performed as described before (Hui and Feng, 2009). Briefly, 5 µL of SYBR Green master Mix (Invitrogen) was added to 1 µL of the appropriate primers (Table 3), 1 µL (1ug/ul)

43 cDNA sample and topped off with DEPC water to a final volume of 10 µL. The primer sequences were designed using Primer Quest (IDT). qPCR reactions were carried out in a Real- Time PCR System (7900 HT, Applied Biosystems, ABI, USA) controlled by SDS2.2.1 software. The cycling parameters were 50°C for 5 min and 95°C for 10 min, followed by 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds followed by a melting curve protocol. The peak of the first-derivative in the melting curve and the shape of the amplification curve were used to assess the quality of the PCR. Changes in gene expression levels following hypoxia and normoxic determined using Ct-Ct plots (Aleksic and Feng, 2012; Hui and Feng, 2009). A linear Ct-Ct plot was created by plotting the Ct (threshold cycle) values of the test gene (NCS-1) against the control gene (β-actin). The resulting plot was group fitted using Origin Pro 8.6 software (Origin Lab, USA) with a linear function, and the Y-intercept was used as a measure of the relative expression between the control and test gene. A smaller Y-intercept indicates relatively higher expression level.

Table 3 Primers used for qPCR

Name Sequence

NCS-1 Forward 5’ATGGGCAAGAGGGCAAGTAAG

(DQ099793.2) Reverse 5’ GGTAATGTTACTGATTCTCCCAC

Forward 5’AGCCATCCTTCTTGGGTATG-3’ β-actin

(DQ206431.1) Reverse 5’ATACCTGGGAACATGGTGGT-3’

2.6 Statistical Analysis

The data are presented as the mean ± s.e.m. Statistical analysis was carried out using SigmaStat 3.0 (Jandel Scientific). Differences between mean values from each experimental group were tested using a Student's t test for two groups and one-way analysis of variance (ANOVA) for multiple comparisons. A two-sample Komogorov-Smirnov test is used to determine the statistical difference between distributions. Differences were considered significant if p < 0.05.

3 Results

3.1 Hypoxia-induced changes in RPeD1 activity

Preliminary data show that after four days of chronic hypoxia treatment, there is increased aerial respiratory duration and frequency in snails (Fei and Feng unpublished). Since aerial respiratory behavior is controlled by the respiratory central pattern generator (rCPG), with the rhythm set by the activity of the pacemaker neuron RPeD1, the altered behavioral output suggests that changes have occurred in the RPeD1 neuron after chronic hypoxia treatment. To determine the hypoxia- induced changes in RPeD1 activity, intracellular sharp electrode recording was conducted in semi-intact preparations. This preparation contains all the elements necessary for hypoxia- induced changes in respiratory behavior, including the peripheral chemoreceptors, the rCPG, as well as the output motoneurons and muscles. This preparation was specifically chosen to determine the hypoxia-induced changes in RPeD1 neuron as previous experiments have shown that the periphery is the site of hypoxia sensing and the source hypoxia mediated electrophysiological changes in the RPeD1 (Inoue et al., 2001).

To test the effect of chronic hypoxia on RPeD1 activity, intracellular recordings of RPeD1 were taken from semi-intact preparations of snails treated with four days of normoxia or hypoxia. The parameters assessed include basal membrane properties (resting membrane potential, input resistance), bursting pattern (frequency, inter-spike interval) and action potential profile (rise time, decay time, half-width duration and amplitude). Figure 9A shows representative traces from normoxic and hypoxic treated snails.

3.1.1 Basal Membrane Properties are not altered by chronic hypoxia

This is the first study showing the changes in resting membrane potential and input resistance of the RPeD1 neuron after chronic hypoxia treatment. Resting membrane potential was taken five minutes after RPeD1 impalement. Input resistance was calculated based on the size of injected hyperpolarizing current and the resulting membrane potential (−70 to −120 mV), following Ohm's law. There are no statistically significant differences in the resting membrane potential (- 54.71± 5.42 mV, n=12 for normoxia, -57.86±6.16 mV, n=10 for hypoxia) or the input resistance (96.67±25.22 MΩ, n=12 for normoxia, 113.48±21.48 MΩ, n=10 for hypoxia) between the hypoxic and normoxic groups, suggesting that basal membrane properties were not altered by chronic hypoxia treatment (Figure 8). The input resistance value is similar to those reported before for the RPeD1 neuron (Lu and Feng, 2011).

Figure 8.

[A]

-10

-20

-30

-40

-50

-60

Resting PotentialMembrane (mV) -70 Normoxia Hypoxia

160 [B] 140 120 100 80 60 40

Input (MOhm) Resistance 20 0 Normoxia Hypoxia

Figure 8. Chronic hypoxia treatment does not alter the resting membrane potential or input resistance of RPeD1 neurons.

[A] No significant differences (p>0.05) in resting membrane potential was observed between the normoxic (n=12) and the hypoxic group (n=10). The data represent mean±s.e.m.

[B] No significant differences (p>0.05) in input resistance was observed between the normoxic (n=12) and the hypoxic group (n=10). The data represent mean±s.e.m.

3.1.2 Increased firing frequency and bursting activity of RPeD1 following chronic hypoxia

To characterize the bursting activity, the spontaneous firing frequency of the RPeD1 neuron and the inter-spike interval was measured. Previous studies have shown that in a semi-intact preparation, after six hours of hypoxia treatment, there is increased RPeD1 action potential firing frequency (Inoue et al., 2001). Extending the hypoxia exposure to 12 hours did not elicit further increase in RPeD1 activity. This is the first study to determine the alteration in firing frequency after four days of chronic hypoxia treatment. Spontaneous RPeD1 firing at rest was recorded for 10 min, beginning 5 min after RPeD1 impalement. Action potential frequency was compared between the normoxic and hypoxic group. The results show that the spontaneous firing frequency was significantly increased in the hypoxic group (2.16±0.49 Hz, n=10) compared to the normoxic group (0.94±0.14 Hz, n=12), suggesting an increase in RPed1 activity (Figure 9B). This increase in firing frequency is observed in the absence of depolarized resting membrane potential (Figure 8A), suggesting that voltage-dependent mechanisms, or changes in synaptic transmission may be at play in controlling the firing frequency.

The effect of hypoxia on bursting pattern was determined by measuring the distribution of inter- spike intervals (ISIs). The ISI is the duration between two consecutive action potentials. The distribution of ISIs can be used to infer bursting patterns (Lu and Feng, 2011). Longer ISI durations indicate sparse firing. Shorter ISIs, on the other hand, suggest more frequent firing. ISI distributions of the normoxic and hypoxic groups were compared, and Figure 9C shows that chronic hypoxic treatment led to a left-ward shift towards shorter inter-spike intervals, which correlates with increased firing frequency.

Figure 9

[A]

[B] 3.0 * 2.5

2.0

1.5

1.0 Frequency (Hz) 0.5

0.0

Normoxia Hypoxia

[C] Count

ISI Duration (Log10 msec) 52

Figure 9. Chronic hypoxia increases bursting activity in RPeD1

[A] Representative traces of RPeD1 bursting activity after normoxic or hypoxia treatment.

[B] Averaged frequency of action potential in RPeD1 for normoxic (n=12) and hypoxic group (n=10). The frequency of spontaneous firing is significantly higher in the hypoxic group compared to the normoxic group (p<0.05). The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia group.

[C] Inter-spike interval (ISI) for RPeD1 firing in the normoxic (n=12) and hypoxic group (n=10). Two-sample Komogorov-Smirnov test shows that the ISI distribution in the hypoxic group is significantly different from that of the normoxic group (p<0.05). The ISI distribution in the hypoxia group is left-shifted towards shorter ISIs.

3.1.3 Altered action potential profile following chronic hypoxia

The shape and time-course of action potentials are regulated by various Na+, K+ and Ca2+ ion channels that are subject to modulation by hypoxia and possibly NCS-1, which is upregulated following after hypoxia. To determine the hypoxia-induced effects on action potential profile, the 10%-90% rise time, 10%-90% decay time, half-width duration and amplitude was analyzed. Figure 10A shows representative single action potential from normoxic and hypoxic groups. The amplitude (Figure 10B) of the action potential, measured from the threshold potential to the peak did not show statistical difference between the two groups (normoxia 52.79±1.87 mV, n=12; hypoxia 51.78±1.40 mV, n=10). The half-width duration (Figure 10C), measured at 50% spike height (threshold voltage to peak), is significantly longer in the hypoxic condition (3.93±0.27 msec, n=10) than the normoxic condition (3.22±0.14 msec, n=12). The 10%-90% rise time (Figure 10D), was significantly increased in the hypoxic groups (2.11±0.21 msec, n=10) compared to the normoxic group (1.56±0.26 msec, n=12). Similarly, the decay time (Figure 10E), is significantly longer in the hypoxic group (2.60±0.22 msec, n=10) compared to the normoxic group (2.01±0.11 msec, n=12).

The rise time in the RPeD1 action potential reflects the activity of the collected group of voltage- gated sodium channels. A longer rise time may suggest that slower kinetics of individual channels in the membrane. Similarly, the decay time reflects the activity of voltage-gated potassium channels, and a longer decay time suggests that channels are operating with slower kinetics. The change in half-width duration is due to the combined activities of several ion channels (Na+, K+, Ca2+), and thus the direct cause of its changes cannot be directly deciphered. However, a consequence of widened action –potentials is that the cell spends more time in a depolarized state, allowing longer time for influx of Ca2+ into the cell through voltage-gated ion channels.

Figure 10.

[A]

[B] [C]

5 60 * 50 4 * 40 3 30

20 2 Amplitude (mV) 10 1

0 Half-width duration (msec) Normoxia Hypoxia 0 NORMOXIA HYPOXIA

[D] [E] 3.0 2.5 * * 2.5 2.0 2.0 1.5 1.5 1.0 1.0 Rise time (msec) Rise

0.5 (msec) time Decay 0.5 0.0 Normoxia Hypoxia 0.0 Normoxia Hypoxia

Figure 10. Chronic hypoxia alters the profile of RPeD1 action potentials

[A] Representative RPeD1 action potential after normoxia or hypoxia treatment.

[B] Averaged action potential amplitude from normoxia (n=12) and hypoxia groups (n=10). There is no statistical difference in amplitude between the two groups. The data represent mean±s.e.m.

[C] Averaged half-width duration of action potentials from the normoxia (n=12) and hypoxia- treated groups (n=10). The half-width duration is significantly longer in the hypoxia group (p<0.05) compared to the normoxia group. The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia group.

[D] Averaged 10%-90% rise time of action potentials from the normoxia (n=12) and hypoxia group (n=10). The rise time is significantly longer in the hypoxia group (p<0.05) compared to the normoxia group. The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia group.

[E] Averaged 10%-90% decay time of action potentials from the normoxia (n=12) and hypoxia group (n=10). The decay time is significantly longer in the hypoxia group (p<0.05) compared to the normoxia group. The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia group.

3.2 Contribution of NCS-1 to hypoxia-induced changes

Chronic hypoxia invokes a multitude of changes in the activity of the RPeD1 neuron. The mechanisms by which these changes are brought about are unclear. Our preliminary data show that NCS-1 level is upregulated following chronic hypoxia, and NCS-1 is known to regulate both ion channel activity and synaptic transmission, and thus may be a mediator for hypoxia-induced neuronal changes in the RPeD1. The efficiency of siRNA injection was also measured with Western Blots, using snail central ganglia as a preparation (Figure 15). NCS-1 siRNA reduced the NCS-1 protein level by approximately 60% in the normoxic condition and by approximately 70% in the hypoxic condition. The control siRNA did not alter NCS-1 protein level in either the normoxic or the hypoxic condition. This data was collected by Guanghe Fei (Feng lab).

In order to determine the contribution of NCS-1 to RPeD1 activity, NCS-1 siRNA, or control siRNA was injected into snails prior to four days of normoxia or hypoxia treatment. The parameters assessed included basal membrane properties (resting membrane potential, input resistance), bursting pattern (frequency, inter-spike interval) and action potential profile (rise time, decay time, half-width duration and amplitude). Figure 12A shows representative traces from normoxic and hypoxic treated snails.

3.2.1 NCS-1 knockdown does not affect basal membrane properties

This is the first study showing the changes in resting membrane potential and input resistance of the RPeD1 neuron in response to changing NCS-1 levels. Resting membrane potential was taken five minutes after RPeD1 impalement. The injection of control siRNA did not affect the resting membrane potential (Figure 11A) in either normoxic (-52.50±4.79 mV, n=9) or hypoxic conditions (-57.14±1.84 mV, n=13) as the values are comparable to those without siRNA injection. Under normoxic conditions, there was no statistical difference between the control and NCS-1 siRNA (-57.50±3.13mV, n=7) groups, suggesting that NCS-1 siRNA does not significantly affect the resting membrane potential. Similarly after hypoxic treatment, the resting membrane potential between the control and NCS-1 siRNA (-58.57±4.04 mV, n=13) groups are statistically similar, suggesting that NCS-1 injection does not significantly alter the resting membrane potential in response to hypoxia treatment. This suggests that NCS-1 levels do not affect the basal resting membrane potential in either normal physiological conditions or hypoxic conditions. The resting membrane potential of the RPeD1 is largely due to current through a potassium leak channel (Hodgkin and Huxley 1947) and the current through the U-type channel, the molluscan homologue of the NALCN channel (Sodium leak Channel-Nonselective; Lu and Feng, 2011). The data do not suggest that NCS-1 regulates either of these channels, and no previous reports have suggested the involvement of NCS-1 with either of these channels.

The injection of control siRNA did not affect the input resistance (Figure 11B) in either normoxic (80.00±20.00 MΩ, n=9) or hypoxic conditions (114.26±33.53 MΩ, n=13), as these values are comparable to those without siRNA injection. Under normoxic conditions, the input resistance between the control siRNA and NCS-1 siRNA (93.98±14.81 MΩ, n=7) group was statistically similar, suggesting that NCS-1 siRNA did not significantly alter the input resistance of the RPeD1. Similarly, under hypoxic conditions, the input resistance between the control siRNA injected group and the NCS-1 siRNA injected group (82.26±16.56 MΩ, n=13) was not statistically different, suggesting that NCS-1 does not modulate input resistance under hypoxic conditions either.

Figure 11.

[A] 0

-10

-20

-30

-40

-50

-60

Resting PotentialMembrane (mV) -70 A NA NA iR siRNA -1 s -1 siR trol S S NC NC + + xia xia o mo yp Hypoxia+controlH siRN Normoxia+conNor

[B]

160 140 120 100 80 60 40

Input (MOhm) Resistance 20 0 A N NA R si l siRNA l siRNA o ro

+NCS-1 a xia+cont oxia+contr o oxi m rmoxia+NCS-1yp siR yp o H H Nor N

Figure 11. NCS-1 siRNA does not alter resting membrane potential or input resistance of RPeD1

[A] Average resting membrane potential of RPeD1 under normoxic and hypoxic conditions, with either control or NCS-1 siRNA. No statistical difference (p>0.05) was observed between the four groups. The data represent mean±s.e.m.

[B] Average input resistance of RPeD1 after normoxic or hypoxic treatment, with either control or NCS-1 siRNA. No statistical difference (p>0.05) was observed between the four groups. The data represent mean±s.e.m.

Normoxia + control siRNA: n= 9 Normoxia + NCS-1 siRNA: n=7 Hypoxia + control siRNA: n = 13 Hypoxia+ NCS-1 siRNA: n=13

3.2.2 NCS-1 knockdown affects RPeD1 bursting activity.

In order to determine whether NCS-1 affects the bursting activity of RPeD1, the spontaneous action potential firing frequency was recorded for 10 min, beginning 5 min after RPeD1 impalement. Control siRNA injection did not affect the firing frequency (Figure 12B) under normoxic or hypoxic conditions (normoxia: 0.66±0.10 Hz, n=9; hypoxia: 1.88±0.35 Hz, n=13). Under normoxic conditions, there was no statistical difference between the control siRNA group and the NCS-1 siRNA group (0.95±0.30 Hz, n=7), suggesting that NCS-1 does not modulate RPeD1 action potential frequency after normoxic treatment. Under hypoxic conditions however, the RPeD1 firing frequency in the NCS-1 siRNA injected group (1.02±0.19 Hz, n=13) was significantly lower compared to the control siRNA injected group, suggesting that hypoxia- induced upregulation of NCS-1 protein levels may play a role in regulating action potential frequency after chronic hypoxia treatment. The RPeD1 firing frequency is controlled by the resting membrane potential, the voltage-gated ion channels, and synaptic transmission. Since the resting membrane potential is not altered by chronic hypoxia treatment or NCS-1 levels, the effect of NCS-1 on RPeD1 firing frequency is most likely through its effects on voltage-gated ion channels and/or its modulation of synaptic transmission.

To determine the effect of NCS-1 on the bursting pattern of RPeD1 (Figure 12C), ISI distributions of all four groups were examined and compared. Control siRNA injection does not significantly alter the ISI distribution under normoxic or hypoxic conditions. NCS-1 siRNA injection under normoxic condition did not lead to a change in ISI distribution compared to the control siRNA condition, suggesting that NCS-1 does not affect bursting activity under normoxic conditions. Under hypoxic conditions, NCS-1 siRNA injection resulted in a rightward shift towards longer inter-spike intervals as compared to the control siRNA condition. This data suggest that NCS-1 siRNA negates the hypoxia-induced shortening of ISIs, indicating that the upregulation of NCS-1 protein following chronic hypoxia treatment may contribute to the increased bursting activity in RPeD1.

Figure 12

[A]

2.5 [B] * 2.0

1.5 # 1.0

Frequency (Hz) 0.5

0.0 NA NA NA R iRNA iR siR s s 1 CS- N NCS-1 + + ia x xia+control o o m yp H Hypoxia Normoxia+controlNor si

[C]

Count

ISI Duration (Log10 msec)

Figure 12. NCS-1 knockdown prevents hypoxia-induced increase in RPeD1 bursting activity

[A] Representative traces of RPeD1 bursting activity after normoxia or hypoxia treatment, with control or NCS-1 siRNA.

[B] Averaged frequency of spontaneous action potential firing in the RPeD1. Under normoxic conditions, no difference was observed between the NCS-1 siRNA and the control siRNA group (p>0.05). The frequency is significantly higher in the hypoxia control siRNA group compared to the normoxic control siRNA group (p<0.05). After hypoxia treatment, the frequency in the NCS-1 siRNA group is significant less than that in the control siRNA group. The data represent mean±s.e.m. * indicates statistical significance (p<0.05) compared to the normoxia control siRNA group. # indicates statistical significance (p<0.05) compared to the hypoxia control siRNA group.

[C] Averaged interspike interval for RPeD1 firing in the normoxic and hypoxic groups, with control or NCS-1 siRNA. Under normoxic conditions, there is no difference in the ISI distribution between the control and NCS-1 siRNA groups. Under hypoxic conditions, the NCS- 1 siRNA group shows a right-ward shift towards longer ISIs compared to the control siRNA group.

Normoxia + control siRNA: n= 9

Normoxia + NCS-1 siRNA: n=7

Hypoxia + control siRNA: n = 13

Hypoxia+ NCS-1 siRNA: n=13

3.2.3 NCS-1 knockdown affects action potential profile

NCS-1 is known to modulate some of the ion channels involved in the generation of action potentials. For example, NCS-1 is known to modulate and interact with voltage-gated potassium channels responsible for repolarization of action potentials (Nakamura et al., 2001). To determine how NCS-1 affect the properties of action potential profile, the amplitude, half-width duration, 10%-90% rise time and 10%-90% decay time were analyzed. Figure 13A shows representative single action potential from normoxic and hypoxic groups, with control or NCS-1 siRNA. In hypoxic and normoxic conditions, the injection of control siRNA did not affect the amplitude, half-width duration, rise time or decay time (Figure 13, Table 4). Under normoxic conditions, the amplitude, half-width duration, rise time or decay time are not statistically different between the control and the NCS-1 siRNA groups (Figure 13, Table 4). Under hypoxic conditions, the amplitude and rise time are similar between the control and NCS-1 siRNA groups, suggesting that NCS-1 does not have an effect on these parameters after hypoxia treatment. On the other hand, after hypoxia treatment, the half-width duration is significantly decreased in the NCS-1 siRNA group (3.03±0.20 msec, n=13) compared to the control siRNA group (4.25±0.38 msec, n=13). The decay time is also significantly decreased in the NCS-1 siRNA group (2.03±0.16 msec, n=13) compared to the control siRNA group (2.87±0.34 msec, n=13). This data suggest that the upregulation of NCS-1 may contribute to the increase in action potential decay time and half-width duration following chronic hypoxia treatment (Figure 13).

Figure 13

[A]

Normoxia+ control siRNA Hypoxia+control siRNA

Normoxia+NCS-1 siRNA Hypoxia+NCS-1 siRNA 10 msec 20 mV

60 [B] [C] 5 50 * 4 40 # 3 30 2 20 Amplitude (mV) 10 1 Half width duration (msec) 0 0

iRNA NA siRNA siRNA s siRNA R l i iRNA iRNA o -1 s siRNA s tr trol l s l n n S-1 co co C + + ontro ontro N c +NCS-1 c xia o oxia a ia+ p x rm rmoxia+NCS oxia+ Hy Hypoxia+NCS-1 rm ypoxia+ No No o H Hypo N Normoxi

3.5 3.0 [E] 3.0 * [D] 2.5 * 2.5 2.0 * # 2.0 1.5 1.5 1.0 1.0 Rise time (msec) time Rise Decay time (msec) 0.5 0.5

0.0 0.0 A N NA RNA RNA RNA iRNA 1 si 1 si siRNA s ol siR ol siR l si l ntr ntr o -1 o S-1 siRNA NCS- NCS- C contr xia+ xia+co + oxia+co oxia+ a xia+NCS xia+contr m rmo ypo o H Hyp p Nor No rmo Hy Hypoxia+N Normoxi No 65

Figure 13. NCS-1 siRNA attenuates hypoxia-induced changes in half-width duration and decay time of RPeD1 action potentials.

[A] Representative single RPeD1 action potential.

[B] Averaged action potential amplitude from normoxia or hypoxia groups with control or NCS- 1 siRNA. There is no statistical difference in amplitude between the four groups. The data represent mean±s.e.m.

[C] Averaged half-width duration of action potentials from normoxia or hypoxia-treated group, with control or NCS-1 siRNA. Under normoxic conditions, there is no statistical difference (p>0.05) between control and NCS-1 siRNA groups. Hypoxia treatment with control siRNA significantly increased the half-width duration, as compared to the normoxia control siRNA group (p<0.05). After hypoxia treatment, the half-width duration in the NCS-1 siRNA group is significantly less than the control siRNA group (p<0.05). The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia control siRNA group. # indicates statistical significance compared to the hypoxia control siRNA group.

[D] Averaged 10%-90% rise time of action potentials from the normoxia or hypoxia groups with control or NCS-1 siRNA. Under normoxic conditions, there is no statistical difference in rise time between the NCS-1 siRNA group and the control siRNA group (p>0.05). Hypoxia treatment significantly increased the rise time, as compared to the normoxic control siRNA group (p<0.05). Under hypoxic conditions, there is no difference in the rise time between the NCS-1 and control siRNA groups. The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia group.

[E] Averaged 10%-90% decay time of action potentials from the normoxia and hypoxia groups with control or NCS-1 siRNA. Under normoxic conditions, there is no statistical difference (p>0.05) between control and NCS-1 siRNA groups. Hypoxia treatment with control siRNA significantly increased the decay time, as compared to the normoxia control siRNA group (p<0.05). After hypoxia treatment, the decay time in the NCS-1 siRNA group is significantly less than the control siRNA group (p<0.05). The data represent mean±s.e.m. * indicates statistical significance compared to the normoxia control siRNA group. # indicates statistical significance compared to the hypoxia control siRNA group.

Table 4 RPeD1 action potential profile

Normoxia + Normoxia + NCS- Hypoxia + Hypoxia + NCS-1 control siRNA 1 siRNA control siRNA siRNA

(n=9) (n=7) (n=13) (n=13)

Amplitude (mV) 53.59±2.25 49.17±2.43 51.77±1.75 49.61±1.27

Half-width (msec) 2.98±0.13 3.14±0.13 2.36±0.38 3.03±0.20

Rise time (msec) 1.42±0.77 1.63±0.10 2.21±0.20 1.99±0.28

Decay time (msec) 1.83±0.09 1.98±0.11 2.87±0.34 2.03±0.16

3.3 Hypoxia-induced upregulation of NCS-1 is dependent on post-translational modifications

Preliminary data from our lab suggest that after four days of chronic hypoxia treatment, the protein level of NCS-1 in snail central ring ganglia are upregulated four folds compared to the normoxic group (Fei and Feng unpublished). The increase in protein levels could be a result of transcriptional, post-transcriptional, translational or post-translational changes. To determine whether the mRNA level of NCS-1 was altered by 4 days of chronic hypoxia treatment, real-time quantitative PCR (qPCR) was carried out. The results show that the NCS-1 mRNA levels from the two groups are comparable after four days of chronic hypoxia treatment (Figure 14). This data suggest that there are no net changes in the in transcriptional and post-transcriptional modifications for NCS-1. As such, the increased NCS-1 protein level could be due to altered translational and/or post-translational mechanisms. Data from our lab suggest that post- translational changes may contribute to the observed increase in NCS-1 protein levels (See discussion).

Figure 14

0.012

0.010

0.008

0.006

0.004

0.002 Relative NCS-1 mRNA level 0.000 Normoxia Hypoxia

Figure 14. NCS-1 mRNA levels are not changed after four days of hypoxia treatment NCS-1 mRNA level in the central nervous system of snails after four days of normoxic or hypoxic treatment was assessed by qPCR. There is no statistical difference in NCS-1 mRNA level between the normoxic (n=6) and the hypoxic (n=6) group. The data represent mean±s.e.m.

4 Discussion 4.1 Summary of Data

To the best of my knowledge, this is one of the first studies addressing the effect of chronic hypoxia, as well as the effect of NCS-1, on the activity of the respiratory central pattern generator in Lymnaea.

My results show that after four days of chronic hypoxic treatment, RPeD1 bursting activity is increased, characterized by increased spontaneous action potential firing frequency, and a shift towards shorter interspike intervals. The profile of individual action potentials was altered also.

The effect of NCS-1 on the RPeD1 activity was assessed under both normoxic and hypoxic conditions with RNAi silencing technique. Although under normoxic conditions, NCS-1 siRNA reduces the protein level of NCS-1 by about 60%, no functional consequence of this was observed in terms of RPeD1 activity. Under hypoxic conditions, NCS-1 siRNA prevented the hypoxia-induced increase in RPeD1 bursting activity. NCS-1 siRNA also attenuated the changes in the half-width duration and decay time of action potentials elicited by hypoxia treatment, but did not affect the rise time or the amplitude.

After four days of hypoxia treatment, our preliminary data (Fei and Feng unpublished) show that NCS-1 protein level is upregulated in the central nervous system of Lymnaea. This could be due to changes at the gene level and/or the protein level. My results show that NCS-1 mRNA level is not altered after hypoxia treatment as compared to after normoxic treatment, suggesting that the observed upregulation in NCS-1 protein level may be due to changes in translational or post- translational mechanisms.

4.2 Hypoxia-induced changes in neuronal networks

The altered electrophysiological properties of RPeD1 could explain the increased aerial respiratory behavior. Previous studies have shown that activity in the RPeD1 initiates respiratory activity and increases the frequency of pneumostome openings/closings (Inoue et al., 2001; Haque et al., 2006). These results suggest that chronic hypoxia treatment leads to a remodeling of the respiratory network, resulting in a different behavioral output, which is more suitable for low oxygen environment. The alteration of neural networks by oxygen fluctuations has been

described before. In particular, neural networks are susceptible to environmental O2 levels, and adjust their output accordingly to regulate motor behaviors in response to environmental changes. For example, in the lobster stomatogatric nervous system, neurons of the pyloric network, which are responsible for peristalsis of the pyloric chamber, adjust their firing properties in response to the PO2 in the arterial blood. When arterial oxygen level decreases during postprandial (unfed) conditions, the pyloric cycle period increases by 30–40%, leading to reduction of pyloric network activity. This plasticity functions to reduce energy expenditure when a high level of neuronal activity is not required (Massabuau and Meyrand, 1996). In the American cockroach Periplaneta americana, the rhythm of gas exchange is controlled by a central pattern generator (CPG) in the metathoracic ganglion. In hypoxic conditions (2% O2), there is significant increase in the CPG output in order to increase oxygen uptake (Woodman et al., 2007). Furthermore, in the anoxia-tolerant locust Locusta migratoria, the activity of the ventilatory central pattern generator (vCPG) ceases firing within five minutes after chemical hypoxia induction. This allows the organism to fall into a deep coma, which functions to minimize energy expenditure. After removal of hypoxic stimuli, the activity of the medial ventilatory nerve - an output of the vCPG - shows significantly increased burst duration and period, which persisted for over 40 min after removal of hypoxic stimuli. This plasticity in the vCPG is partially mediated by activation of the AMP-activated protein kinase (AMPK), which is an evolutionarily conserved pathway that monitors energy status in order to cope with metabolic stress (Rodgers-Garlick et al., 2011). In neonatal mice medullary slices, hypoxia differentially affects pacemakers in the pre-Botzinger complex (PBC) of the ventral respiratory group (VRG). Under normoxic conditions, 2 populations of pacemaker neurons are active – those that carry the persistent sodium current, and those that carry the calcium-activated nonspecific cationic current (ICAN). Under hypoxic conditions, only the pacemaker neurons that carry the persistent sodium current are active. The selective silencing of ICAN carrying neurons is thought to contribute to the generation of gasping behavior. In summary, neuronal networks, including the snail rCPG, are highly plastic entities that adjust their outputs in response to O2 fluctuations. This allows a shift of motor behaviors that are adaptive to the hypoxic surrounding.

4.3 NCS-1 regulation of RPeD1 under normoxic conditions

As a pacemaker neuron, RPeD1 burst activity is dependent both on synaptic inputs (Cheung et al., 2006; Moccia et al., 2009) and modulation by membrane ion channels (Lu and Feng, 2011).

Although previous studies have shown that reduced NCS-1 levels leads to deficient synaptic transmission in mouse hippocampal slices and Drosophila neuromuscular junction (Saab 2010, Dason et al., 2009), my data did not show that NCS-1 siRNA altered RPeD1 bursting activity. The current study did not directly measure synaptic transmission under normoxic conditions, and thus cannot conclude definitively whether NCS-1 siRNA affected neurotransmitter release. Further studies can be done to explore this issue. It is possible that in the Lymnaea central nervous system, NCS-1 siRNA does not have an effect on basal synaptic transmission. On the other hand, it is also possible, based on previous studies, that NCS-1 siRNA does affect basal synaptic transmission; in such a case, the reason that no difference in RPeD1 activity was observed between the NCS-1 and control siRNA groups, could be that the current model is a pacemaker neuron, and its activity is not only dependent on synaptic transmission, but also on ion channel activity.

4.4 Hypoxia-induced changes in RPeD1 neuron

4.4.1 No changes in basal membrane properties

No change in resting membrane potential in the Lymnaea RPeD1 neuron was found. Two channels have been identified to modulate the resting membrane potential of RPeD1 neuron. One is the well established potassium leak current (Hodgkin and Huxley, 1947; Lu and Feng, 2011). The other is a newly characterized non-selective cation channel, known as the U-type channel in snails; its mammalian counterpart is NALCN (Sodium leak channel, nonselective; Lu and Feng, 2011). To the best of my knowledge, there are currently no published reports detailing the effect of chronic hypoxia on either of these channels.

4.4.2 Increased bursting activity

In response to chronic hypoxia treatment, RPeD1 firing frequency exhibited shorter inter-spike intervals. One of the main regulators of bursting activity is the resting membrane potential. In all neurons, firing frequency increases with depolarized membrane potentials (Li, 2011). However, my data show that in response to chronic hypoxia treatment, the resting membrane potential is maintained at a level comparable to that of the normoxic state, yet firing frequency is greatly increased. In pacemaker neurons, such as the RPeD1, firing frequency can also be modulated by synaptic inputs (Cheung et al., 2006; Inoue et al., 2001). The direct input from the

73 peripheral chemoreceptors to the RPeD1 leads to increased RPeD1 firing frequency (Inoue et al., 2001). Other studies show that hypoxia treatment also leads to synaptic changes in the Lymnaea central nervous system. F cluster neurons, located closely to the RPeD1, and share similar electrophysiological properties as RPeD1, were found to show reduced spontaneous firing frequency when bathed in hypoxic saline (100% N2, PO2 = 7 Pa) in an isolated preparation (Cheung et al., 2006). This reduction in spontaneous activity is partially due to a reduction of GABA-A mediated synaptic transmission, which normally exerts excitatory effects (Cheung et al., 2006). In contrast, GABA’s effect on the RPeD1 is inhibitory (Moccia et al., 2009, Molnar et al., 2004) under normoxic conditions. If GABAergic transmission decreases under hypoxic conditions (Cheung et al., 2006), this could release the inhibition on RPeD1, and may contribute to the observed increase in RPeD1 activity after hypoxia treatment.

4.4.3 Changes in action potential profile

After chronic hypoxia treatment, there is increased half-width duration, as well as increased rise- time and decay time of RPeD1 action potentials. The amplitude of the action potential is not changed. The major contributor to the rising phase of action potentials is the opening of voltage- gated sodium channels. Therefore, the increase in rise time may suggest slower kinetics (activation/inactivation), or decreased surface expression of voltage-gated Na+ channels. It is unknown how chronic hypoxia modulates voltage-gated Na+ channel activity and expression in neurons or pacemaker neurons. However, in rat carotid body chemoreceptor cells, NaV1.1 subunit was upregulated by chronic hypoxia (Caceres et al., 2007). In the snail RPeD1 neuron, N-type and L-type voltage gated Ca2+ channels become activated during the rising phase of the action potential. However, due to their slower kinetics, it is unlikely that currents through these channels contribute to the rising phase of the action potential (Bean, 2007). Although theoretically, increased Ca2+ currents could affect the repolarizing phase of the action potential by increasing the decay time and widening the action potential half-width duration, the activation of Ca2+-activated K+ channels by the increased intracellular Ca2+ would negate the effects of the L-type currents (Bean, 2007). In PC12 cells, chronic hypoxia leads to increased currents through L-type voltage gated Ca2+ channels (Peers and Kemp, 2004). It is unknown how the activity of these channels is changed after chronic hypoxia in the snail RPeD1.

The major contributor to the falling phase of action potentials is voltage-gated potassium 2+ channels, and also Ca dependent K+ channels. A decrease in the decay time suggests slower kinetics or decreased expression of voltage-gated K+ channels. It is unknown how chronic hypoxia modulates voltage-gated K+ channels in neurons or pacemaker cells; however, previous studies have shown that in cultured pulmonary artery smooth muscle cells, chronic hypoxia (60-

72 hr, 3% O2) decreases the expression of Kv1.1, Kv1.5, Kv2.1, Kv4.3, and Kv9.3 subunits. The reduced expression of these channels results in cell depolarization and Ca2+ influx, which contributes to pulmonary vasoconstriction (Platoshyn et al., 2000). The half-width duration is significantly increased after hypoxia treatment. The half-width duration is also controlled by the activity of voltage-gated potassium channels. Thus, an increase in half-width duration suggests slower kinetics, or decreased surface expression of these channels. Slower inactivation of voltage-gated sodium channels (Bean, 2007) could also lead to increased half-width duration. The increased half-width duration increases the amount of time the neuron is depolarized, allowing greater influx of Ca2+ into the cell through voltage-gated calcium channels. Ca2+ is a ubiquitous signaling molecule, and could activate a suite of signalling cascades.

Although it is unknown how the activity of specific ion channels in the RPeD1 neurons are altered by chronic hypoxia, my data suggest that there may be changes in the expression or activity of voltage gated Na+, Ca+ and K+ channels that control the shape of the action potential. Further experiments using electrophysiological and pharmacological approaches can be conducted to determine the specific changes, if any, in these channels following chronic hypoxia treatment.

4.5 NCS-1 regulation of RPeD1 under hypoxic conditions

After chronic hypoxia exposure, NCS-1 siRNA significantly affected the bursting activity and the action potential profile of RPeD1 neurons in the semi-intact preparation. NCS-1 siRNA attenuated the hypoxia induced increase in bursting activity. As compared to the control siRNA condition, NCS-1 siRNA injection resulted in decreased action potential firing frequency, and a shift towards longer interspike intervals. The bursting activity of RPeD1 may be the result of altered nicotinic (Bell et al., 2008; Bell and Syed, 2009) or GABA neurotransmission (Cheung et al., 2006). NCS-1 has previously been shown to modulate synaptic transmission, mostly through presynaptic mechanisms such as regulation of voltage-gated Ca2+ channels and PI4Kβ. Post-

75 synaptic mechanisms include direct interaction/regulation of dopamine receptors or regulation of receptor recycling via interaction with AP1 or AP2 (Jo et al., 2008; Saab et al., 2009).

Since the RPeD1 is in a respiratory network, it acts as a presynaptic neuron to other interneurons (IP3, VD4) in the network, and also receives synaptic inputs from these neurons and the peripheral chemoreceptor, and thus also acts as a post-synaptic cell. Previous studies have shown that there is increased acetylcholinergic input to the RPeD1 cell from the chemoreceptors following chronic hypoxia (Bell et al. 2008). It is unknown whether NCS-1 is specifically upregulated in the peripheral chemoreceptors; if so, NCS-1 may facilitate ACh release, thus leading to enhanced RPeD1 activity. Increased NCS-1 in the RPeD1 may also facilitate neurotransmitter release from the RPeD1 cell to the VD4 and IP3 interneurons.

NCS-1 siRNA also reversed the hypoxia-induced changes in decay time and half-width duration. The major channel responsible for the falling phase of action potentials is the voltage-gated K+ channel. Previous studies have shown NCS-1 is able to affect the activity of voltage-gated K+ channels in cardiomyocytes (Guo et al., 2002). NCS-1 co-immunoprecipitates with Kv4.3 subunits in ventricular extracts. Furthermore, NCS-1 increases the membrane expression of Kv4-subunits and decreases rate of inactivation of Kv4-subunit encoded K currents. NCS-1 does not however affect the voltage dependence of steady-state inactivation or the rate of recovery from inactivation (Guo et al., 2002). In the invertebrates, NCS-1 may negatively regulate K+ channel activity. The Drosophila V7 mutants that overexpress frequenin show a Shaker-like phenotype, and do display a reduction in Shaker voltage-gated potassium channel protein levels (Angaut-Petit et al., 1998). It is currently unclear how NCS-1 affects the voltage-gated gated K channels in neurons or pacemaker neurons. Further studies are needed to determine whether NCS-1 interacts with voltage-gated K channels in the RPeD1 cells, and the functional consequence of such interactions.

4.6 RNAi

The in vivo RNAi gene silencing technique has been widely used to manipulate gene and protein expression in L. stagnalis (Aleksic and Feng, 2012; Fei et al., 2007; Fei et al., 2008; Guo et al., 2010; Hui et al., 2007; Hui and Feng, 2008; Lu and Feng, 2011; Nejatbakhsh et al., 2011). The specific sequences used in this study have previously been used to knockdown NCS-1 protein level in Lymnaea Pedal A (PeA) neurons (Hui et al., 2007). 24 hours after addition of 5 nM of

NCS-1 siRNA to cultured PeA neurons, NCS-1 protein levels were reduced by 30%, and such reduction resulted in significant enhancement of neurite outgrowth and a significant reduction in growth cone Ca2+ signals. In the current study, in vivo siRNA injection is able to reduce ganglionic protein expression by 60% in normoxic condition and 75% after hypoxia treatment. It is able to reduce RPeD1 NCS-1 protein level by about 50%. Since siRNA cannot achieve 100% NCS-1 protein knockdown, a hypoxia-tolerant knockout model (see Appendices) was used to confirm whether NCS-1 protein is necessary for hypoxia tolerance.

A major limitation with the use of siRNA is off-target effects. Exogenous siRNA may bind to sequences that are not entirely complimentary, and thus may reduce the expression of non- targeted genes (Jackson et al., 2003). A microarray can be used to detect the gene expression changes induced by injection of siRNA. Also, other siRNA sequences that target other portion of the NCS-1 gene may be used to confirm the results of the current study.

Injection of foreign genetic material such as siRNA may elicit immune responses, leading to activation of cytokines and inflammatory pathways (Judge et al., 2005) in mammalian systems. This concern is circumvented in the snail system, as snails have hemolymph, and do not generate such immune responses.

4.7 Mechanism of NCS-1 upregulation

Previous studies have shown that after injury in the mammalian central nervous system, there is upregulation of NCS-1 protein level. Specifically, after unilateral vagal axotomy in adult rats, there is upregulation of NCS-1 protein level in the dorsal motor nucleus of the vagus (DMV) neurons as early as 1 day after axotomy; the level of NCS-1 peaked at 1 week after axotomy, and gradually decreased over the next two months (Nakamura et al., 2006). Upregulation of NCS-1 functions to render neurons more resistant to cellular stressors, via activation of the PI3K-Akt antiapoptosis pathway (Nakamura et al., 2006; Yip et al., 2010). The upregulation of NCS-1 may be dependent on glial cell line–derived neurotrophic factor (GDNF). Our results show a potential new mechanism for hypoxia induced respiratory plasticity. Specifically, my data suggest that NCS-1 mRNA level is not altered after four days of chronic hypoxia treatment, suggesting that transcriptional mechanisms do not contribute to increased NCS-1 levels. Thus, the level of NCS-1 is regulated at the protein level. Protein levels can be affected by protein synthesis and protein degradation. Our data suggest NCS-1 levels may be elevated due to

77 decreased protein degradation. There is significant increase in HIF-1α, Hsp70 and NCS-1 protein expression in the central nervous system of snails with as little as two days of hypoxia treatment. Furthermore, our data show that the upregulation of NCS-1 protein level is dependent on pre-existing upregulation of Hsp70, such that injection of Hsp70 siRNA, which prevents the hypoxia-induced upregulation of Hsp70, also abolishes the upregulation of NCS-1 protein. Also, time course analysis indicates that Hsp70 upregulation precedes NCS-1 protein upregulation by 6 hours. Lastly, Hsp70 protein co-immunoprecipitates with NCS-1, demonstrating a physical interaction between the two proteins (Fei and Feng unpublished). The simplest conclusion from this data is that the upregulated Hsp70 proteins act as molecular chaperones to promote the stable formation of functional NCS-1 proteins. This is consistent with the existing roles ascribed to Hsp70. Activation of Hsp70 is critical for adaptation to hypoxic conditions (Lu et al., 2010), and these proteins function to protect the neurons from hypoxic stress through its chaperoning effects such as preventing protein misfolding and aggregation (Yenari et al., 2005). Under ischemic conditions, Hsp70 upregulation can also protect the synapse by regulating presynaptic proteins or regulating calcium influxes (Lu et al., 2010). Thus, Hsp70 may function to decrease the degradation of NCS-1 proteins, leading to increased NCS-1 protein levels after chronic hypoxia treatment. The increased NCS-1 is necessary for hypoxia-induced ventilatory increase which improves oxygen intake after chronic hypoxia, and thus is critical for survival of the organism.

Under hypoxic conditions, Hsp70 may be dependent on HIF-1α (Baird et al., 2006). The most well recognized transcription factor for heat shock proteins is heat shock factor-1 (HSF). During hypoxic conditions, HSF in the nucleus undergoes trimerization and binds to the heat shock element (AGAAN) present in the promoter region of all heat shock proteins, and transcriptionally activate the expression of these proteins, including Hsp70. However, recent studies show that during hypoxic conditions, upregulation of Hsp70 is also dependent on HIF-1a. Specifically, HIF-1α can bind to the HIF-1 response element located in HSF intron regions, thus increasing HSF transcripts, which will induce heat shock protein transcription (Baird et al., 2006). Other heat shock proteins, such as Hsp70-2, contain hypoxia-response elements in their promoter region, and thus can be directly transcriptionally activated by HIF-1α (Huang et al., 2009). Other studies have shown the functional dependence of Hsp70 on HIF-1α (Chang et al., 2009; Huang et al., 2009; Xia et al., 2009; Yeh et al., 2010).

4.8 Future Directions

Future studies can aim to delineate the specific ion channel or receptors altered by chronic hypoxia and/or NCS-1. To determine whether the observed changes in RPeD1 activity are due to changes in intrinsic properties (e.g., ion channels) or synaptic changes, intracellular recording, combined with siRNA can be carried out in isolated RPeD1 neurons, which has no synaptic connections. Pharmacology combined with patch clamping techniques can be employed to determine the specific ion channels or receptors involved in hypoxia.

4.9 Importance of Study

This is the first study describing the functional consequence of NCS-1 upregulation following chronic hypoxia treatment in a hypoxia-tolerant model. It is also the first study demonstrating that NCS-1 regulates pacemaker activity in response to chronic hypoxia treatment. This study furthers our understanding of the physiological, molecular and electrophysiological changes in neuronal systems following chronic hypoxia treatment, and describes a potential new target involved in hypoxia.

4.10 Conclusion

In consideration of the behavioral, electrophysiological and molecular data, a new pathway involving NCS-1 in hypoxia tolerance is proposed. After chronic hypoxia treatment, increased levels of NCS-1 protein in the central nervous system of the snail, especially in the respiratory pacemaker neuron RPeD1, leads to increased bursting activity and altered action potential profile of the RPeD1. Such remodeling of RPeD1 activity, coinciding with increased aerial respiratory behavior, functions to maintain adequate oxygen supply in response to chronic hypoxia.

References

Aleksic M, Feng ZP (2012) Identification of the role of C/EBP in neurite regeneration following microarray analysis of a L. stagnalis CNS injury model. BMC Neurosci 13:2.

Angaut-Petit D, Toth P, Rogero O, Faille L, Tejedor FJ, Ferrus A (1998) Enhanced neurotransmitter release is associated with reduction of neuronal branching in a Drosophila mutant overexpressing frequenin. Eur J Neurosci 10(2): 423-434.

Audesirk G, Audesirk T (1989) Effects of in vitro lead exposure on voltage-sensitive calcium channels differ among cell types in central neurons of Lymnaea stagnalis. Neurotoxicology 10:659-669.

Azad P, Zhou D, Russo E, Haddad GG (2009) Distinct mechanisms underlying tolerance to intermittent and constant hypoxia in Drosophila melanogaster. PLoS One 4:e5371.

Azad P, Haddad GG (2009) Survival in acute and severe low o environment: use of a genetic model system. Ann N Y Acad Sci 1177:39-47.

Baird NA, Turnbull DW, Johnson EA (2006) Induction of the heat shock pathway during hypoxia requires regulation of heat shock factor by hypoxia-inducible factor-1. J Biol Chem 281:38675-38681.

Bajec MR (2002) Consequences of altered Frequenin expression at arthropod neuromuscular junctions. MSc. Thesis, University of Toronto.

Bean BP (2007) The action potential in mammalian central neurons. Nature Reviews Neuroscience 8: 451-465.

Bell HJ, Inoue T, Shum K, Luk C, Syed NI (2007) Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron. Eur J Neurosci 25:3537-3550.

Bell HJ, Inoue T, Syed NI (2008) A peripheral oxygen sensor provides direct activation of an identified respiratory CPG neuron in Lymnaea. Adv Exp Med Biol 605:25-29.

Bell HJ, Syed NI (2009) Hypoxia-induced modulation of the respiratory CPG. Front Biosci 14:3825-3835.

Berner RA (1999) Atmospheric oxygen over Phanerozoic time. Proc Natl Acad Sci U S A 96:10955-10957.

Berridge MJ, Bootman MD, Roderick HL (2003) Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol 4:517-529.

Bickler PE, Buck LT (2007) Hypoxia tolerance in reptiles, amphibians, and fishes: life with variable oxygen availability. Annu Rev Physiol 69:145-170.

Birnbaum SG, Varga AW, Yuan LL, Anderson AE, Sweatt JD, Schrader LA (2004) Structure and function of Kv4-family transient potassium channels. Physiol Rev 84:803-833.

Blasiole B, Kabbani N, Boehmler W, Thisse B, Thisse C, Canfield V, Levenson R (2005) Neuronal calcium sensor-1 gene ncs-1a is essential for semicircular canal formation in zebrafish inner ear. J Neurobiol 64:285-297.

Bourne Y, Dannenberg J, Pollmann V, Marchot P, Pongs O (2001) Immunocytochemical localization and crystal structure of human frequenin (neuronal calcium sensor 1). J Biol Chem 276:11949-11955.

Broughton BR, Reutens DC, Sobey CG (2009) Apoptotic mechanisms after cerebral ischemia. Stroke 40:e331-e339.

Bruick RK (2000) Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. Proc Natl Acad Sci U S A 97:9082-9087.

Buckler KJ, Vaughan-Jones RD (1994) Effects of hypoxia on membrane potential and intracellular calcium in rat neonatal carotid body type I cells. J Physiol 476:423-428.

Burgoyne RD, Weiss JL (2001) The neuronal calcium sensor family of Ca2+-binding proteins. Biochem J 353:1-12.

Burgoyne RD (2007) Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat Rev Neurosci 8:182-193.

Caceres AI, Obeso A, Gonzalez C, Rocher A (2007) Molecular identification and functional role of voltage-gated sodium channels in rat carotid body chemoreceptor cells. Regulation of expression by chronic hypoxia in vivo. J Neurochem 102:231-245.

Chang AY, Chan JY, Cheng HL, Tsai CY, Chan SH (2009) Hypoxia-inducible factor 1/heme oxygenase 1 cascade as upstream signals in the prolife role of heat shock protein 70 at rostral ventrolateral medulla during experimental brain stem death. Shock 32:651-658.

Chao D, Xia Y (2010) Ionic storm in hypoxic/ischemic stress: can opioid receptors subside it? Prog Neurobiol 90:439-470.

Chen C, Yu L, Zhang P, Jiang J, Zhang Y, Chen X, Wu Q, Wu Q, Zhao S (2002) Human neuronal calcium sensor-1 shows the highest expression level in cerebral cortex. Neurosci Lett 319:67-70.

Cheung U, Moghaddasi M, Hall HL, Smith JJ, Buck LT, Woodin MA (2006) Excitatory actions of GABA mediate severe-hypoxia-induced depression of neuronal activity in the pond snail (Lymnaea stagnalis). J Exp Biol 209:4429-4435.

Chin D, Means AR (2000) Calmodulin: a prototypical calcium sensor. Trends Cell Biol 10:322- 328.

Cormier-Regard S, Nguyen SV, Claycomb WC (1998) Adrenomedullin gene expression is developmentally regulated and induced by hypoxia in rat ventricular cardiac myocytes. J Biol Chem 273:17787-17792.

Dason JS, Romero-Pozuelo J, Marin L, Iyengar BG, Klose MK, Ferrus A, Atwood HL (2009) Frequenin/NCS-1 and the Ca2+-channel alpha1-subunit co-regulate synaptic transmission and nerve-terminal growth. J Cell Sci 122:4109-4121.

Dason JS, Romero-Pozuelo J, Atwood HL, Ferrus A (2012) Multiple roles for frequenin/NCS-1 in synaptic function and development. Mol Neurobiol 45:388-402.

de BJ, Janoshazi A, Dupont JL, Procksch O, Chasserot-Golaz S, Jeromin A, Vitale N (2006) Functional implication of neuronal calcium sensor-1 and phosphoinositol 4-kinase-beta interaction in regulated exocytosis of PC12 cells. J Biol Chem 281:18098-18111.

Del TR, Levitsky KL, Lopez-Barneo J, Chiara MD (2003) Induction of T-type calcium channel gene expression by chronic hypoxia. J Biol Chem 278:22316-22324.

Diarra A, Sheldon C, Brett CL, Baimbridge KG, Church J (1999) Anoxia-evoked intracellular pH and Ca2+ concentration changes in cultured postnatal rat hippocampal neurons. Neuroscience 93:1003-1016.

Dolphin AC (1999) L-type calcium channel modulation. Adv Second Messenger Phosphoprotein Res 33:153-177.

Ebert BL, Firth JD, Ratcliffe PJ (1995) Hypoxia and mitochondrial inhibitors regulate expression of glucose transporter-1 via distinct Cis-acting sequences. J Biol Chem 270:29083-29089.

Eckhart AD, Yang N, Xin X, Faber JE (1997) Characterization of the alpha1B-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle. Proc Natl Acad Sci U S A 94:9487-9492.

Erdemli G, Xu YZ, Krnjevic K (1998) Potassium conductance causing hyperpolarization of CA1 hippocampal neurons during hypoxia. J Neurophysiol 80:2378-2390.

Fei G, Guo C, Sun HS, Feng ZP (2007) Chronic hypoxia stress-induced differential modulation of heat-shock protein 70 and presynaptic proteins. J Neurochem 100:50-61.

Fei G, Guo C, Sun HS, Feng ZP (2008) HSP70 reduces chronic hypoxia-induced neural suppression via regulating expression of syntaxin. Adv Exp Med Biol 605:35-40.

Fei GH, Feng ZP (2008) Chronic hypoxia-induced alteration of presynaptic protein profiles and neurobehavioral dysfunction are averted by supplemental oxygen in Lymnaea stagnalis. Neuroscience 153:318-328.

Fischer JA, Giniger E, Maniatis T, Ptashne M (1988) GAL4 activates transcription in Drosophila. Nature 332:853-856.

Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL (1996) Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 16:4604-4613.

Gambino F, Pavlowsky A, Begle A, Dupont JL, Bahi N, Courjaret R, Gardette R, Hadjkacem H, Skala H, Poulain B, Chelly J, Vitale N, Humeau Y (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci U S A 104:9063-9068.

Garcia N, Lanuza MA, Besalduch N, Santafe MM, Jeromin A, Tomas J (2005) Localization of neuronal calcium sensor-1 at the adult and developing rat neuromuscular junction. J Neurosci Res 82:1-9.

Gariepy J, Hodges RS (1983) Primary sequence analysis and folding behavior of EF hands in relation to the mechanism of action of troponin C and calmodulin. FEBS Lett 160:1-6.

Gerber HP, Condorelli F, Park J, Ferrara N (1997) Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia. J Biol Chem 272:23659-23667.

Gomez M, De CE, Guarin E, Sasakura H, Kuhara A, Mori I, Bartfai T, Bargmann CI, Nef P (2001) Ca2+ signaling via the neuronal calcium sensor-1 regulates associative learning and memory in C. elegans. Neuron 30:241-248.

Guo CH, Senzel A, Li K, Feng ZP (2010) De novo protein synthesis of syntaxin-1 and dynamin- 1 in long-term memory formation requires CREB1 gene transcription in Lymnaea stagnalis. Behav Genet 40:680-693.

Guo W, Malin SA, Johns DC, Jeromin A, Nerbonne JM (2002) Modulation of Kv4-encoded K(+) currents in the mammalian myocardium by neuronal calcium sensor-1. J Biol Chem 277:26436-26443.

Haddad GG, Donnelly DF (1990) O2 deprivation induces a major depolarization in brain stem neurons in the adult but not in the neonatal rat. J Physiol 429:411-428.

Haddad GG, Wyman RJ, MOHSENIN A, Sun Y, KRISHNAN SN (1997) Behavioral and Electrophysiologic Responses of Drosophila melanogaster to Prolonged Periods of Anoxia. J Insect Physiol 43:203-210.

Haque Z, Lee TK, Inoue T, Luk C, Hasan SU, Lukowiak K, Syed NI (2006) An identified central pattern-generating neuron co-ordinates sensory-motor components of respiratory behavior in Lymnaea. Eur J Neurosci 23:94-104.

Hartness ME, Brazier SP, Peers C, Bateson AN, Ashford ML, Kemp PJ (2003) Post- transcriptional control of human maxiK potassium channel activity and acute oxygen sensitivity by chronic hypoxia. J Biol Chem 278:51422-51432.

Haynes LP, Thomas GM, Burgoyne RD (2005) Interaction of neuronal calcium sensor-1 and ADP-ribosylation factor 1 allows bidirectional control of phosphatidylinositol 4-kinase beta and trans-Golgi network-plasma membrane traffic. J Biol Chem 280:6047-6054.

Haynes LP, Sherwood MW, Dolman NJ, Burgoyne RD (2007) Specificity, promiscuity and localization of ARF protein interactions with NCS-1 and phosphatidylinositol-4 kinase-III beta. Traffic 8:1080-1092.

Hell JW, Westenbroek RE, Warner C, Ahlijanian MK, Prystay W, Gilbert MM, Snutch TP, Catterall WA (1993) Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel alpha 1 subunits. J Cell Biol 123:949-962.

Hendricks KB, Wang BQ, Schnieders EA, Thorner J (1999) Yeast homologue of neuronal frequenin is a regulator of phosphatidylinositol-4-OH kinase. Nat Cell Biol 1:234-241.

HODGKIN AL, HUXLEY AF (1947) Potassium leakage from an active nerve fibre. J Physiol 106:341-367.

Hon WC, Wilson MI, Harlos K, Claridge TD, Schofield CJ, Pugh CW, Maxwell PH, Ratcliffe PJ, Stuart DI, Jones EY (2002) Structural basis for the recognition of hydroxyproline in HIF-1 alpha by pVHL. Nature 417:975-978.

Hu J, Discher DJ, Bishopric NH, Webster KA (1998) Hypoxia regulates expression of the endothelin-1 gene through a proximal hypoxia-inducible factor-1 binding site on the antisense strand. Biochem Biophys Res Commun 245:894-899.

Huang LE, Gu J, Schau M, Bunn HF (1998) Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A 95:7987-7992.

Huang WJ, Xia LM, Zhu F, Huang B, Zhou C, Zhu HF, Wang B, Chen B, Lei P, Shen GX (2009) Transcriptional upregulation of HSP70-2 by HIF-1 in cancer cells in response to hypoxia. Int J Cancer 124:298-305.

Huey RB, Ward PD (2005) Hypoxia, global warming, and terrestrial late Permian extinctions. Science 308:398-401.

Hui K, Fei GH, Saab BJ, Su J, Roder JC, Feng ZP (2007) Neuronal calcium sensor-1 modulation of optimal calcium level for neurite outgrowth. Development 134:4479-4489.

Hui K, Feng ZP (2008) NCS-1 differentially regulates growth cone and somata calcium channels in Lymnaea neurons. Eur J Neurosci 27:631-643.

Hui K, Feng ZP (2009) A new method for rapid analysis of real-time quantitative PCR studies. Front. Neurosci. Conference Abstract: B.R.A.I.N. platform in Physiology poster day 2009

Ikematsu N, Dallas ML, Ross FA, Lewis RW, Rafferty JN, David JA, Suman R, Peers C, Hardie DG, Evans AM (2011) Phosphorylation of the voltage-gated potassium channel Kv2.1 by AMP-

84 activated protein kinase regulates membrane excitability. Proc Natl Acad Sci U S A 108:18132- 18137.

Ikura M (1996) Calcium binding and conformational response in EF-hand proteins. Trends Biochem Sci 21:14-17.

Inoue T, Haque Z, Lukowiak K, Syed NI (2001) Hypoxia-induced respiratory patterned activity in Lymnaea originates at the periphery. J Neurophysiol 86:156-163.

Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY, Semenza GL (1998) Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev 12:149-162.

Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ (2001) Targeting of HIF- alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292:468-472.

Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS (2003) Expression prof ling reveals oﬀ-target gene regulation by RNAi. Nat. Biotechnol. 21: 635–637.

Jeromin A, Muralidhar D, Parameswaran MN, Roder J, Fairwell T, Scarlata S, Dowal L, Mustafi SM, Chary KV, Sharma Y (2004) N-terminal myristoylation regulates calcium-induced conformational changes in neuronal calcium sensor-1. J Biol Chem 279:27158-27167.

Jiang BH, Rue E, Wang GL, Roe R, Semenza GL (1996) Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1. J Biol Chem 271:17771-17778.

Jiang C, Haddad GG (1994) Oxygen deprivation inhibits a K+ channel independently of cytosolic factors in rat central neurons. J Physiol 481 ( Pt 1):15-26.

Jo J, Heon S, Kim MJ, Son GH, Park Y, Henley JM, Weiss JL, Sheng M, Collingridge GL, Cho K (2008) Metabotropic glutamate receptor-mediated LTD involves two interacting Ca(2+) sensors, NCS-1 and PICK1. Neuron 60:1095-1111.

JONES JD (1961) Aspects of respiration in Planorbis corneus L. and Lymnaea stagnalis L. (Gastropoda: Pulmonata). Comp Biochem Physiol 4:1-29.

Judge AD, Sood V, Shaw JR, Fang D, McClintock K, MacLachlan I (2005). Sequence- dependent stimulation of the mammalian innate immune response by synthetic siRNA. Nat. Biotechnol. Nat. Biotechnol. 23: 457–462.

Kabbani N, Negyessy L, Lin R, Goldman-Rakic P, Levenson R (2002) Interaction with neuronal calcium sensor NCS-1 mediates desensitization of the D2 dopamine receptor. J Neurosci 22:8476-8486.

Koizumi S, Rosa P, Willars GB, Challiss RA, Taverna E, Francolini M, Bootman MD, Lipp P, Inoue K, Roder J, Jeromin A (2002) Mechanisms underlying the neuronal calcium sensor-1- evoked enhancement of exocytosis in PC12 cells. J Biol Chem 277:30315-30324.

Kretsinger RH, Nockolds CE (1973) Carp muscle calcium-binding protein. II. Structure determination and general description. J Biol Chem 248:3313-3326.

Kutala VK, Khan M, Angelos MG, Kuppusamy P (2007) Role of oxygen in postischemic myocardial injury. Antioxid Redox Signal 9:1193-1206.

Lewis A, Peers C, Ashford ML, Kemp PJ (2002) Hypoxia inhibits human recombinant large conductance, Ca(2+)-activated K(+) (maxi-K) channels by a mechanism which is membrane delimited and Ca(2+) sensitive. J Physiol 540:771-780.

Li, K (2011) Men1-dependent increase in RPeD1 excitability is required for long term memory consolidation after aversive operant conditioning in Lymnaea stagnalis.MSc. thesis. University of Toronto.

Lian LY, Pandalaneni SR, Patel P, McCue HV, Haynes LP, Burgoyne RD (2011) Characterisation of the interaction of the C-terminus of the dopamine D2 receptor with neuronal calcium sensor-1. PLoS One 6:e27779.

Lipscombe D, Helton TD, Xu W (2004) L-type calcium channels: the low down. J Neurophysiol 92:2633-2641.

Lu TZ, Quan Y, Feng ZP (2010) Multifaceted role of heat shock protein 70 in neurons. Mol Neurobiol 42:114-123.

Lu TZ, Feng ZP (2011) A sodium leak current regulates pacemaker activity of adult central pattern generator neurons in Lymnaea stagnalis. PLoS One 6:e18745.

Lu TZ, Feng ZP (2012) NALCN: A Regulator of Pacemaker Activity. Mol Neurobiol.

Lukowiak K (1991) Experimental reconstruction of neuronal pattern generators. Curr Opin Neurobiol 1:577-582.

Lukyanetz EA, Shkryl VM, Kravchuk OV, Kostyuk PG (2003) Action of hypoxia on different types of calcium channels in hippocampal neurons. Biochim Biophys Acta 1618:33-38.

Magoski NS, Bauce LG, Syed NI, Bulloch AG (1995) Dopaminergic transmission between identified neurons from the mollusk, Lymnaea stagnalis. J Neurophysiol 74:1287-1300.

Mallart A, Angaut-Petit D, Bourret-Poulain C, Ferrus A (1991) Nerve terminal excitability and neuromuscular transmission in T(X;Y)V7 and Shaker mutants of Drosophila melanogaster. J Neurogenet 7:75-84.

Martone ME, Edelmann VM, Ellisman MH, Nef P (1999) Cellular and subcellular distribution of the calcium-binding protein NCS-1 in the central nervous system of the rat. Cell Tissue Res 295:395-407.

Massabuau JC, Meyrand P (1996) Modulation of a neural network by physiological levels of oxygen in lobster stomatogastric ganglion. J Neurosci 16:3950-3959.

Masson N, Willam C, Maxwell PH, Pugh CW, Ratcliffe PJ (2001) Independent function of two destruction domains in hypoxia-inducible factor-alpha chains activated by prolyl hydroxylation. EMBO J 20:5197-5206.

McCamphill PK, Dunn TW, Syed NI (2008) Serotonin modulates transmitter release at central Lymnaea synapses through a G-protein-coupled and cAMP-mediated pathway. Eur J Neurosci 27:2033-2042.

McFerran BW, Graham ME, Burgoyne RD (1998) Neuronal Ca2+ sensor 1, the mammalian homologue of frequenin, is expressed in chromaffin and PC12 cells and regulates neurosecretion from dense-core granules. J Biol Chem 273:22768-22772.

McFerran BW, Weiss JL, Burgoyne RD (1999) Neuronal Ca(2+) sensor 1. Characterization of the myristoylated protein, its cellular effects in permeabilized adrenal chromaffin cells, Ca(2+)- independent membrane association, and interaction with binding proteins, suggesting a role in rapid Ca(2+) signal transduction. J Biol Chem 274:30258-30265.

Metzen E, Berchner-Pfannschmidt U, Stengel P, Marxsen JH, Stolze I, Klinger M, Huang WQ, Wotzlaw C, Hellwig-Burgel T, Jelkmann W, Acker H, Fandrey J (2003) Intracellular localisation of human HIF-1 alpha hydroxylases: implications for oxygen sensing. J Cell Sci 116:1319-1326.

Min JH, Yang H, Ivan M, Gertler F, Kaelin WG, Jr., Pavletich NP (2002) Structure of an HIF- 1alpha -pVHL complex: hydroxyproline recognition in signaling. Science 296:1886-1889.

Misonou H, Mohapatra DP, Menegola M, Trimmer JS (2005) Calcium- and metabolic state- dependent modulation of the voltage-dependent Kv2.1 channel regulates neuronal excitability in response to ischemia. J Neurosci 25:11184-11193.

Moccia F, Di CC, Winlow W, Di CA (2009) GABA(A)- and AMPA-like receptors modulate the activity of an identified neuron within the central pattern generator of the pond snail Lymnaea stagnalis. Invert Neurosci 9:29-41.

Mole DR, Maxwell PH, Pugh CW, Ratcliffe PJ (2001) Regulation of HIF by the von Hippel- Lindau tumour suppressor: implications for cellular oxygen sensing. IUBMB Life 52:43-47.

Muller M, Somjen GG (2000) Na(+) dependence and the role of glutamate receptors and Na(+) channels in ion fluxes during hypoxia of rat hippocampal slices. J Neurophysiol 84:1869-1880.

Nakamura TY, Pountney DJ, Ozaita A, Nandi S, Ueda S, Rudy B, Coetzee WA (2001) A role for frequenin, a Ca2+-binding protein, as a regulator of Kv4 K+-currents. Proc Natl Acad Sci U S A 98:12808-12813.

Nakamura TY, Sturm E, Pountney DJ, Orenzoff B, Artman M, Coetzee WA (2003) Developmental expression of NCS-1 (frequenin), a regulator of Kv4 K+ channels, in mouse heart. Pediatr Res 53:554-557.

Nakamura TY, Jeromin A, Smith G, Kurushima H, Koga H, Nakabeppu Y, Wakabayashi S, Nabekura J (2006) Novel role of neuronal Ca2+ sensor-1 as a survival factor up-regulated in injured neurons. J Cell Biol 172:1081-1091.

Nakamura TY, Jeromin A, Mikoshiba K, Wakabayashi S (2011) Neuronal calcium sensor-1 promotes immature heart function and hypertrophy by enhancing Ca2+ signals. Circ Res 109:512-523.

Nalefski EA, Falke JJ (1996) The C2 domain calcium-binding motif: structural and functional diversity. Protein Sci 5:2375-2390.

Nejatbakhsh N, Guo CH, Lu TZ, Pei L, Smit AB, Sun HS, van Kesteren RE, Feng ZP (2011) Caltubin, a novel molluscan tubulin-interacting protein, promotes axonal growth and attenuates axonal degeneration of rodent neurons. J Neurosci 31:15231-15244.

Nesic OB, Magoski NS, McKenney KK, Syed NI, Lukowiak K, Bulloch AG (1996) Glutamate as a putative neurotransmitter in the mollusc, Lymnaea stagnalis. Neuroscience 75:1255-1269.

Nikitin ES, Vavoulis DV, Kemenes I, Marra V, Pirger Z, Michel M, Feng J, O'Shea M, Benjamin PR, Kemenes G (2008) Persistent sodium current is a nonsynaptic substrate for long- term associative memory. Curr Biol 18:1221-1226.

Nilsson GE, Ostlund-Nilsson S (2004) Hypoxia in paradise: widespread hypoxia tolerance in coral reef fishes. Proc Biol Sci 271 Suppl 3:S30-S33.

Olafsson P, Wang T, Lu B (1995) Molecular cloning and functional characterization of the Xenopus Ca(2+)-binding protein frequenin. Proc Natl Acad Sci U S A 92:8001-8005.

Osborne SL, Meunier FA, Schiavo G (2001) Phosphoinositides as key regulators of synaptic function. Neuron 32:9-12.

Pan CY, Jeromin A, Lundstrom K, Yoo SH, Roder J, Fox AP (2002) Alterations in exocytosis induced by neuronal Ca2+ sensor-1 in bovine chromaffin cells. J Neurosci 22:2427-2433.

Peers C (1990) Effects of D600 on hypoxic suppression of K+ currents in isolated type I carotid body cells of the neonatal rat. FEBS Lett 271:37-40.

Peers C, Kemp PJ (2004) Ion channel regulation by chronic hypoxia in models of acute oxygen sensing. Cell Calcium 36:341-348.

Peers C, Dallas ML, Boycott HE, Scragg JL, Pearson HA, Boyle JP (2009) Hypoxia and neurodegeneration. Ann N Y Acad Sci 1177:169-177.

Pena F, Ramirez JM (2005) Hypoxia-induced changes in neuronal network properties. Mol Neurobiol 32:251-283.

Pierson DJ (2000) Pathophysiology and clinical effects of chronic hypoxia. Respir Care 45:39- 51.

Platoshyn O, Golovina VA, Bailey CL, Limsuwan A, Krick S, Juhaszova M, Seiden JE, Rubin LJ, Yuan JX (2000) Sustained membrane depolarization and pulmonary artery smooth muscle cell proliferation. Am J Physiol Cell Physiol 279:C1540-C1549.

Pongs O, Lindemeier J, Zhu XR, Theil T, Engelkamp D, Krah-Jentgens I, Lambrecht HG, Koch KW, Schwemer J, Rivosecchi R, . (1993) Frequenin--a novel calcium-binding protein that modulates synaptic efficacy in the Drosophila nervous system. Neuron 11:15-28.

Poulain C, Ferrus A, Mallart A (1994) Modulation of type A K+ current in Drosophila larval muscle by internal Ca2+; effects of the overexpression of frequenin. Pflugers Arch 427:71-79.

Rajebhosale M, Greenwood S, Vidugiriene J, Jeromin A, Hilfiker S (2003) Phosphatidylinositol 4-OH kinase is a downstream target of neuronal calcium sensor-1 in enhancing exocytosis in neuroendocrine cells. J Biol Chem 278:6075-6084.

Raley-Susman KM, Kass IS, Cottrell JE, Newman RB, Chambers G, Wang J (2001) Sodium influx blockade and hypoxic damage to CA1 pyramidal neurons in rat hippocampal slices. J Neurophysiol 86:2715-2726.

Ratcliffe PJ, O'Rourke JF, Maxwell PH, Pugh CW (1998) Oxygen sensing, hypoxia-inducible factor-1 and the regulation of mammalian gene expression. J Exp Biol 201:1153-1162.

Riesco-Fagundo AM, Perez-Garcia MT, Gonzalez C, Lopez-Lopez JR (2001) O(2) modulates large-conductance Ca(2+)-dependent K(+) channels of rat chemoreceptor cells by a membrane- restricted and CO-sensitive mechanism. Circ Res 89:430-436.

Rizo J, Sudhof TC (1998) C2-domains, structure and function of a universal Ca2+-binding domain. J Biol Chem 273:15879-15882.

Rodgers-Garlick CI, Armstrong GA, Robertson RM (2011) Metabolic stress modulates motor patterning via AMP-activated protein kinase. J Neurosci 31:3207-3216.

Romero-Pozuelo J, Dason JS, Atwood HL, Ferrus A (2007) Chronic and acute alterations in the functional levels of Frequenins 1 and 2 reveal their roles in synaptic transmission and axon terminal morphology. Eur J Neurosci 26:2428-2443.

Rousset M, Cens T, Gavarini S, Jeromin A, Charnet P (2003) Down-regulation of voltage-gated Ca2+ channels by neuronal calcium sensor-1 is beta subunit-specific. J Biol Chem 278:7019- 7026.

Saab BJ (2010) The synaptic role of neuronal calcium sensor 1 in dentate gyrus plasticity, curiosity and spatial memory. PhD thesis, University of Toronto.

Saab BJ, Georgiou J, Nath A, Lee FJ, Wang M, Michalon A, Liu F, Mansuy IM, Roder JC (2009) NCS-1 in the dentate gyrus promotes exploration, synaptic plasticity, and rapid acquisition of spatial memory. Neuron 63:643-656.

Saitoh K, Arie T, Teraoka T, Yamaguchi I, Kamakura T (2003) Targeted gene disruption of the neuronal calcium sensor 1 homologue in rice blast fungus, Magnaporthe grisea. Biosci Biotechnol Biochem 67:651-653.

Sakakibara M, Okuda F, Nomura K, Watanabe K, Meng H, Horikoshi T, Lukowiak K (2005) Potassium currents in isolated statocyst neurons and RPeD1 in the pond snail, Lymnaea stagnalis. J Neurophysiol 94:3884-3892.

Scalettar BA, Rosa P, Taverna E, Francolini M, Tsuboi T, Terakawa S, Koizumi S, Roder J, Jeromin A (2002) Neuronal calcium sensor-1 binds to regulated secretory organelles and functions in basal and stimulated exocytosis in PC12 cells. J Cell Sci 115:2399-2412.

Semenza GL, Roth PH, Fang HM, Wang GL (1994) Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J Biol Chem 269:23757-23763.

Semenza GL (2001) HIF-1 and mechanisms of hypoxia sensing. Curr Opin Cell Biol 13:167- 171.

Semenza GL (2001) Hypoxia-inducible factor 1: oxygen homeostasis and disease pathophysiology. Trends Mol Med 7:345-350.

Sharp FR, Bernaudin M (2004) HIF1 and oxygen sensing in the brain. Nat Rev Neurosci 5:437- 448.

Sheldon C, Diarra A, Cheng YM, Church J (2004) Sodium influx pathways during and after anoxia in rat hippocampal neurons. J Neurosci 24:11057-11069.

Shimoda LA, Polak J (2011) Hypoxia. 4. Hypoxia and ion channel function. Am J Physiol Cell Physiol 300:C951-C967.

Silver IA, Erecinska M (1990) Intracellular and extracellular changes of [Ca2+] in hypoxia and ischemia in rat brain in vivo. J Gen Physiol 95:837-866.

Silverman-Gavrila LB, Lu TZ, Prashad RC, Nejatbakhsh N, Charlton MP, Feng ZP (2009) Neural phosphoproteomics of a chronic hypoxia model--Lymnaea stagnalis. Neuroscience 161:621-634.

Sippy T, Cruz-Martin A, Jeromin A, Schweizer FE (2003) Acute changes in short-term plasticity at synapses with elevated levels of neuronal calcium sensor-1. Nat Neurosci 6:1031-1038.

Skelton NJ, Kordel J, Akke M, Forsen S, Chazin WJ (1994) Signal transduction versus buffering activity in Ca(2+)-binding proteins. Nat Struct Biol 1:239-245.

Sowter HM, Ratcliffe PJ, Watson P, Greenberg AH, Harris AL (2001) HIF-1-dependent regulation of hypoxic induction of the cell death factors BNIP3 and NIX in human tumors. Cancer Res 61:6669-6673.

Syed NI, Bulloch AG, Lukowiak K (1990) In vitro reconstruction of the respiratory central pattern generator of the mollusk Lymnaea. Science 250:282-285.

Syed NI, Winlow W (1991) Coordination of locomotor and cardiorespiratory networks of Lymnaea stagnalis by a pair of identified interneurones. J Exp Biol 158:37-62.

Szucs A, Rubakhin SS, Stefano GB, Hughes TK, Rozsa KS (1995) Interleukin-4 potentiates voltage-activated Ca-currents in Lymnaea neurons. Acta Biol Hung 46:351-362.

Tanouye MA, Wyman RJ (1980) Motor outputs of giant nerve fiber in Drosophila. J Neurophysiol 44:405-421.

Taverna E, Francolini M, Jeromin A, Hilfiker S, Roder J, Rosa P (2002) Neuronal calcium sensor 1 and phosphatidylinositol 4-OH kinase beta interact in neuronal cells and are translocated to membranes during nucleotide-evoked exocytosis. J Cell Sci 115:3909-3922.

Taylor SC, Batten TF, Peers C (1999) Hypoxic enhancement of quantal catecholamine secretion. Evidence for the involvement of amyloid beta-peptides. J Biol Chem 274:31217-31222.

Tjong YW, Jian K, Li M, Chen M, Gao TM, Fung ML (2007) Elevated endogenous nitric oxide increases Ca2+ flux via L-type Ca2+ channels by S-nitrosylation in rat hippocampal neurons during severe hypoxia and in vitro ischemia. Free Radic Biol Med 42:52-63.

Trapp S, Ballanyi K (1995) KATP channel mediation of anoxia-induced outward current in rat dorsal vagal neurons in vitro. J Physiol 487 ( Pt 1):37-50.

Trimmer JS (1991) Immunological identification and characterization of a delayed rectifier K+ channel polypeptide in rat brain. Proc Natl Acad Sci U S A 88:10764-10768.

Tsujimoto T, Jeromin A, Saitoh N, Roder JC, Takahashi T (2002) Neuronal calcium sensor 1 and activity-dependent facilitation of P/Q-type calcium currents at presynaptic nerve terminals. Science 295:2276-2279.

Wang CY, Yang F, He X, Chow A, Du J, Russell JT, Lu B (2001) Ca(2+) binding protein frequenin mediates GDNF-induced potentiation of Ca(2+) channels and transmitter release. Neuron 32:99-112.

Wang GL, Semenza GL (1993) General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A 90:4304-4308.

Wang GL, Jiang BH, Rue EA, Semenza GL (1995) Hypoxia-inducible factor 1 is a basic-helix- loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A 92:5510-5514.

Weiss JL, Archer DA, Burgoyne RD (2000) Neuronal Ca2+ sensor-1/frequenin functions in an autocrine pathway regulating Ca2+ channels in bovine adrenal chromaffin cells. J Biol Chem 275:40082-40087.

Werle MJ, Roder J, Jeromin A (2000) Expression of frequenin at the frog (Rana) neuromuscular junction, muscle spindle and nerve. Neurosci Lett 284:33-36.

Wijsman TCM, van der Lugt HC, Hoogland HP (1985). Anaerobic metabolism in the freshwater snail Lymnaea stagnalis: haemolymph as a reservoir of D-lactate and succinate. Comp. Biochem. Physiol. 81, 889-895.

Wood SM, Gleadle JM, Pugh CW, Hankinson O, Ratcliffe PJ (1996) The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. J Biol Chem 271:15117-15123.

Woodman JD, Cooper PD, Haritos VS (2007) Cyclic gas exchange in the giant burrowing cockroach, Macropanesthia rhinoceros: effect of oxygen tension and temperature. J Insect Physiol 53:497-504.

Wu L, Bauer CS, Zhen XG, Xie C, Yang J (2002) Dual regulation of voltage-gated calcium channels by PtdIns(4,5)P2. Nature 419:947-952.

Xia LM, Tian DA, Zhang Q, Yan W, Zhu Q, Luo M, Zhou ZZ, Tang Y, Zhang QL, Wang W (2009) [Hypoxia induces heat shock protein HSP70-2 expression in a HIF-1 dependent manner]. Zhonghua Gan Zang Bing Za Zhi 17:207-212.

Yao H, Haddad GG (2004) Calcium and pH homeostasis in neurons during hypoxia and ischemia. Cell Calcium 36:247-255.

Yap KL, Ames JB, Swindells MB, Ikura M (1999) Diversity of conformational states and changes within the EF-hand protein superfamily. Proteins 37:499-507.

Yeh CH, Hsu SP, Yang CC, Chien CT, Wang NP (2010) Hypoxic preconditioning reinforces HIF-alpha-dependent HSP70 signaling to reduce ischemic renal failure-induced renal tubular apoptosis and autophagy. Life Sci 86:115-123.

Yenari MA, Liu J, Zheng Z, Vexler ZS, Lee JE, Giffard RG (2005) Antiapoptotic and anti- inflammatory mechanisms of heat-shock protein protection. Ann N Y Acad Sci 1053:74-83.

Yip PK, Wong LF, Sears TA, Yanez-Munoz RJ, McMahon SB (2010) Cortical overexpression of neuronal calcium sensor-1 induces functional plasticity in spinal cord following unilateral pyramidal tract injury in rat. PLoS Biol 8:e1000399.

Zhao X, Varnai P, Tuymetova G, Balla A, Toth ZE, Oker-Blom C, Roder J, Jeromin A, Balla T (2001) Interaction of neuronal calcium sensor-1 (NCS-1) with phosphatidylinositol 4-kinase beta stimulates lipid kinase activity and affects membrane trafficking in COS-7 cells. J Biol Chem 276:40183-40189.

Zheng Q, Bobich JA, Vidugiriene J, McFadden SC, Thomas F, Roder J, Jeromin A (2005) Neuronal calcium sensor-1 facilitates neuronal exocytosis through phosphatidylinositol 4-kinase. J Neurochem 92:442-451.

Zucker RS, Regehr WG (2002) Short-term synaptic plasticity. Annu Rev Physiol 64:355-405.

Appendices

Figure 15.

[B] [A]

Figure 15. Effect of NCS-1 siRNA on NCS-1 protein expression

[A] Representative semi-quantitative immunoblots of NCS-1 and β-actin were for the control, siRNA and NCS-1 siRNA treated animals under indicated conditions.

[B] The average of normalized intensity ratio of the indicated proteins over β-actin , indicating the relative expression levels of NCS-1 from individual 3 experiments is summarized accordingly. The hypoxic animals were exposed to the hypoxia condition for 4 days. In all figures, H indicates hypoxia. The siRNAs were injected into the central ring ganglia before the animals were placed into the hypoxia conditions. The animals under the normoxia condition were used as the negative control. The dashed line indicates the intensity ratio of the specific protein to β-actin in normoxia. The data are presented as mean ± s.e.m. * indicates statistical significance (p < 0.05) as compared to the normoxia group; # indicates statistical significance (p < 0.05) as compared to the siRNA treated snails without giving hypoxia.

Data courtesy of Dr. Guanghe Fei, a postdoctoral fellow in the Feng Lab

5 Drosophila melanogaster as an experimental model

This is a collaborative effort between myself (Feng Lab), Dr. Jeffrey Dason (Charlton Lab) and Mike Qiu (Sun Lab). I developed and carried out the hypoxia and heat assays, and data analysis. Dr. Dason provided the flies and contributed to development of heat assay. Mike Qiu carried out the hypoxia and heat assays, and performed data analysis.

5.1 Genetic Model

Drosophila Melanogaster, more commonly known as the fruit fly, is a widely used genetic model organism for biological research. The major advantages of this model include short generation time, high fecundity and a sequenced genome (Adams et al., 2000). Although simple, about 75% of known human disease genes can be matched in the genome of fruit flies (Reiter et al., 2001). The tools for genetic manipulation are well established, and it is possible to create genetic models (knockout, knockin) that are unavailable in other organisms.

5.1.1 GAL4/UAS system

The GAL4/UAS system is a powerful genetic tool to spatially and temporally alter gene expression in Drosophila. GAL4, a yeast transcriptional activator, can activate transcription of a reporter under the control of upstream activating sequences (UAS) in Drosophila (Brand and Perrimon, 1993; Fischer et al., 1988). Expression of the gene of interest is achieved only in the presence of the GAL4 (Duffy, 2002). Enhancer-trap GAL4 constructs can be randomly inserted into the genome, and the expression of these GAL4 lines are determined by the genomic enhancers. There are GAL4 lines that target specific tissues, such as the nsyb-GAL4 (Verstreken et al., 2009) lines that target neurons.

5.1.2 FLP/FRT recombination

Site-specific recombination can be used to create chromosome deletions and duplications. In this process, site-specific recombinases perform rearrangement of DNA segments by recognizing and binding to short DNA sequences, at which they cleave the DNA backbone, exchange the two DNA helices involved and rejoin the DNA strands. In Drosophila, flippase (FLP) site-specific recombinase can be used to cause recombination between its targets sites under controlled conditions in vivo (Golic and Golic 1996). FLP recognizes and recombines short asymmetric

96 sequences known as FLP recombination targets (FRTs). Currently, a large collection of insertion lines containing FRT sites are available at Exelixis (Thibault et al., 2004). In the presence of FLP recombinase, these lines can be used to generate small deletions (Parks et al., 2004). In addition to FRT sites, each insertion line also contains a white+ transgene (w+) resulting in the red eye phenotype. The insertions are kept in a w- background, but have red eyes due to the presence of the w+ transgene. The w+ transgene will be removed as part of the deletion in the presence of the FLP recombinase. Therefore, deletions can be screened for by eye color selection. This technique has previously been used to generate frequenin knockout flies (Dason et al., 2009)

5.2 Molecular Model

Frequenin, the Drosophila orthologue of NCS-1, was originally discovered in nervous system in Drosophila (Mallart, 1991; Pongs et al., 1993). Two frequenin (frq) genes, frq1 and frq2, have since been described (Romero-Pozuelo et al., 2007). frq null mutants generated using site- specific recombination to delete both frq genes, were viable but had defects in larval locomotion and impaired Ca2+ entry, which leads to deficient synaptic transmission and enhanced nerve- terminal growth. The effect is mediated through a functional interaction with the α1 subunit of voltage-gated Ca2+ channel (Dason et al., 2009). Overexpression of frequenin (Romero-Pozuelo et al., 2007) using targeted gene expression approach by the GAL4/UAS system (Brand & Perrimon 1993) results in increased quantal release but fewer boutons at each motoneuron.

5.3 Model of Hypoxia-Tolerance

Aside from the genetic advantages, the fruit fly has been used as a model to study the molecular mechanisms underlying the hypoxia-induced stress. The fly can withstand 3-4 hours of anoxia without showing cell injury (Azad and Haddad, 2009). Furthermore, adult flies that overexpress

Hsp70 show enhanced survival compared to controls after exposure to 1.5% O2 for 7 days. In particular, overexpression of Hsp70 in the heart, and specific regions of the brain (mushroom body, antennal lobe) resulted in better survival than controls. In contrast, exclusive overexpression of Hsp70 in the muscle, glial cells and the entire nervous system did not result in increased survival compared to the controls (Azad et al., 2009).

5.4 Hypothesis/Rationale

5.4.1 Rationale

Previous data from the Feng lab show that NCS-1/frequenin is upregulated following chronic hypoxia. Knocking down NCS-1 level with siRNA, which achieved 60% and 75% reduction in NCS-1 protein expression under normoxic and hypoxic conditions respectively, attenuated hypoxia-induced adaptive responses in respiration at the behavioral cellular and molecular level. The purpose of this study is to determine how a complete absence of the NCS-1/frequenin gene would affect hypoxia tolerance in a hypoxia-tolerant model.

5.4.2 Objectives and Hypotheses

Determine the role of NCS-1 in Hsp70-dependent stresses and the mechanisms by which NCS-1 exerts its neuroprotective effects using Drosophila as a model

1. Determine the role of frequenin in hypoxia-induced neural behaviors in frq null and overexpressed flies. I hypothesize that frq null flies will show reduced hypoxia tolerance (survival, time to paralysis) compared to the control after hypoxia treatment, whereas overexpressors will be more resistant to hypoxia. 2. Determine whether the effect of frq in hypoxic stress is seen in other stressors, such as heat stress, and thus may be an essential protein for general stress tolerance. I hypothesize that frq null flies will exhibit reduced survival after heat stress compared to controls. 3. Determine whether the effect of frequenin nulls is mediated through reduced PI4Kβ – PIP – PIP2 pathway. PI4Kβ is one of the proteins reported to be involved in hypoxia, and decreases in PI4Kβ is associated with neuronal cell death in hippocampal cells after ischemia (Furuta et al., 2003). I hypothesize that PI4Kβ-nulls will show similar phenotypes as the frequenin nulls after stress.

6 Materials and Methods 6.1 Fly stocks

All drosophila strains were kindly provided by Dr. Jeffrey Dason (Charlton Lab, University of Toronto, Canada).

All fly stocks were grown at 25°C on cornmeal agar with dry yeast. w1118 flies were used as controls. frqdel1 flies carry a deletion that removes the entire frq1 gene and part of the frq2 gene, resulting in no detectable Frq protein (Dason et al., 2009). hsp70 flies are a recombinant line that has two deletions (Df(3R)Hsp70A and Df(3R)Hsp70B) that remove all six hsp70 genes (Gong and Golic 2004, 2006). Using a series of standard genetic crosses a double frqdel1 and hsp70 null mutant was created. fwd3/Df(3L)7C flies have an ethylmethane sulfonate (EMS)-induced mutation that results in a premature stop codon and no full-length PI4K protein (Brill et al., 2000). The GAL4/UAS system (Brand and Perrimon, 1993) was used to overexpress Frq1, Frq2 or Hsp70. Flies carrying UAS-frq1, UAS-frq2 or UAS-hsp70 were previously described (Romero- Pozuelo et al., 2007; Xiao et al., 2007). nsyb-GAL4 (Verstreken et al., 2009) was used to drive the expression of UAS constructs in neurons.

6.2 Hypoxia Assay

6.2.1 Flies

Young adult flies 7-11 days old, were sorted according to sex 7 days prior to hypoxia exposure.

This was done to ensure that the anesthesia (CO2) used for sorting does not interfere with hypoxia exposure. ~10 flies (male or female) were placed in each vial with agar and dry yeast, and were grown at 25°C until hypoxia exposure.

6.2.2 Hypoxia Assay

Flies were transferred into blank vials (without food) prior to hypoxia exposure to prevent sticking to the agar after hypoxia exposure. All vials were placed in a hypoxia chamber

(Biospherix, NY USA) that contains 1% oxygen balanced with 99% N2 for 3 hours at room temperature. Oxygen concentration was regulated by a compact oxygen controller (ProOx 110, Biospherix, NY USA), to which a compressed nitrogen gas source (Linde, Mississauga, ON) was attached.

6.2.3 Paralysis

The entire hypoxia exposure was captured by video camera, controlled by VirtualDub software. The amount of time it took for the flies to cease moving after hypoxia onset was recorded and analyzed.

6.2.4 Survival

After hypoxia exposure, flies were transferred back to vials containing agar and dry yeast. At 4 and 24 hours after hypoxia exposure, the number of flies alive were counted and analyzed.

6.3 Heat Assay

6.3.1 Flies

Young adult flies 7-11 days old, were sorted according to sex 7 days prior to heat exposure. This

was done to ensure that the anesthesia (CO2) used for sorting does not interfere with heat tolerance. ~10 flies (male or female) were placed in each vial with agar and dry yeast, and were grown at 25°C until heat exposure.

6.3.2 Heat Assay

Flies were transferred into blank vials (without food) prior to heat shock to prevent sticking to the agar. All vials were placed in a heat chamber with the temperature pre-adjusted to 38°C. The temperature was continuously adjusted to maintain 38±1°C for the entire one hour of heat shock.

6.3.3 Survival

After heat exposure, flies were transferred back to vials containing agar and dry yeast. At 4 and 24 hours after heat shock, the number of flies alive were counted and analyzed.

6.3.4 Paralysis

The number of flies moving 10, 20, 30, 40, 50 and 60 minutes after being placed in the heat chamber was counted and analyzed.

100

6.4 Statistical Analysis

The data are presented as the mean ± s.e.m. Statistical analysis was carried out using SigmaStat 3.0 (Jandel Scientific). Differences between mean values from each experimental group were tested using a Student's t test for two groups and one-way analysis of variance (ANOVA) for multiple comparisons. Differences were considered significant if p < 0.05.

7 Results 7.1 Developing Hypoxia Assay

One of the parameters I wanted to test was hypoxia would affect movement. The preliminary trials showed that at oxygen levels greater than 1.5%, flies did not exhibit deficits in movement. This is consistent with previous studies which show that flies can continuously move freely in an

environment with 1.5% O2 for up to seven days (Azad et al., 2009). Previous studies have also shown that after 1-2 min in anoxia, flies became motionless (Haddad et al., 1997); such oxygen tension would not provide enough discriminating power to establish a difference between the different fly strains. As such, an oxygen level between 0 and 1.5% O2 was to be chosen.

I also wanted to compare the survival rate between the control and the frequenin knockouts. Since previous studies show that frequenin or NCS-1 upregulation is neuroprotective against stress, I hypothesized that frequenin knockouts would have lower rate of survival compared to the control after hypoxia treatment. Thus the assay could not be overly rigorous to ensure a large survival rate in the controls.

7.2 Developing Heat Assay

I wanted to determine how heat shock affects movement and its effects on survival. Previous studies have shown that 39°C heat shock for 85 minutes is lethal for flies, whereas a 37°C heat shock for 55 min is non-lethal and is effective in inducing the expression of Hsp70 (Velazquez et al., 1983). Thus 38°C was chosen to ensure adequate survival of control flies. Also, 38°C is the temperature where synaptic transmission becomes non-permissive (Karunanithi et al., 1999; Littleton et al., 1998).

101

7.3 Frequenin knockout flies do not show reduced survival under normal conditions

NCS-1 is required for survival in yeast (Hendricks et al., 1999), but not in worms (Gomez et al., 2001), flies (Dason et al., 2009) and mice (Nakamura et al., 2011). We hypothesized that NCS-1 is required for survival under stressful conditions, such as hypoxia and heat. NCS-1 knockout mice have a 30% reduction in survival compared to controls under normal conditions (Nakamura et al., 2011). Therefore, we first characterized whether there were any changes in lifespan of frq null flies, which has not previously been examined. Upregulation of NCS-1 in Lymnaea stagnalis is dependent on Hsp70 levels (Fei and Feng, unpublished data), therefore, the lifespan of hsp70 null flies (Gong and Golic, 2004) was also examined. In addition, using a series of standard genetic crosses a double frq and hsp70 null mutant was created and also examined. No reduction in survival of any of the three mutants has been observed after 3 weeks under normal conditions (Figure 16).

102

Figure 16.

Survival under control condition

1.2

1.0

0.8

0.6

Survival rate Survival W1118 0.4 Frqdel1 Hsp70 null 0.2 Frqdel1/Hsp70 null

0.0 Day 1 Day 5 Day 10 Day 15 Day 20

103

Figure 16. Survival rate of flies are indifferent under normal physiological conditions. Survival of w1118 (genetic control), frequenin null (frqdel1), Hsp70 null and frequenin-Hsp70 double null (frqdel1/Hsp70 null) under physiological conditions over three weeks (n=6 trials, with 10 flies per trial). On Day 1, the flies were 3-4 days old.

104

7.4 Frequenin knockout flies show reduced survival and faster paralysis after hypoxia

In order to determine how frq nulls and overexpressors survive after hypoxic stress, two lines of NCS-1 (frequenin) knockout flies as well as their genetic control were subjected to hypoxia treatment (1% O2) for three hours. hsp70 null flies (Gong and Golic 2004) and double frq and hsp70 null mutant were also tested to determine how they behave under hypoxic conditions. Their vertical locomotion behavior (pre- and post-hypoxia), survival, time to paralyze after hypoxia onset, and recovery time from hypoxia was recorded and analyzed. 4 hours and 24 hour after hypoxia treatment, the survival level of frq and hsp70 nulls are significantly lower compared to the controls. Furthermore, frq nulls paralyze sooner than the controls following the onset of hypoxia. Interestingly, the frq and hsp70 double nulls show similar phenotypes as the hsp70 nulls (Figure 17). Flies that overexpress Frq or Hsp70 do not show difference in the aforementioned parameters compared to the control (nsyb-GAL4) (Figure 18).

105

Figure 17.

[A] 1.0 4 Hour 24 Hour 0.8

0.6 * * 0.4 Survival rate * * #* #* 0.2

0.0 W1118 Hsp70 null Frqdel1 Frqdel1/Hsp70 null

6000 [B] 5000

4000

3000 *

2000 Time to (sec)paralysis Time 1000

0 W1118 Hsp70null Frqdel1 Frq/Hsp70null

106

Figure 17. frq nulls show impaired tolerance to hypoxia.

[A] Survival rate of frequenin null (frqdel1, n=16 trials), Hsp70 null (n=18 trials), and frequenin and Hsp70 double nulls (n=14 trials) compared to the genetic controls (w1118, n=39 trials).

Survival was measured 4 and 24 hours after hypoxia treatment (1% O2, 3 hours). * indicates statistical significance compared to the w1118 control at the same time point (p<0.05), and # indicates statistical significance from the 4 hour time point (p<0.05).

[B] The time it takes for the flies to paralyze after hypoxia onset. * indicates statistical significance compared to the respective control (p<0.05).

107

Figure 18.

[A]

1.0 1.0

0.8 0.8

0.6 0.6

0.4 0.4 Survival rate Survival Survival rate Survival

0.2 0.2

0.0 0.0 L4 S 0+ nSYB-GAL4 Frq+ A UA 7 -G B- SP YB SY H nS n

[B]

4000 6000

5000 3000 4000

2000 3000

2000 1000 Time to (sec)Time paralysis

Time to paralysis Time (sec) 1000

0 0 nSYB-GAL4 Frq2+ + + + 4/ S/ 70 AL A p G -U Hs B- YB SY S n- n

108

Figure 18. Overexpression of frq or Hsp70 does not alter hypoxia tolerance.

[A] Survival rate of frequenin (n=16 trials) and Hsp70 (n=14 trials) overexpressors compared to the respective genetic controls (nsyb-GAL4 n=18 trials; UAS-Hsp70 n=14 trials). Survival was measured 4 and 24 hours after hypoxia treatment (1% O2, 3 hours).

[B] The time it takes for the flies to paralyze after hypoxia onset.

109

7.5 Frequenin knockout flies show reduced survival and faster paralysis after heat shock.

Hsp70 is known to play a role in thermotolerance in flies (Gong and Golic 2004; Karunanithi et al., 1999) and other organisms (Edwards et al., 2001; King et al., 2002). Given that NCS-1 and Hsp70 interact (Fei and Feng, unpublished data), we hypothesized that NCS-1 is required for thermotolerance. In order to determine whether NCS-1 (frequenin) is essential for thermotolerance, frq nulls and overexpressors, as well as their genetic controls were subjected to thermal stress (38C) for 1 hour. hsp70 null mutants and double frq and hsp70 null mutants were also tested. The number of flies moving during the hour of treatment as well as survival at 4 hour and 24 hours post heat stress was recorded. The data show that a greater percentage of frq null flies paralyze faster after heat stress, and show significantly lower survival rates compared to the controls and hsp70 nulls. hsp70 nulls paralyze faster and show lower survival rates compared to the controls also (Figure 19).

110

Figure 19

. Survival after heat stress

0.7 4 hour 0.6 24 hour

0.5

0.4 * * * * * * 0.3 Survival

0.2

0.1

0.0 W1118 hsp70- Frq- Frq/Hsp null

1.2 W1118 Hsp70 null 1.0 * Frq null Frq/Hsp null 0.8 *

0.6 *

0.4 Proportion moving Proportion

0.2

0.0 10 min 20 min 30 min 40 min 50 min 1 hr

111

Figure 19. Frq nulls, Hsp70 nulls and Frq/Hsp70 double nulls show impaired tolerance to heat stress.

[A] Survival rate of frequenin null (frqdel1, n=12 trials), Hsp70 null (n=10 trials), and frequenin and Hsp70 double nulls (n=6 trials) compared to the genetic controls (w1118, n=10 trials). Survival was measured 4 and 24 hours after heat shock treatment * indicates statistical significance compared to the w1118 control at the same time point (p<0.05).

[B] Proportion of flies moving after heat onset. * indicates that the w1118 is significantly different from all other lines (p<0.05).

112

7.6 fwd null mutants have reduced survival and tolerance to heat shock

NCS-1 directly interacts with phosphatidylinositol-4 kinase β (PI4Kβ) to regulate neuronal secretion in neural secretory cells (de Barry et al., 2006; Haynes et al., 2005; Haynes et al., 2007; Koizumi et al., 2002; McFerran et al., 1998; McFerran et al., 1999; Rajebhosale et al., 2003; Scalettar et al., 2002; Taverna et al., 2002; Weiss et al., 2010). This kinase regulates the levels of phosphatidylinositol 5-phosphate (PIP), which is converted to phosphatidylinositol 4,5- bisphosphate (PIP2; Rajebhosale et al., 2003). Furthermore, decreased levels of PI4K are associated with delayed neuronal cell death in the mouse hippocampus after transient forebrain ischemia (Furuta et al., 2003). The sole Drosophila PI4Kβ is encoded by the four wheel drive (fwd) gene (Brill et al., 2000). We tested the effects of heat shock (38C for 1 hour) on survival and the time of paralysis onset in fwd null mutants and control flies. fwd mutants paralyzed significantly faster than controls (Figure 20) and survival was severely reduced after both 4 and 24 hours (Figure 20).

113

Figure 20

0.6

0.5

0.4

0.3

Survival rate Survival 0.2

0.1

0.0 W1118 PI4KIIIbeta null

4 hr 24 hr

1.2

1.0

0.8

0.6

0.4

0.2

Proportion of flies moving 0.0

in in in in in hr m m m m m 1 10 20 30 40 50

W1118 PI4KIIIbeta null

114

Figure 20. fwd (PI4KIIIβ) null mutants have reduced survival and tolerance to heat shock.

[A] Survival of flies after heat (38C) treatment. Survival was measured 4 and 24 hours after heat treatment (n= 1 trial, 10 flies/trial).

[B] Proportion of flies moving after heat (38C) onset (n=1 trial, 10 flies/trial)

115

8 Discussion 8.1 Summary of Data

My results show that flies deficient in both frequenin genes are less tolerant to hypoxia and heat stress compared to the controls. Flies deficient in the PI4K gene also show similar trend.

8.2 Frequenin and stress tolerance

The results obtained are in agreement with the hypothesis that frq nulls show reduced hypoxia tolerance compared to controls. Flies that overexpress Frq did not show improved hypoxia tolerance (in terms of survival, or paralysis) compared to the controls. There are several possibilities that lead to this result. The controls show a high survival rate (80%), and thus the proposed added benefits of increased frequenin level may not be evident. Furthermore, previous reports have suggested that there is upregulation of NCS-1 after stress. Therefore, the levels of frequenin may be comparable between the controls and the overexpressors, such that there is no difference in survival after hypoxic stress. Further experiments, testing the mRNA and protein levels of frequenin with qPCR and Western blots respectively, can be carried out to determine whether there are changes in frequenin expression after hypoxic stress.

8.3 Hsp70 and stress tolerance

Hsp70 is a well-known stress protein that is upregulated by hypoxia, and confers protection to the hypoxic organism. As expected, hsp70 nulls show decreased survival compared to controls. Hsp70 overexpressors, however, did not exhibit increased survival rates compared to the controls. Flies are extremely hypoxia tolerant such only after 7 days of chronic hypoxia treatment in 1.5% O2, the effects of Hsp70 overexpression on survival becomes apparent (Azad and Haddad 2009)

The frq and hsp70 double nulls exhibit similar survival rates as the hsp70 null. Specifically, the survival rate is only moderately decreased 4 hours after hypoxia treatment, but there is a further reduction in survival rate 24 hours after hypoxia treatment, at which time, it is similar to that of frequenin nulls. Since the survival rates of the double null resembles that of the hsp70 null, it suggests that Hsp70 acts upstream of NCS-1.

116

These data suggest that both Hsp70 and frequenin proteins are important for thermotolerance. The trends observed in the heat stress experiment are in agreement with those of hypoxic stress, suggesting that frequenin plays a significant role for both types of stresses in vivo. Previous studies have shown that NCS-1 is necessary for various types of stresses in vivo such as oxidation, axotomy and B12 withdrawal (Nakamura et al., 2006). Taken together, the data suggest that frequenin plays a neuroprotective role in in vivo stress tolerance.

8.4 PI4K and heat tolerance fwd null mutants showed reduced survival and faster paralysis onset in response to heat shock compared to the controls, suggesting that the fwd drive gene may be important for heat tolerance. Further experiments will be carried out to determine if the fwd drive gene is involved in hypoxia. Trans-heterozygous genotypes will be tested to determine if frq and fwd are functionally linked through participation in the same pathway. This approach was previously used to show a functional link between frq and cacophony (α1-subunit of voltage-gated Ca2+ channels).

The neuroprotective effects of NCS-1 have previously been reported to be mediated through activation of PI3K-Akt anti-apoptosis pathway (Nakamura et al., 2006; Yip et al, 2010). In this pathway, PI3K converts PIP2 to PIP3, and PIP3 is crucial for the activation of Akt. The mechanism by which NCS-1 affects PI3K-Akt pathway is not clear. It is possible that the effect of NCS-1 is mediated through PI4K. PI4K converts PI to PIP, which is converted to PIP2 by PI5K. Previous studies in PC12 cells have shown that NCS-1 is able to increase PI4K activity, leading to increased levels of PIP2. The increased PIP2 levels may facilitate the PI3K-Akt pathway, leading to the protective effects of NCS-1. The current data are not sufficient to address the interaction between NCS-1, PI4K, and PI3K-Akt; thus further experiments are warranted.

117

References

Parks AL, et al. (2004) Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nat Genet 36:288-292.

Xiao C, Mileva-Seitz V, Seroude L, Robertson RM (2007) Targeting HSP70 to motoneurons protects locomotor activity from hyperthermia in Drosophila. Dev Neurobiol 67:438-455.

Haddad GG, Wyman RJ, MOHSENIN A, Sun Y, KRISHNAN SN (1997) Behavioral and Electrophysiologic Responses of Drosophila melanogaster to Prolonged Periods of Anoxia. J Insect Physiol 43:203-210.

Velazquez JM, Sonoda S, Bugaisky G, Lindquist S (1983) Is the major Drosophila heat shock protein present in cells that have not been heat shocked? J Cell Biol 96:286-290.

Furuta Y, Uehara T, Nomura Y (2003) Correlation between delayed neuronal cell death and selective decrease in phosphatidylinositol 4-kinase expression in the CA1 subfield of the hippocampus after transient forebrain ischemia. J Cereb Blood Flow Metab 23:962-971.

Azad P, Haddad GG (2009) Survival in acute and severe low o environment: use of a genetic model system. Ann N Y Acad Sci 1177:39-47.

Azad P, Zhou D, Russo E, Haddad GG (2009) Distinct mechanisms underlying tolerance to intermittent and constant hypoxia in Drosophila melanogaster. PLoS One 4:e5371.

118

Gong WJ, Golic KG (2004) Genomic deletions of the Drosophila melanogaster Hsp70 genes. Genetics 168:1467-1476.

Haynes LP, Sherwood MW, Dolman NJ, Burgoyne RD (2007) Specificity, promiscuity and localization of ARF protein interactions with NCS-1 and phosphatidylinositol-4 kinase-III beta. Traffic 8:1080-1092. de BJ, Janoshazi A, Dupont JL, Procksch O, Chasserot-Golaz S, Jeromin A, Vitale N (2006) Functional implication of neuronal calcium sensor-1 and phosphoinositol 4-kinase-beta interaction in regulated exocytosis of PC12 cells. J Biol Chem 281:18098-18111.

Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415.

Thibault ST, et al. (2004) A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet 36:283-287.

Brill JA, Hime GR, Scharer-Schuksz M, Fuller MT (2000) A phospholipid kinase regulates actin organization and intercellular bridge formation during germline cytokinesis. Development 127:3855-3864.

Weiss JL, Archer DA, Burgoyne RD (2000) Neuronal Ca2+ sensor-1/frequenin functions in an autocrine pathway regulating Ca2+ channels in bovine adrenal chromaffin cells. J Biol Chem 275:40082-40087.

119

Reiter LT, Potocki L, Chien S, Gribskov M, Bier E (2001) A systematic analysis of human disease-associated gene sequences in Drosophila melanogaster. Genome Res 11:1114-1125.

Adams MD, et al. (2000) The genome sequence of Drosophila melanogaster. Science 287:2185- 2195.

Duffy JB (2002) GAL4 system in Drosophila: a fly geneticist's Swiss army knife. Genesis 34:1- 15.

Verstreken P, Ohyama T, Haueter C, Habets RL, Lin YQ, Swan LE, Ly CV, Venken KJ, De CP, Bellen HJ (2009) Tweek, an evolutionarily conserved protein, is required for synaptic vesicle recycling. Neuron 63:203-215.

Golic KG, Golic MM (1996) Engineering the Drosophila genome: chromosome rearrangements by design. Genetics 144:1693-1711.

Littleton JT, Chapman ER, Kreber R, Garment MB, Carlson SD, Ganetzky B (1998) Temperature-sensitive paralytic mutations demonstrate that synaptic exocytosis requires SNARE complex assembly and disassembly. Neuron 21:401-413.

Karunanithi S, Barclay JW, Robertson RM, Brown IR, Atwood HL (1999) Neuroprotection at Drosophila synapses conferred by prior heat shock. J Neurosci 19:4360-4369.

Edwards JL, King WA, Kawarsky SJ, Ealy AD (2001) Responsiveness of early embryos to environmental insults: potential protective roles of HSP70 and glutathione. Theriogenology 55:209-223.

King YT, Lin CS, Lin JH, Lee WC (2002) Whole-body hyperthermia-induced thermotolerance is associated with the induction of heat shock protein 70 in mice. J Exp Biol 205:273-278.